Abstract
Plant growth promoting rhizobacteria (PGPRs) are very effective in immobilization of heavy metals and reducing their translocation in plants via precipitation, complex formation and adsorption. The present study was therefore designed to understand the role of Pseudomonas aeruginosa and Burkholderia gladioli in mitigation of Cd stress (0.4 mM) in 10-days old L. esculentum seedlings. The present work investigated growth characteristics, photosynthetic pigments, metal tolerance index, metal uptake and the contents of metal chelating compounds (protein bound and non-protein bound thiols, total thiols) in microbes inoculated Cd treated L. esculentum seedlings. The gene expression profiling of different metal transporters was conducted in order to investigate the quantitative analysis. Our results revealed Cd generated toxicity in seedlings in terms of reduced growth (root length, shoot length and fresh weight) and photosynthetic pigments (chlorophyll, carotenoid and xanthophyll) which enhanced upon inoculations of P. aeruginosa and B. gladioli. Further, the metal uptake along with levels of protein and non-protein bound thiols was also enhanced in Cd-treated seedlings. Gene expression studies suggested enhanced expression in the metal transporter genes which were further declined in the microbe supplemented seedlings. Therefore, micro-organisms possess growth promoting traits that enable them to reduce metal toxicity in plants.
Introduction
Heavy metals have been widely distributed and a prominent apprehension for sustainable agriculture and human welfare1,2. They have been discharged in the environment through anthropogenic activities such as fertilizers, industrial wastes, pesticides, mining, sewage etc.3. Many of these metals act as vital nutrients for plant growth under optimal concentrations but when they exceed their optimal limits, they tend to be toxic in nature4. There is undoubtedly an urgent need to promote crop productivities by eliminating the metal toxicities from food chain5.
Cd is highly toxic and non-essential heavy metal existing in the environment that leads to reduction in the plant productivities6. It shows higher affinity for sulphur in acidic conditions because of its mobile nature, thereby promoting absorption towards roots6. The translocation of heavy metals in plants occurs through sympast or apoplast or with the help of different transporters7. It causes biochemical and physiochemical disturbances within plants by inhibiting their growth, photosynthesis, pigments, nutrient uptake, germination, electron transport chain, etc.8. Many vegetable crops can lead to the accumulation of Cd, causing severe damages towards crop productivity9. To maintain the quality and standards of vegetable crops there is an urgent need for remediation of these metal polluted soils. Different physio-chemical and biological methods of remediation have been employed in order to remove heavy metal pollutants from the fields10. The most commonly used technique for heavy metal remediation is in situ immobilization of metals through supplementation of different inorganic and organic agents such as phosphate salts, biochar, zeolites, manure, lime etc. This technique is known to be highly efficient, practically applicable and simple along with the economic benefits11,12. It has also been observed that these amendments can elevate pH levels and decrease the bioavailability of metals to plants at the polluted sites13. They have also been reported to prevent the translocation of heavy metals to food chain via precipitation, complex formation and adsorbing properties10, but many metal immobilizers are toxic for the sound quality of water and soil14. Therefore, there is the need for metal immobilizers which can remediate the multi-metal contaminated sites in eco-friendly manner along with the restoration of the soil properties and plant health15,16.
Metal immobilising and metal-resistant plant growth promoting rhizobacteria (PGPR) have recently been studied to stimulate growth and reduce the bioavailability of heavy metals and their accumulation within plants10,17–19. It was reported that Bacillus megaterium promoted growth and decreased uptake and translocation of Ni in Brassica juncea, Luffa cylindrica and Sorghum halepense plants20. It was demonstrated that Neorhizobium huautlense T1–17 stimulated the radish and Chinese cabbage growth under Cd and Pb stress and reduced their accumulation within the plant tissues21. Moreover, metal resistant and growth promoting bacteria provides resistance to plants in metal polluted sites by production of plant hormones such as indole-3-acetic acid (IAA), gibberellins etc. They also lead to the production of solubilising phosphates, siderophores and 1-aminocyclopropane-1-carboxylate (ACC) - deaminase that promote the plant growth and defense properties and reduce the translocation of heavy metals within the plant tissues20,22,23.
It has been reported that Cd pollution in different plant species is linked to Fe deficiency due to their alike chemical characteristics24. Normally, the lower Fe concentration in different plant species raised under Cd contamination lead to chlorosis due to inhibition of their chloroplast and chlorophyll synthesis25. The microbes tend to bind Fe and form siderophore complexes so as to provide Fe to plants. In addition to this, plant growth promoting bacteria can also bind directly with these heavy metals in order to reduce their bioavailability and toxicity26. Furthermore, micro-organisms also result in the upregulation of plant defense system, heavy metal tolerant proteins (MTP family) and phytohormones under Cd stress27. The micro-organisms also result in the regulation of metal transporter genes (ZIP gene family) upon Cd exposure that further reduces its accumulation in Zea mays21. Bacillus subtilis is well known metal resistant bacteria that was reported to reduce the Cd accumulation and promote plant growth in Oryza sativa grown under Cd stressed conditions27,28. It was further suggested by Guo et al. that Burkholderia sp. D54 significantly promoted the growth in Sedum alfredii by oxidising Fe(II) and Mn (II) that further forms Fe precipitates and arrest the uptake of metals upon root surfaces29. Similar trends were also found by Dong et al. in which inoculation of Burkholderia sp. decreased Cd translocation in rice and elevating the photosynthetic efficiencies in plants30. A better interpretation of characteristics of metal-resistant and metal-immobilizer plant growth promoting bacteria is a crucial prerequisite for establishment of effective and eco-friendly strategies for crop production in metal polluted environment.
L. esculentum is the most important, widely consumed crop and is quite sensitive to heavy metal stress. It is rich in nutrients and contains vitamins, lycopene, antioxidants and essential minerals31. Cd has severely affected the yield of tomato plants worldwide. The diversity of micro-organisms present in the rhizosphere shows mutualistic interactions and positively regulate the growth and metabolism of the plant under normal as well as stressed conditions. They are well known to ameliorate Cd toxicities by immobilization and reducing their translocation to the plant tissues.
The objectives of the present study were to explore the role of Pseudomonas aeruginosa and Burkholderia gladioli in 10-days old L. esculentum seedlings grown under Cd stress (0.4 mM). The effects of these strains were observed upon growth characteristics, photosynthetic efficiencies, metal tolerance index and metal uptake. Also the contents of metal chelating compounds such as protein bound thiols, non-protein bound thiols ant total thiols were assessed. The role of different metal transporters involved in Cd uptake and translocation were also analysed through expression profiling using qRT-PCR.
Results
The significant observations on growth, photosynthetic pigments, metal tolerance index and its uptake, metal chelating compounds and expression profiling of the metal transporters are presented as below:
Growth parameters
The effect of micro- organisms (P. aeruginosa (M1) and B. gladioli (M2)) on growth parameters of 10-day old L. esculentum seedlings under Cd stress was assessed in terms of root length, shoot length and fresh weight of the seedlings. It was observed that Cd stress resulted in reduction of the growth attributes of seedlings. Cd stress declined the root length and shoot length of seedlings by 32 and 31.61% in comparison to control plants. Furthermore, 35.64% decrease in the fresh was observed respectively. But supplementation of P. aeruginosa (M1) enhanced the root length, shoot length and fresh weight by 41, 39.8, 36.8%. Also, the application of B. gladioli (M2) improved the root length, shoot length and fresh weight by 48.2, 48.4, 52.7% respectively as compared to plants under Cd stress. Two-way ANOVA revealed the significant differences between root and shoot lengths and fresh weight (Table 1).
Table 1.
Effect of M1 (109 cells/ml) and M2 (109 cells/ml) on growth parameters.
Treatments | Root length (cm) (Mean ± SD) |
Shoot Length (cm) (Mean ± SD) |
Fresh weight (mg) (Mean ± SD) |
---|---|---|---|
CN | 7.10 ± 0.230b | 5.91 ± 0.094c,d | 10.28 ± 0.168c |
Cd | 4.78 ± 0.355d | 4.04 ± 0.180e | 7.58 ± 0.275d |
M1 | 8.48 ± 0.278a | 6.95 ± 0.075a | 13.18 ± 0.382a |
M1 + Cd | 6.77 ± 0.220b,c | 5.66 ± 0.38c,d | 10.38 ± 0.248c |
M2 | 7.42 ± 0.404b | 7.21 ± 0.100a | 12.65 ± 0.220a |
M2 + Cd | 7.09 ± 0.190b,c | 6.00 ± 0.123b,c | 11.58 ± 0.238b |
F- ratio(df 1,12) T | 112.65** | 265.103** | 310.74** |
F- ratio(df 2,12) D | 55.81** | 124.805** | 264.014** |
F- ratio(df 2,12) T × D | 18.411** | 5.340* | 20.411** |
HSD | 0.795 | 0.521 | 0.722 |
aRoot length. bShoot length and cFresh weight in 10-days old L. esculentum seedlings under Cd stress (0.4 mM). Data is presented as means of 3 replicates ± S.D (standard deviation) and HSD values. F ratio values, * indicates significance at P ≤ 0.05 and ** indicates significance at P ≤ 0.01). Different letters on the graphs indicate that mean values of treatments are significantly different at p < 0.5 according to Tukey’s multiple comparison test (CN-Control, Cd-Cadmium, M1-Pseudomonas aeruginosa, M2- Burkholderia gladioli).
