Intestinal electrogenic sodium-dependent glucose absorption in tilapia and trout reveal species differences in SLC5A-associated kinetic segmental segregation

Abstract

Electrogenic sodium-dependent glucose transport along the length of the intestine was compared between the omnivorous Nile tilapia (Oreochromis niloticus) and the carnivorous rainbow trout (Oncorhynchus mykiss) in Ussing chambers. In tilapia, a high-affinity, high-capacity kinetic system accounted for the transport throughout the proximal intestine, midintestine, and hindgut segments. Similar dapagliflozin and phloridzin dihydrate inhibition across all segments support this homogenous high-affinity, high-capacity system throughout the tilapia intestine. Genomic and gene expression analysis supported findings by identifying 10 of the known 12 SLC5A family members, with homogeneous expression throughout the segments with dominant expression of sodium-glucose cotransporter 1 (SGLT1; SLC5A1) and sodium-myoinositol cotransporter 2 (SMIT2; SLC5A11). In contrast, trout’s electrogenic sodium-dependent glucose absorption was 20–35 times lower and segregated into three significantly different kinetic systems found in different anatomical segments: a high-affinity, low-capacity system in the pyloric ceca; a super-high-affinity, low-capacity system in the midgut; and a low-affinity, low-capacity system in the hindgut. Genomic and gene expression analysis found 5 of the known 12 SLC5A family members with dominant expression of SGLT1 (SLC5A1), sodium-glucose cotransporter 2 (SGLT2; SLC5A2), and SMIT2 (SLC5A11) in the pyloric ceca, and only SGLT1 (SLC5A1) in the midgut, accounting for differences in kinetics between the two. The hindgut presented a low-affinity, low-capacity system partially attributed to a decrease in SGLT1 (SLC5A1). Overall, the omnivorous tilapia had a higher electrogenic glucose absorption than the carnivorous trout, represented with different kinetic systems and a greater expression and number of SLC5A orthologs. Fish differ from mammals, having hindgut electrogenic glucose absorption and segment specific transport kinetics.

INTRODUCTION

Glucose is the major molecular constituent of carbohydrate digestion, entering the intestinal enterocytes via the apically located sodium-dependent glucose transporters (SGLTs) (1, 5, 10, 11, 32). These transporters are members of the SLC5A (solute carrier family member 5A) family, simultaneously transporting glucose and sodium, creating a measurable current during absorption (6, 9). The transporters exist in both omnivorous and carnivorous species and represent the first ports of entry for glucose into the intestine (23, 46, 50, 70).

Since their initial discovery, a total of 12 SLC5A isoforms have been identified in the omnivorous human genome and are expressed in various tissues (25, 84). Ten of these genes are sodium-coupled substrate transporters for solutes like glucose, myoinositol, and anions, whereas the other two genes have different coupling ions and functions (57, 84). The stoichiometry of this transport is dependent on the family member (57, 62). Generally, the SGLTs are characterized kinetically in two categories. First is a high-affinity (H_a) transporter, with sensitivity to low concentrations of glucose and low-capacity (L_c), saturating at low concentrations of glucose (17, 21a, 32, 35, 57, 62). Second is a low-affinity (L_a) transporter with sensitivity to glucose at higher concentrations and high-capacity (H_c) transporter, saturating at high concentrations of glucose (17, 21a, 32, 35, 57, 62). This classification developed due to the initial difference in kinetics between the first SGLTs discovered (1, 17, 32, 34, 45, 82, 89). The SGLT isoform 1 (SLC5A1) transporter demonstrated a H_a/L_c transport, and sodium-glucose cotransporter 2 (SGLT2; SLC5A2) exhibited L_a/H_c transport (1, 6, 32, 42, 51). Physiological studies identifying two transport systems supported the existence of both a H_a/L_c and L_a/H_c for glucose in the intestine of both omnivorous and carnivorous mammals, including cat, rat, pig, human, and cattle (5, 9, 21a, 36, 45, 49, 89). Only a few of these studies have segregated the H_a/L_c to the proximal small intestine in omnivores and carnivores, but gene association is minimal or lacking (32, 34, 62). However, defining specific physiological attributes to members of the SLC5A family has been challenging due to a previous lack of genomic information, substrate promiscuity, species differences, and tissue-specific regulation (34, 60). In fish, this is particularly true, with the identification of SGLTs being minimal and their functions mostly presumed from sequence identity with mammalian SGLTs, despite sequence differences (1, 61, 91).

Studies comparing intestinal glucose absorption kinetics and association with SLC5A gene family between omnivores and carnivores are lacking in mammalian literature and unknown in fish, despite the generally accepted notion that omnivores can absorb larger amounts of glucose than carnivores (8, 13, 16, 18, 21, 35, 77). This gap in the literature is particularly salient in fish, which have a lower importance for carbohydrates in their natural diet, but have known differences between omnivorous and carnivorous utilization of glucose (71). Here, using ex vivo intestinal segments mounted in Ussing chambers, we measured the sodium-coupled electrogenic absorption of glucose along the gastrointestinal tract of omnivorous Nile tilapia (Oreochromis niloticus) and carnivorous rainbow trout (Oncorhynchus mykiss). Differences and absences of intestinal segmental kinetic segregation and pharmacological inhibition were successfully compared with expression of specific SLC5A family members with previously described functions, some supporting known glucose absorption. Tilapia demonstrated similar kinetics throughout all of its intestinal segments, which was defined as a one-kinetic homogeneous system. Specifically, tilapia has a single H_a/H_c sodium-dependent glucose transport system along the entirety of its intestinal tract. In contrast, trout demonstrated different transport kinetics in the pyloric ceca, midgut, and hindgut intestinal segments. This was defined as a three-kinetic heterogeneous system, with a H_a/L_c, sH_a/L_c, and L_a/L_c transport occurring in the pyloric ceca, midgut, and hindgut, respectively. Overall, the data presented here define a H_c one-kinetic homogenous system in tilapia, and a L_c three-kinetic heterogeneous system of sodium-dependent glucose transport in trout, supported by SLC5A gene expression.

MATERIALS AND METHODS

Maintenance of Animals

All fish were maintained in accordance with the guidelines of the Canadian Council on Animal Care (2005) (15). All animal protocols were approved by the Animal Care Committee at the University of Saskatchewan (AUP no. 19980142).

Nile tilapia.

Nile tilapia were obtained from AmeriCulture (Animas, NM) as fingerlings. They were housed in 360-liter tanks filtered via a biological filtration system. Photoperiod was kept constant at 14:10-h light-dark cycle, and the water temperature was maintained at 27 ± 2°C. Fish were fed a standard ration of commercial feed by hand twice per day to visual satiety. The average weight of fish at the time of study was 500 g.

Rainbow trout.

