Abstracts

Ataxia

1

Assessment of sleep spindle density among genetically positive sca1, sca2 and sca3 patients: a comparative study

Ragasudha Botta (Bangalore, India)

Objective: To compare the sleep spindle densities of genetically proven SCA1, SCA2 and SCA3 patients.

Background: Spinocerebellar ataxias (SCA) are a group of progressive ataxias associated with hereditary CAG trinucleotide repeats, and slow degeneration of brain stem and cerebellum (1). The patients usually present in their third or fourth decades with neurological manifestations with or without sleep problems (2). Additionally, degeneration of thalamus to varying extent is present in both SCA2 and SCA3 (3). Sleep spindles are distinctive EEG oscillations (11‐16Hz) occurring during NREM stage (4) and generated by the thalamo‐cortical interplay (5). Therefore, decrease in sleep spindle density could reflect the ongoing neurodegeneration in thalamic circuitry.

Methods: 18 Patients of both gender between the age groups 18‐47 years who are genetically positive for SCA1, SCA2 and SCA3 are recruited from Parkinsons and movement disorder clinic and OPD, NIMHANS. Sleep quality was assessed using Mayo's, ESS, PSQI, and IRLS rating scales. Whole night polysomnography was done in the human sleep research laboratory, Dept. of neurophysiology. Sleep spindle densities were analysed using neuroloop gain plugin of Polyman v1.15 software (6), and averaged across the NREM sleep using custom scripts written in MATLAB‐2013a. Kruskal Wallis test was used to analyse the sleep spindle density differences between the groups and pair wise comparisons were done using Mann Whitney test.

Results: The mean age of SCA1 patients is 39.17±5.419, SCA2 patients is 30.80±9.445, and SCA3 patients is 35.43±6.347 years. Sleep architectural details and particularly REM sleep deficits of these patients were reported in a previous study. In the current study, significant spindle density differences are found in SCA 2 & 3 patients when compared to age & gender matched controls. The NREM spindle density values (percentage Neuroloop gain) are 16.91% in SCA1, 0% in SCA2, 1.2% in SCA3 and 59.49% in control groups. However, there are no significant differences in spindle densities between the SCA1, SCA2 and SCA3 patients.

Conclusions: SCAs are hereditary progressive ataxias with thalamic abnormalities playing a role in their pathogenesis. This study has shown "thalamic switch" disruption, as reflected by reduced spindle densities observed in these patients, particularly SCA2 & SCA3. Thus, sleep spindle deficits could act as one of the biomarkers of ongoing neurodegeneration in the thalamic circuitry of SCA patients. Further studies are required to see the relation between number of CAG repeats and sleep spindle density values.

References: 1. Leggo J, Dalton A, Morrison PJ, Dodge A, Connarty M, Kotze MJ, et al. Analysis of spinocerebellar ataxia types 1, 2, 3, and 6, dentatorubral‐pallidoluysian atrophy, and Friedreich's ataxia genes in spinocerebellar ataxia patients in the UK. J Med Genet. 1997 Dec;34 (12):982–5. 2. Paulson H. Spinocerebellar Ataxia Type 3. In: Pagon RA, Adam MP, Ardinger HH, Wallace SE, Amemiya A, Bean LJ, et al., editors. GeneReviews (®) [Internet]. Seattle (WA): University of Washington, Seattle; 1993 [cited 2015 Jun 23]. Available from: http://www.ncbi.nlm.nih.gov/books/NBK1196/3. Rüb U, Del Turco D, Del Tredici K, de Vos R a. I, Brunt ER, Reifenberger G, et al. Thalamic involvement in a spinocerebellar ataxia type 2 (SCA2) and a spinocerebellar ataxia type 3 (SCA3) patient, and its clinical relevance. Brain J Neurol. 2003 Oct;126 (Pt 10):2257–72. 4. De Andrés I, Garzón M, Reinoso‐Suárez F. Functional Anatomy of Non‐REM Sleep. Front Neurol [Internet]. 2011 Nov 15 [cited 2015 Jun 23];2. Available from: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3215999/5. Astori S, Wimmer RD, Lüthi A. Manipulating sleep spindles‐‐expanding views on sleep, memory, and disease. Trends Neurosci. 2013 Dec;36 (12):738–48. 6. Kemp B, Zwinderman AH, Tuk B, Kamphuisen HA, Oberyé JJ. Analysis of a sleep‐dependent neuronal feedback loop: the slow‐wave microcontinuity of the EEG. IEEE Trans Biomed Eng. 2000 Sep;47 (9):1185–94.

Figure 1.

Bar diagram showing the differences in sleep spindle densities in patients with Spinocerebellar ataxia 1, 2 and 3 as compared to controls

Table 1.

Clinical Characteristics of patients with Spinocerebellar ataxias (n=18)

	SCA1 (n=6)	SCA2 (n=5)	SCA3 (n=7)
Age(Mean)	39.17±5.42 years	30.80±9.45 years	35.43±6.35 years
Duration if illness(Mean)	4.67±1.63 years	4.28±4.4 years	5±2.3 years
Severity of illness(ICARS)	39.33±17.85	29.4±14.32	45.57±19.77
CAG repeat length	53.83±4.30 (47‐59)	43.2±2.16(41‐46)	68.57±2.63(65‐72)
Clinical features:
Ataxia	100%(6)	100%(5)	100%(7)
Dysarthria	100%(6)	100%(5)	85.7%(6)
Spasticity	30%(2)	0%(0)	0%(0)
Dystonia	0%(0)	0%(0)	0.1%(1)
Brisk Reflexes	33.3%(2)	20%(1)	28.5%(2)
Weakness/ Wasting	0%(0)	0%(0)	0%(0)
Saccade abnormalities	66.6%(4)	60%(3)	42%(3)
Pursuit Abnormalities	16.6%(1)	40%(2)	57.1(4)
ESS	1.8	2.4	4
RBDSQ	0.5	0.2	1.6
HAM‐A	8.8	3.2	8.6
HAM‐D	6.7	1.4	4.7
PSQI	4.5	3.6	4.6

SCA: Spinocerebellar ataxia

ICARS: International cooperative ataxia rating scale

CAG: Cytosine Adenine Guanine

1. SCA Patient

Figure 2.

 

2. Control

Figure 3.

 

Neuro‐loop gain is a measure of probability of sleep‐related spindle to repeat itself, and is independent of the amplitude of EEG rhythms (Kemp et. al., 2000).

Note the decrease in sleep spindle probability among the patients.

2

Adult onset cerebellar ataxia after influenza vaccination: A case report

Chayasak Wantaneeyawong (Chiang Mai, Thailand)

Objective: To describe a rare case of adult onset cerebellar ataxia in form of pancerebellar dysfunction following influenza vaccination.

Background: ‐

Methods: Case description: A 74 year‐old male patients presented with gait disturbance and dizziness without vertigo for 4 days. He had past medical illness of essential hypertension, dyslipidemia and benign prostatic hypertrophy. Tracking on his past history he had received influenza vaccine ten days prior to symptoms. On neurologic examination, he had signs of pancerebellar dysfunction including dysmetria of all limbs, truncaland gait ataxia. MRI brain showed no abnormality. Mild CSF pleocytosis was found (WBC 7 cell/mm3, PMN 14%, Lym 86%), but CSF protein and sugar were within normal range. The serum and CSF paraneoplastic antibody panel were negative. Other laboratory investigations were unremarkable. On follow up examination 4 weeks after the onset, the improvement of dizziness, limb ataxia and gait ataxia was noted but still not fully recovery.

Results: Discussion: The etiology of cerebellar ataxia in this case was presumed to be postvaccinated cerebellopathy. When encountering patients with acute to subacute cerebellar ataxia in form of pancerebellar dysfunction, immune mediated etiology should be kept in mind. One of important but rare cause of immune mediated cerebellar ataxia is postvaccination. Therefore it is advisable to take history in all patients presented with cerebellar ataxia.

Conclusions: Postvaccinated cerebellar dysfunction is a rare cause of cerebellar ataxia in adult. Imprudent history taking may make misdiagnosis of this condition. Therefore careful history taking is crucial in diagnosing of this rare condition.

References: 1. Park KM, Kim SE, Kim SE. An Elderly Case of Acute Cerebellitis after Alleged Vaccination. Journal of Movement Disorders 2012;5:21‐23. 2. Yanagisawa T, Saito H. Acute Cerebellar Ataxia after Influenza Vaccination with Recurrence and Marked Cerebellar Atrophy. Tohoku J. Exp. Med., 1989, 158, 95‐103. 3. Sunaga Y, et al. Acute cerebellar ataxia with abnormal MRI lesions after varicella vaccination. Pediatr Neurol 1995; 13:340‐342.

3

Insulin/diabetes pathways are directly targeted by miRNAs leading to severe SCA2 phenotype

Vishnu Swarup, Himanshu Singh, Mohammed Faruq, Achal Srivastava (New Delhi, India)

Objective: To screen and understand different roles of altered miRNAs into cellular pathways associated in spinocerebellar ataxia type‐2 (SCA2) pathology.

Background: SCA2 is most common SCA in India. The noncoding miRNAs are known to control expression of target genes by binding to 5'UTR, CDS and 3'UTR. The causal gene, atxn2 is ~147kb long which provide potential sites for miRNA binding but still unveiled.

Methods: The miRNA expression levels of SCA2 patients were compared with that of matched healthy control using Agilent's miRNA microarrays (version 21.0). The levels of miRNA were calculated using bioconductor ‘limma’ package and t‐test was used to find p‐values (<0.05). Subsequently, the candidate miRNA screening, role in disease aetiology and miRNA enrichment analysis was performed using miEAA: microRNA enrichment analysis and annotation tool (http://www.ccb.uni-saarland.de/mieaa_tool/).

Results: Twenty two miRNAs were found to be significantly altered in SCA2 patients. Though, the miRNA enrichment analysis suggested its role in various human diseases such as cancers, neurological diseases etc., two candidate miRNAs (hsa‐miR‐1301‐3p and hsa‐miR‐374b‐5p) were found to be over‐represented in the metabolic pathways, insulin signalling pathway (hsa04910) and type II diabetes mellitus (hsa04930) (Figure 1). It is interesting to note that the miRNA hsa‐miR‐1301‐3p share the pathogenesis in Huntington disease (P00029) as well as SCA2 and involved in Calcium signalling pathway (hsa04020) too.

Conclusions: Over‐representation of two altered miRNAs (hsa‐miR‐1301‐3p and hsa‐miR‐374b‐5p) in insulin signalling (hsa04910) and type II diabetes mellitus pathways (hsa04930) indicate their possible deregulation (though not yet reported) in SCA2 patients (Table 1). Impaired insulin signalling might be due to accumulation of lipids in brain which alters membrane lipid composition and altered lipid metabolism has also been found in SCA2 disease models only [1]. Huntington disease and SCA2 share apoptotic mode of cell death via altered calcium signalling. However, better understanding of metabolic deregulation at molecular level could provide a deep insight of the mechanisms involved in insulin signalling in these patients.

References: [1] Lastres‐Becker, I. (2008) Insulin receptor and lipid metabolism pathology in ataxin‐2 knock‐out mice. Hum Mol Genet 17, 1465–1481.

Figure 1.

Enriched miRNAs – high (green), low (red) and their pathways obtained from miRNA Enrichment Analysis

Table 1.

Identified cellular pathways identified by miRNA enrichment analysis and annotation tool.

Pathway (Code)	Enrichment	miRNA
Cholesterol biosynthesis (P00014)	under‐represented	lisa‐miR‐1301‐3p
Calcium signalling pathway (hsa04020)	under‐represented	lisa‐miR‐1301‐3p
Insulin signalling pathway (hsa04910)	over‐represented	hsa‐miR‐374b‐5p
Type II diabetes meilitus (hsa04930)	over‐represented	hsa‐miR‐374b‐5p, hsa‐miR‐130 l‐3p
Huntington disease (P00029)	under‐represented	hsa‐miR‐1301‐3p

4

Oral trehalose improves neurological symptoms in patients with spinocerebellar ataxia 3

Noorasyikin Mohamed Arifin, Norlinah Ibrahim, Elena Aisha Azizan, Teh Chiek, Farah Waheeda Tajurudin, Siti Binti Mat Desa, Long Kha Chin, Tan Hui Jan, Wan Nur Nafisah Wan Yahya (Kuala Lumpur, Malaysia)

Objective: The main objective of this study was to determine the effects of oral trehalose on clinical symptoms in genetically confirmed SCA 3 patients using validated ataxia rating scale (SARA scale) and SCAFI and INAS, and quality of life (EQ‐5D‐3L) over 6 months compared to baseline.

Background: Spinocerebellar Ataxia 3 (SCA 3) is the commonest inherited ataxia leading to early wheelchair dependence and death. Recent evidence suggests that IV Trehalose, a disaccharide may stabilize disease progression in SCA 3 patients. This study was conducted to explore if oral trehalose conferred similar benefits in SCA3 patients.

Methods: This prospective single arm interventional study involved 15 genetically confirmed SCA 3 patients with no concomitant diabetes, over 6 months. Following enrolment, patients were instructed to ingest 100g of oral trehalose daily diluted in water or other beverages Assessments were performed at baseline, 2,4 and 6‐months using ataxia rating scales (SARA, SCAFI and INAS) and EQ‐5D‐3L scale.

Results: Thirteen patients completed the study. Eight (61.5%) patients showed significant improvement in neurological function, SARA and EQ‐5D‐3L scores at 2 months (SARA: p=0.035; EQ5D3L: p=0.022), 4 months (SARA: p=0.050; EQ5D3L: p=0.007) and 6 months (SARA: p=0.050, EQ5D3L p=0.011) compared to baseline. The SCAFI 8‐minute walking test improved significantly at 2, 4 and 6 months; p=0.012, p=0.012 and p =0.007 respectively. Patients who improved had significantly lower age of onset, (p=0.002) shorter disease duration (p=0.01) and low baseline SARA (p=0.004) scores compared to those who did not improve.

Conclusions: Oral trehalose was effective in improving neurological function, 8‐minute walking test scores, SARA and quality of life scores in 8 of 13 patients. This suggests that oral trehalose may have a disease stabilizing effect in SCA 3. A placebo controlled clinical trial in a larger sample is required to verify this finding.