Photosynthetic pigments
The photosynthetic pigments were determined by analysing total chlorophyll, carotenoid and xanthophyll contents. Total chlorophyll content was lowered by 35.9% with 0.4 mM Cd concentration as compared to control seedlings. Seedlings treated with P. aeruginosa (M1) resulted in increased total chlorophyll content by 91.05%. Application of seedlings with B. gladioli (M2) also elevated the total chlorophyll content of the seedlings grown under Cd stress by 144.7%. The carotenoid content decreased by 54.7% in 0.4 mM Cd treated seedlings relative to untreated seedlings. Inoculation of P. aeruginosa (M1) led to elevation in carotenoid content by 213.6% in 0.4 mM Cd treated seedlings whereas seedlings amended with B. gladioli (M2) by 222.7% respectively. Further, xanthophyll content was observed to be declined by 44.8% in Cd stressed seedlings. An increase in the contents of xanthophylls by 192.3 and 225.8% was noticed after augmentation of P. aeruginosa (M1) and B. gladioli (M2) in Cd stressed seedlings (Fig. 1).
Figure 1.
Effect of M1 (109 cells/ml) and M2 (109 cells/ml) on photosynthetic pigments. (A) Chlorophyll content (B) Carotenoid content (C) Xanthophyll content in 10-days old L. esculentum seedlings under Cd stress. Data is presented as means of 3 replicates ± S.D (standard deviation) and HSD values. F ratio values, *indicates significance at P ≤ 0.05 and **indicates significance at P ≤ 0.01). Different letters on the graphs indicate that mean values of treatments are significantly different at p < 0.5 according to Tukey’s multiple comparison test (CN- Control, Cd-Cadmium, M1- Pseudomonas aeruginosa, M2- Burkholderia gladioli).
Heavy metal tolerance Index and accumulation
Heavy metal tolerance index was observed to be lowered from 100% in control seedlings to 40% in 0.4 mM Cd stressed plants. An elevation in the tolerance index was recorded by 51.1 and 76% when Cd stressed seedlings were amended with (P. aeruginosa (M1) and B. gladioli (M2) respectively.
Furthermore, Cd accumulation in L. esculentum seedlings was found directly proportional to Cd concentration. The metal accumulation in roots was found to be enhanced by 505.9% in roots of Cd stressed plants as compared to control plants. Moreover, the accumulation of Cd in shoots was elevated by 109.5%. On supplementation of P. aeruginosa accumulation of Cd was reduced in roots and shoots of Cd treated seedlings by 16.43 and 13.78%. In addition, accumulation of Cd was found lowered in roots and shoots of Cd exposed seedlings by 21.83 and 7.73% by application of B. gladioli respectively (Fig. 2).
Figure 2.
Effect of M1 (109 cells/ml) and M2 (109 cells/ml) on (A) Shoot metal uptake (B) Root metal uptake (C) Heavy metal tolerance index in 10-days old L. esculentum seedlings under Cd stress. Data is presented as means of 3 replicates ± S.D (standard deviation) and HSD values. F ratio values, * indicates significance at P ≤ 0.05 and ** indicates significance at P ≤ 0.01). Different letters on the graphs indicate that mean values of treatments are significantly different at p < 0.5 according to Tukey’s multiple comparison test (CN-Control, Cd-Cadmium, M1- Pseudomonas aeruginosa, M2- Burkholderia gladioli).
Metal chelating compounds
An elevation in the accumulation of Cd in Lycopersicon seedlings triggers the synthesis of metal chelating compounds i.e protein bound thiols (PBT), non-protein bound thiols (NPBT) and total thiols. It was noticed that Cd led to significant elevation in protein bound thiols by 50.22% in Cd stressed seedlings as compared to control. With P. aeruginosa and B. gladioli application, an elevation in PBT was recorded by 77.7 and 96.2% respectively. Moreover, an increase in NBT and total thiols by 61.36 and 52.49% was recorded in Cd treated seedlings in comparison to untreated seedlings. Supplementation of both the strains in Cd exposed seedlings led to further elevation in the NBT by 36.22 and 47.45% and total thiols by 68.8 85.7% respectively (Table 2).
Table 2.
Effect of M1 (109 cells/ml) and M2 (109 cells/ml) on metal chelating compounds.
Treatments | Total thiols (mmol g−1 FW) (Mean ± SD) |
Non-protein bound thiols (mmol g−1 FW) (Mean ± SD) |
Protein bound thiols (mmol g−1 FW) (Mean ± SD) |
---|---|---|---|
Control | 0.122 ± 0.0169e | 0.0247 ± 0.0015d | 0.0973 ± 0.0154d |
Cd | 0.186 ± 0.0183d | 0.0398 ± 0.0022c | 0.1463 ± 0.0160c |
M1 | 0.220 ± 0.0091c,d | 0.0493 ± 0.0018abc | 0.1714 ± 0.0075c |
M1 + Cd | 0.314 ± 0.0061a | 0.0543 ± 0,0021ab | 0.2601 ± 0.0082a |
M2 | 0.252 ± 0.0123b,c | 0.0430 ± 0.0015bc | 0.2093 ± 0.012b |
M2 + Cd | 0.346 ± 0.0076a | 0.0588 ± 0.0017a | 0.2871 ± 0.0088a |
F- ratio(df 1,12) T | 197.44** | 2.231 | 160.16** |
F- ratio(df 2,12) D | 218.11** | 17.09** | 178.41** |
F- ratio(df 2,12) T × D | 2.721* | 9.62** | 4.35 |
HSD | 0.0346 | 0.014 | 0.0324 |
aTotal thiol content bNon- protein bound thiol content and cProtein bound thiol content in 10-days old L. esculentum seedlings under Cd stress (0.4 mM). Data is presented as means of 3 replicates ± S.D (standard deviation) and HSD values. F ratio values, * indicates significance at P ≤ 0.05 and ** indicates significance at P ≤ 0.01). Different letters on the graphs indicate that mean values of treatments are significantly different at p < 0.5 according to Tukey’s multiple comparison test (CN-Control, Cd-Cadmium, M1-Pseudomonas aeruginosa, M2- Burkholderia gladioli).
Gene expression analysis
Cd-treated Lycopersicon seedlings (shoots) showed a drastic increase in the gene expression of metal transporter genes under Cd stress as compared to control seedlings. Gene expression studies of metal transporter 1, metal transporter 3, metal transporter 5, metal transporter 6 and metal transporter 7 genes revealed an up regulation by 34.06, 433, 12 folds, 62.6 and 53.18% respectively. Moreover, other transporter genes i.e metal transporter 8, metal transporter 9, metal transporter 10, metal transporter 11, metal transporter 12, metal transporter 13, metal transporter 14, metal transporter 15 and metal transporter 16 showed enhanced expression in Cd treated seedlings by 320%, 23 folds, 146, 92.3, 338, 174, 404, 171 and 39.6% respectively. However, metal transporter 2 and metal transporter 4 showed a reduced expression by 41.02 and 35.56% in Cd-treated seedlings in response to control.The seedlings treated with P. aeruginosa (M1) showed decline in the expression of metal transporter 1, metal transporter 2, metal transporter 3, metal transporter 4, metal transporter 5, metal transporter 6 and metal transporter 7 by 35.04, 26.47, 91.1, 95.1, 43.4, 37.9 and 43.2% in Cd treated seedlings. However, metal transporter 8, metal transporter 9, metal transporter 10, metal transporter 11, metal transporter 12, metal transporter 13, metal transporter 14, metal transporter 15 and metal transporter 16 also showed the reduced expressions by 72.2, 65.7, 54.8, 41.2, 62.3, 32.2, 87.1, 90.4 and 50% respectively in seedlings exposed to Cd. Similar decline in the expression of metal transporter 1, metal transporter 2, metal transporter 3, metal transporter 4, metal transporter 5, metal transporter 6 and metal transporter 7 was recorded by 72.9, 72.1, 96.2, 80.5, 96.4 and 80.69% respectively on application of B. gladioli (M2) in Cd stresses seedlings. Also the expression levels of metal transporter 8, metal transporter 9, metal transporter 10, metal transporter 11, metal transporter 12, metal transporter 13, metal transporter 14, metal transporter 15 and metal transporter 16 were also lowered upon inoculation of B. gladioli (M2) in Cd treated seedlings by 88, 91.4, 85.5, 85.28, 90.1, 75, 85.1, 82.7 and 83.4% respectively (Figs 3 and 4).
Figure 3.
Effect of M1 (109 cells/ml) and M2 (109 cells/ml) on (A) Metal transporter1 (B) Metal transporter 2 (C) Metal transporter 3. (D) Metal transporter 4 (E) Metal transporter 5 (F) Metal transporter 6 (G) Metal transporter 7 (H) Metal transporter 8 in 10-days old L. esculentum seedlings under Cd stress. Data is presented as means of 3 replicates ± S.D (standard deviation) and HSD values. F ratio values, * indicates significance at P ≤ 0.05 and ** indicates significance at P ≤ 0.01). Different letters on the graphs indicate that mean values of treatments are significantly different at p < 0.5 according to Tukey’s multiple comparison test (CN-Control, Cd-Cadmium, M1-Pseudomonas aeruginosa, M2- Burkholderia gladioli).