Female rainbow trout were obtained as wild-type, fertilized eggs from Trout Lodge (Sumner, WA). After hatching, the fish were reared in standard 1,000- to 4,000-liter density tanks, provided with biologically filtered recirculation systems until 2 yr of age, when used for this study. They were housed in municipal, dechlorinated water at temperatures between 11 ± 2°C, with a photoperiod at 12:12-h light-dark cycle. They were fed a standard ration of commercial feed at 2–5% of their body weight. At the time of study, the average weight of fish used was 400 g.

Ex Vivo Tissue Collection

Fish were euthanized by blunt trauma, and the entire intestinal section was dissected out of both fish. In Nile tilapia, the intestine was much longer than that of the trout, and it contained no pyloric ceca. Its intestinal section was separated as proximal intestine (2 in. distal from the stomach), midintestine (5 in. distal from the stomach), and hindgut (5–6 in. distal from the stomach). In rainbow trout, the intestine was separated according to the pyloric ceca region (located directly distal to the stomach), midgut (located right after the pyloric ceca, 2 in. from the stomach), and hindgut (5–6 in. from the stomach). The pyloric ceca is visually distinct from the midgut section. Similarly, the hindgut is visually distinct from the midgut, and it was represented as a thicker, larger diameter tissue, darker in pigment, along with visual differences in musculature (14).

Electrophysiology

Ussing Chamber technique.

The fish intestinal sections were examined in Ussing chambers using techniques adapted from this group (58, 59, 73, 80). The Ussing chamber system used in this study was an EasyMount Ussing Chamber System (Physiologic Instruments, San Diego, CA). Sections were washed in teleost saline (in mM): 118 NaCl, 2.9 KCl, 2.0 CaCl₂·2H₂O, 1.0 MgSO₄·7H₂O, 0.1 NaH₂PO₄·H₂O, 2.5 Na₂HPO₄, and 1.9 NaHCO₃ at pH 7.9 (78). This physiological buffer was used for both tilapia and trout. No glucose was added to the buffer. The lumen of the intestine for both fish was also washed with buffer using an 18-gauge needle, to clean the luminal membrane of any residual chyme.

The dissected tissue sections were exposed as a flat sheet between two sliders of inserts (slider no. P2304, Physiologic Instruments). The available tissue area for tilapia and trout was constant and equal to 0.3 cm². The teleost saline buffer solutions bathing the apical and basal sides of the intestine had a buffer volume of 5 ml and were continuously gassed throughout the experiment with 1% CO₂ and 99% O₂ for the fish (19).

The transepithelial voltage and passing current set across the tissue was measured via agar bridges and Ag/AgCl reference electrodes. These electrodes were connected to leads that lead to the voltage/current clamp. The short-circuit current was measured by the computer (in µA), and this was a result of the tissue current opposing the current induced by the electrodes. The pulse was kept constant at 0.001 V. A recirculating bath capable of chilling and heating controlled the temperature of the jacketed chambers, with tissues examined at fish housing temperatures. The temperature used for tilapia was between 25 and 26°C and for trout was between 11 and 12°C. Needle valves were also present for the adjustment of gas flow into the chambers.

Once mounted, the tissue was allowed to reach a steady baseline current for 30–40 min before 1 mM increments of glucose were added to the apical side and the short-circuit current were measured in microamperes. An equivalent amount of d-mannitol was added to the basal side to prevent the development of osmotic gradients from the addition of glucose. Also, mannitol would not be transported across the epithelium, which presents no interference with the measurement of glucose transport. Before each addition of glucose and mannitol, a wait period of 3–4 min was allowed for equilibration of the current.

Chemicals.

Dapagliflozin is a competitive inhibitor of glucose for mammalian SGLT2 (L_a/H_c) transporters, with EC₅₀ values around 1.12 nM for human SGLT2 (17, 39, 51). Phloridzin dihydrate is a competitive inhibitor against mammalian sodium-glucose cotransporter 1 (SGLT1) (H_a/L_c) transporters, with a K_i around 1 µM for renal and intestinal sodium-glucose cotransporters (1, 79, 86). For pharmacological characterization, 0.001, 0.01, 0.1, 1, 10, 100, 200, and 300 µM of dapagliflozin, and 1, 10, and 100 µM of phloridzin dihydrate (AdooQ Bioscience, Irvine, CA) were used in sequential order in the Ussing chamber as final concentrations. The inhibitors were added after each tissue segment reached a final glucose and mannitol concentration of 50 mM. For tilapia, dose responses of dapagliflozin, followed by phloridzin dihydrate addition were performed. Additionally, a dose response of phloridzin dihydrate by itself was conducted in tilapia after final glucose and mannitol concentrations of 50 mM was reached. In trout, dose responses of dapagliflozin followed by phloridzin dihydrate were used.

RNA extraction and cDNA synthesis using RT-PCR.

Approximately 1-mg samples of tissue were obtained from the dissection of the intestinal tract, and stored in RNAlater RNA Stabilization Solution at −80°C. RNA was isolated using the TRIzol reagent, and cDNA was synthesized through reverse transcription PCR using the qScript cDNA SuperMix (Quanta Biosciences). The reaction was run as incubation for 5 min at 25°C, then 30 min at 42°C, and the final 5 min at 85°C. The cDNA samples were stored at −80°C for subsequent use in quantitative PCR (qPCR).

Genomic identification of SLC5A genes.

A detailed BLAST+ (Basic Local Alignment Search Tool) application was used to identify all of the annotated SLC5A transporters in both tilapia and trout. The 12 human SLC5A transporter sequences retrieved from the National Center for Biotechnology Information website (https://www.ncbi.nlm.nih.gov/) were used in a “blastn” command to search for similar mRNA sequences in the tilapia and trout genome (90). The expect value (e-value) was used to assess the significance of the match, where an e-value close to 0 was considered significant and an e-value higher than 10⁻¹⁵ was considered as a nonsignificant match. Once SLC5A transporters were identified from tilapia and trout, phylogenetic trees were generated using the alignment program CLUSTAL W and MEGA7 (https://www.megasoftware.net/) software.

Gene transcript expression levels by quantitative polymerase chain reaction.

qPCR was performed on the RT-PCR reaction using the GoTaq qPCR Master Mix containing SYBRGreen1 (Promega, Madison, WI). The Bio-Rad qPCR system was used to perform these reactions. The total volume of the PCR reaction was 12.5 µl. A total of 40 cycles of qPCR were performed, with each cycle consisting of GoTaq Hot Start Polymerase activation at 95°C for 2 min, and then denaturation at 95°C for 15 s, followed by annealing/extension at the primer’s hybridization temperature (59°C) for 1 min. The dissociation step was at 60–95°C. Serial dilutions of cDNA were also used to generate a standard curve for each target gene, where the efficiency of each primer was calculated. The efficiencies for the tilapia primers ranged from 1.9 to 2.1, and similar range of efficiencies was determined for trout primers as well. EFα1 (α-elongation factor 1) was the housekeeping gene, and it was used to normalize the relative expression levels in tilapia and trout. The method of analysis used to represent the relative expression levels was calculated using ΔCT, where the amount of the gene of interest was normalized to the amount of EFα1 in that sample (75).