References: 1.Stevanin, G et al. (2007). Clinical and Genetic Aspects of Spinocerebellar Ataxias with Emphasis on Polyglutamine Expansion, 113‐144. In Schapira A.H.V & Samuels M.A, Blue Books of Neurology: Spinocerebellar Degenerations the Ataxias and Spastic Paraplegias, Philadelphia, Butterworth Heinemann Elsevier2. Schmitz‐Hubsch et al. Spinocerebellar Ataxia 1,2,3 and 6 Disease Severity and non‐ataxia symptoms. EuroSCA AAN. 2008. Page983‐9893. Tan EK, Zhao Y, Puong KY, et al. Fragile X premutation alleles in SCA, ET, and parkinsonism in an Asian cohort. Neurology 2004;63 (2):362‐3634. Chen ZZ, Wang CM, Lee GC, et al. (2015). Trehalose Attenuates the Gait Ataxic and Gliosis of SCA 17 Mice. Neurochem Res2015 Apr; 40 (4):800‐10. doi.10.1007/s11064‐015‐1530‐4. Epub 2015 Feb 125. Gordon CR, Zaltzman R, Klein C, et al. (2016). Lecture: Prelimanary Results of Intravenous Trehalose for Treatment of Spinocerebellar Ataxia Type 3 (SCA 3). Special Issues on Controversial Neurology. From the 10th World Congress on Controversial In Neurology (CONy), Lisbon, 17th March 20166. Kaplton RE, Hill SD, Bispham NZ, et al. (2016). Reasearch Paper: Oral Trehalose Supplementation Improves Resistance Artery Endothelial Function in Healthy Middle‐Aged and Older Adults. Aging, June 2016, Vol 8 No. 6, 1167‐11837. Saute JA, de Castilhos RM, Monte TL, et al. A randomized, phase 2 clinical trial of lithium carbonate in Machado‐Joseph disease. Mov Disord 2014;29 (4):568‐573

5

Extra‐cerebellar signs and non‐motor features in Chinese patients with spinocerebellar ataxia type 3

Xiaoqin Yuan, Ruwei Ou, Yanbing Hou, Xueping Chen, Huifang Shang (ChengDu, People's Republic of China)

Objective: To systematically explore the prevalence of extra‐cerebellar signs and the clinical profiles of non‐motor symptoms including fatigue, excessive daytime sleepiness (EDS) and sleep disturbances in Chinese patients with spinocerebellar ataxia type 3 (SCA3).

Background: Spinocerebellar ataxia type 3 (SCA3), also known as Machado‐Joseph disease (MJD), is the most frequent subtype with a worldwide distribution. The pathological and neurodegenerative processes in SCA3 affect a large variety of functional and neurotransmitter systems, which lead to a wide range of clinical manifestations. Several extra‐cerebellar and non‐motor symptoms may insidiously occur and are likely to be under‐recognized in clinical practice.

Methods: This study included 40 patients with SCA3 and 40 age‐ and gender‐ matched healthy controls (HC). Extra‐cerebellar signs were assessed with the Inventory of Non‐Ataxia Symptoms (INAS). The INAS count denoted the number of non‐ataxia symptoms in each patient. The severity of fatigue, EDS, and sleep quality were assessed with quantitative questionnaires including Fatigue Severity Scale (FSS), Epworth Sleepiness Scale (ESS) and Pittsburgh Sleep Quality Index (PSQI). In addition, psychiatric symptoms (depression and anxiety) were measured with the Hamilton Depression Rating Scale (HAMD) (24 items) and Hamilton Anxiety Rating Scale (HAMA).

Results: Extra‐cerebellar signs were detected in 87.5% of all SCA3 patients and the mean total INAS count was 2.30±1.57. Rigidity was the most frequent extra‐cerebellar sign (45%, N=18), while myoclonus (0%), resting tremor (5%, N=2) and sensory symptoms (5%, N=2) were the most rare ones. SCA3 patients with rigidity had significantly higher scores of SARA than those without rigidity (p <0.05). Compared to HC, patients with SCA3 showed more severe fatigue, sleep problems, anxiety, and depression (p <0.05). The FSS score of SCA3 patients were correlated with age at onset, HAMD score, and PSQI score.

Conclusions: Our study indicates that a majority of SCA3 patients present at least one extra‐cerebellar signs. Non‐motor symptoms are common in our series of SCA3 patients, especially fatigue and sleep disturbances. Some treatable factors for fatigue should be addressed, especially depression and sleep quality.

References: Jacobi, H., Rakowicz, M., Rola, R., Fancellu, R., Mariotti, C., Charles, P., Durr, A., Kuper, M., Timmann, D., Linnemann, C., Schols, L., Kaut, O., Schaub, C., Filla, A., Baliko, L., Melegh, B., Kang, J.S., Giunti, P., Van De Warrenburg, B.P., Fimmers, R., and Klockgether, T. (2013). Inventory of Non‐Ataxia Signs (INAS): validation of a new clinical assessment instrument. Cerebellum 12, 418‐428.Moro, A., Munhoz, R.P., Moscovich, M., Arruda, W.O., Raskin, S., and Teive, H.A. (2014). Movement disorders in spinocerebellar ataxias in a cohort of Brazilian patients. Eur Neurol 72, 360‐362.

6

Usefulness root mean square (RMS) analysis using wearable sensors for assessing balance in neurodegenerative disorders

Pan‐Woo Ko, Ho‐Won Lee, Bo‐Woo Jung, Jieun Kim, Yong‐Hyun Lim (Daegu, South Korea)

Objective:‐

Background: Postural instability is a common cause of sudden falls and fall‐related injuries in patients with neurodegenerative diseases. To measure balance, commonly‐used clinical assessment tools are lack the sensitivity to accurately and consistently identify those people with neurodegenerative diseases. Recently, using wearable sensors for assessing balance become alternative method for giving us objective and sensitive values.

Methods: This study applied to 18 patients with sporadic adult‐onset cerebellar ataxia (SAOA), 15 patients with Parkinson's disease (PD), and 9 healthy control. All participants were instructed to maintain an upright standing position in front of white wall, with performing visual conditions (eyes‐open/close) and foot conditions (foot‐open/close). To measure postural stability, we used a tri‐axial gyro‐based motion sensors (Polhemus G4) attached to participant's upper body (vertex, 7th Cervical and 5th Lumbar spine). After filtering a noise, data were analyzed with the following parameters: Mean Distance (Average distance of summing AP (x) & ML (y) sway), Root Mean Square of Velocity (RMS; all 3 axes; x, y, z), RMS of Acceleration (all 3 axes).

Results: The mean distance reflecting the magnitude of AP and ML sway was analyzed by repeated measures ANOVA. Comparing with healthy control, patients with SAOA showed a larger mean distance (Ataxia: 1.76 cm vs PD: 1.36 cm vs Control: 0.8 cm, p < .001, effect size = .85). In RMS velocity analysis, there was also a significant difference between 3 group (Ataxia: 1.70 cm/s vs PD: 0.79 cm/s vs Control: 0.52 cm/s, p < .001, effect size = .57). As a result of Post‐Hoc test, there was a significant difference between SAOA and PD group (p < .001), and between SAOA and control group (p < .001), however, there was no differnce between PD and control group (n.s). In RMS acceleration analysis, Three groups showed statistically significant differences (Ataxia: 31.43 cm/s2 vs PD: 18.52 cm/s2 vs Control: 15.63 cm/s2,p < .001, effect size = .29). In detail, there were significant differences between SAOA and PD group (p < .05), SAOA and control (p < .01) groups, but not between PD and control group (n.s).

Conclusions: Using wearable sensors to measure postural instability in neurodegenerative disorders is useful. Especially, RMS and RMS acceleration showed disease specific characteristics. Our study shows not only usefulness as assesment tool but also an evidence that have disease‐specific postural control system in neurodegenerative disease.

7

The CAG repeat correlates with autonomic function in spinocerebellar ataxia type‐2 (SCA‐2) in India population

Akhilesh Sonakar, Mohammed Faruq, Achal Srivastava (New Delhi, India)

Objective: To investigate correlation of expanded CAG repeat with Autonomic function in pathogenesis of SCA2.

Background: Spinocerebellar ataxia is a progressive neurodegenerative disorder characterized by gait, limb ataxia and autonomic dysfunction. It is caused due to expansion of trinucleotide CAG repeats in ATXN2 gene and is transmitted in an autosomal dominant manner.

Methods: Clinico‐genetically confirm 72 SCA2 patients were recruited from Ataxia clinic, AIIMS. All the patients were underwent detailed clinical evaluation and advised for radiological, biochemical and and electrophysiological testing. Further their autonomic functions were correlated with their genetic spectrum.

Results: A total number of 72 unrelated Spinocerebellar Ataxia type‐2 patients comprised 42 Male and 30 females has been recruited for the study at our Ataxia clinic, AIIMS, New Delhi. Mean (SD) range of expanded trinucleotide repeats is 41.5 (2.69)36‐49. All patients had a progressive Cerebellar ataxia. Autonomic function parameters were abnormal in 56 (77.77%) with expanded CAG range 37‐49 repeat and normal 16 (22.22%) with expanded CAG range 36‐48 repeat in Spinocerebellar ataxia type‐2 patients. In patients with normal Autonomic function, mean (SD), range of age at onset is 29.03 (11.97), 17‐46 and mean (SD), of CAG repeat is 42.75 (3.47). In patients with abnormal Autonomic function, mean (SD), range of age at onset is 31.69 (9.72), 10‐55 and mean (SD), of CAG repeat is 41.12 (2.64). No significance difference has been observed in these two group.

Conclusions: SCA2 represent clinic‐genetically a heterogeneous disorder. It represents the commonest ataxia in Indian subcontinent. Our study shows in higher range of expanded CAG repeat (CAG 36‐48) also has normal autonomic function in SCA2 patients. Here we conclude Trinucleotide repeats (TNR) are not causal for Abnormal Autonomic Function in Spinocerebellar Ataxia Type‐2.

233

Clinical assessment of balance in ataxic patients with mean velocity using a triaxial accelerometer.

Pan‐Woo Ko, Ho‐Won Lee, Bo‐Woo Jung, Jieun Kim (Daegu, South Korea)

Objective: To assess the usefulness of mean velocity using wearable devices by comparison of variables with other neurodegenerative diseases.

Background: Postural instability and gait disturbance in patients with Sporadic Adult‐Onset Cerebellar ataxia (SAOA) are main problems threaten the independence and activities of daily living. The International Cooperative Ataxia Rating Scale (ICARS) and SARA have been widely used for this purpose. However, the daily use of the tools is difficult due to its many assessments. Wearable sensors provide the affordable alternative for clinicians because of its convenience and accuracy. Therefore, we evaluated the usefulness of variables using a triaxial accelerometer in patients with cerebellar ataxia to assess their balance.

Methods: SAOA subjects were selected in consecutive order form a prospectively enrolled ataxia registry. We also enrolled patients with Idiopathic Parkinson's disease (IPD) and normal controls. All participants were instructed to maintain an upright position in front of a white wall. To measure postural stability, we used tri‐axial gyro‐based motion sensors attached to participants' upper body (vertex, 7th cervical, and 5th lumbar spine). 30‐sec trials were performed consisting of two randomized, blocked repetition.

Results: Various parameters including mean distance, mean velocity and mean acceleration were analyzed A mean velocity (medial to lateral, anterior to posterior, cm/s) of patients with SAOA is significantly higher than other groups analyzed by repeated measures ANOVA (SAOA : IPD : Controls, 10.798 : 5.913 : 4.939, p < 0.001).

Conclusions: Using mean velocity to assess the balance of ataxia patients is useful. And it is sensitive and objective markers for the assessment and follow‐up of imbalance in patients with cerebellar ataxia.

Choreas (Non‐Huntington's Disease)

8

Nemaline rods in a patient of chorea‐acanthocytosis with a novel pathogenic mutation of VPS13A gene

Qian Zheng, Chunlin Zhang, Ling Jiao (Guiyang Shi, Guizhou Sheng, People's Republic of China)

Objective: To report the clinical features, laboratory investigations, and muscle biopsy of a chorea‐acanthocytosis (ChAc) patient with a novel pathogenic mutation of VPS13A gene.

Background: Chorea‐acanthocytosis is present with involuntary movements, psychiatric symptoms, amyotrophy, and erythrocyte acanthocytosis. It is an autosomal recessive inherited movement disorder associated with mutations in VPS13A on chromosome 9q21.

Methods: We report the clinical features, laboratory investigations, and muscle biopsy features of a ChAc patient. And we searched related cases in pubmed database using the following terms: " chorea‐acanthocytosis ", “clinical features “,and "muscle biopsy", search language and unlimited duration. These related cases were summarized and analyzed in combination.

Results: This is a 31‐year‐old male, presenting chronic development of involuntary movements of the face, neck, and upper extremities. An electron microscopy of peripheral blood found an increased number of acanthocytes. A biopsy of the left biceps brachii was performed on the basis of the increased level of CK. H&E staining occasionally revealed small angular and regenerating fibers. Modified Gomori trichrome‐stained cryostat sections displayed a moderate number of the collections of the rod structures preferentially located under the sarcolemma. The sequence analysis of the exome revealed exhibited VPS13A:c.444delA, which was a homozygote mutation of a 38 ‐exon gene on chromosome 9.

Conclusions: ChAc is a familial neurodegenerative disorder with various clinical presentations. This disorder may represent a clinical diagnostic challenge, especially when presentation is atypical. The diagnosis should be considered in patients with movement disorders, psychiatric symptoms, and amyotrophy. Peripheral blood smear, muscle biopsy, and sequence analysis of VPS13A are essential for diagnosis and different diagnoses.

9

A review on hemichorea caused by nonketotic hyperosmolar state

Hafiz Khuram Raza, Jie Zu, Xinxin Yang, Wei Zhang, Chenchen Cui, Chuan‐Ying Xu, Qihua Xiao, Guiyun Cui (Xuzhou, People's Republic of China)

Objective: To increase the awareness of this rare association between hemichorea and diabetes mellitus among physicians.

Background: Movement disorders are common manifestations in different medical illnesses and have been grouped into four main categories; parkinsonism, non‐parkinsonian tremor, chorea and dystonia. Literature regarding chorea has been globally published since 1985 revealing it to be a benign disorder dominantly affecting elderly males. Nonketotic hyperosmolar state in patients with diabetes mellitus can also lead to hemichorea. We have summarized the clinical and diagnostic features and explore the different treatment options in patients with hemichorea caused by nonketotic hyperglycemia.

Methods: We have searched pubmed with keywords chorea, hemichorea, nonketotic hyperosmolar state, and diabetes mellitus, and selected publications which seemed appropriate. We reviewed the clinical and diagnostic features, differential diagnosis, and treatment options of hemichorea associated with nonketotic hyperosmolar state.

Results: Chorea is a very rare complication of nonketotic hyperglycemia. The combination of hemichorea, nonketotic hyperglycemia and, high density in the contralateral striate area of the brain on T1‐weighted image is diagnostic. Other possible causes, however, needs to be ruled out. Patients usually improve once the control of blood glucose is achieved and the prognosis is generally very good.

Conclusions: Nonketotic hyperglycemia should also be considered in patients with hemichorea, but physicians also need to pay attention to other possible causes. Since the patients' clinical state directly depends on the blood glucose levels, the control of diabetes is very critical.

References: 1. Raza HK,Jing J,Cui G,Liang X,Hua F,Zhang Z,Tang H,Shi H,Chen H. Hemichorea caused by nonketotic hyperosmolar state: A case report and review of the literature. Somatosens Mot Res.2017 34 (1):44‐462. Aquino JH, Spitz M, Pereira JS. Hemichorea‐Hemiballismus as the First Sign of Type 1b Diabetes During Adolescence and Its Recurrence in the Setting of Infection. J Child Neurol.2015 30 (10):1362‐5

Clinical Trials and Therapy in Movement Disorders

10

Using smartphones to deliver intensive voice therapy for individuals with Parkinson's disease

Chan Yen, Kartini Ahmad, Chu Shin Ying, Norlinah Ibrahim (Kuala Lumpur, Malaysia)

Objective: This study examined the voice performance outcome and patients' perceptions after intensive voice therapy for individuals with Parkinson's disease (PD) via smartphone.

Background: Among the hypokinetic dysarthria symptoms, hypophonia is the most typical and the main reason for reduced speech intelligibility (1). Intensive voice therapy targeting vocal loudness has been shown to be effective to improve vocal loudness and speech intelligibility in individuals with PD (2). However, the accessibility to intensive voice therapy remain limited, due to patients' restricted mobility, travel issues and unavailability of speech‐language therapists in Malaysia. Smartphones with cellular internet being one of the commonly used telecommunication devices in the 21st century offers the potential to overcome the barriers to deliver the services to these underserved population.