Figure 4.
Effect of M1 (109 cells/ml) and M2 (109 cells/ml) on (A) Metal transporter 9 (B) Metal transporter 10 (C) Metal transporter 11 (D) Metal transporter12 (E) Metal transporter13 (F) Metal transporter14 (G) Metal transporter15 (H) Metal transporter16 in 10-days old L. esculentum seedlings under Cd stress. Data is presented as means of 3 replicates ± S.D (standard deviation) and HSD values. F ratio values, * indicates significance at P ≤ 0.05 and ** indicates significance at P ≤ 0.01). Different letters on the graphs indicate that mean values of treatments are significantly different at p < 0.5 according to Tukey’s multiple comparison test (CN-Control, Cd-Cadmium, M1-Pseudomonas aeruginosa, M2- Burkholderia gladioli).
Discussion
The present study revealed that Cd metal inhibited the growth of L. esculentum seedlings in terms of root and shoot length. This decline in plant growth in the presence of Cd might be due to lowered water potential and nutrient imbalance. It can also be due to obstruction in the proton pumps that further causes impairment in the cell division and elongation32. Our studies are in agreement with Dutta et al. and Ahmad et al. who suggested that Cd treated B. juncea showed reduced root and shoot lengths33,34. Moreover, reports of decline in the root and shoot lengths due to metal toxicity have been suggested in earlier studies conducted in Vigna mungo exposed to Cd33, Zea mays exposed to Cu and Pb35, O. sativa exposed to As36, and Pennisetum purpureum exposed to Pb37. Suppression in the root and shoot elongation is correlated to direct inhibition of root as well as shoot metabolism38. Supplementation of microbial strains (P. aeruginosa and B. gladioli) significantly improved the growth of seedlings in the present study. Micro-organisms are beneficial for the plant growth and development, and helps in phosphorous uptake in plants39. The mechanism by which micro-organisms enable phosphate uptake is mainly through extending branching pattern and root hair formation, through hormonal stimulation. This facilitates organic phosphates via microbial turnover that induces metabolic activities involved in solubilization and mineralization of organic phosphorous. The metabolic activity involves efflux of protons and different anions followed by the release of phosphatases enzymes that lead to phosphorus hydrolysis and mineralization respectively. Stimulation of root and shoot length by microbial inoculations was also observed by Liu et al. in Z. mays under Cd stress40. It was further reported that Enterobacter asburiae KE17 enhanced the growth and metabolism of soybeans under Cu and Zn toxicity41. The increase in root and shoot length was attributed to the plant growth promoting traits possessed by the inoculated micro-organisms.
The present study revealed that Cd toxicity resulted in declined fresh weight of the seedlings. Similar reports on reduced biomass under Cd stress in B. juncea have been observed by Verma et al. and Dutta et al.33,42. Reduction in the plant biomass during Cd stress is mainly due to its adverse affects upon mineral uptake, photosynthesis, chlorophyll synthesis, altered water and hormonal balance43. Cd is first exposed to roots which later on through apoplastic pathway may enter the system and can disrupt the complete metabolism of the plant44. Further, fresh weight of roots and shoots were found to be lowered in Cd-treated Russian knapweed45. Our results revealed that inoculations of P. aeruginosa and B. gladioli improved fresh weight of L. esculentum seedlings. There is a direct correlation of plant growth and biomass with plant growth promoting rhizobacteria (PGPRs) which was found to be increased after augmentation of PGPRs under Cd toxicity46. An elevation in the growth characteristics was also observed in Enterobacter inoculated O. sativa exposed to Cd47. Our studies were in the agreement with the previous studies conducted by Treesubsuntorn et al. who found that B. subtilis and B. cereus when inoculated to Cd exposed O. sativa plants resulted in the higher root and shoot biomass48. This is possibly due to plant growth hormone production (IAA) by assisted microbes that regulate the hormones within plant tissues and make them acclimatize towards stress conditions48. Moreover, Trichoderma sp. elevated the plant growth characteristics such as plantbiomass, yield, germination rate and many other plant growth promoting traits under arsenic (As) toxicity49. It was found that As tolerant strain improved the phosphate solubilisation from soil towards plant system via phosphate and As transporters that enhanced the metabolic and physiological activities of the Cicer arietinum plants49. Several other studies in Solanum nigrum L.50, Ocimum gratissimum L.51, Eruca sativa46, Zea mays52, and O. sativa53 under Cd exposure showed the similar results that plant growth promoting bacteria could attribute to improved growth indices as found in our studies. Similarly, various reports of P. aeruginosa and B. gladioli in growth promotion and phosphate solubilization in heavy metal toxicity have been reported54–56.
The results of the present study showed that Cd toxicity reduced the contents of photosynthetic pigments such as chlorophyll, carotenoid and xanthophylls in L. esculentum seedlings. It has been observed that Cd hinders photosynthetic machinery of rice plants by altering the levels of chlorophyll a, chlorophyll b, carotenoids and net photosynthetic activity57. It also causes the structural changes in leaves leading to damage in their photosynthetic apparatus. It was investigated by Amirjani. that Cd exposure reduced the levels of carotenoids, total chlorophyll, chlorophyll a and chlorophyll b in Triticum aestivum58. The decline in the levels of photosynthetic pigments is mainly due to loss of cell wall and membrane integrity of thylakoid membrane. Many other heavy metals such as Zn, Fe, Cu, Hg, Cr and Pb leads to impediment of enzymes such as rubisco, chlorophyll synthase, protochlorophyllide reductase and δ-aminolevulinic acid dehydratase involved in the synthesis of chlorophyll59, that result in the breakdown of chlorophyll pigments60. Moreover, Cd- mediated breakdown of chlorophyll might be due to the activation of enzymes involved in hydrolysis of chlorophyll such as chlorophyllase61. They also lead to the activation of xanthophyll cycle in order to protect the photosynthetic apparatus from the metal exposure62. Moreover, carotenoids protect the plant’s photosynthetic machinery from photo-oxidative disruptions through ROS scavenging. Reduction in carotenoids lead to PSII damage by retrogression of D1 protein that inhibits chlorophyll synthesis63. The observations made in our study are in accordance with Chen et al. who reported decline in the chlorophyll and carotenoid levels in Cd treated B. campestris and B. juncea44. Enhancement in the photosynthetic pigments could occur in the presence of plant growth promoting bacteria that increases nutrient uptake in plants through phosphate solubilization and exudating essential substances that play crucial role in synthesis of photosynthetic pigments required for light harvesting complex and its photo assimilation64. Inoculation of Klebsiella pneumoniae in V. mungo enhanced the levels of chlorophyll under Cd stress33. It was suggested by Rizvi et al. that Azotobacter chrococcum when supplemented with Cu and Pb exposed Zea mays plants enhanced the chlorophyll contents35.
Furthermore, elevation in chlorophyll as well as carotenoid contents in O. sativa was observed upon inoculations with Pseudomonas putida and C. vulgaris upon As treatment which is attributed to lessened accumulation of As that prevented the toxicity symptoms of As. We can speculate that it is most likely due to the growth promoting effects of PGPRs as well as enhanced protein levels that in turn stimulated the pigment levels. Several studies of PGPRs in enhancing the levels of chlorophyll and carotenoids under Cd stress have been reported such as Proteus vulgaris in pigeon pea65, Enterobacter in rice47, Azotobacter in Plantago ovata66, and K. pneumoniae in rice53.
In the current study, Cd stress lowered the heavy metal tolerance index and enhanced Cd- uptake in L. esculentum seedlings. It was demonstrated that inhibition of seed germination in various cereal crops such as rice, wheat and barley in response to different heavy metals is probably due to the morphological and physiological changes in roots that results in reducing heavy metal tolerance67. The results also signifies that treatment of seedlings with microbial strains (P. aeruginosa and B. gladioli) individually mitigates Cd induced reduction in heavy metal tolerance index. Heavy metal tolerance index in Ni and Cd treated tomato seedlings was reduced upon increased concentrations of Ni and Cd which upon supplementation of Methylobacterium oryzae and Burkholderia sp. was enhanced68. According to them, these metals raised stress marker ethylene levels which was reduced upon microbial inoculations. Along with this, they also observed that microbes precipitated heavy metals and lowered their availability by binding to functional groups such as hydroxyl, carboxyl, amide group etc. and chelating them via extracellular produced polymers such as humic substances and polysaccarides68. The results of the present study showed that Cd content was more in roots as compared to shoots. Similarly, studies with enhanced accumulation of different metal ions in roots were reported in Z. mays under Cu stress35, O. sativa under As stress36, and rapeseed under Cd presence69. The reduction in the uptake and translocation of heavy metals towards shoots is the adaptive measure adopted by the plants under stressful conditions70. Augmentation of micro-organisms in the present study reduced the Cd accumulation in roots as well as shoots. Previous studies conducted by Rizvi et al. suggested that Z. mays when inoculated with A. chroococcum reduced the Cu and Pb accumulation in plant organs which is most likely due to the secretion of different metabolites, protons and exudates that act as metal chelators and immobilise Pb35. Moreover, it was reported that metal tolerant strain Bacillus megaterium reduced the Ni translocation20, and As-tolerant Exiguobacterium reduced As translocation in Vigna radiata plants by colonization at the root surfaces71. It has been found that Acinetobacter lwofii promotes the growth and reduces As uptake in V. radiata72 They speculated that A. lwofii produced growth promoting substances such as indole-3 acetic acid and siderophores that help them to resist the metal contamination. In addition, they also form biofilms which restricted the As uptake in these plants72.