The primers for tilapia and trout SLC5A genes and EFα1 were designed using the Integrated DNA Technologies website (https://www.idtdna.com/pages), where the sequences and their accession numbers are presented in Tables 1 and 2, respectively.

Table 1.

Tilapia primer sequences used for quantitative PCR

Gene	Forward Primer (5′–3′)	Reverse Primer (5′–3′)	Accession No.
SGLT1	CCCGAGTACTTGAAGAAGAG	GCAATAACAGCGAGGTAGA	XM_019361130.1
SGLT2	AGGAGGATGAGGGAGAATAA	ACACTGGGTCCTCACTAA	XM_013273846.2
SMIT1	CAACGCCAAGTACAGAAAC	CTCTGCGATTCTCCCTTATAG	XM_019353114.1
SGLT4	ATGGTGGTTGGAATCTGG	GTCCCTGCTAGACCAATAAA	XM_005475685.3
NIS	TCCATGTCCTACCTCTACTT	GACCCTCCACTTTCTTCTT	XM_005453978.3
SMCT1	TCAGTGTTGAGTGAGAAGG	AGAGCGAACACCACATAG	XM_013271289.2
SGLT5	CACCGTGGACTCTGATTT	TACATCTGCGTGTGAAGAG	XM_003455975.4
SMIT2	GAGACGGAAGAAGGAAGATG	GCCCAGTAACCAATGATAAAG	XM_005461087.3
SMIT	GCTGTCTGTGGATCTCTATT	GAACTGTGTCCGTGTAGAT	XM_019352280.1
SMVT	CAGGAGGAATAGCAGAAGTC	CTTGGTTCACACCGTACA	XM_005460242.3
EFα1	CTCTTCTACCGTCGGATTAC	ATTGACTCCCTCGTAGAAAC	XM_005476483.3

EFα1, α-elongation factor 1; NIS, sodium-iodide cotransporter; SGLT1, SGLT2, SGLT4, SGLT5, sodium-glucose cotransporters 1, 2, 4, and 5, respectively; SMCT1, sodium-monocarboxylate cotransporter 1; SMIT, SMIT1, SMIT2, sodium-myoinositol cotransporter and cotransporters 1 and 2, respectively; SMVT, sodium-multivitamin cotransporter.

Table 2.

Trout primer sequences used for quantitative PCR

Gene	Forward Primer (5′–3′)	Reverse Primer (5′–3′)	Accession No.
SGLT1	CTAAGTGTCACGGCTCTATAC	GCGTCTGGAAGTTCTCATAA	XM_021591066.1
SGLT2	ATTGGTAGTGGTCACTTTGT	AAACAGCCAGCCCAATAG	NM_001124432
SGLT4	GTGCTGGTGTTTGTGTATG	AGATGGTGCTCTGGAATG	XM_021604024.1
NIS	GGCTTGTGTCTCGTTGTA	TGTCCAGCACCAAGTATG	XM_021573060.1
SMIT2	CAAGATCCTGCCCTTCTT	GTAGCTTCATGACCAGTTTG	XM_021592865.1
SMVT	ATCTTACCAGCGCTTACC	CCCATAGATCAAAGCCAGTA	XM_021573745.1
EFα1	AGCGAGCTCAAGAAGAAG	GACCAAGAGGAGGGTATTC	NM_001124339.1

EFα1, α-elongation factor 1; NIS, sodium-iodide cotransporter; SGLT1, SGLT2, SGLT4, sodium-glucose cotransporters 1, 2, and 4, respectively; SMIT2, sodium-myoinositol cotransporter 2; SMVT, sodium-multivitamin cotransporter.

Statistical analyses.

Maximal velocity (V_max; represented in µA/cm²) and Michaelis-Menten contant (K_m; represented in mM) values were determined for each intestinal section in each species using GraphPad Prism 8 (GraphPad Software) (44, 53, 64, 66). Here, the K_m values for both fish species represent the concentration at 50% maximum rate of the transporter, and the assumption is made that the rate of transport (catalysis) and rate of binding are similar. Tilapia intestinal segments followed Sigmoidal kinetics, whereas trout pyloric ceca and midgut followed Michaelis-Menten kinetics, and the kinetics in trout hindgut fit Sigmoidal Hill kinetics (F-test, P < 0.05, Figs. 1 and 4). The equations used for the Sigmoidal Hill kinetics and Michaelis-Menten fits were the following:

Fig. 1.

Sigmoidal Hill kinetics for sodium-dependent and sodium-independent electrogenic glucose transport for tilapia in proximal intestine (A), illustrated with representative trace on the right side (B) (sodium-dependent fish: n = 26; sodium-independent fish: n = 7); midintestine (C), illustrated with representative trace on the right side (D) (sodium-dependent fish: n = 30; sodium-independent fish: n = 6); and hindgut (E), illustrated with representative trace on the right side (F) (sodium-dependent fish: n = 31; sodium-independent fish: n = 6). The maximal velocity (V_max) and Michaelis-Menten constant (K_m) are represented in the proximal intestine (A) for illustration. Values are means ± SE. I_sc, short-circuit current.

Fig. 4.

Michaelis-Menten and Sigmoidal Hill kinetics for sodium-dependent and sodium-independent electrogenic glucose transport for trout in pyloric ceca (A), illustrated with representative trace on the right side (B) (sodium-dependent fish: n = 12; sodium-independent fish: n = 5); midgut (C), illustrated with representative trace on the right side (D) (sodium-dependent fish: n = 18; sodium-independent fish: n = 4); and hindgut (E), illustrated with representative trace on the right side (F) (sodium-dependent fish: n = 24; sodium-independent fish: n = 4). The maximal velocity (V_max) and Michaelis-Menten constant (K_m) are represented in pyloric ceca (A) for illustration. Values are means ± SE. I_sc, short-circuit current.

$$\text{Sigmoidal\hspace{0.17em}Hill\hspace{0.17em}fit:\hspace{0.17em}}Y=V_{max}\times X^h/\left(K_{\text{d}}^h+X^h\right)$$

$$\text{Michaelis-Menten\hspace{0.17em}fit:\hspace{0.17em}}Y=V_{max}\times X/\left(K_{\text{m}}+X\right)$$