Methods: Eleven participants (mean age 65 years, SD 6.9; mean post‐onset duration 8.5 years; mild‐moderate hypokinetic dysarthria) were recruited to the study. All participants received intensive voice therapy via a free videoconferencing platform in their smartphones (WhatsApp or WeChat). They completed twelve sessions of therapy over four weeks. Their voice performance and perception were measured in person before and after therapy. The outcome measurement tools included a perceptual judgement of voice performance via Consensus Auditory‐Perceptual Evaluation of Voice‐V (CAPE‐V) rated by two speech‐language therapists, measurements of loudness (dB SPL), Voice Handicap Index‐10 (VHI‐10) and the Smartphone Based Therapy Satisfaction Questionnaire (STSQ) ‐ a patient satisfaction questionnaire.

Results: Comparison between pre‐ and post‐ treatment results for measurement of vocal loudness indicated a statistically significant (p<0.05) increase for sustained vowel (pre=67.85 dB SPL, post =73.86 dB SPL) and monologue (pre=58.65 dB SPL, post=64.61 dB SPL) whereas no significant change in reading task. The participants' fundamental frequency (F0) showed no changes after treatment. A series of Wilcoxon signed ranked tests were conducted to examine participants' speech intelligibility and each voice parameter in CAPE‐V. The results revealed significant improvement in speech intelligibility, overall severity and loudness level, with no change in roughness, breathiness, strain, and pitch. A positive response was observed in the participants' perception about their vocal functions post treatment via VHI‐10 (pre =19.73 points, post = 12.91 points, p<0.05). Before the treatment using smartphone, some of the participants were uncertain of the comprehensiveness of instructions, adequacy of time to respond, comfort levels, and preference for face‐to‐face consultation. However, these aspects were significantly improved with more than 70% participants agreeing on all statements in STSQ which reflected a positive experience on smartphone service delivery.

Conclusions: This study demonstrated that intensive voice therapy using smartphones is an effective and feasible method to improve speech and voice performance in individuals with PD. Positive responses from participants about their experience with smartphone delivery method indicated that this novel telepractice method was acceptable. Future studies should examine the effectiveness of intensive voice treatment via smartphones for individuals with PD compared to face‐to‐face in individuals with PD.

References: 1. Holmes, R. J., Oates, J. M., Phyland, D. J. & Hughes, A. J. 2000. Voice characteristics in the progression of Parkinson's disease. International Journal of Language & Communication Disorders, 35 (3), 407–418. 2. Sapir, S., Ramig, L. O. & Fox, C. M. 2011. Intensive voice treatment in Parkinson's disease: Lee Silverman Voice Treatment. Expert Review of Neurotherapeutics, 11 (6), 815–830.

11

Treatment of synkinesis of primary and postparalytic hemifacial spasm with botulinum neurotoxin type a

Junhui Su, Yang Na, Xiaolong Zhang, Yougui Pan, Libin Xiao, Yijing He, Lixi Li, Lingjing Jin (Shanghai, People's Republic of China)

Objective: This study summarizes the therapeutic efficacy and safety of BoNT‐A injection among primary and postparalytic hemifacial spasm patients with facial synkinesis.

Background: It is interesting to note that facial synkinesis could occur in both primary and postparalytic hemifacial spasm. However, studies focused on comparison of efficacy of botulinum neurotoxin type A (BoNT‐A) for treatment of hemifacial spasm combined with synkinesis were seldom reported.

Methods: Twelve patients presenting with postparalytic hemifacial spasm combined with synkinesis during 2009 to 2018 were selected for analysis. With a ratio of 1:2, 24 patients with primary hemifacial spasm combined with synkinesis were included according to the similar gender as post‐paralytic group. Outcomes included latency, duration of effect, dosage of BoNT‐A injection, and satisfaction score of treatment. Moreover, videos containing resting state and 5 voluntary facial movements (eyebrow lifting, frown, eye closure, teeth showing, and pouting), improvement of spasm, and synkinesis were also analyzed in this study.

Results: Except for a significantly higher satisfaction score (84.79±19.81 vs 64.17±31.54, P<0.05) seen in primary hemifacial spasm patients, latency (4.38±2.17 vs 4.67±4.14 days), duration of effect (3.83±2.94 vs 4.96±2.48 days), and dosage of injection (31.35±12.30 vs 26.98±8.75 U) were similar in both groups after BoNT‐A treatment (P>0.05). Moreover, both groups showed a highly efficient rate (91.67% vs 95.83%, P>0.05) of improvement of spasm after BoNT‐A treatment. As for improvement of synkinesis, post‐ paralytic hemifacial spasm showed a higher efficient rate (83.33% vs 58.33%, P>0.05) of severity. As for 5 voluntary facial movement‐related synkinesis, significant improvement of pouting‐induced synkinesis was seen in the primary group (P<0.05).

Conclusions: BoNT‐A was an efficient and safe intervention, not only improving the severity of spasm, but also decreasing the severity of synkinesis. Pouting‐induced synkinesis was significantly improved in the primary group.

References: [1] Green KE, Rastall D, Eggenberger E. Treatment of Blepharospasm/Hemifacial Spasm[J]. Curr Treat Options Neurol, 2017, 19 (11): 41. DOI:10.1007/s11940‐017‐0475‐0[2] Lu AY, Yeung JT, Gerrard JL, et al. Hemifacial spasm and neurovascular compression[J]. ScientificWorldJournal, 2014, 2014: 349319. DOI:10.1155/2014/349319[3] Husseman J, Mehta RP. Management of synkinesis[J]. Facial Plast Surg, 2008, 24 (2): 242‐249. DOI:10.1055/s‐2008‐1075840[4] Kollewe K, Mohammadi B, Dengler R, et al. Hemifacial spasm and reinnervation synkinesias: long‐term treatment with either Botox or Dysport[J]. J Neural Transm (Vienna), 2010, 117 (6): 759‐763. DOI:10.1007/s00702‐010‐0409‐4[5] Colosimo C, Bologna M, Lamberti S, et al. A comparative study of primary and secondary hemifacial spasm[J]. Arch Neurol, 2006, 63 (3): 441‐444. DOI:10.1001/archneur.63.3.441[6] Cohen DA, Savino PJ, Stern MB, et al. Botulinum injection therapy for blepharospasm: a review and report of 75 patients[J]. Clin Neuropharmacol, 1986, 9 (5): 415‐429. [7] Ross BG, Fradet G, Nedzelski JM. Development of a sensitive clinical facial grading system[J]. Otolaryngol Head Neck Surg, 1996, 114 (3): 380‐386. DOI:10.1016/S0194‐59989670206‐1[8] Barbosa ER, Takada LT, Goncalves LR, et al. Botulinum toxin type A in the treatment of hemifacial spasm: an 11‐year experience[J]. Arq Neuropsiquiatr, 2010, 68 (4): 502‐505. [9] Batisti JP, Kleinfelder AD, Galli NB, et al. Treatment of hemifacial spasm with botulinum toxin type a: effective, long lasting and well tolerated[J]. Arq Neuropsiquiatr, 2017, 75 (2): 87‐91. DOI:10.1590/0004‐282X20160191[10] Choe WJ, Kim J. Increasing the area and varying the dosage of Botulinum toxin a injections for effective treatment of hemifacial spasm[J]. Acta Otolaryngol, 2016, 136 (9): 952‐955. DOI:10.3109/00016489.2016.1165864[11] Wang L, Hu X, Dong H, et al. Clinical features and treatment status of hemifacial spasm in China[J]. Chin Med J (Engl), 2014, 127 (5): 845‐849. [12] Fujiwara K, Furuta Y, Nakamaru Y, et al. Comparison of facial synkinesis at 6 and 12 months after the onset of peripheral facial nerve palsy[J]. Auris Nasus Larynx, 2015, 42 (4): 271‐274. DOI:10.1016/j.anl.2015.01.001[13] Xiao L, Pan Y, Zhang X, et al. Facial asymmetry in patients with hemifacial spasm before and after botulinum toxin A treatment[J]. Neurol Sci, 2016, 37 (11): 1807‐1813. DOI:10.1007/s10072‐016‐2670‐2[14] Maria CM, Kim J. Individualized management of facial synkinesis based on facial function[J]. Acta Otolaryngol, 2017, 137 (9): 1010‐1015. DOI: 10.1080/00016489.2017.1316871[15] Markey JD, Loyo M. Latest advances in the management of facial synkinesis[J]. Curr Opin Otolaryngol Head Neck Surg, 2017, 25 (4): 265‐272. DOI:10.1097/MOO.0000000000000376

12

The effects of combined low frequency repetitive transcranial magnetic stimulation and motor imagery on upper extremity motor recovery following stroke

Wenxiu Pan, Pu Wang, Qing Xie (Shanghai, People's Republic of China)

Objective: To investigate the effects of low frequency transcranial magnetic stimulation (LF‐rTMS) combined with motor imagery (MI) on upper limb motor function during stroke rehabilitation.

Background: Hemiplegic upper extremity activity obstacle is a common movement disorder after stroke. Recently, a number of researchers have establish different treatment approaches to augment upper limb activity in rehabilitation 1. Compared with a single intervention, sequential protocol or combination of several techniques has been proven to be better for alleviate motor function disorder 2.Repetitive transcranial magnetic stimulation (rTMS) is one of noninvasive brain stimulations. Randomized controlled trials have shown that short courses of inhibitory, contralesional rTMS can improve the motor function of hemiplegia after stroke 3, 4. Another noninvasive neuromodulation technique‐motor imagery (MI), has been proved to augment the efficacy of rehabilitation 5‐8.

Methods: This study was a single‐blinded randomized controlled trial; investigators were blinded from all assessments carried out. All participants who met the criteria were randomly assigned to two groups by a computer‐generated randomization table. Participants were assigned to 2 intervention cohorts: (1) rTMS+MI group was applied at 1Hz rTMS over the primary motor cortex of the contralesional hemisphere combined with audio‐based MI; (2) rTMS group received same therapeutic parameters of LF‐rTMS, and was applied audio‐based non‐specific MI in the meantime. LF‐rTMS protocol was conducted in 10 sessions over 2 weeks for 30 min. Both groups received the same dosage of conventional rehabilitation on top of their interventions.

Results: Primary outcome measure: (1) The motor functions of the hemiplegic upper limb were measured by the Wolf Motor Function Test (WMFT). Secondary outcome measures included: (1) the Fugl‐Meyer Assessment upper extremity (UE‐FMA) subscore; (2) the Modified Barthel index (MBI), and (3) the Box and Block Test (BBT). All evaluations were conducted at baseline, end‐intervention and 2 weeks postintervention. All assessments of upper limb function improved in both groups at the end‐intervention (week 2) and 2 weeks follow up (week 4). In particular, significant differences were observed between two groups at end‐intervention and after intervention (P<0.05). No serious adverse events occurred in these participants, and no one withdrawed from the study.

Conclusions: The purpose of this study was to investigate the therapeutic effects of LF‐rTMS combined with MI training in chronic post‐stroke patients with upper extremity motor impairment. The results showed that all functional assessments of upper limb improved after the above interventions, and this study also suggested that patient's daily living ability improved accordingly. In these findings, we saw greater changes of WMFT (p<0.01), UE‐FMA (p<0.01), BBT (p<0.01), and MBI (p<0.001) scores in the rTMS+MI group compared with rTMS group. These results demonstrate the efficacy of this combination therapy as a means of improving upper extremity dysfunction in patients with chronic stroke.

References: 1 Yang, N., Zhou, D., Chung, R., Li‐Tsang, C. & Fong, K. Rehabilitation Interventions for Unilateral Neglect after Stroke: A Systematic Review from 1997 through 2012. Front Hum Neurosci 7, 187 (2013).2 Saevarsson, S., Halsband, U. & Kristjansson, A. Designing rehabilitation programs for neglect: could 2 be more than 1+1? Appl Neuropsychol 18, 95‐106 (2011).3 Lefaucheur, J. et al. Evidence‐based guidelines on the therapeutic use of repetitive transcranial magnetic stimulation (rTMS). Clin Neurophysiol 125, 2150‐2206 (2014).4 Hsu, W., Cheng, C., Liao, K., Lee, I. & Lin, Y. Effects of repetitive transcranial magnetic stimulation on motor functions in patients with stroke: a meta‐analysis. Stroke 43, 1849‐1857 (2012).5 Cantillo‐Negrete, J., Carino‐Escobar, R., Carrillo‐Mora, P., Elias‐Vinas, D. & Gutierrez‐Martinez, J. Motor Imagery‐Based Brain‐Computer Interface Coupled to a Robotic Hand Orthosis Aimed for Neurorehabilitation of Stroke Patients. J Healthc Eng 2018, 1624637 (2018).6 Fernandez‐Gomez, E. & Sanchez‐Cabeza, A. [Motor imagery: a systematic review of its effectiveness in the rehabilitation of the upper limb following a stroke]. Rev Neurol 66, 137‐146 (2018).7 Kim, J., Cho, Y., Park, J. & Kim, W. Effect of motor imagery training and electromyogram‐triggered neuromuscular electrical stimulation on lower extremity function in stroke patients: a pilot trial. J Phys Ther Sci 29, 1931‐1933 (2017).8 Guerra, Z., Lucchetti, A. & Lucchetti, G. Motor Imagery Training After Stroke: A Systematic Review and Meta‐analysis of Randomized Controlled Trials. J Neurol Phys Ther 41, 205‐214 (2017).

Cognitive Disorders

13

Molecular aspects of movement disorders, and its association with consanguinity in Pakistani population

Shoaib Rehman (Bannu, Pakistan)

Objective: Purpose of the study was to improve the understanding on genetic basis of movement disorders and use of this information for protective measurements like carrier screening and prenatal diagnosis for movement disorders.

Background: Movement disorders refer to a group of neurological conditions that causes abnormal increased or reduced movements, which may be voluntary or involuntary e.g Ataxia, Parkinson diseases and neurodegenration with brain iron accumulation (NBIA) etc.

Methods: Large consanguineous Pakistani family with autosomal recessive NBIA having multiple affected births was subjected to STS (Single tagged sequence) marker analyses for mapping of homozygosity in known genes and known loci regions using a fluorescence three primer method. All individuals showed exclusion for all known genes and loci regions. Detailed clinical examination was made for two affected of the family and showed phenotype of NBIA. Further its three loops were subjected to the Genome wide scanning using SNP6.0 array for detection of homozygous regions. Two genes, PANK2 and WDR45, were subjected for sequencing as best candidates.

Results: No linkage with the already reported loci and genes was observed during STS marker analysis. Upon sequencing, no mutation/s was observed in PANK2 and WDR45 genes. Genome wide scanning results showed no shared homozygous region for all three loops and even for any two loops, and no match was found for compound heterozygosity.

Conclusions: All these analyses made the molecular genetics of MR6 very complicated and suggest several possible molecular etiologies; it could be compound heterozygous, have three different mutations or be digenic. This complexity of NBIA needs advanced molecular studies like whole exome sequencing and functional analyses to understand the molecular genetics of this disease phenotype.

14

Translating the MMSE into assamese: suggestion for culture and language appropriate sentence prompt

Madri Kakoti (Lucknow, India)

Objective: The current paper explores the relevance of the Mini Mental State Examination (MMSE) in an Assamese speaking population, with specific reference to two questions/prompts used in the said test, and the best methods to modify them.