Molecular studies revealed that PGPRs led to As biotransformation in wheat plants where up regulation of arsC, aioA and arsM genes reduced As levels in roots as well as shoots10,73. Furthermore, metal homeostasis within plants is mainly regulated by metal transporters and transport proteins depending upon the bioavailability of these metals74. In present study, gene expression profiling of metal transporter genes in seedlings under Cd metal stress have been studied through qRT-PCR. It was observed that expression of metal transporters were enhanced that resulted in the accumulation of Cd in roots and shoots which were lowered in the presence of microbes. A study conducted by Chen et al. showed that cloning of As- antiporter ACR3 Pteris vittata, PvACR3;1 was done and expressed in Arabidopsis thaliana and Nicotiana tabacum and yeast75. The results observed by them in yeast indicated that PvACR3;1 is a well developed antiporter that efflux As into the medium. Moreover, they also found that Arabidopsis thaliana and Nicotiana tabacum accumulated higher levels of As and reduced their accumulation in shoots75.
It was further reported that Pseudomonas putida possesses very well developed CzcCBA efflux system which involved three main genes CzcA, CzcB and CzcC and effect of these genes were studied in tobacco plants under Cd exposure76. They postulated that CzcB and CzcC genes led to lowered accumulation of Cd in shoots thereby reducing the Cd toxicity in contaminated soils. Similar studies revealed by Manzoor et al.depicted that microbes such as Pseudomonas possess metal resistance genes such as CzcR, Pbr A, CadA2 and ZntA that encodes different efflux proteins involved in metal detoxification processess. These genes belongs to PIB- type ATPases that transport metal ions from cytoplasm towards periplasm and precipitated to prevent the entry into the nearby cells77. Moreover, CzcA gene (encoded by bacteria) is a key antiporter and it has been found to be involved in controlling metal ion bioavailability at contaminated sites78. Therefore, the reduction of metal uptake via inoculation of plant growth promoting microbes enabled the Lycopersicon plants to survive better under metal exposure by detoxifying them that would otherwise affected the overall plant health.
The present study also revealed that metal chelating compounds such as total thiols, protein bound thiols and non-protein bound thiols were enhanced in seedlings under Cd stress. These metal chelators usually consist of sulfhydrl (-SH) groups that effectively bind to metals in order to immobilise them1. Our studies are in accordance with the studies of Aly and Mohamed. in Scenedemus bijugatus and maize under Cu stress79. Moreover, Cu accumulation can modulate glutathione levels which further stimulates the metal binding properties and sequester the metals80. It has been studied that thiol metabolism is the most crucial pathway in regulation of heavy metal stress tolerance. It mainly consists of non-protein thiols (NBTs), phytochelatins, protein thiols and glutathione that form complexes with metals and mediate their transport and sequestration into the vacuoles81. Moreover, NBT imparts antioxidant properties to the plants. The most important metabolite of thiol metabolism, cysteine produced during sulphur assimilation leads to the synthesis of phytochelatins and glutathione. The supplementation of P. putida in rice plants under As toxicity enhanced the levels of NBTs, phytochelatins and glutathione. According to their study, it is most probably due to complexation of As in shoots and roots36. This elevation in the levels of thiols might be due to increased nutrient uptake of different nutrients such as nitrogen, phosphorous, magnesium, potassium and sulphur in the presence of micro-organisms that stimulate the synthesis of these metal chelating compounds.
Conclusions
The results of the present study concluded that presence of plant growth promoting rhizobacterial strains P. aeruginosa and B. gladioli in soils promoted growth of plants in terms of root length, shoot length and fresh weight in L. esculentum seedlings subjected to Cd stress. A significant increase in the photosynthetic efficiency was also observed in Cd exposed microbe inoculated seedlings by elevating the contents of photosynthetic pigments such as chlorophyll, carotenoid and xanthophylls. Further, it was found that presence of these microbes reduced the Cd metal accumulation in the seedlings. The decreased levels of Cd resulted in alleviation of Cd toxicity through decreasing its bioavailability. The effective role played by microbes in reduction of metal uptake is mainly due to immobilization that results in binding the metal to root by complex formation which further prevent its translocation towards shoot. The role of metal chelating compounds such as non-protein thiols and protein thiols have also been elucidated in binding actions of heavy metals by microbes. Moreover, PGPRs also promote plant growth by enhancing mineral uptake, phytohormone production and nitrogen fixation. Therefore, all these traits act as driving force in enhancing the growth of plants under metal polluted environment. The present study therefore projects the contribution of micro-organisms in decreasing Cd toxicity and accumulation, implicating their roles for achieving the goal of lower Cd concentrations in tomato plants with better growth conditions.
Materials and Methods
Inoculation of microbial strains
Selected microbial strains (Pseudomonas aeruginosa strain no. MTCC7195) and Burkholderia gladioli strain no. MTCC10242) were obtained from IMTECH, Mohali, Punjab (India). These strains were cultured individually by addition of bacterial strains in 50 mL of nutrient broth (13 gL−1) medium. The flasks were later placed in the BOD incubator (Caltan (Deluxe Automatic), New Delhi, India) for 24–48 h at 28 °C for their proliferation. After their growth sub-culturing was done so as to maintain them for future. The culture was grown by adding 1 mL of above grown pure culture of bacteria (109 cells/mL) in 50 mL nutrient broth at 28 °C for 24–48 hrs. It was then centrifuged at 8000 rpm, 4 °C for 15 minutes to obtain the pellet. Pellet was washed twice using distilled water and resuspended in distilled water. The concentration of 109 cells/mL was adjusted for the experimental purpose.
Plant material and treatments
The certified seeds of L. esculentum (tomato) var. Pusa Ruby were sterilized by using 0.01% mercuric chloride (HgCl2) solution. The seeds were dipped for a minute and rinsed thoroughly for 5–6 times using distilled water. Petriplates were lined with Whatman filter paper (grade 1 with diameter 10 cm) onto which thirty seeds were raised by soaking the seeds with microbial suspensions (having diameter approx. 10 cm) at 109 cells/mL concentration and CdCl2 solution containing Cd (0.4 mM). The Petri plates were tracked in seed germinator for 10 days at controlled conditions of light (16-h photoperiod with white fluorescent light intensity 175 μmol m−2 s−1), temperature (22–25 °C), and relative humidity (80–90%) in seed germinator. Cd concentration was selected on the basis of IC50 (0.4 mM) value.
Growth Parameters
Growth parameters were assessed after harvesting the seedlings by examining their root length and shoot length. Fresh weight was also recorded from the harvested seedlings after 10-days.
Evaluation of Heavy metal tolerance index
Heavy metal tolerance index was calculated using method of Balint et al.82. For this, dry weights of seedling samples were taken and tolerance index was calculated using the formula given below:
Metal accumulation
Cd- metal accumulation in plant tissues (roots and shoots) was estimated by using Atomic Absorption Spectrophotometer (Shimadzu 6200, Agilent technologies GTA 120). The seedlings were harvested and their roots and shoots were separated and allowed to dry in oven at 65 °C for 48 hrs. The dried plant samples were further digested using the method proposed by Allen et al.83. For digestion, 200 mg of powdered sample was taken which was then digested in aqua regia (H2SO4: HNO3: HClO4, v/v) in ratio 1:3:1 using glass beakers on a hot induction plate. After that, digested samples were cooled and filtered using 0.22-μm nylon syringe filters. The samples were further diluted using double distilled water to make up the final volume upto 50 ml. These digested samples were stored at room temperature and used for further analysis.
Photosynthetic pigments
Determination of chlorophyll and carotenoid content
Estimation of chlorophyll and carotenoid content was done by the method given by Arnon84 and Maclachlan and Zalik85, respectively. For this purpose, 1 g of fresh seedlings were macerated in 4 mL of 80% acetone. It was further centrifuged at 12,000 rpm for 15–20 min at 4 °C. The supernatant was taken for estimation of chlorophyll and carotenoid contents. Absorbance at 645 nm and 663 nm was taken for chlorophyll analysis, whereas absorbance at 480 and 510 nm was measured for carotenoids using spectrophotometer (Thermo electron corporation, Genesys 10 UV).
Determination of xanthophyll content
Estimation of xanthophyll content was done by method proposed by Lawrence86. For this purpose, 50 mg of oven dried powdered seedling sample was kept in a 100-mL volumetric flask. To this, addition of 30 mL of combined extract (hexane (10 mL):acetone (7 mL):absolute alcohol (6 mL):toluene (7 mL)) was done and flask was shaken for 15–20 min. It was then followed by mixing 40% methanolic KOH (2 mL) to the flask. The flask was then kept in the water bath (58 °C) for 20–25 min after which the samples were placed under dark conditions for an hour. 30 mL of hexane along with 10% sodium sulfate was mixed to a volume of 100 mL followed by vigorous shaking for a minute. Again the flask was incubated under dark conditions. The upper layer was shifted into a 50-mL volumetric flask and volume was adjusted using hexane. Absorbance was taken at 474 nm.