A one-way ANOVA was performed on the three intestinal sections of each species to determine whether the V_max and K_m values for each gut section was significantly different (92). All data met parametric assumptions, being normally distributed and exhibited homogeneity of variance, so ANOVA analyses were used (92). After ANOVA, pairwise comparisons were made using Tukey’s posteriori tests, as appropriate. A P < 0.05 was considered significantly different. To compare the V_max values between tilapia and trout, Student’s t-test was performed to confirm significance. For the inhibitor dapagliflozin, the percent activity remaining was calculated from the division of the 50 mM increment short-circuit current (the concentration where the transporter is 100% saturated and it is 100% uninhibited) and the resultant drop in current from the addition of each drug concentration. For phloridzin dihydrate, the percent activity remaining was calculated from the division of the 300 μM concentration of dapagliflozin (concentration where Ha/L_c transporter is uninhibited) and the resultant drop in current from the addition of the drug. Parametric two-way ANOVAs (two factors: intestinal sections and dosage of the drug) were performed on the three intestinal sections of each species and the dosages of each inhibitor to determine significance (92). The K_i values for the dapagliflozin response and the phloridzin dihydrate-only responses were calculated for tilapia using the “One-Site Fit logIC50” from GraphPad Prism 8 (GraphPad Software). This fit follows the equation: $Y=\text{bottom}+(\text{top}-\text{bottom})/\left[1+{10}^{X-LogI{C}_{50}}\right]$. Parametric one-way ANOVA was performed on the three intestinal sections to determine significance. For the qPCR analyses, fold differences were determined by the Bio-Rad system, where the threshold cycle was established using the housekeeping gene, EFα1. A two-way ANOVA (two factors: intestinal location and gene) was conducted on the gene expressions, followed by Tukey’s posteriori test for pairwise comparisons. All statistical analyses were performed on SigmaPlot (Systat).

RESULTS

Nile Tilapia

Ha/Hc electrogenic glucose absorption kinetics.

In tilapia, glucose gradients performed in an Ussing chamber measured short-circuit current and demonstrated electrogenic sodium-dependent glucose absorption that followed Sigmoidal Hill kinetics in all intestinal segments, with Hill coefficients > 1 (proximal intestine, midintestine, and hindgut). All three intestinal sections saturated around 30 mM glucose in tilapia (Fig. 1). Additionally, the calculated V_max and K_m values were consistent with that of a H_a/H_c system in all segments (Fig. 1 and Table 3). No statistically significant differences in V_max and K_m values were found among the different intestinal segments in tilapia (Table 3; V_max: P = 0.5, K_m: P = 0.4), demonstrating a single H_a/H_c system throughout the tilapia gastrointestinal tract. Generally, low K_m values around 4–6 mM and high V_max values around 47–60 µA/cm² were found throughout tilapia gut. Sodium dependency of glucose transport was confirmed by replacement of sodium with potassium, creating a sodium-free teleost saline Ussing chamber buffer, which eliminated the glucose-stimulated current (Fig. 1). Similarly, a sodium-free teleost saline using N-methyl-d-glucamine as a substitute for sodium was performed, which eliminated the glucose-stimulated current as well (data not shown).

Table 3.

V_max and K_m values for Nile tilapia and rainbow trout

Nile Tilapia			Rainbow Trout
Tilapia (Vmax)/Trout (Vmax), %	Tissue	Vmax, µA/cm2	Km, mM	Tissue	Vmax, µA/cm2	Km, mM
Proximal	47.0 ± 6.7	4.2 ± 0.7	Pyloric ceca	2.3 ± 0.4a,b	4.2 ± 1.0a	2,043d
Midintestine	59.6 ± 7.0	6.0 ± 1.0	Midgut	1.7 ± 0.3a	1.8 ± 0.3b	3,506d
Hindgut	56.2 ± 9.3	5.7 ± 1.1	Hindgut	2.4 ± 0.2b	12.3 ± 1.6c	2,342d

Values are means ± SE. Maximal velocity (V_max; µA/cm²) and Michaelis-Menten constant (K_m; mM) are represented for each tissue type in Nile tilapia and rainbow trout. Area of intestinal segment was 0.3 cm². There were no significant differences in V_max and K_m values between tissues for tilapia. In trout, significant differences between V_max values are as follows:

^apyloric ceca vs.

^bhindgut, and a midgut vs. ^bhindgut, with no significant differences between pyloric ceca and midgut (Tukey’s test after one-way ANOVA, P < 0.05). Significant differences between K_m values in trout are as follow: ^apyloric ceca vs. ^bmidgut, ^apyloric ceca vs.

^chindgut, and ^bmidgut vs. ^chindgut (Tukey’s test after one-way ANOVA, P < 0.05).

^dSignificant V_max values between tilapia and trout (Student’s t-test, P < 0.05).

Inhibition of H_a/H_c kinetics.

Dapagliflozin, a selective inhibitor for SGLT2 (SLC5A2) or L_a/H_c sodium-dependent glucose transport, and phloridzin dihydrate, an SGLT1 (SLC5A1) or H_a/L_c system inhibitor, were used to help decipher some of the kinetics (51, 28, 65). Fig. 2 illustrates the percent activity remaining in each intestinal tissue after the cumulative addition of increasing dosages of inhibitors dapagliflozin and then phloridzin, as well as phloridzin addition alone.

Fig. 2.

A: percent activity remaining of short-circuit current in Nile tilapia of dapagliflozin (0.001, 0.01, 0.1, 10, 100, 200, and 300 µM; i) (all tissues: n = 25), following addition of phloridzin dihydrate (1, 10, 100 µM; ii) (all tissues: n = 25) and phloridzin dihydrate (1, 10, 100 µM; iii) without previous addition of dapagliflozin (proximal: n = 22, midintestine: n = 18, and hindgut: n = 20) on intestinal tissues. B: representative traces for proximal tissue of dapagliflozin addition (i), phloridzin dihydrate addition following dapagliflozin (ii), and phloridzin dihydrate-only addition (iii). Values are means ± SE. *Significance from 100% transporter activity before inhibition, which is presented as the dashed line (two-way ANOVA, P < 0.05).

The three intestinal sections in tilapia were similarly inhibited by dapagliflozin in a dose-dependent manner (Fig. 2Ai, P > 0.5 for tissue differences), with ~50–60% activity remaining at a final 300 µM dose in all intestinal segments (Fig. 2Ai, P < 0.05 for inhibitor effect). The K_i (inhibition at 50%) values for the proximal intestine was 7.7 ± 1.5 µM, midintestine was 7.4 ± 1.7 µM, and the hindgut was 5.7 ± 1.6 µM. These values were not significantly different from each other (P = 0.6). No significant inhibition was found on addition of phloridzin dihydrate added sequentially after dapagliflozin (Fig. 2Aii, P > 0.5). However, addition phloridzin by itself resulted in significant inhibition (Fig. 2Aiii, P < 0.05 for inhibitor effect) at a final concentration of 100 µM, with ~60–80% activity remaining, again with no significant differences found between intestinal segments (Fig. 2Aiii, P > 0.5 for tissue differences). Additionally, the K_i values for the proximal intestine was 11.1 ± 0.002 µM, the midintestine was 11.6 ± 0.002 µM, and the hindgut was 7.6 ± 0.002 µM. The K_i values between the intestinal segments were not significantly different from each other (P = 0.4).