Background: The MMSE has two prompts that need both a linguistic and cultural translation in Assamese (a north east Indian state)—a prompt asking to spell WORLDS and one to repeat "no ifs, ands or buts". Valcour et al have talked about the low specificity for cognitive empowerment of the phrase.

Methods: The paper suggests ways to remodel the said questions/prompts in a way suitable for the said population, on the basis of a test conducted with 50 people. Of the same 25 people were patients of Alzheimer's Disease as diagnosed by their physicians and 25 people were gender matched control subjects with no history of cognitive impairment. Before and after remodelling the MMSE, all 50 people completed the test and were given the score as indicated in the MMSE score card. The scores were then checked for cognitive impairment specificity by pitting them against scores of the respective patients on the Clinical Dementia Rating scale.

Results: The number question and the alliterative culture appropriate question added to the test are highly specific to the CDR scores of the participants. 100% of the severely cognitively impaired participants of the current test were unable to complete the task to a satisfactory level of completion. The alliterative culture appropriate question also appears to be highly specific to lower CDR scores of 2 and 1‐0.5 as well. All three questions were successfully completed by the gender matched control patients. No cognitively unimpaired participant had any difficulty completely any of the tasks.

Conclusions: It can now be suggested that the Assamese version of the MMSE after translation of all the other points, replaces the spelling question with the number prompt, and the sentence ‘No ifs, ands or buts’ with the language and culture appropriate ‘Teu ha humuniyaah kaahi gusi gol’. Both of these prompts are better suited in specificity and sensitivity to cognitive impairment and are better indicators of impairment as shown by the test conducted with 25 patients diagnosed with AD.

References: Schmitt FA, Cragar D, Ashford JW, et al. “Measuring cognition in advanced Alzheimer's disease for clinical trials”. J Neural Transm Suppl. 2002;62:135–148.• Valcour VG, Masaki KH, Blanchette PL. “The Phrase “No Ifs, ands or buts” and Cognitive Testing, Lessons from an Asian American Community”. Hawaii Medical Journal. 2007;61:72‐74

15

The correlation between cholinergic system related cognitive impairment of Parkinson's disease and the cortical thickness of brain

Siming Rong (Guangzhou, People's Republic of China)

Objective: The aim of this study is to investigate the correlation between cognitive domain impairment such as visuospatial, memory, attention in PD‐MCI and cortical thickness in brain regions accepted the projection from the cholinergic system.

Background: Parkinson disease (PD) cognitive impairment include PD mild cognitive impairment (PD‐MCI) and Parkinson disease dementia (PDD). With the progression of Parkinson's disease, mild cognitive impairment in PD will probably progress to PDD. Therefore, early diagnose of PD‐MCI is very important for the treatment of Parkinson's disease. Though pathogenesis of cognitive impairment of PD remains unclear, more and more studies have found that cognitive impairment of PD involves a variety of neurotransmitter systems including dopaminergic, norepinephrine and cholinergic systems. In 2012, diagnostic criteria of PD‐MCI published by Movement Disorder Society divided cognitive function of PD into five domains domains (attention and working memory, executive function, language, memory, visuospatial function), which define the level diagnostic standard. However, it is unclear whether a single neurotransmitter pathway damage is associated with impairment of a particular cognitive domain in Parkinson's disease. The Dual Syndrome Hypothesis think that dysfunction of the fronto‐striatal dopaminergic system is mainly related to impairment of cognitive domains such as executive function, while dysfunction of the occipito‐parietal, occipito‐temporal cholinergic system is mainly related to impairment of cognitive domains such as visuospatial function, memory and attention 1.

Methods: Patients with Parkinson's disease who were hospitalized and outpatient from June 2015 to January 2018 were enrolled. Each patient underwent MMSE, MoCA, HAMA, HAMD and 10 neuropsycological test including 2 tests within each of the five domains. We define the impairment of memory, attention, visuospatial function as the cholinergic related cognition. According to the Level‐II standard 2 in the diagnostic criteria of PD‐MCI, all non‐dementia patients with Parkinson's disease were divided into PD‐NC group and PD‐MCI group. PD‐MCI group was further divided into PD‐MCI‐CCI group (PD‐MCI with only cholinergic cognitive impairment) and PD‐MCI‐other (PD‐MCI with other pattern of cognitive impairment) according to the impairment of cognitive domain. All subjects underwent 3.0T MR whole brain imaging. Freesurfer software were used to analyze the cortical thickness between PD‐NC and PD‐MCI and PD‐MCI‐CCI.

Results: 35 PD‐NC, 35 PD‐MCI was selected in the study. Among the PD‐MCI group, 18 patients only has memory, attentional and visuospatial dysfunction which we define as cholinergic cognitive impairment. No significant difference was found in age, sex, education, duration of disease, UPDRS‐III, H&Y stage, HAMA and HAMD. Global cognitive function assessment showed that PD‐MCI had lower MMSE and MoCA scores than PD‐NC (MMSE Z=‐4.276,P<0.001,MoCA Z=‐3.649, P=0.001). PD‐MCI have cortical thinning in frontal, temporal, parietal and occipital lobe in the left and right hemisphere compared with PD‐NC. Patients in PD‐MCI‐CCI group had cortex thinning in inferior parietal, pars opercularis, rostral middle frontal, superior parietal in the left hemisphere and in superior frontal, parahippocampal, superior temporal, bankssts, inferior parietal, caudal middle frontal, pars opercularis, pars triangularis in the right hemisphere.

Conclusions: Cognitive domains impairments such as memory, visuospatial and attention in PD‐MCI is related to the thinning of cortex accepted the projection from cholinergic system.

References: 1. Kehagia, A.A., et al, Neurodegener Dis, 2013. 11 (2): p. 79‐922. Litvan, I., et al., Mov Disord, 2012. 27 (3): p. 349‐56.

16

Retrospective study of cognitive dysfunction and dyskinesia, mental disorders, and other related factors in patients with Parkinson's disease

Wei Zhang (Nanjing, People's Republic of China)

Objective: To investigate the relationship between cognitive impairment and age, gender, education years, H‐Y stage, UPDRS II score, duration of disease, mood changes (depression, anxiety) and other factors in Parkinson's disease patients.

Background: Parkinson disease (PD) is a common neurodegenerative disease in the middle‐aged and elderly. The disease was first described by the British doctor James Parkinson system in 1817. The average age of onset of PD is about 60 years old, with an incidence of about 17 / 100000. The exact etiology and pathogenesis of PD have not been fully elucidated, and most scholars believe that it is the result of multiple effects of genetic and environmental factors. The pathophysiological mechanism of PD is mainly the degeneration and deletion of dopaminergic neurons in substantia nigra. The clinical manifestations of PD are progressively worsening myotonia, quiescent tremor, slow movement and abnormal posture and gait. PD patients not only have the above motor symptoms, but also have cognitive dysfunction, autonomic nervous dysfunction, emotional changes and other non‐motor symptoms. With the aging of society, the population of PD is gradually increasing, which brings heavy mental and economic burden to society and families. Not only does dyskinesia have a tremendous impact on the work and daily life of PD patients, but non‐motor symptoms also have an impact on the quality of life of patients. Among them, cognitive impairment is more common in the course of PD patients, can appear in the early and middle stages of the disease, the incidence of late course is higher. It is a transitional state between normal and dementia. According to statistics, dementia is found in 22‐31.3% of PD patients. There are few studies on cognitive impairment of PD in China, and mainly focus on the study of memory impairment in cognitive domain. But there are few studies on the correlation between cognitive impairment of PD patients and age, sex, course of disease, length of education, degree of motor impairment, mental disorders and other factors.

Methods: Eighty Parkinson's patients who were hospitalized in Department of Neurology, Xu Zhou Medical University Affiliated Hospital from December 2015 to December 2017 were selected as the case group. The age, education level, and living habits of the physical examination at the physical examination center of our hospital during the same period were selected. Similar healthy subjects without head cranial lesions, dyskinesia, anxiety and depression were included in the control group. Collecting and recording all relevant clinical data of the subject. The Montreal Cognitive Assessment (MoCA), the Mini Mental State Examination (MMSE), and the Unified Parkinson's disease rating scale (UPDRS) Version 3.0, Part II, The Hamilton Anxiety scale (HAMA) and Hamilton Rating Scale for Depression (HAMD) were used to evaluate the subjects. Statistical analysis of the differences between study variables in the PD group and the control group and the relationship between PD patients' cognitive dysfunction and gender, duration of disease, UPDRS II score, H‐Y stage. All data were processed using SPSS23.0 statistical software. Measurement type data, if obey normal distribution, use ± s; if it does not obey normal distribution, use median and four quantile spacing. For comparisons between two groups, if the variances are equal, an independent sample t‐test is used; if the variances are not homogeneous, a t' test is used. One‐way analysis of variance was used for the comparison between the three groups and the three groups. Multiple comparisons were performed using LSD. The 2 test was used to compare the rates between groups. All tests were performed with a=0.05 as the test level. P<0.05 was considered statistically significant.

Results: 1. Relative indexes of 80 PD patients and 80 healthy controls: Age: PD group averaged 65.10±8.375 years, and control group averaged 64.78±10.499 years. The number of years of education: the average group in the PD group was 7.66 ± 4.6 years, and that in the control group was 7.81 ± 4.543 years. There was no significant difference in the age and education years between the PD group and the control group, and the difference was not statistically significant (P>0.05). The total score of MoCA: the average of PD group was 19.59±5.189 points, 63 (78.75%) were lower than the normal value, and the average was 27.68±1.357 points of the control group, 0 was lower than the normal value. MMSE scores, MOCA score, seven cognitive domains, HAMD depression, HAMA anxiety score between the two groups were differences, differences were statistically significant (P <0.05), the average score of the MMSE score, MoCA score, seven cognitive domains of PD group was lower than that of the control group. The mean values of the HAMD depression and HAMA anxiety scores in the PD group were higher than those in the control group. 2. There was a positive correlation between the 7 cognitive domains scores and MoCA total scores of the two groups of the whole population, and the differences were statistically significant (P<0.05). The visual space and performance ability, attention, abstraction, delayed recall, and orientation scores of the control group were positively correlated with the MOCA total score, and the difference was statistically significant (P<0.05). There was a positive correlation between the 7 cognitive domain scores and the MoCA total scores in the PD group, and the differences were statistically significant (P<0.05). 3. The MoCA total score, naming, attention and language scores of patients with different course of PD were different, and the differences were statistically significant (P<0.05). The MoCA score, name, attention, and language scores for the 1‐5 year course were greater than the corresponding scores for the course of the disease over 10 years. 4. The MoCA total score, naming, and attention score of PD patients with different UPDRS II scores were different, and the differences were statistically significant (P<0.05). UPDRSII score: The MoCA score, naming, and attention score of 15‐30 points are greater than the corresponding score of 30 points or more. 5. The score of MoCA, 7 cognitive domains score, the HAMD depression, anxiety of HAMA were different in different H‐Y stage of PD patients, the differences were statistically significant (P <0.05). The MoCA score, 7 cognitive domains score of H‐Y stage 1‐2 were greater than the score of H‐Y stage:2.5‐3, 4. The score of HAMD depression and HAMA anxiety r of H‐Y stage 1‐2 were rating less than the score of H‐Y stage 4. 6. Of the 80 patients with PD, 47 were men, 29 had cognitive impairment (61.7%), 33 were women, and 17 had cognitive impairment (51.5%). There was no significant difference in the incidence of cognitive impairment among PD patients of different genders. The difference was not statistically significant (P>0.05).

Conclusions: 1. The cognitive impairments of PD patients have a positive correlation with duration, UPDRS II score, H‐Y stage, depression level, anxiety level, and no significant correlation with the patient's gender, age, education years. 2. Delayed recall, language, attention, visual space, and executive dysfunction can better screen cognitive impairment in patients with PD. 3. The longer the disease course of PD patients, the more severe of the name, attention and language disorders; the higher the UPDRSII score of PD patients, the more severe of the name and attention disorder; the higher the H‐Y stage of PD patients, the more severe of the 7 cognitive domain dysfunction, depression and anxiety.

References: 1. Weintraub D, Hauser RA, Elm JJ, et al. Rasagiline for mild cognitive impairment in Parkinson's disease: A placebo‐controlled trial. Mov Disord, 2016;31:709‐714. 2. Domingos JM, Godinho C, Dean J, et al. Cognitive Impairment in Fall‐Related Studies in Parkinson's Disease. J Parkinsons, 2015;5:453‐469. 3. Leroi I, Collins D. Non‐dopaminergic treatment of cognitive impairment and dementia in Parkinson's disease: a review[J]. Journal of the neurological sciences, 2006,248 (1‐2):104‐114.4. He X,Zhang Y, Chen J, et al. Changes in theta activities in the left posterior temporal region, left occipital region and right frontal region related to mild cognitive impairment in Parkinson's disease patients. Int J Neurosci, 2017;127:66‐72. 5. Alty JE, Cosgrove J, Jamieson S, et al. Which figure copy test is more sensitive for cognitive impairment in Parkinson's disease: Wire cube or interlocking pentagons?[J]. Clinical neurology and neurosurgery, 2015,139:244‐246.6. Van Uem JMT, Cerff B, Kampmeyer M, et al. The association between objectively measured physical activity, depression, cognition, and health‐related quality of life in Parkinson's disease[J]. Parkinsonism & related disorders, 2018,48:74‐81. 7. Almuqbel M, Melzer TR, Myall DJ, et al. Metabolite ratios in the posterior cingulate cortex do not track cognitive decline in Parkinson's disease in a clinical setting.Parkinsonism Relat Disord, 2016;22:54‐61. 8. Fullard ME, Tran B, Xie SX, et al. Olfactory impairment predicts cognitive decline in early Parkinson's disease[J]. Parkinsonism & related disorders, 2016,25:45‐51.

Drug‐Induced Movement Disorders

17

This abstract has been withdrawn.

18

This abstract has been withdrawn.

19

Naringenin restores motor and non‐motor deficits and enhances antioxidant status in rotenone‐induced rat model of Parkinson's disease more effectively following pre‐treatment than post‐treatment

Syeda Madiha, Saida Haider (Karachi, Pakistan)

Objective: In the present study, we investigated the effects of pre‐ and post‐supplementation of naringenin on rotenone‐induced neurotoxicity.

Background: The role of oxidative stress has been strongly implicated in age‐related neurodegenerative disorders such as Parkinson's disease (PD). Flavonoids have potential to combat various neurodegenerative diseases. Naringenin is a bioflavonoid and antioxidant against various diseases.

Methods: The study was divided into pre‐ and post‐treatment of naringenin in rotenone‐induced PD model. In pre‐treatment phase rats were supplemented with naringenin (50 mg/kg, p.o.) before the administration of rotenone for two weeks and in post‐treatment naringenin supplemented for two weeks after 8 days of rotenone (1.5 mg/kg, s.c.) administration. Behavioral activities were monitored for motor and non‐motor symptoms of PD. Neurochemical and biochemical estimation was also performed.

Results: Rotenone administration significantly (p<0.01) produced motor, non‐motor deficits, oxidative stress and neurotransmitter alterations compared to controls. Pre‐ and post‐supplementation of naringenin significantly (p<0.01) restored rotenone‐induced motor and non‐motor deficits, enhanced (p<0.01) antioxidant enzyme activities and reversed neurotransmitter alterations.