Metal chelating compounds
Total thiols
Determination of total thiols was done by homogenising 0.5 g of seedling sample in 20 mM ascorbate buffer prepared using 20 mM EDTA (Ethylene diamine tetra acetic acid). Centrifugation was carried out at 12,000 g for 15–20 min, at 4 °C. To 0.5 mL of above obtained supernatant 2.4 mL of 200 mM Tris HCl and 10 mM of DTNB (5,5-dithio-bis-[2-nitrobenzoic acid]) was mixed. It was then allowed to stand for 20 min after which absorbance was recorded at 412 nm87.
Non-protein thiols
0.5 g of fresh seedlings were macerated in 3 mL of ice cold 5% sulfosalicylic acid. The sample was then centrifuged at 12,000 g for 15–20 min at 4 °C. To 100 µL of extract, PPB (potassium phosphate buffer, 0.1 M; pH-7), 0.5 mL of 1 mM DTNB and 0.5 M EDTA was mixed. It was then placed for 15 minutes and absorbance was noted at 412 nm88.
Protein bound thiols
Estimation of protein bound thiols was done by subtraction of the non protein thiols (NPT) from total thiols (TT).
Gene expression analysis of metal transporters
RNA was isolated from tomato seedlings using Trizol method (Invitrogen, Life Technologies, USA). Analysis of RNA was done qualitatively as well as quantitatively through agarose gel electrophoresis (2%) and Nano Drop spectrophotometer (By Thermo Scientific, USA). The RNA isolated was treated with DNase (DNA-free TM kit; Ambion TURBO DNA-freeTM, From Life Technologies, USA) in order to restrict DNA contamination. Further, cDNA was synthesised with ImProm-IITM Reverse Transcription System (Promega, Madison, USA) using 1 μg of RNA (treated by DNase) as template and oligodT12 primer (First Choice RLM-RACE Kit, Ambion, Life Technologies, Carlsbad, USA)89. The primers used in the current study are listed in the Table 3 (Integrated DNA technologies, USA).
Table 3.
Nucleotide sequences used in experiment.
Metal transporter genes | Primer code | Primer Sequences | Tm (·C) |
---|---|---|---|
SGN-U143555 At5g21930; ATPase, E1-E2 type transporter family (Metal transporter 1) |
SGN-U14F26 SGN-U14R26 |
Forward primer GCTTCAAATGCAGCATCC Reverse primer TCCAGCTGCAATGGGTA |
60.3 59.7 |
SGN-U165841 At5g21930.1; ATPase, E1-E2 type transporter family (Metal transporter 2) |
SGN-U16F27 SGN-U16R27 |
Forward primer GCTTTATTAGGACCTGGACG Reverse primer TCCCATTGAAGCTCAGAGTTA |
60.1 60.0 |
SGN-U166596 At4g33525.1; Metal transporting P-Type ATPase (Metal transporter 3) |
SGN-U16F28 SGN-U16R28 |
Forward primer TTCTAGCAGTCTGTCAGTCG Reverse primer TTCTAGCAGTCTGTCAGTCG |
59.9 60.2 |
SGN-U213018 At5g21930.1; Metal transporting ATPase like protein (Metal transporter 4) |
SGN-U21F29 SGN-U21R29 |
Forward primer GCTTCAAATGCAGCATCC Reverse primer TCCAGCTGCAATGGGTA |
60.3 59.7 |
SGN-U236090 At5g21930; PAA2 (P- type ATPase metal transporter family) (Metal transporter 5) |
SGN-U23F30 SGN-U23R30 |
Forward primer GCTTTATTAGGACCTGGACG Reverse primer TCCCATTGAAGCTCAGAGTTA |
60.1 60.0 |
SGN-U239322 At4g33520.3; PAA1 (P- type ATPase 1 metal transporter family) (Metal transporter 6) |
SGN-U23F31 SGN-U23R31 |
Forward primer TTCTAGCAGTCTGTCAGTCG Reverse primer AGGTTTATACTTCCTGCGG |
59.9 60.2 |
SGN-U318095 At5G21930.2; PAA2 (P- type ATPase metal transporter family) (Metal transporter 7) |
SGN-U31F32 SGN-U31R32 |
Forward primer GCTTCAAATGCAGCATCC Reverse primer TCCAGCTGCAATGGGTA |
60.3 59.7 |
SGN-U320813 At5G21930.1; PAA2 (P- type ATPase metal transporter family) (Metal transporter 8) |
SGN-U32F33 SGN-U32R33 |
Forward primer TAATCGAGTGGCTTTCGC Reverse primer GTCTCGTCCAGGTCCTAA |
59.9 60.0 |
SGN-U321017 At4g33520.2; HMA6, PAA1 (Metal transporting P-type ATPase 1) (Metal transporter 9) |
SGN-U32F34 SGN-U32R34 |
Forward primer TAGCAATTGGTGGTGGAGT Reverse primer TGTTGTATCCGAAGGCCC |
60.4 60.3 |
SGN-U342455 At4G33520.2; HMA6, PAA1 (Metal transporting P-type ATPase 1) (Metal transporter 10) |
SGN-U34F35 SGN-U34R35 |
Forward primer TTCTAGCAGTCTGTCAGTCG Reverse primer AGGTTTATACTTCCTGCGG |
59.9 60.2 |
SGN-U574793 At5g21930.1; ATPase, E1-E2 type transporter family (Metal transporter 11) |
SGN-U5F36 SGN-U5R36 |
Forward primer TTCTAGCAGTCTGTCAGTCG Reverse primer AGGTTTATACTTCCTGCGG |
59.9 60.2 |
SGN-U584889 At5g21930; ATPase, E1-E2 type transporter family (Metal transporter 12) |
SGN-U5F37 SGN-U5R37 |
Forward primer TAATCGAGTGGCTTTCGC Reverse primer GTCTCGTCCAGGTCCTAA |
59.9 60.0 |
SGN-U585274 At5g21930; ATPase, E1-E2 type transporter family (Metal transporter 13) |
SGN-U58F38 SGN-U58R38 |
Forward primer TAGCAATTGGTGGTGGAGT Reverse primer TGTTGTATCCGAAGGCCC |
60.4 60.3 |
SGN-U527536 At5g21930; ATPase, E1-E2 type transporter family (Metal transporter 14) |
SGN-U52F39 SGN-U52R39 |
Forward primer TTCTAGCAGTCTGTCAGTCG Reverse primer AGGTTTATACTTCCTGCGG |
59.9 60.2 |
SGN-U535703 At5g21930; ATPase, E1-E2 type transporter family (Metal transporter 15) |
SGN-U53F40 SGN-U53R40 |
Forward primer TAGCAATTGGTGGTGGAGT Reverse primer TGTTGTATCCGAAGGCCC |
60.4 60.3 |
SGN-U542816 At5g21930; ATPase, E1-E2 type transporter family (Metal transporter 16) |
SGN-U54F41 SGN-U54R41 |
Forward primer TAATCGAGTGGCTTTCGC Reverse primer GTCTCGTCCAGGTCCTAA |
59.9 60.0 |
Gene expression studies using qRT-PCR
Molecular studies in 10-day old tomato seedlings subjected to different treatments were done by expression studies of different metal transporter genes mentioned in Table 1. using quantitative real time RT-PCR (qRT-PCR)90. IM- Prom-IITM Reverse Transcription System (Promega, USA) was used for cDNA preparation. The primers designed for qRT-PCR profiling was carried out using Primer3 software. Expression study was preceded according to the manual instructions given along with the instrument Light Cycler 96 Real Time PCR System (Hoffmann-La Roche, Switzerland). PCR reaction (20 μL) preparation was done by combining the following reaction mixtures: cDNA (appropriately diluted), 1× Light Cycler 480 SYBR Green I Master (Hoffmann-La Roche, Switzerland) and 1 μM primers (Integrated DNA Technologies, USA, refer Table 1 for sequences). The prerequisite for qRT-PCR (thermal cycler) were: incubation period at 95 °C for 10–15 min, followed by 45 cycles of 3 step amplification (95 °C–10 s, 60 °C–15 s and 72 °C–25 s). Data interpretation was done through dissociation curve (heating upto 95 °C–10 s under normal conditions and cooling to 65 °C–60 s). Later, heat was given slowly upto 97 °C (1 s) at lowered ramping rate of 0.2 °C/s to check distinct qPCR reaction rate. Data was assessed in triplicates that also includes the negative control (non-template). Ubq (Ubiquitin) gene was used as house-keeping control gene for normalization purposes. The data was calculated using threshold cycle (Ct) of the amplification curve. The relative gene expression level was assessed using the 2−ΔΔct method91,92 (where Ct = (Ct, target − Ct, Ubiquitin)time × − (Ct, target −Ct, Ubiquitin time 0).
Statistical Analysis
The results of the present study were interpreted statistically through two- way analysis of variance (ANOVA) and Tukey’s multiple comparison test to find the HSD (Honestly Significant Difference) among means. The values are mentioned as means ± standard deviation (S.D) and significant differences were checked at p ≤ 0.05 and 0.01. The data was examined in well built software in Microsoft excel.
Acknowledgements
This work was supported by University of Grants Commission- University of Excellence (UGC-UPE), Govt. of India.