SLC5A gene profiling affirms kinetics.

To identify the genes responsible for the observed current, tilapia genomic analysis was performed, which found 10 of 12 known SLC5A family members. The SLC5A transporters identified were SGLT1 (SLC5A1), SGLT2 (SLC5A2), SMIT1 (SLC5A3, sodium-myoinositol cotransporter 1), SGLT4 (SLC5A9, sodium-glucose cotransporter 4), NIS (SLC5A5, sodium-iodide cotransporter), SMCT1 (SLC5A8, sodium-monocarboxylate cotransporter 1), SGLT5 (SLC5A10, sodium-glucose cotransporter 5), SMIT2 (SLC5A11, sodium-myoinositol cotransporter 2), SMIT (SLC5A3, sodium-myoinositol cotransporter), and SMVT (SLC5A6, sodium-multivitamin cotransporter) in the genome using the BLAST+ application (Table 1). The expression levels of each gene were then compared among the different tissues using quantitative real-time PCR.

All intestinal tissues in tilapia had similar gene profiling with no significant differences in expression from each other, supporting the similarity in physiological responses of the three segments (Fig. 3A, P > 0.5 for tissue differences). Overall, SGLT1 (SLC5A1) and SMIT2 (SLC5A11) expression were significantly higher than the expression of the other genes in all tissues (Fig. 3A, P < 0.001). The proximal intestine and hindgut had significantly higher SMIT2 (SLC5A11) expression than SGLT1 (SLC5A1) (Fig. 3A, P < 0.05 for transporter type within each tissue location), whereas the midintestine had statistically similar SGLT1 (SLC5A1) and SMIT2 (SLC5A11) expression (Fig. 3A, P > 0.5 for transporter type in midintestine). Sequence similarities in identified tilapia SLC5A transporters were compared in a phylogenetic tree (Fig. 3B). In a CLUSTAL W analysis, the nucleotide identities of SLC5A family members found in the genome relative to tilapia SGLT1 (SLC5A1) were 60.6% SGLT2 (SLC5A2), 47.9% SMIT1 (SLC5A3), 57.5% SGLT4 (SLC5A9), 35.5% NIS (SLC5A5), 33% SMCT1 (SLC5A8), 53.8% SGLT5 (SLC5A10), 55.3% SMIT2 (SLC5A11), 48.3% SMIT (SLC5A3), and 37.4% SMVT (SLC5A6).

Fig. 3.

A: relative expression levels of SLC5A transporters in Nile tilapia (proximal intestine: n = 8–10, midintestine: n = 6–10, hindgut: n = 6–10) using quantitative PCR. Expression levels were normalized against EFα1 (α-elongation factor 1) housekeeping gene. Values are means ± SE. *There were no significant differences between tissues for SGLT1 (SLC5A1): proximal vs. midintestine vs. hindgut. **Significant differences were found between genes SGLT1 (SLC5A1) and SMIT2 (SLC5A11) for proximal and hindgut (two-way ANOVA, P < 0.05). B: phylogenetic tree of the 10 members of the SLC5A family of cotransporters. The alignment program CLUSTAL W and the phylogenetic display program MEGA7 were used to generate the tree. NIS, sodium-iodide cotransporter; SGLT1, SGLT2, SGLT4, and SGLT5, sodium-glucose cotransporters 1, 2, 4, and 5, respectively; SMCT1, sodium-monocarboxylate cotransporter 1; SMIT, SMIT1, SMIT2, sodium-myoinositol cotransporter and cotransporters 1 and 2, respectively; SMVT, sodium-multivitamin cotransporter.

Rainbow Trout

Electrogenic glucose absorption reveals a three-kinetic system.

A glucose gradient performed in the Ussing chamber using the pyloric ceca, midgut, and hindgut intestinal segments of trout resulted in short-circuit current. The pyloric ceca and midgut both followed Michaelis-Menten kinetics, whereas the hindgut followed Sigmoidal Hill kinetics (Fig. 4). The pyloric ceca and midgut both saturated around 5 mM glucose, with a significantly higher K_m value in the pyloric ceca (4.2 mM) compared with the midgut (1.8 mM) (Table 3, P < 0.05), but not significantly different V_max values between the two trout tissues (2.3 vs. 1.7 µA/cm²) (Table 3, P > 0.5). These values characterize a H_a/L_c system in the pyloric ceca and a super-high-affinity (sH_a)/L_c system in the midgut of trout (Fig. 4 and Table 3). The trout hindgut saturated around 50 mM glucose, but with a significantly higher K_m value than the midgut and pyloric ceca (Fig. 4 and Table 3, P < 0.05). The Hill coefficient was > 1 for the hindgut. The V_max value in the trout hindgut was slightly higher than that of the midgut, but was similar to the pyloric ceca and not significantly different from each other (Fig. 4 and Table 3, P > 0.5). The observed V_max (2.4 µA/cm²) and higher K_m (12.3 mM) values in the hindgut in comparison to the proximal sections of the trout intestine support a L_a/L_c system. Thus trout presents with three different kinetic systems along their gastrointestinal tract, with large differences in affinity for glucose and an overall Lc for glucose transport compared with tilapia. Specifically, tilapia V_max values were significantly (2,043–3,506% or ~20−35 times, P < 0.05 in Student’s t-test) higher compared with trout (Table 3). Finally, sodium dependency of glucose transport was demonstrated in a sodium-free buffer (Fig. 4). Additionally, a sodium-free teleost saline using N-methyl-d-glucamine as a substitute for sodium was performed, which eliminated the glucose-stimulated current as well (data not shown). Interestingly, in trout, there was no significant inhibition in any of the kinetic systems in response to both dapagliflozin and phloridzin dihydrate (Fig. 5A, i and ii, P > 0.5 for inhibitor effect in two-way ANOVA).

Fig. 5.

A: percent activity remaining in rainbow trout of dapagliflozin (0.001, 0.01, 0.1, 10, 100, 200, and 300 µM; i) (all tissues: n = 12), following addition of phloridzin dihydrate (1, 10, 100 µM; ii) (all tissues: n = 12) and representative trace for pyloric ceca of dapagliflozin and phloridzin dihydrate additions (iii). Values are means ± SE. Dashed line represents 100% transporter activity before inhibition.

SLC5A gene profiling affirms kinetics.

To identify the genes responsible for the observed kinetics, trout genomic analysis was performed and identified 5 of 12 known SLC5A family members. Trout SGLT1 (SLC5A1), SGLT2 (SLC5A2), SGLT4 (SLC5A9), NIS (SLC5A5), SMIT2 (SLC5A11), and SMVT (SLC5A6) were identified in the trout genome after using the BLAST+ application (Table 2). The expression levels of each gene were compared among the different tissues using quantitative real-time PCR.