Conclusions: In conclusion, the results of the present study indicated that pre‐treatment of naringenin showed more enhancing effects as compared to post‐treatment. Our study strongly suggests that daily intake of flavonoids have potential to combat PD.

References: 1) Madiha S, Batool Z, Tabassum S, Liaquat L, Sadir S, Perveen T, Haider S (2018). Therapeutic effects of curcuma longa against rotenone‐induced gross motor skills deficits in rats. Pak J Zool 50: 1245‐1256.2) Rice‐Evans C (2001). Flavonoids antioxidants. Curr Med Chem 8: 797‐807.3) Zbarsky V, Datla KP, Parkar S, Rai DK, Aruoma OI, Dexter DT (2005). Neuroprotective properties of the natural phenolic antioxidants curcumin and naringenin but not quercetin and fisetinin a 6‐OHDA model of Parkinson's disease. Free Radic Res 39: 1119‐1125.

20

Interaction between mGluR5 and NR2B is increased in 6‐OHDA parkinsonian rats with L‐dopa‐induced dyskinesia

Jingya Lin (Shanghai, People's Republic of China)

Objective: In this study, we would like to investigated that whether the interaction of mGluR5 and NR2B occurs in the striatum and to which extent this interaction was involved in the development of LID.

Background: Overactivation and hypersensitivity of glutamatergic signaling in the basal ganglia plays an important role in the pathophysiology of LID. Blockade of ionotropic or metabotropic glutamatergic receptors (mGluRs) has a beneficial effect on dyskinesia. Furthermore, emerging evidence indicates that the function of mGluR5 and NR2B is related in the brain Bioluminescence resonance energy transfer (BRET) imaging has recently revealed that a physical interaction between group I mGluRs and N‐methyl‐D‐aspartate receptors (NMDARs) could underlie the effects of up‐regulated NMDAR activity induced by local mGluRs in hippocampal neurons Overall, the evidence demonstrated that interactions of these two types of glutamatergic receptors induce different functional outcomes in model animals. However, understanding of whether mGluR5‐NR2B interaction is present in experimental parkinsonism and dyskinesia is still lacking NMDARs, particularly the NMDAR subunit NR2B, connect with various cytoplasmic proteins and enzymes via PSD‐95, which couples the C‐terminal of NR2B. Similarly, group I mGluRs bind all Homer proteins through their long C‐terminal intracellular tails. Both the Homer family and PSD‐95 are enriched in the postsynaptic density (PSD). Thus, this physical arrangement may promote protein‐protein interactions among receptors and enable the PSD to transmit various extracellular signals to modulate postsynaptic activity and plasticity Conversely, the physical arrangement might allow Homer1b/c to link NR2B to mGluR5 inside the PSD. In this study, we hypothesized that interaction of mGluR5 and NR2B occurs in the striatum and exerts an important effect on the development of LID.

Methods: We divided the experiments into two parts to determine the importance of the mGluR5‐NR2B interaction. In the first part, we used antagonists to interfere with the mGluR5‐NR2B interaction. Sprague‐Dawley (SD) rats were unilaterally injected with 6‐OHDA in the MFB to produce PD model Rats, The confirmed PD rats were then injected intraperitoneally with either saline or a L‐dopa/benserazide cocktail or saline for 14 days to produce L‐dopa‐induced dyskinesia model animals and their control group. These rats received an intraperitoneal injection of either saline, MTEP or MK801 30 min before the L‐dopa/benserazide cocktail injection and were defined as the LID group, MTEP group and MK801 group, respectively. The confirmed PD rats were then injected intraperitoneally with either saline or a L‐dopa/benserazide cocktail or saline for 14 days to produce L‐dopa‐induced dyskinesia model animals and their control group. These rats received an intraperitoneal injection of either saline, MTEP or MK801 30 min before the L‐dopa/benserazide cocktail injection and were defined as the LID group, MTEP group and MK801 group, respectively. In the two sets of experiments, AIM access and open field tests were conducted in all groups, including the experiments during the treatment period. The behavioral data were recorded by a blinded observer. Striatal tissues were harvested from all animals 2 h after the last injection for co‐immunoprecipitation, immunoblot, western blot and Q‐PCR.

Results: We found the following results: (1) A direct interaction of mGluR5 and NR2B exists in the striatum of SD rats; (2) The interaction of NR2B and mGluR5, as assessed by non‐denatured co‐immunoprecipitation, was significantly increased in the LID group, and this effect was correlated with L‐dopa‐induced dyskinesia. (3) interrupted the interaction with the antagonists of mGluR5 (MTEP), NMDARs (MK801), or the Tat peptide, all of them significantly reduced the interaction between the two receptors, and were accompanied by attenuation of the severity of dyskinesia. (4) the AIM scores and NR2B levels in the mGluR5 precipitates as well as of PKC and p‐ERK1/2 levels in striatal homogenates from the lesioned side and found significant correlations. All these data indicate that the interaction of NR2B with mGluR5 is sensitive to the severity of LID.

Conclusions: Taken together, our findings show that mGluR5 and NR2B interact in the striatum in SD rats and that this interaction was increased following intermittent L‐dopa administration. The increase in interaction was accompanied by improved PKC‐dependent signaling, as demonstrated by an increase in the expression of molecular markers such as epsilon PKC, p‐ERK1/2, c‐fos and pdyn after L‐dopa priming. Therefore, interfering with this interaction might contribute to the simultaneous reduction in AIM scores and the expression levels of the molecular markers. Collectively, these results indicate that NR2B‐mGluR5 interactions in striatal neurons are an important mechanism for LID. Up‐regulation of this interaction is a plastic response to long‐term L‐dopa therapy and may contribute to dyskinetic behavior in LID rats.

References: Aarts, M., Liu, Y., Liu, L., Besshoh, S., Arundine, M., Gurd, J. W., Wang, Y. T., Salter, M. W. and Tymianski, M. (2002) Treatment of ischemic brain damage by perturbing NMDA receptor‐ PSD‐95 protein interactions. Science, 298, 846‐850.Bastide, M. F., Dovero, S., Charron, G., Porras, G., Gross, C. E., Fernagut, P. O. and Bezard, E. (2014) Immediate‐early gene expression in structures outside the basal ganglia is associated to l‐DOPA‐induced dyskinesia. Neurobiology of disease, 62, 179‐192.Calabresi, P., Di Filippo, M., Ghiglieri, V., Tambasco, N. and Picconi, B. (2010a) Levodopa‐induced dyskinesias in patients with Parkinson's disease: filling the bench‐to‐bedside gap. The Lancet. Neurology, 9, 1106‐1117.Calabresi, P., Filippo, M. D., Ghiglieri, V., Tambasco, N. and Picconi, B. (2010b) Levodopa‐induced dyskinesias in patients with Parkinson's disease: filling the bench‐to‐bedside gap. The Lancet Neurology, 9, 1106‐1117.Diwakar, S., Magistretti, J., Goldfarb, M., Naldi, G. and D'Angelo, E. (2009) Axonal Na+ channels ensure fast spike activation and back‐propagation in cerebellar granule cells. Journal of neurophysiology, 101, 519‐532.El Arfani, A., Bentea, E., Aourz, N. et al. (2014) NMDA receptor antagonism potentiates the L‐DOPA‐induced extracellular dopamine release in the subthalamic nucleus of hemi‐parkinson rats. Neuropharmacology, 85, 198‐205.Fieblinger, T., Sebastianutto, I., Alcacer, C., Bimpisidis, Z., Maslava, N., Sandberg, S., Engblom, D. and Cenci, M. A. (2014) Mechanisms of dopamine D1 receptor‐mediated ERK1/2 activation in the parkinsonian striatum and their modulation by metabotropic glutamate receptor type 5. The Journal of neuroscience : the official journal of the Society for Neuroscience, 34, 4728‐4740.

21

ALDH1A1 regulates postsynaptic μ–opioid receptor expression in the dorsal striatal projection neurons and dyskinesia through transsynaptic retinoic acid signaling

Jing Pan, Shengdi Chen (Shanghai, People's Republic of China)

Objective: In order to indicated that dietary supplement of retinoic acid (RA), a product of Aldehyde dehydrogenase 1A1 (ALDH1A1), restored The μ–type opioid receptors (MOR1) expression, supporting a transsynaptic RA signaling in regulating postsynaptic MOR1 levels. And RA supplement had beneficial effects in mitigating L‐DOPA–induced dyskinetic (LID) movements suggesting potential therapeutic applications of RA or related compounds in treating LID.

Background: ALDH1A1 is selectively expressed by the nigrostriatal dopaminergic (nDA) neurons in the ventral tier of substantia nigra pars compacta (SNpc), which preferentially degenerate in Parkinson's disease (PD), the most common degenerative movement disorder. A fraction of ALDH1A1–positive nDA axons innervate the striosome (or “patch”) compartments of dorsal striatum. The MOR1 are selectively expressed by the striatal projection neurons (SPNs) in the striosomes. Both ALDH1A1 and MOR1 levels are reduced in the postmortem PD brains. However, it remains to determine whether downregulation of ALDH1A1 in the presynaptic nDA neurons affect the expression and function of MOR1 in the postsynaptic SPNs, as well as the implications for PD pathogenesis and therapy.

Methods: Using genetically modified mouse models, we examined the expression and function of MOR1 in the brains of postnatal and adult Aldh1a1 knockout (Aldh1a1–/–) and pituitary homeobox 3 spontaneous knockout (Pitx3ak/ak) mice, which lack ALDH1A1 expression and nDA neurons, including the ALDH1A1–positive nDA neurons, respectively. We also applied pharmacological manipulations to restore the MOR1 levels and activity in those mouse models.

Results: We found that a lack of ALDH1A1 in the presynaptic nDA neurons led to severe reduction of MOR1 levels in the postsynaptic SPNs of striosome compartments in the dorsal striatum of postnatal and adult Aldh1a1–/– mice. Dietary supplement of retinoic acid (RA), a product of ALDH1A1, restored MOR1 levels in the dorsal striatum of Aldh1a1–/– mice. RA treatment also upregulated MOR1 expression in the dorsal striatum of Pitx3ak/ak mice, mitigated L‐3,4‐dihydroxypheylalanine (L‐DOPA)–induced dyskinetic movements, and alleviated L‐DOPA induced abnormal hyper activation of protein kinase A (PKA)/extracellular‐signal‐regulated kinase (ERK) pathways.

Conclusions: These findings demonstrate for the first time that the presynaptic expression of ALDH1A1 is required for the postsynaptic MOR1 levels and functions in the dorsal striosomes through transsynaptic RA signaling. Additionally, RA supplement may provide beneficial effects in mitigating L‐DOPA–induced dyskinetic movements through promoting MOR1 activity.

References: Liu G, Yu J, Ding J, Xie C, Sun L, Rudenko I, Zheng W, Sastry N, Luo J, Rudow G, et al: Aldehyde dehydrogenase 1 defines and protects a nigrostriatal dopaminergic neuronsubpopulation. The Journal of clinical investigation 2014, 124:3032‐3046. Kordower JH, Olanow CW, Dodiya HB, Chu Y, Beach TG, Adler CH, Halliday GM,Bartus RT: Disease duration and the integrity of the nigrostriatal system in Parkinson's disease. Brain 2013, 136:2419‐2431. Cai H, Liu G, Sun L, Ding J: Aldehyde Dehydrogenase 1 making molecular inroads into the differential vulnerability of nigrostriatal dopaminergic neuron subtypes in Parkinson's disease. Transl Neurodegener 2014, 3:27. Koppaka V, Thompson DC, Chen Y, Ellermann M, Nicolaou KC, Juvonen RO, Petersen D, Deitrich RA, Hurley TD, Vasiliou V: Aldehyde dehydrogenase inhibitors: a comprehensive review of the pharmacology, mechanism of action, substrate specificity, and clinical application. Pharmacological reviews 2012, 64:520‐539.

Dystonia

22

Familial Dystonia in patients with pantothenate kinase‐ associated neurodegeneration and magnetic resonance imaging eye‐of‐tiger sign: two case reports.

Tuan‐Anh Nguyen, Tran Thanh, Thi‐Hung Nguyen (Ho Chi Minh City, Viet Nam)

Objective: To decribe two cases of familial early adulthood‐onset dystonia with abnormal brain MRI.

Background: Pantothenate kinase‐ associated neurodegeneration (PKAN), formerly called Hallervorden‐Spatz disease, is a rare disorder characterized by progressive extrapyramidal dysfunction and dementia 1. It is the first identified and most common subtype of neurodegenerative brain iron accumulation (NBIA) with iron deposition in basal ganglia, particularly globus pallidus. PKAN is autosomal recesive disorder caused by mutation over PANK2 gene on 20p13. The age of onset is the late childhood or early adolescence. The precise incidence of this syndrome is unknown. It is estimated to affect 1 to 3 per million people worldwide. The clinical manifestation is characterized by progressive dementia, spasticity, rigidity, dystonia, and choreoathetosis. Magnetic resonance imaging (MRI) of brain shows abnormal low T2 signal in the globus pallidus bilaterally which is known as “the eye of the tiger” sign.

Methods: Case report Case 1: A 24 year‐old female presented her symptoms at the age of 22 with rigidity of tongue, mandibular and cervical muscles. One month later, she developed difficulties in eating because her tongue couldn't transport food into pharynx. Subsequently, she had abnormal posture of the spine and right‐sided slowsiness. On neurological examination, her Mini Mental State Exam (MMSE) was normal (30/30). She had oromandibular (jaw‐opening type) dystonia and retrocollis. Her gait was in unnaturally backward position in standing and walking. She has mild right‐sided bradykinesia. Blood test showed normal ceruloplasmin, calcium, phosphate, AST,ALT, PTH, Fe, FerritinHer symptoms didn't respond to Madopar 250mg (1 tablet x 6/day) and Trihexyphenidyl 2mg (2 tablets x 3/day), even worsened with Baclofen. Case 2: This is 22 year‐old male who is a younger brother of the first patient. His symptoms started earlier at the age of 20. He had the similar clinical presentation with rigidity of tongue, mandibular and cervical muscles but not abnormal posture or limbs. His MMSE result was normal. He also did not response to Madopar, Trihexyphenidyl or Baclofen. MRI of 2 cases revealed simillar abnormality: low‐signal intensity rings surrounding the central high‐signal intensity regions in the medial aspects of bilateral globus pallidus on T2 weighed MRI (The eye of the tiger sign). Remaining members of 3 generations of family are healthy.

Results: Approaching to dystonia, it can be classified by the age of onset, distribution, and aetiology. Our cases occurred at early adulthood‐onset, manifested oromandibular and spinal dystonia, dopamin‐unresponsive parkinsonism, and had “the eye‐of‐the tiger” sign in brain MRI 2. These features suggested PKAN because there is one‐to‐one correlation between a specific radiography finding, “the eye‐of‐the tiger” sign and this disorder 2. This disease is one of extrapyramidal disorders associated with increased accumulation of brain metal 3. The other two disorders are Wilson's disease, Neuroferritinopathy. In Wilson's disease, neurological manifestations come along with obviously abnormal liver function, and serum ceruroplasmin was clearly decreased. In our cases, these features are absent so we don't think of this diagnosis. Neuroferritinopathy is an autosomal dominant, late‐onset basal ganglia disorder resulting from mutation in the gene for ferritin light chain 1 (FTL1) on chromosome 19q13. Mean age of onset is around 40 years. Serum ferritin concentration may be low. We excluded this diagnosis because our cases were expected as an autosomal recessive disorder, earlier onset and serum ferritin concentration was normal. As mentioned above, our cases should be diagnosed as pantothenate kinase‐ associated neurodegeneration (PKAN), known as Hallervorden‐Spatz disease. Their brain MRIs were abnormal with “the eye of the tiger” sign. However, dementia hasn't presented yet because our patients are at the early stage of the disease. So we need to spend more time for follow‐up in the future. In Vietnam, genetic test has not been available. Eventhough there is no genetic analysis, pantothenate kinase‐associated neurodegeneration, a form of neurodegeneration with brain iron accumulation (NBIA) still is considered as the cause of our patients with familial dystonia.