Author Contributions
K.K., V.J. performed all the experiments, analysed data and wrote the paper. R.B., S.G.G. and P.O. designed and supervised experiments and helped in the data analysis.
Competing Interests
The authors declare no competing interests.
Footnotes
Publisher’s note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Kanika Khanna and Vijay Lakshmi Jamwal contributed equally.
Contributor Information
Sumit G. Gandhi, Email: sumit@iiim.ac.in
Puja Ohri, Email: ohri11puja@gmail.com.
Renu Bhardwaj, Email: renubhardwaj82@gmail.com.
References
- 1.Rizwan M, et al. Cadmium stress in rice: toxic effects, tolerance mechanisms, and management: A critical review. Environ. Sci. Pollut. Res. 2016;23(18):17859–17879. doi: 10.1007/s11356-016-6436-4. [DOI] [PubMed] [Google Scholar]
- 2.Edelstein, M. & Ben-Hur, M. Heavy metals and metalloids: Sources, risks and strategies to reduce their accumulation in horticultural crops. Sci. Hort (2018).
- 3.Zhang L, et al. Spatial and seasonal characteristics of dissolved heavy metals in the east and west Guangdong coastal waters, South China. Mar. Pollut. Bull. 2015;95:419–426. doi: 10.1016/j.marpolbul.2015.03.035. [DOI] [PubMed] [Google Scholar]
- 4.Deng X, Xia Y, Hu W, Zhang H, Shen Z. Cadmium-induced oxidative damage and protective effects of N-acetyl-l-cysteine against cadmium toxicity in Solanum nigrum L. J. Hazard. Mater. 2010;180(1–3):722–729. doi: 10.1016/j.jhazmat.2010.04.099. [DOI] [PubMed] [Google Scholar]
- 5.Gall JE, Boyd RS, Rajakaruna N. Transfer of heavy metals through terrestrial food webs: a review. Environ. Monit. Assess. 2015;187(4):201. doi: 10.1007/s10661-015-4436-3. [DOI] [PubMed] [Google Scholar]
- 6.Kabata-Pendias, A. Trace elements in soils and plants. (CRC press, 2010).
- 7.Gupta VK, et al. Study on the removal of heavy metal ions from industry waste by carbon nanotubes: effect of the surface modification: a review. Crit. Rev. Environ. Sci. Technol. 2016;46(2):93–118. doi: 10.1080/10643389.2015.1061874. [DOI] [Google Scholar]
- 8.Gallego SM, et al. Unravelling cadmium toxicity and tolerance in plants: insight into regulatory mechanisms. Environ. Exp. Bot. 2012;83:33–46. doi: 10.1016/j.envexpbot.2012.04.006. [DOI] [Google Scholar]
- 9.Bolan N, et al. Remediation of heavy metal (loid) s contaminated soils–to mobilize or to immobilize? J. Hazard. Mater. 2014;266:141–166. doi: 10.1016/j.jhazmat.2013.12.018. [DOI] [PubMed] [Google Scholar]
- 10.Wang Q, Zhang WJ, He LY, Sheng XF. Increased biomass and quality and reduced heavy metal accumulation of edible tissues of vegetables in the presence of Cd-tolerant and immobilizing Bacillus megaterium H3. Ecotoxicol. Environ. Saf. 2018;148:269–274. doi: 10.1016/j.ecoenv.2017.10.036. [DOI] [PubMed] [Google Scholar]
- 11.Marques AP, Moreira H, Franco AR, Rangel AO, Castro PM. Inoculating Helianthus annuus (sunflower) grown in zinc and cadmium contaminated soils with plant growth promoting bacteria–Effects on phytoremediation strategies. Chemosphere. 2013;92(1):74–83. doi: 10.1016/j.chemosphere.2013.02.055. [DOI] [PubMed] [Google Scholar]
- 12.Sun Z, et al. Spatial variations and bioaccumulation of heavy metals in intertidal zone of the Yellow River estuary, China. Catena. 2015;126:43–52. doi: 10.1016/j.catena.2014.10.037. [DOI] [Google Scholar]
- 13.Zanuzzi A, Faz A, Acosta JA. Chemical stabilization of metals in the environment: a feasible alternative for remediation of mine soils. Environ. Earth Sci. 2013;70(6):2623–2632. doi: 10.1007/s12665-013-2313-3. [DOI] [Google Scholar]
- 14.Udeigwe TK, Eze PN, Teboh JM, Stietiya MH. Application, chemistry, and environmental implications of contaminant-immobilization amendments on agricultural soil and water quality. Environ. Int. 2011;37(1):258–267. doi: 10.1016/j.envint.2010.08.008. [DOI] [PubMed] [Google Scholar]
- 15.Zhou R, et al. Remediation of Cu, Pb, Zn and Cd-contaminated agricultural soil using a combined red mud and compost amendment. Int. Biodeterior. Biodegrad. 2017;118:73–81. doi: 10.1016/j.ibiod.2017.01.023. [DOI] [Google Scholar]
- 16.Liu, S. J. et al. The effect of several activated biochars on Cd immobilization and microbial community composition during in-situ remediation of heavy metal contaminated sediment. Chemosphere (2018). [DOI] [PubMed]
- 17.Yuan ZM, et al. Application of phosphate solubilizing bacteria in immobilization of Pb and Cd in soil. Environ. Sci. Pollut. Res. 2017;24:21877–21884. doi: 10.1007/s11356-017-9832-5. [DOI] [PubMed] [Google Scholar]
- 18.Mallick I, et al. Effective rhizoinoculation and biofilm formation by arsenic immobilizing halophilic plant growth promoting bacteria (PGPB) isolated from mangrove rhizosphere: a step towards arsenic rhizoremediation. Sci. Total. Environ. 2018;610:1239–1250. doi: 10.1016/j.scitotenv.2017.07.234. [DOI] [PubMed] [Google Scholar]
- 19.Han H, Sheng X, Hu J, He L, Wang Q. Metal-immobilizing Serratia liquefaciens CL-1 and Bacillus thuringiensis X30 increase biomass and reduce heavy metal accumulation of radish under field conditions. Ecotoxicol. Environ. Saf. 2018;161:526–533. doi: 10.1016/j.ecoenv.2018.06.033. [DOI] [PubMed] [Google Scholar]
- 20.Rajkumar M, Ma Y, Freitas H. Improvement of Ni phytostabilization by inoculation of Ni resistant Bacillus megaterium SR28C. J. Environ. Manag. 2013;128:973–980. doi: 10.1016/j.jenvman.2013.07.001. [DOI] [PubMed] [Google Scholar]
- 21.Wang Q, Chen L, He LY, Sheng XF. Increased biomass and reduced heavy metal accumulation of edible tissues of vegetable crops in the presence of plant growth-promoting Neorhizobium huautlense T1–17 and biochar. Agric. Ecosyst. Environ. 2016;228:9–18. doi: 10.1016/j.agee.2016.05.006. [DOI] [Google Scholar]
- 22.Chandra, D., Barh, A. & Sharma, I. P. Plant growth promoting bacteria: A gateway to sustainable agriculture. In: Microbial Biotechnology in Environmental Monitoring and Cleanup, IGI Global, 318–338 (2018).