In trout, SGLT1 (SLC5A1) expression in the pyloric ceca and midgut were significantly higher than the expression levels of the other genes, supporting the higher affinity and L_c kinetics in both tissue segments (Fig. 6A, P < 0.001). In addition, SGLT2 (SLC5A2) and SMIT2 (SLC5A11), two L_a transporters, had significantly higher expression in the trout pyloric ceca than the midgut, supporting the H_a to sH_a paradigm between pyloric ceca and midgut (Fig. 6A, P < 0.05). A significant drop in SGLT1 (SLC5A1) was found in the trout hindgut, potentially explaining the reduced affinity in this segment (Fig. 6A, P < 0.05). However, significant drops in SGLT2 (SLC5A2) and SMIT2 (SLC5A11) were also noted, leaving the observed glucose absorbing capacity unexplained (Fig. 6A, P < 0.05). The phylogenetic tree identifying sequence similarities between trout SLC5A transporters are illustrated in Fig. 6B. In a CLUSTAL W analysis, the nucleotide identities relative to trout SGLT1 (SLC5A1) were 62.3% SGLT2 (SLC5A2), 56.5% SGLT4 (SLC5A9), 38.3% NIS (SLC5A5), 59.4% SMIT2 (SLC5A11), and 40.5% SMVT (SLC5A6).

Fig. 6.

A: relative expression levels of SLC5A transporters in rainbow trout (pyloric ceca: n = 6–10, midgut: n = 10, hindgut: n = 8–10) using quantitative PCR. Expression levels were normalized against EFα1 (α-elongation factor 1) housekeeping gene. Values are means ± SE. ^A,B,C,D Significant differences were found between tissues for SGLT1 (SLC5A1) for ^A pyloric ceca vs. ^B hindgut and for ^A midgut vs. ^B hindgut (two-way ANOVA, P < 0.05); there were no significant differences between pyloric ceca and midgut. Significant differences were found between tissues for SGLT2 (SLC5A2) and SMIT2 (SLC5A11) for ^C pyloric ceca vs. ^D midgut and for ^C pyloric ceca vs. ^D hindgut (two-way ANOVA, P < 0.05); there were no significant differences between midgut and hindgut. B: phylogenetic tree of the six members of the SLC5A family of cotransporters. The alignment program CLUSTAL W and the phylogenetic display program MEGA7 were used to generate the tree. NIS, sodium-iodide cotransporter; SGLT1, SGLT2, SGTLT4, sodium-glucose cotransporters 1, 2, and 4, respectively; SMIT2, sodium-myoinositol cotransporter 2; SMVT, sodium-multivitamin cotransporter.

DISCUSSION

This study demonstrated that tilapia intestine possesses higher electrogenic glucose absorption and greater expression of glucose transporter orthologs than trout intestine. Differences between the two fish species portray tilapia as a homogeneous, one-kinetic glucose absorption system (H_a/H_c) throughout the gastrointestinal tract. In contrast, trout have heterogeneous, three-kinetic glucose absorption systems (H_a/L_c, sH_a/L_c, and L_a/L_c) corresponding to the three different intestinal segments. Comparative studies between omnivore and carnivore sodium-dependent glucose absorption has been minimally explored in mammals and birds, with studies lacking in fish (22, 26, 43). Additionally, the existence of two different segment-specific, sodium-dependent glucose transport systems along the small intestine associated with SLC5A transporters have been shown in mammals, but has not been described in fish (49, 61, 89). In the present study, we present fundamental differences that exist between the omnivorous tilapia and carnivorous trout in terms of sodium-dependent glucose transport along the gastrointestinal tract. Additionally, both fish species have hindgut sodium-dependent glucose absorption, suggesting a divergent adaptation from mammals, where colonic glucose absorption is lacking.

One-Kinetic SLC5A-Associated Homogeneous Glucose Absorption in Tilapia

Tilapia, an omnivorous fish, would generally consume a higher carbohydrate diet in their natural environment and has been shown to better tolerate a higher glucose load than trout in terms of its clearance from the plasma (76). In captivity, tilapia are generally fed a higher carbohydrate-inclusion diet (up to 50% dietary carbohydrate), which is correlated with good growth (52, 64, 69, 76, 87). In contrast, trout can tolerate up to 20% carbohydrate in their diet, before exhibiting poor growth (25, 87). Both dietary carbohydrate levels in fish are generally lower than in mammalian diets, which are up to 60% inclusion (16). Our study adds to these known nutritional physiological differences by demonstrating that tilapia have ~20–35 times (~2,000–3,500%, Table 3) higher capacity for sodium-dependent glucose transport than corresponding segments in trout. The higher absorption in tilapia is driven by a single unique H_a/H_c kinetic system, which is demonstrated by low K_m and high V_max values along the entirety of the intestinal tract, which would enhance their ability to absorb more glucose, a characteristic of omnivores (Table 3) (87). Similarly, a study carried out in the omnivorous freshwater fish black bullhead (Ictalurus melas) using isolated enterocytes found brush-border transport of 3-O-methyl-d-glucose (nonmetabolizable form of d-glucose) to saturate at ~40 mM (79).

Further characterization with pharmacological inhibitors supported the homogenous H_a/H_c kinetic system in tilapia. In mammals, these inhibitors have been used to differentiate the kinetic systems (H_a/L_c and L_a/H_c) of SGLTs (27, 34, 51, 67, 86). Specifically, the recently developed dapagliflozin and the traditionally used phloridzin dihydrate have been used to inhibit SGLT2 (SLC5A2), a L_a/H_c transporter and SGLT1 (SLC5A1), a H_a/L_c transporter, respectively, in the kidney of rats, pigs, and humans (27, 51, 84, 85). Additionally, phloridzin dihydrate has been used with studies in fish using techniques like brush-border membrane vesicles exhibiting inhibition of sodium-dependent glucose transport (1, 61, 79, 81, 88). Here, dapagliflozin was first applied, to selectively inhibit L_a/H_c transporter kinetics, followed by phloridzin dihydrate to inhibit any further H_a/L_c kinetics.

Dapagliflozin resulted in inhibition, with all intestinal segments responding similarly, with sequential addition of phloridzin dihydrate not resulting in any further inhibition. In contrast, phloridzin addition by itself resulted in similar significant inhibition in all segments. All segments reacting the same to all inhibitors with similar K_i values exhibited throughout the intestine support a one-kinetic, homogeneous system throughout tilapia gut. The lack of sequential inhibition of phloridzin after dapagliflozin suggest that 1) dapagliflozin can inhibit H_a/L_c transporters (SGLT1-like) in tilapia; or 2) the unique H_a/H_c system is created by a single SGLT, which is sensitive to both drugs. Arguing against the latter possibility is the fact that genomic and gene expression analysis suggested the former.