Conclusions: Our two rare cases of pantothenate kinase‐ associated neurodegeneration are first published in Vietnam. The most important thing is genetic analysis which is unavailable now to confirm the diagnosis and find out effective treatment to improve the patient's quality of life. Further investigation is needed in the future.

References: 1.Dashti, M., & Chitsaz, A. (2014). Hallervorden‐Spatz disease. Advanced Biomedical Research, 3, 191. http://doi.org/10.4103/2277-9175.1406232. Hayflick SJ, Westaway SK, Levinson B, Zhou B, Johnson MA, Ching H, Gitschier J. Genetic, clinical, and radiographic delineation of Hallervorden‐Spatz syndrome. N. Engl. J. Med. 2003;348:33–403.Gregory, A., Polster, B. J., & Hayflick, S. J. (2009). Clinical and genetic delineation of neurodegeneration with brain iron accumulation. Journal of Medical Genetics, 46 (2), 73–80. http://doi.org/10.1136/jmg.2008.061929

Image 1.

case 1

Image 2.

case 1

Image 3.

case 2

Image 4.

case 2

Image 5.

case 1

Image 6.

case 2

23

Dystonic storm following battery depletion in the subthalamic nuclei stimulation for dystonia secondary to pantothenate kinase‐associated neurodegeneration

Li Xia, Zhang Cheng, Li You, Wu Wen (Shanghai, People's Republic of China)

Objective: To describe the characters, mean of positive therapy of dystonic storm resulted from battery depletion in the patient with Pantothenate kinase‐associated neurodegeneration (PKAN) underwent Subthalamic Nuclei Stimulation (STN).

Background: Deep brain stimulation (DBS) has been reported to improve motor function in the patient with PKAN. The sudden cessation of stimulation can trigger a rare complication‐ dystonia storm, which have been studied in the other type of dystonia.

Methods: We present a 17‐year‐old girl with severe dystonic storm induced by unilateral battery depletion of STN‐DBS in the patient of generalized dystonia secondary to PKAN syndrome which was diagnosed by the eye‐of‐the‐tiger sign (Figure 1) and genetic screen of PKAN2, and meanwhile reviewed three patients with dystonic storm triggered by failure of DBS devices. (Table 1)

Results: The patient presented a fever, sweating, increasingly frequent episodes of dystonia involving neck, trunk and bilateral limbs and continuous orofacial dystonia resulted in swallowing failure, with painful muscle spasms. The laboratory signs, like leukocyte and serum CK, are positive. She scored 78/120 on the motor part and 26/30 on the disability part of BFMDRS. The BFMDRS score dropped to 45.5/17 (motor/disability) one month after exchanging new battery.

Conclusions: Dystonic storm is a severe episodes of hyperkinetic movement disorders that needed urgent hospital admission. Importantly, preemptive devices of DBS are the effective solution to prevent the harm resulted from dystonic storm.

References: Termsarasab P, Frucht SJ. Dystonic storm: a practical clinical and video review. J Clin Mov Disord 2017;4:10.

Figure 1.

 

Table 1.

Clinical characteristics of our report and 3 other reports with dystonic storm triggered by failure of DBS IPG^a

Article	Primary disease	Cause	Treatments	Outcome
Rohani et al2	tardive dystonia	depletion of the IPG	endotracheal intubator and intravenous midazolam	the patient died from bradyarrhythmia and asystole
Sobstyl et al3	primary generalized dystonia	unilateral discontinuation of pallidal stimulation	intravenous bicarbonate propofol and fentanyl, tracheal intubation and restoration of bilateral pallidal stimulation	patient's status improved within 2 weeks
Cheung et al7	DYT1 dystonia	cessation of stimulation	intravenous sedation and initiation of pallidal stimulation	the patients were recovered after up to 29 days
Lee et al	PKAN syndrom	unilateral battery depletion	exchange new battery	patient's status improved within one week

^aIPG: internal pulse generator; PKAN: Pantothenate Kinase‐Associated Neurodegeneration

24

This abstract has been withdrawn.

25

Therapeutic effect of repetitive transcranial magnetic stimulation on writer's cramp

Lin Wang, Yingmai Yang, Xinhua Wan (Beijing, People's Republic of China)

Objective: The current prospective study was to observe the treatment efficacy of rTMS for writer's cramp.

Background: Focal hand dystonia (FHD) is a disorder characterized by involuntary contraction and co‐contraction of muscles of the hand causing abnormal posturing and reduced fine motor control. Writer's cramp is the most prevalent types of FHD. Because writer's cramp will affect hand function and thus influence the work ability and career development of the patients, most of them have the desire for treatment. The current treatments mainly include oral medication and botulinum toxin injection. Oral medication is only valid for the mild patients. The efficacy of the treatment with botulinum toxin injection is less than that of the other focal dystonia, e.g. cervial dystonia and blepharospasm, and also accompanies obvious hand weakness. At present,the general understanding is that the mechanism of dystonia is related to loss of inhibition. Repetitive transcranial magnetic stimulation (rTMS) is a new type of noninvasive and safe neural regulation method and has been utilized by other researchers on dystonia. The preliminary results illustrate that low frequency rTMS might have the function of increase inhibition and improve symptoms.

Methods: Fifteen primary writer's cramp patients were enrolled in the study. Ten patients were allocated into the treatment group, and five patients were in the control group. In the treatment group, 1Hz rTMS was performed at an intensity of 90% resting motor threshold (RMT). Over the left premotor cortex 1200 stumuli per day were delivered for five consecutive days. Clinic effect evaluation and patients' self‐evaluations had been performed before the first treatment and after five days of the treatment. The sham stimulations on the same sites were executed for control group.

Results: Writer's cramp rating scale (WCRS), Burke‐Fahn‐Marsden scale (BFM), writing time before and after the treatment in both treatment group and control group had no statistical significance. The WCRS and BFM scale and writing time between treatment group and control group have no statistical significance. But the variation of the WCRS,BFM movement scale after rTMS in treatment group are obviously higher than that of control group. The differences of the subjective self‐evaluations in these two groups have statistical significance (P=0.006).

Conclusions: Consecutive low frequency rTMS can improve writer's cramp patients' subjective self‐evaluations and has the improvement tendency on the corresponding scales, which suggests that rTMS has the improvement tendency on the clinical symptom of writer's cramp. Further studies with enlarged sample numbers or with more sensitive observation criteria are suggested.

References: [1]Siebner HR, Tormos JM, Ceballos‐Baumann AO, et al. Low‐frequency repetitive transcranial magnetic stimulation of the motor cortex in writer's cramp. Neurology, 1999, 52: 529‐537. [2]Borich M, Arora S, Kimberley TJ. Lasting effects of repeated rTMS application in focal hand dystonia. Restor Neurol Neurosci, 2009, 27: 55‐65.

26

A case of neck and upper limb movement disorder onset static encephalopathy starts with with delayed dystonia.

Yixi He (Shanghai, People's Republic of China)

Objective: A case of neck and upper limb movement disorder onset static encephalopathy starts with with delayed dystonia.

Background: A variety of cerebral insufficiency can result in static encephalopathy with developmental delays and relatively fixed motor and cognitive deficits.

Methods: Try to describe the clinical features and diagnosis and treatment of patients.

Results: A 24‐year‐old male patient developed involuntary twitch of his upper limbs without obvious cause 3 months ago, and his head and neck fell backward, limbs muscle tension without any obvious cause, uncombined with conscious disorders or no limbs twitch. He was admitted to a hospital for treatment in other hospitals and considered muscular dystonia and cerebral palsy. He was given 0.5 tablet Madopar 4 times a day and 0.25 tablet of clonazepam 3 times a day. However therapeutic effect didn't show well.Physical Examination: Conscious mind, vague, owe cooperation. Bilateral pupils are equal size and rounded, and are sensitive to light reflex. Bilateral eye movement is in place without nystagmus and staring. Cervical and limbs muscle hypertension. Bilateral tendon reflex (+++). The patient was incooperative in muscle strength, coordination movement and sensory examination. Bilateral Babinski (+). Meningeal irritation sign (‐).After admission, the patients were treated with baclofen, methadone, clonazepam and benzodiazepine to relieve muscle tension. The patient's head and neck were tilted back, and EMG indicated extensive muscular dystonia in the extremities and neck. Thus local botulinum toxin injection in neck muscle was gives.

Conclusions: Patients with static encephalopathy with delayed dystonia may be treated with botulinum toxin injection if the oral medication is not effective. The case regrets that no cranial MR and genetic tests were performed for further identification.

References: [1] Beran‐Koehn MA.Violent recurrent ballism associated with infections in two children with static encephalopathy. [J]Mov Disord. 2000 May;15 (3):570‐4.

Education in Movement Disorders

27

Knowledge and Perception of Parkinson's disease among Patients and Caregivers.

Xing Yan Choo, Yan Jing Tan, Yong Wei, Jia Lun Lim, Mohamad Azhan, Kar Foo Lau, Chong‐Tin Tan, Karuthan Chinna, Shen‐Yang Lim, Ai Huey Tan (Johor Bahru, Malaysia)

Objective: We aimed to develop and validate a questionnaire to evaluate the level of knowledge and perception regarding Parkinson's disease (PD) among patients and caregivers.

Background: Relatively little is known about patients' and caregivers' knowledge and perceptions regarding PD, which have important implications for patient and caregiver self‐efficacy, health‐seeking behaviours and access to appropriate treatments.

Methods: The Knowledge and Perception of Parkinson Disease Questionnaire (KPPDQ) was developed based on local and international resources, and expanded from the Knowledge of Parkinson's Disease Questionnaire (KPDQ) published in 2013. Part 1 of the KPPDQ tests recognition of PD motor and non‐motor symptoms (NMS), part 2 tests general knowledge regarding PD, and part 3 assesses perceptions towards various aspects of the disease (disease burden, treatment perspectives, stigma, and care in advanced disease). Content validity was tested among 5 movement disorder neurologists. The KPPDQ was subsequently translated and back‐translated into the Chinese and Malay language, and administered to consecutive patients and caregivers attending the Neurology Clinic.

Results: All items were scored relevant by movement disorder neurologists. Cognitive debriefing revealed that the questionnaire was readable and the intended meaning was clear. Items lacking in clarity were revised. To date, 32 patients and 28 caregivers have completed the KPPDQ. For parts 1 and 2, preliminary data revealed that urinary problems, visual hallucinations, swallowing difficulty and reduced sense of smell were poorly recognised by patients and caregivers. Overall, motor symptoms were better recognized than NMS. Common misperceptions included “all PD patients experience tremor”, “PD is diagnosed using a brain scan”, and “there is a cure for PD”. A larger samples size is currently being recruited for evaluation of psychometric properties.

Conclusions: Important gaps in knowledge were evident, which could present a barrier to early diagnosis and appropriate treatment of PD. A well‐designed questionnaire with good internal consistency and retest reliability is important to help better understand patients' and caregivers' knowledge perception towards the disease and treatment.

References: A.H. Tan, C.T. Tan, C. Marras, K.W. Loh, N.W. Wye Ho, Q.H. Lim, et al., (2015). Knowledge of Parkinson's disease in a multiethnic urban Asian setting, J. Parkinson's Dis. 5 (4) 865–879.Jitkritsadakul O, Boonrod N, Bhidayasiri R (2017). Knowledge, attitudes and perceptions of Parkinson's disease: A cross‐sectional survey of Asian patients, J.Neurol Sci. 374:69‐74. doi: 10.1016/j.jns.2016.12.063.Khan AU, Akram M, Daniyal M, Zainab R (2018). Awareness and current knowledge of Parkinson disease: A Neurodegenerative disorder. Int J Neurosci :1‐64. doi: 10.1080/00207454.2018.1486837.

Table 1.

Demographic data

Clinical Characteristics	PD Patients (n= 32)	Caregivers (n=28)	P value
Age	65.16+9.616	57.07±14.762	0.014
Gender (%male)	71.9	39.3	0.023
Race
% Chinese	59.4	67.9	0.688
% Malay	25.0	25.0
% Indian	12.5	7.1
% Others	3.1	0.0
Education Level
% Tertiary	46.9	46.4	0.761
% Secondary	40.6	46.4
% Primary	12.5	7.1
%none	0.0	0.0
Healthcare‐related Work (%Yes)	3.1	10.7	0.331
Attendance at educational events (%Yes)	15.6	17.9	1.000

Table 2.

Recognition of Parkinson's disease symptoms (percentage of correct responses for each symptom)

	Percentage of correct responses (%)
	PD Patients (n=32)	Caregivers (n=28)	P value
Slowness of movement	96.9	96.4	1.000
Seizures/ Fits	65.6	60.7	0.900
Tremors (involuntary shaking movements)	93.8	96.4	1.000
Rigidity (muscle stiffness)	81.3	85.7	0.737
Imbalance/ tendency to fall	84.4	89.3	0.712
Walking problems	81.3	85.7	0.737
Memory problems	53.1	67.9	0.369
Low mood/depression	62.5	78.6	0.283
Visual hallucinations (seeing things or people that are not really there)	40.6	39.3	1.000
Reduced sense of smell	46.9	25.0	0.137
Hearing loss	46.9	42.9	0.959
Speech difficulty	71.9	75.0	1.000
Swallowing difficulty	43.8	53.6	0.617
Pain	53.1	57.1	0.959
Urinary problems	37.5	35.7	1.000
Constipation	68.8	57.1	0.508
Acting out dreams (e.g. punching, kicking or shouting) during sleep	65.6	71.4	0.838
Difficulty sleeping/insomnia	59.4	53.6	0.848

Table 3.

Recognition of Parkinson's disease symptoms (average number of symptoms correctly identified)

Symptom Category	Mean number of symptoms answered correctly		P value
	PD Patients (n=32)	Caregivers (n=28)
Motor symptoms (maximum=5)	4.38±0.976	4.54±0.962	0.524
Non‐motor symptoms (maximum = 11)	6.13±3.210	6.14±2.889	0.982
Total symptoms (maximum=16)	10.14±3.968	11.06±2.955	0.436

Table 4.