- 23.Gupta P, Kumar V, Usmani Z, Rani R, Chandra A. Phosphate solubilization and chromium (VI) remediation potential of Klebsiella sp. strain CPSB4 isolated from the chromium contaminated agricultural soil. Chemosphere. 2018;192:318–327. doi: 10.1016/j.chemosphere.2017.10.164. [DOI] [PubMed] [Google Scholar]
- 24.Ogo Y, et al. Spatial transcriptomes of iron‐deficient and cadmium‐stressed rice. New Phytol. 2014;201(3):781–794. doi: 10.1111/nph.12577. [DOI] [PubMed] [Google Scholar]
- 25.Burd GI, Dixon DG, Glick BR. A plant growth promoting bacterium that decreases nickel toxicity in plant seedlings. Appl. Environ. Microbiol. 1998;64:3663–3668. doi: 10.1128/aem.64.10.3663-3668.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Thiem D, et al. Cadmium‐induced changes in the production of siderophores by a plant growth promoting strain of Pseudomonas fulva. J. Basic Microbiol. 2018;18:1800034. doi: 10.1002/jobm.201800034. [DOI] [PubMed] [Google Scholar]
- 27.Khaksar G, Treesubsuntorn C, Thiravetyan P. Effect of endophytic Bacillus cereus ERBP inoculation into non-native host: potentials and challenges for airborne formaldehyde removal. Plant Physiol. Biochem. 2016;107:326–336. doi: 10.1016/j.plaphy.2016.06.020. [DOI] [PubMed] [Google Scholar]
- 28.Suksabye P, Pimthong A, Dhurakit P, Mekvichitsaeng P, Thiravetyan P. Effect of biochars and microorganisms on cadmium accumulation in rice grains grown in Cd-contaminated soil. Environ. Sci. Pollut. Res. 2016;23(2):962–973. doi: 10.1007/s11356-015-4590-8. [DOI] [PubMed] [Google Scholar]
- 29.Guo J, et al. Effects of inoculation of a plant growth promoting rhizobacterium Burkholderia sp. D54 on plant growth and metal uptake by a hyperaccumulator Sedum alfredii Hance grown on multiple metal contaminated soil. World J. Microbiol. Biotechnol. 2011;27(12):2835–2844. doi: 10.1007/s11274-011-0762-y. [DOI] [Google Scholar]
- 30.Dong MF, et al. Inoculation of Fe/Mn-oxidizing bacteria enhances Fe/Mn plaque formation and reduces Cd and As accumulation in Rice Plant tissues. Plant Soil. 2016;404(1–2):75–83. doi: 10.1007/s11104-016-2829-x. [DOI] [Google Scholar]
- 31.Kalaji HM, et al. Identification of nutrient deficiency in maize and tomato plants by in vivo chlorophyll a fluorescence measurements. Plant Physiol. Biochem. 2014;81:16–25. doi: 10.1016/j.plaphy.2014.03.029. [DOI] [PubMed] [Google Scholar]
- 32.Sharma P, Dubey RS. Modulation of nitrate reductase activity in rice seedlings under aluminium toxicity and water stress: role of osmolytes as enzyme protectant. J. Plant Physiol. 2005;162(8):854–864. doi: 10.1016/j.jplph.2004.09.011. [DOI] [PubMed] [Google Scholar]
- 33.Dutta P, Karmakar A, Majumdar S, Roy S. Klebsiella pneumoniae (HR1) assisted alleviation of Cd (II) toxicity in Vigna mungo: a case study of biosorption of heavy metal by an endophytic bacterium coupled with plant growth promotion. Eur. Med. J. Environ. Integ. 2018;3(1):27. doi: 10.1007/s41207-018-0069-6. [DOI] [Google Scholar]
- 34.Ahmad P, et al. Alleviation of cadmium toxicity in Brassica juncea L. (Czern. & Coss.) by calcium application involves various physiological and biochemical strategies. PloS one. 2015;10(1):e0114571. doi: 10.1371/journal.pone.0114571. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Rizvi A, Khan MS. Heavy metal induced oxidative damage and root morphology alterations of maize (Zea mays L.) plants and stress mitigation by metal tolerant nitrogen fixing Azotobacter chroococcum. Ecotoxicol. Environ. Saf. 2018;157:9–20. doi: 10.1016/j.ecoenv.2018.03.063. [DOI] [PubMed] [Google Scholar]
- 36.Awasthi S, et al. A consortium of alga (Chlorella vulgaris) and bacterium (Pseudomonas putida) for amelioration of arsenic toxicity in rice: A promising and feasible approach. Environ. Exp. Bot. 2018;150:115–126. doi: 10.1016/j.envexpbot.2018.03.001. [DOI] [Google Scholar]
- 37.Das A, Osborne JW. Monitoring the stress resistance of Pennisetum purpureum in Pb (II) contaminated soil bioaugmented with Enterobacter cloacae as defence strategy. Chemosphere. 2018;210:495–502. doi: 10.1016/j.chemosphere.2018.07.050. [DOI] [PubMed] [Google Scholar]
- 38.Andresen, E. & Küpper, H. Cadmium toxicity in plants. In Cadmium: from toxicity to essentiality 395–413, Springer, Dordrecht (2013). [DOI] [PubMed]
- 39.Ahemad M, Kibret M. Mechanisms and applications of plant growth promoting rhizobacteria: current perspective. J. King Saud Univ. Sci. 2014;26(1):1–20. doi: 10.1016/j.jksus.2013.05.001. [DOI] [Google Scholar]
- 40.Liu L, et al. Effects of arbuscular mycorrhizal inoculation and biochar amendment on maize growth, cadmium uptake and soil cadmium speciation in Cd-contaminated soil. Chemosphere. 2018;194:495–503. doi: 10.1016/j.chemosphere.2017.12.025. [DOI] [PubMed] [Google Scholar]
- 41.Kang SM, et al. Enterobacter asburiae KE 17 association regulates physiological changes and mitigates the toxic effects of heavy metals in soybean. Plant Biol. 2015;17(5):1013–1022. doi: 10.1111/plb.12341. [DOI] [PubMed] [Google Scholar]
- 42.Verma K, Shekhawat GS, Sharma A, Mehta SK, Sharma V. Cadmium induced oxidative stress and changes in soluble and ionically bound cell wall peroxidase activities in roots of seedling and 3–4 leaf stage plants of Brassica juncea (L.) czern. Plant Cell Rep. 2008;27(7):1261–1269. doi: 10.1007/s00299-008-0552-7. [DOI] [PubMed] [Google Scholar]
- 43.Qadir, S. et al. Modulation of plant growth and metabolism in cadmium-enriched environments. Rev. Environ. Contam. Toxicol. 51–88, Springer, Cham (2014). [DOI] [PubMed]
- 44.Chen, X., Wang, J., Shi, Y., Zhao, M. Q. & Chi, G. Y. Effects of cadmium on growth and photosynthetic activities in pakchoi and mustard. Bot. Stud. 52(1) (2011).
- 45.Rasouli-Sadaghiani, M. H. et al. Arbuscular Mycorrhizal Fungi and Rhizobacteria Promote Growth of Russian Knapweed (Acroptilon repens L.) in a Cd-Contaminated Soil. J. Plant Growth Regul. 1–9 (2018).
- 46.Kamran MA, Syed JH, Eqani SAMAS, Munis MFH, Chaudhary HJ. Effect of plant growth-promoting rhizobacteria inoculation on cadmium (Cd) uptake by Eruca sativa. Environ. Sci. Pollut. Res. 2015;22(12):9275–9283. doi: 10.1007/s11356-015-4074-x. [DOI] [PubMed] [Google Scholar]
- 47.Mitra S, et al. Bioaccumulation of cadmium by Enterobacter sp. and enhancement of rice seedling growth under cadmium stress. Ecotoxicol. Environ. Saf. 2018;156:183–196. doi: 10.1016/j.ecoenv.2018.03.001. [DOI] [PubMed] [Google Scholar]
- 48.Treesubsuntorn C, Dhurakit P, Khaksar G, Thiravetyan P. Effect of microorganisms on reducing cadmium uptake and toxicity in rice (Oryza sativa L.) Environ. Sci. Pollut. Res. 2018;25(26):25690–25701. doi: 10.1007/s11356-017-9058-6. [DOI] [PubMed] [Google Scholar]
- 49.Tripathi P, et al. Arsenic tolerant Trichoderma sp. reduces arsenic induced stress in chickpea (Cicer arietinum) Environ. Pollut. 2017;223:137–145. doi: 10.1016/j.envpol.2016.12.073. [DOI] [PubMed] [Google Scholar]
- 50.Wan Y, et al. Effect of endophyte-infection on growth parameters and Cd-induced phytotoxicity of Cd-hyperaccumulator Solanum nigrum L. Chemosphere. 2012;89(6):743–750. doi: 10.1016/j.chemosphere.2012.07.005. [DOI] [PubMed] [Google Scholar]
- 51.Otieno N, et al. Plant growth promotion induced by phosphate solubilizing endophytic Pseudomonas isolates. Frontiers in Microbiol. 2015;6:745. doi: 10.3389/fmicb.2015.00745. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Roychowdhury, R., Qaiser, T. F., Mukherjee, P. & Roy, M. Isolation and Characterization of a Pseudomonas aeruginosa Strain PGP for Plant Growth Promotion. Proc Natl Acad Sci India Sect B: Biol Sci. 1–8 (2017).