Bioinformatic analysis identifying 10 SLC5A transporters exhibited similar gene expressions across all three intestinal segments in tilapia. Such similar expression would explain homogenous segmental sodium-dependent glucose kinetics and inhibition. More specifically, the similar, but significantly higher, levels of SGLT1 (SLC5A1) and SMIT2 (SLC5A11) expression in all three segments compared with all of the other SLC5A genes, support two different transporters contributing to the H_a/H_c system. The elevated expression of SGLT1 (SLC5A1), a well characterized H_a/L_c transporter, supports the high-affinity kinetics and phloridzin inhibition (9). Interestingly, although SMIT2 (SLC5A11) had the highest expression compared with all of the other genes, it is known to primarily transport inositols (90). However, it is previously known as SGLT6 and was characterized as a very L_a glucose transporter in mammals (3, 7, 20). The high capacity of glucose transport was demonstrated with rabbit SMIT2 (SLC5A11) cRNA injected into Xenopus oocytes and detected glucose transport at ~50 mM (57). In the phylogenetic tree (Fig. 3B), SMIT2 (SLC5A11) is divergent from SGLT1 (SLC5A1) with only 55.3% homology, suggesting differences in function. Nonetheless, the putative high-capacity glucose transporter could explain H_c kinetics found in each of the tilapia intestinal segments. Altogether, the combined dominant expression and function of these two transporters are further supported by a Sigmoidal Hill fit. Together, this suggests that the heterogeneous expression in tilapia of 10 different SLC5A transporters along all areas of gastrointestinal tract, with a dominance of SGLT1 (SLC5A1) and SMIT2 (SLC5A11) expression, produces the H_a/H_c kinetics and the pharmacological inhibition observed. Such a H_a/H_c system would be advantageous for an omnivorous fish to absorb high levels of glucose presented to the gut from the diet (87).

Three-Kinetic SLC5A-Associated Glucose Absorption in Trout

The segregation of three-kinetic, sodium-dependent glucose transport systems was found along the gastrointestinal tract of trout. In all of the trout gut segments, the capacity for glucose transport was low in comparison to tilapia. However, the overall affinity was higher in the proximal segments of trout pyloric ceca and midgut, but drastically decreased as it reached the distal hindgut. The low capacity in all three segments of trout would protect the fish from rapid glucose absorption. Exogenous glucose ingestion in carnivorous fish has been shown to induce the process of gluconeogenesis, further increasing the plasma glucose levels (54, 68). This can lead to persistent hyperglycemia (high plasma glucose levels) and high levels of plasma insulin, which can hinder growth and increase liver size (48, 72). The differences in affinity explain how the proximal sections are sensitive to glucose transport when luminal glucose concentrations are low, around 1–5 mM, but the hindgut is sensitive to glucose transport only when the intestinal luminal glucose concentration is much higher, >5mM.

The differences in affinity for glucose between the trout pyloric ceca and midgut may assist glucose absorption as the concentration of glucose decreases in the chyme as it moves through the intestine (1). The H_a/L_c transport system characterized in the present study in the pyloric ceca would be efficient at absorbing most of the available glucose in the trout chyme. However, as the chyme moves to the midgut with decreasing glucose concentrations, the sH_a/L_c transport system would become advantageous. A related study examining proximal intestinal glucose absorption in the carnivorous, seawater, pacific copper rockfish demonstrate similar kinetic segmental differences (1). The uptake of d-[³H]glucose in brush-border membrane vesicles of pyloric ceca and upper intestine (anatomically similar to midgut) exhibited Michaelis-Menten kinetics of sodium-dependent glucose absorption (1). The mucosal-to-serosal glucose influx (V_max) was similar between both organs (pyloric ceca and upper intestine), but the K_m values were different (high K_m for pyloric ceca and low K_m for upper intestine) (1). The differences in the K_m values indicate that pyloric ceca has lower affinity for glucose concentration than the upper intestine (midgut) (1). Similarly, we found differences in K_m values between pyloric ceca and midgut, where the midgut demonstrated a sHa for glucose compared with the pyloric ceca, with no differences in the V_max. Ahearn et al. (1) that, since the pyloric ceca has first access to the food, it absorbs more of the nutrients at higher concentrations. In contrast, the chyme that is released to the subsequent midgut section has lower nutrient content, thus needing a higher affinity transport system (1). Here we took trout intestinal segmental contributions further by characterizing glucose uptake in the hindgut as well. Interestingly, the above assertion does not hold for the trout hindgut with its Sigmoidal Hill fit and L_a and H_c than the midgut, suggesting physiological roles for this system other than nutrient absorption. Finally, the use of known mammalian SGLT inhibitors suggests a lack of contribution from trout SGLT1 (SLC5A1) and SGLT2 (SLC5A2) to the kinetic systems. However, given that the sequence similarity of trout SGLT1 (SLC5A1) and SGLT2 (SLC5A2) to human is only 58% and 66%, respectively, this finding was not too surprising. Alternatively, the lack of inhibition may be attributed to the lower temperature used for trout kinetic measurements. Such temperature sensitivity of glucose transport inhibitors has previously been described (29). Thus the three-kinetic trout system was further characterized by genomic and gene expression analysis.

In trout, 5 of the known 12 SLC5A transporters where found and exhibited high SGLT1 (SLC5A1, H_a/L_c) expression in the pyloric ceca and midgut compared with the other SLC5A transporters. These data are correlated with the Michaelis-Menten V_max values for the trout pyloric ceca and midgut segments that exhibit L_c transport. However, the trout pyloric ceca SGLT2 (SLC5A2) and SMIT2 (SLC5A11), which are L_a transporters, were more prominently expressed than in the midgut, possibly explaining the comparatively lower affinity detected in the pyloric ceca segment (3, 7, 20). Therefore, the kinetics of H_a/L_c in the trout pyloric ceca is likely due to the combined expression of SGLT1 (SLC5A1), SGLT2 (SLC5A2), and SMIT2 (SLC5A11), whereas the sH_a/L_c kinetics in the midgut is due to a decrease in SGLT2 (SLC5A2) and SMIT2 (SLC5A11). In comparison, the decrease in trout hindgut SGLT1 (SLC5A1) expression was associated with a drastic reduction in affinity to glucose in this segment, again suggesting that the Ha and sHa of the pyloric ceca and midgut is driven by SGLT1 (SLC5A1). The expression of the other SLC5A genes in the trout hindgut, which do not significantly differ from the midgut then may account for the L_c kinetics. Although our analysis of SLC5A gene expression does account for the kinetics defined in this study, there is still the possibility of another unidentified SGLT-like transporter that may explain the Lc paradigm in trout hindgut. Overall, our results confirm that the carnivorous trout has SGLT1 (SLC5A1), SGLT2 (SLC5A2), and SMIT2 (SLC5A11) transporters in the pyloric ceca likely driving an observed H_a/L_c system, and an increase in proportional SGLT1 (SLC5A1) expression to SGLT2 (SLC5A2) and SMIT2 (SLC5A11) driving a sH_a/L_c system in the midgut. A L_a/L_c kinetic system in the trout hindgut is supported by low expression of all trout SLC5A genes and a significant drop in SGLT1 (SLC5A1).