General knowledge regarding Parkinson's disease

Statements	Percentage with correct responses		P value
	Patients (n=32)	Caregivers (n=28)
Parkinson's disease and Alzheimer's disease are different names for the same disease	59.4	75.0	0.314
Parkinson's disease is a degenerative disease of the brain (associated with loss of brain cells)	96.9	75.0	0.020
In Parkinson's disease, the level of a chemical (neurotransmitter)in the brain called dopamine is reduced	87.5	75.0	0.361
All patients with Parkinson's disease experience tremor (involuntary shaking movements)	21.9	25.0	1.000
Parkinson's disease can initially affect one side of the body	75.0	46.4	0.045
Parkinson's disease is more common in older persons	59.4	53.6	0.848
Parkinson's disease can also affect young adults	62,5	85.7	0.083
Parkinson's disease usually affects multiple members of the same family	40.6	46.4	0.848
Parkinson's disease is diagnosed using a brain scan (MRI)	21.9	28.6	0.765
There are treatments that can improve the symptoms of Parkinson's disease	90.6	78.6	0.281
There are new treatments that can cure Parkinson's disease	46.9	35.7	0.540
Patients with Parkinson's disease usually become wheelchair‐dependent within 3 years of diagnosis	65.6	71.4	0.838

Epidemiology

28

Prevalence of restless legs syndrome among Parkinson's disease in the Asian population: a systematic review and meta‐analysis of real world studies

Md Azharuddin, Mohammad Adil, Pinaki Ghosh, Manju Sharma (New Delhi, India)

Objective: The objective of this study to conduct a systematic review and meta‐analysis to estimate the prevalence of Restless legs syndrome (RLS) in Parkinson's disease patients in Asia.

Background: Restless legs syndrome (RLS) is a neurological disorder characterized by an irresistible urge to move the legs especially at evenings that lead to insomnia. The evidence established the dopaminergic link between Parkinson's disease and restless legs syndrome. It has shown to negatively impact the quality of life of patients. Hence, the overall prevalence of RLS among Parkinson's disease may provide better clinical decision making.

Methods: A systematic search of English articles on PubMed/Medline and Web of Science was performed from inception to August 2018, to identify the relevant studies that estimate the prevalence of RLS among Parkinson's disease patients in Asia. A meta‐analysis was performed using “meta” package within the R programming (R 3.5.0). Publication bias was assessed using Egger's and Begg's tests.

Results: Of the 344 relevant literature, we included 12 studies after meeting the inclusion criteria. The total of 2472 participants was included. with a mean age of 64.3 years. RLS was defined according to the International Restless Legs Syndrome Study Group (IRLSSG) or based on clinical interview. Among 12 publications, 3 each were from Japan and South Korea, 2 were from India, and one each from Singapore, Malaysia, Thailand, and China respectively. The random effect model estimated the pooled prevalence of RLS, which was 10.9% (95% confidence interval 7.3‐15.8), with a high degree of heterogeneity (I2 = 91%, p<0.01). The RLS prevalence was reported higher in Thailand (38.3%), whereas the lowest prevalence was reported in Singapore (3.0%). The Egger's and Begg's tests were suggesting no significant (p>0.05) risk of publication bias.

Conclusions: The summary of this systematic review and meta‐analysis indicated the presence of a high degree of heterogeneity, results into there is a considerable amount of uncertainty regarding the prevalence of RLS among Parkinson's disease patients in Asia.

References: 1. Egger M, Smith GD, Schneider M, Minder C. Bias in meta‐analysis detected by a simple, graphical test. Bmj. 1997 Sep 13;315 (7109):629‐34.2. Allen RP, Picchietti D, Hening WA, et al. Restless legs syndrome: diagnostic criteria, special considerations, and epidemiology. A report from the restless legs syndrome diagnosis and epidemiology workshop at the National Institutes of Health. Sleep Med 2003;4 (2):101e19.

29

High serum total cholesterol level decreases the risk of Parkinson's disease: a systematic review and meta‐analysis

Gaurav Nepal (Kathmandu, Nepal)

Objective: To reach a convincing conclusion on the association between serum cholesterol level and risk of Parkinson's disease (PD).

Background: PD is a neurodegenerative disorder, which leads to progressive deterioration of motor function due to loss of dopaminergic neurons in the substantia nigra of the basal ganglia. The disease pathophysiology is largely idiopathic and may result from a complicated interplay of genetic and environmental factors. Recently, a growing number of literature have provided evidence that circulating cholesterol is related to PD. However, these studies have revealed conflicting results with no clear conclusions.

Methods: We searched multiple electronic bibliographic databases to identify studies published from 1990 to 2018. Following the application of inclusion and exclusion criteria, the relative risk estimates of all the included studies were employed to estimate the pooled RR using the inverse variance random‐effects method. The Newcastle–Ottawa Scale was used to assess the risk of bias, and the publication bias was detected by using a funnel plot, Begg's test, and Egger's test.

Results: Our study included a total of 266,677 subjects with 7,057 PD cases. High serum cholesterol level was associated with a significantly reduced risk of PD (RR=0.66, 95% CI: 0.52–0.85, P <0.0001). Study result was stable even after sensitivity analysis. There was no evidence of publication bias.

Conclusions: In conclusion, our meta‐analysis supported the hypothesis that high serum cholesterol was associated with significantly reduced risk of PD. Our findings provide important insights into the molecular pathways underlying the etiology of idiopathic Parkinson's disease and highlight a key role of serum cholesterol level in Parkinson's disease pathogenesis.

Table 1.

 

Figure 1.

 

30

Parkinson's distribution by age, gender, occupation and motor, non‐motor symptoms in Pakistani population.

Saima Naureen, Nafees Ahmad (Rawalpindi, Pakistan)

Objective: Present study was designed to investigate Parkinsons disease distribution by occupation, age and gender wise occurrence of PD.UPDRS III was used to assess severity for motor symptoms and most common non motor symptoms among Pakistani population.

Background: Parkinson is second common neurodegenerative disorder characterized by rigidity, bradykinesia, and postural instability with motor and non motor manifestation.

Methods: This hospital based study was carried for one and half year from October 2016 to January 2018 from a local neurological unit visited by thousands of patients anually. Informed written consent was obtained from all patients with detailed interview to obtain demographic and clinical information. Trained neurologist diagnosed each case under the guidelines of UPDRS scale. motor and non mootor symptoms severity was recorded and analyzed.

Results: Total 241 patients were evaluated for the present study. Parkinson's syndrome and secondary cases were excluded by necessary clinical and radiological evaluation. From data it was seen that 189 were male and 52 were females. 177 patients had tremor dominant PD among which fifty six of the PD patients have at least one family relative positive for PD. Age wise distribution of disease shows youngest case at the age of 29 years with minimum Parkinson's patients in the age group of 31‐40 ( 4%). Most patients are in the age group of 51‐60 (41%) with minimum difference from the age group of 61‐70. Maximum age recorded was 85 years. Occupation wise distribution of patients revealed that 13% were laborers, 5% teachers, 2% engineers, 49% farmers, 12% drivers, 10% shopkeepers and 9% military workers. Here farmers and laborers were directly or indirectly linked to pesticides and heavy metal exposure respectively. Among patients 23% were smokers and remaining 77% were non‐smokers. Tea consumption is common among rural than urbans (21% of total PD cases). All cases were assessed for motor symptoms by using the UPDRS III (speech, facial expression, tremor at rest rigidity, rapid alternating hand movement, finger taps, bradykinesia/hypokinesis, pull test). Mean UPDRS –III score does not differ much among male and female at disease onset and progression. Tremor frequency is more among the age group between 61‐70. Most common non motor symptoms among our population were insomnia, constipation, apathy, sweating, taste change, neuropsychiatric and gastrointestinal disturbances.

Conclusions: Familial PD contributes to 40% of PD cases among Pakistani population. Smoking might have a protective role over PD occurrence. Farmers are more affected with PD, needs further investigation to see the effect of pesticides and metal exposure. Probability of sleep difficulties and nighttime awakening are common in majority of PD patients.

Genetics (Non‐PD)

31

Co‐expression network‐based analysis of genome wide association data and disease genes links polyglutamine neurodegenenerative diseases with depression

Miaozhen Huang, Miaozhen Huang, Dineke Verbeek (Groningen, Netherlands)

Objective: The objective of this study was to exploring the genetic link between polyglutamine (polyQ) neurodegenerative diseases (NDs) and depression, and to expose the shared pathways using gene co‐expression network and pathway analysis.

Background: Several studies showed a higher prevalence of depression in polyQ NDs cases compared to the general population. Depressive cases are also more prone to develop NDs. Thus, we hypothesize the existence of shared pathways underlying both diseases.

Methods: Co‐expression analysis was performed via GeneNetwork with 1451 Genome Wide Association Studies loci (GWAS) of depression obtained from the GWAS Catalog and 9 polyQ disease genes referring to spinocerebellar ataxia type 1,2 3, 6, 7, and 17, Huntington's disease, Dentatorubro‐pallidoluysian atrophy, and Spinal and bulbar muscular atrophy. First, pathway analysis was performed on the gene networks for depression and polyQ‐NDs using databases including DAVID and PANTHER. Second, pathway and protein‐protein interaction analysis was performed on shared genes between both gene networks followed by a multi‐gene expression query in different brain regions by GETxportal.

Results: We identified 67 pathways in the gene network of depression and 66 pathways in the gene network of polyQ ND. Of these pathways 15 were shared between depression and polyQ‐ND. Upon network analysis of 19 shared genes between the two gene networks we revealed several unique pathways that were significantly enriched including transcription regulation and chromatin modifying enzymes and organization, ubiquitination. The Protein‐Protein interaction network analysis of the shared genes pointed to a role for BPTF, Bromodomain PHD Finger Transcription Factor, which is a key gene in transcription regulation. Notably, almost all shared genes are highly expressed in cerebellum and the cerebellar hemisphere.

Conclusions: In our study, we were able to identify shared pathways and genes linked to both depression and poly‐Q NDs. Our data proposes a key role for transcription regulation via BPTF in the shared pathogenesis of these diseases. Interestingly, no link is yet reported for BPTF in the etiology of depression or polyQ‐NDs. Likewise the role of the cerebellum in this shared pathogenesis is yet not known. Further studies are necessary to further explore the shared components underlying the molecular mechanisms of depression and poly‐Q NDs.

32

Association of SLC1A2 and PPARGC1A with essential tremor in southern Chinese

Gen Li, Pei Huang, Shishuang Cui, Shengdi Chen (Shanghai, People's Republic of China)

Objective: The aim of this study was to investigate between several genetic markers and essential tremor (ET) in Chinese population.

Background: Essential tremor (ET) is a common movement disorder mainly characterized by kinetic and postural tremor predominantly in both upper limbs and may involve other regions of body. The prevalence of ET in individuals in China was 0.306%. It is a burden to patients no matter physically or psychologically and affects daily lives of patients.Genetic factors play an important role in the pathogenesis of ET. With the help of genomewide association study and whole‐exome sequencing, several single nucleotide polymorphisms (SNPs) and mutations associated with ET were revealed, such as LINGO1, HAPLN4, SCN4A, USP46, HTRA2, HS1BP3, DRD3, SLC1A2, FUS, KCNS2, NOS3, TENM4, STK32B, CTNNA3 and PPARGC1A. Several studies were focused into Asian ET. However, a few SNPs were studied in these researches. Thus, in this study, we selected 16 SNPs and 16 mutations to further test the relationship of these genetic risk factors with ET in Chinese population.

Methods: 144 familial ET patients, 156 sporadic ET patients and 300 controls were recruited. MassArray and SNaPShot were used to detect 16 single nucleotide polymorphisms (SNPs) and 16 mutations. Meta‐analysis was performed.

Results: Dominant model and overdominant model of rs3794087 of SLC1A2 were associated with ET (Dominant: p: 0.019, OR: 1.50; Overdominant: p: 0.010, OR: 0.63). rs17590046 of PPARGC1A was associated with ET in Asian population after meta‐analysis (Alleleic: p: 0.009, OR: 0.70; Dominant: p: 0.014, OR: 0.70; Overdominant: p: 0.029, OR: 1.38.).

Conclusions: Our results suggested that the association of SLC1A2 with ET in Chinese population. In Asian population, PPARGC1A was associated with ET. More large ET cohorts are warranted.

Table 1.

Demographic data of cases and controls

	ET Patients (N=300)	Controls (N=300)	p Value
Gender, Female, N (%)	152 (50.67)	146 (48.67)	0.683
Age, Mean (SD), years	58.43 (14.04)	64.70 (9.77)	<0.001
Familial ET, N (%)	144 (48.00)	‐	‐

ET: Parkinson's disease; SD: standard deviations

Table 2.

Association of SNPs of candidate genes and odds ratio to ET risk

	Candidate Gene	SNP	Model	p valuea	ORa	95% CIa
ET v.s. Control	SLC1A2	rs3794087	Dominant	0.019	1.50	(1.07, 2.10)
	SLC1A2	rs3794087	Overdominant	0.010	0.63	(0.45, 0.90)
Familial ET v.s. Control	STK32B	rs10937625	Allele	0.019	1.59	(1.08, 2.36)
	STK32B	rs10937625	Additivec	0.020	‐	‐
	SLC1A2	rs3794087	Dominant	0.031	1.58	(1.04, 2.39)
	STK32B	rs10937625	Dominant	0.018	1.71	(1.09, 2.67)
	CTNNA3	rs10822974	Dominant	0.049	1.72	(1.02, 3.01)
	SLC1A2	rs3794087	Overdominant	0.025	0.61	(0.40, 0.94)
	STK32B	rs10937625	Overdominant	0.029	0.60	(0.38, 0.95)
Sporadic ET v.s. Control	DRD3	rs6280	Allele	0.035	1.42	(1.02, 1.97)
	DRD3	rs6280	Additivec	0.037	‐	‐
	DRD3	rs6280	Recessive	0.038	1.53	(1.03, 2.28)
	DRD3	rs6280	Recessiveb	0.047	1.52	(1.01, 2.31)
	SLC1A2	rs3794087	Overdominant	0.043	0.65	(0.43, 0.97)
	CTNNA3	rs7903491	Overdominant	0.036	1.52	(1.03, 2.26)
	CTNNA3	rs7903491	Overdominantb	0.033	1.56	(1.04, 2.34)
Sporadic ET v.s. Familial ET	CTNNA3	rs7903491	Dominant	0.034	0.58	(0.35, 0.96)
	CTNNA3	rs7903491	Dominantb	0.008	0.39	(0.19, 0.77)
	LINGO1	rs9652490	Overdominant	0.029	0.58	(0.36, 0.94)
	PPARGC1A	rs17590046	Overdominantb	0.047	0.35	(0.12, 0.96)

CI: Confidence Interval, EOPD: early onset Parkinson's disease, LOPD: late onset Parkinson's disease, OR: odd ratio, PD: Parkinson's Disease; SNP: single nucleotide polymorphism

^a p value, OR and 95% CI were obtained from risk analysis and refer to the risk allele.

^bAdjusted for age and gender.

^c p value was calculated by Cochran‐Armitage trend test for additive model.

Table 3.

AFT models of genetic models of SNPs of each comparison

		Models of SNPs	p value	Coefficients Value	95% CI
ET vs. Control		Dominant model of rs3794087	1.99 × 10‐2	‐3.77	(‐3.94, ‐0.60)
Familial ET v.s. Control	Model 1	Dominant model of rs3794087	4.77 × 10‐2	‐4.82	(‐9.60, ‐0.05)
		Dominant model of rs10937625	1.87 × 10‐1	‐3.48	(‐8.66, 1.69)
		Dominant model of rs10822974	3.68 × 10‐1	‐2.90	(‐9.23, 3.42)
	Model 2	Overdominant model of rs3794087	4.90 × 10‐2	4.89	(0.02, 9.76)
		Dominant model of rs10937625	1.51 × 10‐1	‐3.78	(‐8.94, 1.38)
		Dominant model of rs10822974	3.95 × 10‐1	‐2.74	(‐9.07, 3.58)

AFT: Accelerated failure time; CI: confidence interval; EOPD: Early Onset Parkinson's Disease; LOPD: Late Onset Parkinson's Disease; PD: Parkinson's Disease; SNP: single nucleotide polymorphisms;

Table 4.