- 53.Linu MS, Stephen J, Jisha MS. Phosphate solubilizing Gluconacetobacter sp., Burkholderia sp. and their potential interaction with cowpea (Vigna unguiculata (L.) Walp.) Int. J. Agric. Res. 2009;4(2):79–87. doi: 10.3923/ijar.2009.79.87. [DOI] [Google Scholar]
- 54.Prapagdee B, Khonsue N. Bacterial-assisted cadmium phytoremediation by Ocimum gratissimum L. in polluted agricultural soil: a field trial experiment. Int. J. Environ. Sci. Technol. 2015;12(12):3843–3852. doi: 10.1007/s13762-015-0816-z. [DOI] [Google Scholar]
- 55.Moreira H, Pereira SI, Marques AP, Rangel AO, Castro PM. Selection of metal resistant plant growth promoting rhizobacteria for the growth and metal accumulation of energy maize in a mine soil—Effect of the inoculum size. Geoderma. 2016;278:1–11. doi: 10.1016/j.geoderma.2016.05.003. [DOI] [Google Scholar]
- 56.Pramanik K, Mitra S, Sarkar A, Soren T, Maiti TK. Characterization of cadmium-resistant Klebsiella pneumoniae MCC 3091 promoted rice seedling growth by alleviating phytotoxicity of cadmium. Environ. Sci. Pollut. Res. 2017;24(31):24419–24437. doi: 10.1007/s11356-017-0033-z. [DOI] [PubMed] [Google Scholar]
- 57.Rascio N, et al. Metal accumulation and damage in rice (cv. Vialone nano) seedlings exposed to cadmium. Environ. Exp. Bot. 2008;62(3):267–278. doi: 10.1016/j.envexpbot.2007.09.002. [DOI] [Google Scholar]
- 58.Amirjani M. Effects of cadmium on wheat growth and some physiological factors. Int. J. Forest, Soil and Erosion (IJFSE) 2012;2(1):50–58. [Google Scholar]
- 59.Wahid A, Ghani A, Javed F. Effect of cadmium on photosynthesis, nutrition and growth of mung bean. Agron. Sustain. Dev. 2008;28(2):273–280. doi: 10.1051/agro:2008010. [DOI] [Google Scholar]
- 60.Hashem HA. Cadmium toxicity induces lipid peroxidation and alters cytokinin content and antioxidant enzyme activities in soybean. Botany. 2013;92(1):1–7. doi: 10.1139/cjb-2013-0164. [DOI] [Google Scholar]
- 61.Harpaz-Saad S, et al. Chlorophyllase is a rate-limiting enzyme in chlorophyll catabolism and is post translationally regulated. Plant Cell. 2007;19(3):1007–1022. doi: 10.1105/tpc.107.050633. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 62.Mohamed AA, Castagna A, Ranieri A, di Toppi LS. Cadmium tolerance in Brassica juncea roots and shoots is affected by antioxidant status and phytochelatin biosynthesis. Plant Physiol. Biochem. 2012;57:15–22. doi: 10.1016/j.plaphy.2012.05.002. [DOI] [PubMed] [Google Scholar]
- 63.Huang GY, Wang YS. Physiological and biochemical responses in the leaves of two mangrove plant seedlings (Kandelia candel and Bruguiera gymnorrhiza) exposed to multiple heavy metals. J. hazard. Mater. 2010;182(1–3):848–854. doi: 10.1016/j.jhazmat.2010.06.121. [DOI] [PubMed] [Google Scholar]
- 64.Tanaka A, et al. Chlorophyll a oxygenase (CAO) is involved in chlorophyll b formation from chlorophyll a. Proc. Natl. Acad. Sci. USA. 1998;95(12):719–12 723. doi: 10.1073/pnas.95.21.12719. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 65.Rani A, Shouche YS, Goel R. Declination of copper toxicity in pigeon pea and soil system by growth-promoting Proteus vulgaris KNP3 strain. Curr. Microbiol. 2008;57(1):78. doi: 10.1007/s00284-008-9156-2. [DOI] [PubMed] [Google Scholar]
- 66.Haneef I, Faizan S, Perveen R, Kausar S. Impact of bio-fertilizers and different levels of cadmium on the growth, biochemical contents and lipid peroxidation of Plantago ovata Forsk. Saudi J. Biol. Sci. 2014;21(4):305–310. doi: 10.1016/j.sjbs.2013.12.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 67.Mahmood T, Islam KR, Muhammad S. Toxic effects of heavy metals on early growth and tolerance of cereal crops. Pakistan J. Bot. 2007;39(2):451. [Google Scholar]
- 68.Madhaiyan M, Poonguzhali S, Sa T. Metal tolerating methylotrophic bacteria reduces nickel and cadmium toxicity and promotes plant growth of tomato (Lycopersicon esculentum L.) Chemosphere. 2007;69(2):220–228. doi: 10.1016/j.chemosphere.2007.04.017. [DOI] [PubMed] [Google Scholar]
- 69.Han H, Wang Q, He LY, Sheng XF. Increased biomass and reduced rapeseed Cd accumulation of oilseed rape in the presence of Cd-immobilizing and polyamine-producing bacteria. J. hazard. Mater. 2018;353:280–289. doi: 10.1016/j.jhazmat.2018.04.024. [DOI] [PubMed] [Google Scholar]
- 70.Ghani A, Shah AU, Akhtar U. Effect of lead toxicity on growth, chlorophyll and lead (Pb^) Pakistan J. Nutr. 2010;9(9):887–891 9. doi: 10.3923/pjn.2010.887.891. [DOI] [Google Scholar]
- 71.Pandey N, Bhatt R. Role of soil associated Exiguobacterium in reducing arsenic toxicity and promoting plant growth in Vigna radiata. Eur. J. Soil Biol. 2016;75:142–150. doi: 10.1016/j.ejsobi.2016.05.007. [DOI] [Google Scholar]
- 72.Das J, Sarkar P. Remediation of arsenic in mung bean (Vigna radiata) with growth enhancement by unique arsenic-resistant bacterium Acinetobacter lwoffii. Sci. Total Environ. 2018;624:1106–1118. doi: 10.1016/j.scitotenv.2017.12.157. [DOI] [PubMed] [Google Scholar]
- 73.Gu CS, et al. De novo characterization of the Iris lactea var. chinensis transcriptome and an analysis of genes under cadmium or lead exposure. Ecotoxicol. Environ. Saf. 2017;144:507–513. doi: 10.1016/j.ecoenv.2017.06.071. [DOI] [PubMed] [Google Scholar]
- 74.Clemens S. Toxic metal accumulation, responses to exposure and mechanisms of tolerance in plants. Biochimie. 2006;88(11):1707–1719. doi: 10.1016/j.biochi.2006.07.003. [DOI] [PubMed] [Google Scholar]
- 75.Chen Y, et al. Heterologous expression of Pteris vittata arsenite antiporter PvACR3; 1 reduces arsenic accumulation in plant shoots. Environ. Sci. & Technol. 2017;51(18):10387–10395. doi: 10.1021/acs.est.7b03369. [DOI] [PubMed] [Google Scholar]
- 76.Nesler A, et al. Functional components of the bacterial CzcCBA efflux system reduce cadmium uptake and accumulation in transgenic tobacco plants. New biotechnol. 2017;35:54–61. doi: 10.1016/j.nbt.2016.11.006. [DOI] [PubMed] [Google Scholar]
- 77.Manzoor M, et al. Metal tolerance of arsenic-resistant bacteria and their ability to promote plant growth of Pteris vittata in Pb-contaminated soil. Sci. Tot. Environ. 2019;660:18–24. doi: 10.1016/j.scitotenv.2019.01.013. [DOI] [PubMed] [Google Scholar]
- 78.Roosa S, et al. Bacterial metal resistance genes and metal bioavailability in contaminated sediments. Environ. Pollut. 2014;189:143–151. doi: 10.1016/j.envpol.2014.02.031. [DOI] [PubMed] [Google Scholar]
- 79.Aly AA, Mohamed AA. The impact of copper ion on growth, thiol compounds and lipid peroxidation in two maize cultivars (‘Zea mays’ L.) grown ‘in vitro’. Aus. J. Crop Sci. 2012;6(3):541. [Google Scholar]
- 80.Nagalakshmi N, Prasad MNV. Responses of glutathione cycle enzymes and glutathione metabolism to copper stress in Scenedesmus bijugatus. Plant Sci. 2001;160(2):291–299. doi: 10.1016/S0168-9452(00)00392-7. [DOI] [PubMed] [Google Scholar]
- 81.Awasthi S, Chauhan R, Srivastava S, Tripathi RD. The journey of arsenic from soil to grain in rice. Front. Plant Sci. 2017;8:1007. doi: 10.3389/fpls.2017.01007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 82.Balint AF, Kovács G, Sutka J. Copper tolerance of Aegilops, Triticum, Secale and triticale seedlings and copper and iron contents in their shoots. Acta Biol. Szeged. 2002;46:77–78. [Google Scholar]
- 83.Allen, S. E., Grimshaw, H. M. & Rowland, A. P. Chemical analysis. In: Chapman, S. B. (Ed.), Methods in Plant Ecology. Blackwell Scientific Publications, Oxford – London 335–335 (1976).
- 84.Arnon DT. Copper enzymes in isolated chloroplast polyphenol oxidase in Beta vulgaris. Plant Physiol. 1949;24:1–15. doi: 10.1104/pp.24.1.1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 85.Maclachlan C, Zalik S. Plastid structure, chlorophyll concentration and free amino acid composition of a 10 chlorophyll mutant of barley. Can. J. Bot. 1963;41:1053–1062. doi: 10.1139/b63-088. [DOI] [Google Scholar]
- 86.Lawrence. J. Determination of total xanthophyll and marigold oleoresin. J. AOAC Int. 1990;2:970–975. [Google Scholar]
- 87.Sedlak J, Lindsay RH. Estimation of total, protein bound, and nonprotein sulfhydryl groups in tissue with Ellman’s reagent. Anal Biochem. 1968;25:192–205. doi: 10.1016/0003-2697(68)90092-4. [DOI] [PubMed] [Google Scholar]
- 88.Del Longo OT, Gonzalez CA, Pastori GM, Trippi VS. Antioxidant defences under hyperoxygenic and hyperosmotic conditions in leaves of two lines of maize with differential sensitivity to drought. Plant Cell Physiol. 1993;34:1023–1028. [Google Scholar]
- 89.Awasthi P, et al. Cloning and expression analysis of chalcone synthase gene from Coleus forskohlii. J. Genet. 2016;95(3):647–57. doi: 10.1007/s12041-016-0680-8. [DOI] [PubMed] [Google Scholar]
- 90.Rather IA, et al. Molecular cloning and functional characterization of an antifungal PR-5 protein from Ocimum basilicum. Gene. 2015;558:143–151. doi: 10.1016/j.gene.2014.12.055. [DOI] [PubMed] [Google Scholar]
- 91.Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
- 92.Awasthi P, et al. Plant omics: isolation, identification, and expression analysis of cytochrome P450 gene sequences from Coleus forskohlii. OMICS. 2015;19:782–792. doi: 10.1089/omi.2015.0148. [DOI] [PubMed] [Google Scholar]