Fish Hindgut Glucose Absorption: Different from Mammals

The presence of sodium-dependent glucose absorption in the hindgut of tilapia and trout was surprising in comparison to the mammalian models, where it is nonexistent in this location (32, 34, 35, 49). However, for aquatic animals, the regulation of ionic and osmotic balances are extremely important, utilizing ionic and substrate transporters in their gills, kidneys, and intestines to maintain this balance (38, 83). The gut plays a role in osmoregulation by controlling the intake of dietary ions, using glucose transporters along with dietary substrates to passively contribute to ionic and osmotic balances (63, 83). Interestingly, the presence of active d-glucose uptake in the rectum was found in frugivorous avian species and was considered important to offset the fast digesta transit through their short gut (55, 56). However, the omnivorous chicken with its longer gut demonstrated high hindgut glucose uptake (30). This suggest functions of this glucose absorption other than nutrient uptake. One possibility would be osmoregulation, especially given the proximity of the rectum and cloaca (2, 31). Together, our characterization of sodium-dependent glucose transport and associated SGLTs in the hindguts of these fish may be an unexplored mechanism that may contribute to ionic and osmotic regulation in tilapia and trout.

Omnivorous and Carnivorous Comparisons Between Fish and Mammals

The homogenous H_a/H_c kinetic system of sodium-dependent glucose absorption that exists throughout the omnivorous tilapia differs from previously characterized omnivorous systems, such as the dog, cattle, human, rat, and pig (27, 32, 34, 35, 45, 74). Generally, two types of intestinal segmental differences in sodium-dependent glucose absorption kinetic systems were identified, with H_a/L_c kinetics in the jejunum, L_a/H_c in the ileum, and the colon being void of transport (27, 32, 34, 35, 45, 74). Thus tilapia have evolved to use their entire intestinal tract for H_a/H_c sodium-dependent glucose absorption, whereas omnivorous mammals only utilized their small intestinal sections (jejunum and ileum) for either H_a/L_c or L_a/H_c, but never show H_a/H_c sodium-dependent glucose absorption (5, 12, 32, 49). This fundamental difference suggests that tilapia may be more efficient than these other omnivorous mammals at absorbing glucose. Comparatively, trout differ from the carnivorous cat, with the cat having similar intestinal kinetic segmental segregation to omnivorous animals with H_a/L_c and L_a/H_c kinetics (89). The trout differs with three-kinetic, sodium-dependent glucose transport systems (H_a/L_c, sH_a/L_c, L_a/L_c), that is overall L_c. This suggests that trout have a very limited capacity to absorb glucose compared with other omnivorous and carnivorous mammals.

Limitations

There are a few limitations in this study based on the techniques used. The assumption of mRNA expression of the SLC5A transporters directly correlating with protein function does not always hold. However, identifying these fish SLC5A proteins using Western blots is not currently possible as there are no available fish SLC5A antibodies. Another technical limitation in this study involves the possibility of contamination of other tissues when collecting whole intestinal segments for RT-qPCR. Avoiding contamination by scraping cells off the epithelial lumen was not possible, given the very thin intestinal tissue, which would tear upon scraping, thus not completely eliminating contamination. Another limitation addresses the higher absorptive capacity seen in tilapia, which could be due to other structural and functional adaptations. The present study expressed absorptive capacity in terms of intestinal segment area exposed by the insert in the Ussing chamber (0.3 cm²). However, while the tissue area was constant, the epithelial surface area may have differed between the two species, depending on the size of villi and microvilli structures. Additionally, the higher SGLT1 expression in tilapia compared with trout may contribute to the higher V_max values, as the coupling ratio of sodium to glucose for SGLT1 is known to be 2:1 (6, 9, 23, 24, 32–34, 37, 49). Finally, the definition of K_m in this study is collectively termed as affinity, where the assumption is made that the rate of transport and binding is similar. This assumption is supported by the fact that our technique requires the simultaneous binding and transport of glucose to generate a current. These limitations further address the fact that tilapia and trout may have other adaptive mechanisms in place for the observed differences, but studying these mechanisms/functions would be beyond the scope of the present study.

In conclusion, in tilapia, electrogenic sodium-dependent glucose absorption was characterized as a segmentally homogenous H_a/H_c kinetic system. These finding were supported by the high expression of SGLT1 (SLC5A1) and SMIT2 (SLC5A11), and similar sensitivities to dapagliflozin and phloridzin dihydrate throughout the gastrointestinal tract. In trout, a H_a/L_c system in the pyloric ceca was supported by the expression of SGLT1 (SLC5A1), SGLT2 (SLC5A2), and SMIT2 (SLC5A11), whereas the midgut demonstrated an sH_a/L_c kinetic system, supported by the SGLT1 (SLC5A1) expression and a decrease in SGLT2 (SLC5A2) and SMIT2 (SLC5A11) expression compared with pyloric ceca. Finally, the hindgut demonstrated a L_a/L_c kinetic system supported by a decrease in SGLT1 (SLC5A1) expression and a general expression of SLC5A genes. Overall, tilapia and trout demonstrate differences in transport kinetics and intestinal segmental contribution associated with SLC5A family members. Additionally, these findings highlight segmental kinetic differences between the gastrointestinal tract of fish and mammals.

Perspectives and Significance

Here, we present the first report comparing the kinetic characterization of electrogenic sodium-dependent glucose transport in the omnivorous Nile tilapia and the carnivorous rainbow trout gastrointestinal tract. The differences found suggest that omnivorous and carnivorous fish may have unique transport systems for glucose. This may have evolved to allow each species to maximize its glucose uptake from its natural diet. However, this omnivore-carnivore paradigm needs to be further tested in other mammalian and aquatic systems. Finally, in comparison to mammals, the discovery here of hindgut sodium-dependent glucose absorption in fish suggests that this process may play a greater role in osmoregulation, a homeostatic mechanism vital to aquatic species.

GRANTS

This research was supported by Natural Sciences and Engineering Research Council of Canada Discovery Grant 371364–2010 (M. E. Loewen), Natural Sciences and Engineering Research Council of Canada CRD CRDPJ: 446912–13, and the Saskatchewan Pulse Crop Development Board (M. E. Loewen and L. P. Weber).

DISCLOSURES

No conflicts of interest, financial or otherwise, are declared by the authors.

AUTHOR CONTRIBUTIONS

M.E.L. conceived and designed research; M.S. and M.E.L. performed experiments; M.S. and M.E.L. analyzed data; M.S., L.P.W., and M.E.L. interpreted results of experiments; M.S. and M.E.L. prepared figures; M.S. and M.E.L. drafted manuscript; M.S., L.P.W., and M.E.L. edited and revised manuscript; M.S., L.P.W., and M.E.L. approved final version of manuscript.