Meta analysis of relevant SNPs

Gene	SNP	Power	Allele model				Dominant model
			I2	p value	OR	95% CI	I2	p value	OR	95% CI
LINGO1	rs11856808	0.050	0.0%	0.976	1.00	(0.82, 1.21)	0.0%	0.816	1.03	(0.80, 1.34)
	rs9652490	0.161	0.0%	0.202	1.11	(0.95, 1.29)	0.0%	0.603	1.05	(0.87, 1.27)
SLC1A2	rs3794087	0.065	72.0%	0.792	1.03	(0.82, 1.29)	73.8%	0.536	1.09	(0.83, 1.44)
DRD3	rs6280	0.108	0.0%	0.346	1.10	(0.90, 1.34)	0.0%	0.537	1.16	(0.73, 1.85)
PPARGC1A	rs17590046	0.092	0.0%	0.009	0.70	(0.54, 0.91)	0.0%	0.014	0.70	(0.53, 0.93)

Gene	SNP		Recessive model				Overdominant model
			I2	p value	OR	95% CI	I2	p value	OR	95% CI
LINGO1	rs11856808		0.0%	0.676	0.92	(0.62, 1.37)	22.8%	0.613	0.94	(0.72, 1.21)
	rs9652490		59.5%	0.368	1.32	(0.72, 2.39)	0.0%	0.591	1.06	(0.87, 1.29)
SLC1A2	rs3794087		3.2%	0.257	0.83	(0.59, 1.15)	68.0%	0.307	0.88	(0.68, 1.13)
DRD3	rs6280		0.0%	0.385	1.12	(0.87, 1.45)	0.0%	0.592	1.07	(0.83, 1.39)
PPARGC1A	rs17590046		50.0%	0.421	0.49	(0.08, 2.82)	0.0%	0.029	1.38	(1.03, 1.84)

CI: confidence interval; OR: odds ratio; SNP: single nucleotide polymorphism

Table S1.

Primers of tested SNPs and mutations

MassARRAY
Gene	SNP	1st Primer	2nd Primer	UEP_SEQ
NOS3	c.164C>T	ACGTTGGATGTCTT C ACACGAGGGAACTTG	ACGTTGGATGAC AAACCCTTCCTGATGACC	CTCCCAACAGCCCCC
TEXM4	c4324G>A	ACGTTGGATGTTGCTTAGCAGGAAGTGGTC	ACGTTGGATGTGTGGTCCTGCAAATCTCTG	CAGGTGCGCATTGTC
TENM4	c.1553G>A	ACGTTGGATGTGAAGCCTGTCTCATGGCTG	ACGTTGGATGATGGCAGGAGGCTCCTAAC	ACCCCGCGCCAGTCTC
NOS3	c.46G>A	ACGTTGGATGTGCTTGCCGCACAGCCCAA	ACGTTGGATGACATGGGCAACTTGAAGAGC	GCCTGGGCCACCCTGC
LINGO 1	rs9652490	ACGTTGGATGACCGCTGGTCTAAAGCTGG	ACGTTGGATGAGATGTCACAGATCAGTGCC	CAGAGTGAAGCTAGGC
TENM4	c.3382G>A	ACGTTGGATGCATTTGGGACAAGACAGACG	ACGTTGGATGAGGCTTACCAAAGGCTTCTG	TTCTGAAAGCCCAAACA
TENM4	c4895G>A	ACGTTGGATGAGACAACAATGGCAACATGG	ACGTTGGATGCATGGTCACCCAGTACACCT	TCCCAGTAGAGTCTCGG
TENM4	C.14210A	ACGTTGGATGTGTGTATGTGAAGGAGGGAG	ACGTTGGATGTAGACCATCCTGTGCATCTG	ggCTCTGGGAAAGGCAG
TENM4	c.7353G>A	ACGTTGGATGACCTTAGTAGCAGCAACGT C	ACGTTGGATGACTTGATGTCCTGGGAGTTG	GGGGTTGTTGTTTTTGAA
SCN4A	rs571210585	ACGTTGGATGACAGC ATCATCTGCCTGTT C	ACGTTGGATGCTGTT GAGGATGGGGTT GAG	cttcGGAGCCCGT CCC AGC
L1NG01	rsl1856808	ACGTTGGATGTCCTACAAAATCCCCACTGC	ACGTTGGATGGGGACTTAGTTCTCTCACTC	CTCAGAAAGTCACCCAAAC
SLC1A2	rs3794087	ACGTTGGATGCGTAGGCTTCTTTAGCATCC	ACGTTGGATGTGCTCCCAGGAAAGAAAAGG	AAGGGAACCAAAGCCAACT
HS1BP3	rsl1680700	ACGTTGGATGGCAT GGTTCCATTTTCTCCG	ACGTTGGATGTAAGACACATTGGGCTCTGG	sssaGGTGAGAGCCGCTCCC
TENM4	c.4603A>C	ACGTTGGATGTCTGG AGACGATGGTTATGC	ACGTTGGATGACAC ACAGCCAAGGAAGAT G	GGAAGATGGGGTATTTAACT
FUS	c.1129C>T	ACGTTGGATGACTAGCAGGTAGCTCCTCAC	ACGTTGGATGAGGTCTCATTTGCTACTCGC	accctCCGGGCAGACTTTAAT
TENM4	c.5287G>A	ACGTTGGATGAGCAGCCGCAAGGAGCCAT	ACGTTGGATGTTCT GAGCAGTCTGTGCTT G	GTCCGGAACAGCTACTACATC
TENM4	c.3053G>A	ACGTTGGATGTTTCT CTGCACAGGAGCTGG	ACGTTGGATGATGAGATTCCCAGCTGTGAC	tggGACCTGAGCAATTTTGCCC
DRD3	rs6280	ACGTTGGATGTGGC ACCTGTGGAGTT CTCT	ACGTTGGATGTCT GGGCTATGGCAT CTCTG	ggcagCTCT GAGCCAGCT GAGT
KCNS2	c.1137T>A	ACGTTGGATGAGGC AGAGGCAGTCAGCTTT	ACGTTGGATGTACCGTCAGTATGACCACAG	tscCCACAGTGGGGTACGGGGA
FUS	rs387907274	ACGTTGGATGGCCACAGACTCAATTGTAAC	ACGTTGGATGTGTTC AACAAGCAGAACAGG	catACAACAAC ACCATCTTT GT G
HAPLN4	rs781390304	ACGTTGGAT GAGTAGACGCCGAAGAGCCG	ACGTTGGATGT ACCCCATCGTG AACCCGC	cccccGCCTGGTGT GCGCAGCCTC
TENM4	c.3412G>A	ACGTTGGATGGT GGGCTTTGCTCACTT ATG	ACGTTGGATGTCTGGGCAGGATTCATATTC	teaAGGATTCATATTCATAACCCA
TENM4	C.41000A	ACGTTGGATGCAGGC ATTACAGTGGACAAG	ACGTTGGATGGAT CCCATTCTGATCGAT GC	gtcgGATCGATGCGTCTGATCATG
TENM4	c.158G>C	ACGTTGGATGTGCGGCACAATGTCCTTGAC	ACGTTGGATGCAGAAATCGTACAGCTCCAG	gttcAGGCCTACGACCAGGACGCCC
HTRA2	rs72470545	ACGTTGGATGATATC ACACTGCAGCCTCT C	ACGTTGGATGTCAGCATGGTGTACTCATCC	ccetcCTCATCCATAAAGTCATCCTG
USP46	rs759572548	ACGTTGGATGTCCTGTTTCTTCTCCTCCTG	ACGTTGGATGCTAC ATGCAGCAGGATGCT C	TTTAAATTATTTGCTAAACACTATTG

Polymer Chain Reaction (PCR)
Gene	SNP	Forward Primer	Reverse Primer	Reaction conditions of PCR
STK32B	rsl0937625	GTGCCCTTTATCTCCATCCCT	GCGCTGTCAGCTCT GATTCTA	95°C 2 min—»95°C 30s‐o4°C 30s‐>72°C lmin—>go to step 2 for 35 times—»72°C 5 min
CTNNA3	rs7903491	AGGTGCTCTGATGTTGGG	TTCTTGGGCTTCTTATGG
CTNNA3	rsl0822974	ACCTCTCTAGGTTCTAAGGCCA	GGACGGCCTAGAT GTTACCG
CTNNA3	rsl2764057	ATACGCAAGCCT GCACAAAC	TGGGTGAATG AAACCAATTCCC
PPARGC1A	rsl7590046	AGTTGAGGTGTT GCAGAGCA	GGAGCAAGTGGTCACCTGAA

Table S2.

The PCR Reaction System

	Volume
R Taq	0.25μL	Code No.R001A, Takara
10× loading buffer	5μL	Code No.R001A, Takara
dNTP Mixture	4μL	Code No.R001A, Takara
ddH2O	37.75μL
Template	1μL
Forward Primer (10 μmol/L)	1μL
Reverse Primer (10 μmol/L)	1μL

Table S3.

Association of SNPs of candidate genes and odds ratio to ET risk

Candidate Gene	SNP	HWE p value	MAF (case/control)	Allele					Dominant Model
				Effect allele	p α	p trend c	ORa	95%CIa	p	OR	95%CI
LINGO1	rsll856808	0.744	0.34/0.34	T	0.918	0.920	1.00	‐	0.833	0.97	(0.70, 1.33)
	rs9652490	0.663	0.24/0.22	G	0.532	0.544	1.09	(0.83, 1.43)	0.546	1.11	(0.80, 1.54)
SLC1A2	rs3794087	0.119	0.24/0.19	A	0.066	0.066	1.30	(0.98, 1.73)	0.019	1.50	(1.07, 2.10)
DRD3	rs6280	0.523	0.25/0.28	T	0.275	0.279	1.16	(0.89, 1.50)	0.627	1.17	(0.63, 2.19)
SIK32B	rsl0937625	0.005	0.18/0.12	C	‐	‐	‐	‐	‐	‐	‐
CTNNA3	rs7903491	0.921	0.45/0.44	G	0.686	0.677	1.05	(0.83,1.32)	0.632	0.92	(0.64, 1.31)
	rsl0822974	0.727	0.43/0.46	G	0.469	0.475	1.09	(0.86, 1.38)	0.171	1.33	(0.89, 2.00)
	rsl2764057	0.693	0.30/0.31	G	0.649	0.658	0.94	(0.74,1.21)	0.681	0.93	(0.68, 1.29)
PPARGC1A	rsl7590046	0.131	0.07/0.09	C	0.188	0.212	0.75	(0.49, 1.15)	0.155	0.71	(0.44, 1.13)

Candidate Gene	SNP	Genetic Power	Dominant Model (adjusted)b			Recessive Model			Recessive Model (adjusted)b
			p	OR	95%CI	p	OR	95%CI	p	OR	95%CI
LINGO1	rsll856808	0.050	0.521	1.14	(0.77, 1.67)	0.915	1.03	(0.64, 1.66)	0.923	0.97	(0.56, 1.68)
	rs9652490	0.082	0.343	1.20	(0.82, 1.77)	0.754	1.11	(0.57, 2.16)	0.777	1.12	(0.52, 2.40)
SLC1A2	rs3794087	0.132	0.122	1.37	(0.92, 2.04)	0.723	0.87	(0.40, 1.89)	0.640	0.80	(0.30, 2.05)
DRD3	rs6280	0.129	0.869	1.06	(0.52, 2.24)	0.266	1.20	(0.87, 1.66)	0.722	1.07	(0.85, 1.57)
STK32B	rsl0937625	‐	‐	‐	‐	‐	‐	‐	‐	‐	‐
CTNNA3	rs7903491	0.059	0.513	0.87	(0.68, 1.32)	0.195	1.32	(0.87, 2.01)	0.127	1.46	(0.90, 2.38)
	rsl0822974	0.081	0.266	1.31	(0.81, 2.13)	0.925	0.98	(0.69, 1.40)	0.740	0.93	(0.61, 1.41)
	rsl2764057	0.065	0.873	1.03	(0.71, 1.51)	0.767	0.92	(0.54, 1.56)	0.602	1.18	(0.64,2.16)
PPARGC1A	rsl7590046	0.258	0.099	0.61	(0.34, 1.09)	1.000	‐	‐	0.767	1.29	(0.22, 7.01)

Candidate Gene	SNP	Overdominant model			Overdominant model (adjusted)b				Number of sample tested
		p	OR	95%CI	p	OR	95%CI		Case		Control
LINGO1	rsll856S08	0.777	1.05	(0.76. 1.45)	0.485	0.87	(0.70, 1.28)		299		298
	rs9652490	0.643	0.92	(0.66,1.30)	0.408	0.85	(0.57, 1.26)		298		296
SLC1A2	rs3794087	0.010	0.63	(0.45, 0.90)	0.073	0.69	(0.46, 1.03)		280		297
DRD3	rs6280	0.379	1.16	(0.83, 1.62)	0.785	1.06	(0.72, 1.56)		295		294
STK32B	rsl0937625	‐	‐	‐	‐	‐	‐		297		290
CTNNA3	rs7903491	0.150	1.27	(0.92, 1.76)	0.075	1.41	(0.97,2.08)		294		295
	rsl0822974	0.232	0.82	(0.59, 1.14)	0.228	0.79	(0.54, 1.16)		296		280
	rsl2764057	0.815	1.04	(0.75, 1.45)	0.870	1.03	(0.70, 1.52)		298		296
PPARGC1A	rs1 7590046	0.138	1.45	(0.89, 2.39)	0.067	1.78	(0.97,2.56)		299		299

CI= confidence interval; HWE = Hardy‐Weinberg Equilibrium; MAF = minor allele frequency; OR = odds ratio; PD = Parkinson's Disease; SNP = single nucleotide polymorphism.

^a p value, OR and 95% CI were obtained from risk analysis and refer to the risk allele.

^b Adjusted for age and gender.

^c p value was calculated by Cochran‐Armitage trend test for additive model.

Table S4.

Association of SNPs of candidate genes and odds ratio to familial ET risk

Candidate Gene	SNP	HWE p value	MAF (case' control)	Allele					Dominant Model
				Effect allele	p α	p trend c	ORa	95%CIa	p	OR	95%CI
LINGO1	rs1 1856808	0.416	0.31/0.34	T	0.284	0.300	0.85	(0.63,1.15)	0.208	0.77	(0.52,1.1)
	rs9652490	0.302	0.22/0.22	G	0.979	0.980	1.00	(0.72,1.41)	0.663	0.91	(0.60,1.3)
SLC1A2	rs3794087	0.260	0.25/0.19	A	0.071	0.076	1.37	(0.97, 1.93)	0.031	1.58	(1.04,2.3)
DRD3	rs6280	0.952	0.29/0.28	T	0.716	0.716	0.94	(0.69, 1.29)	0.805	0.91	(0.45,1.9)
STK32B	rsl0937625	0.124	0.18/0.12	C	0.019	0.020	1.59	(1.08,2.36)	0.018	1.71	(1.09,2.6)
CTNNA3	rs7903491	0.407	0.49/0.44	G	0.196	0.171	1.21	(0.91,1.61)	0.359	1.24	(0.79,1.9)
	rsl0822974	0.407	0.41/0.46	G	0.236	0.242	1.19	(0.89, 1.59)	0.049	1.72	(1.02,3.0)
	rsl2764057	0.948	0.32/0.31	G	0.707	0.713	1.06	(0.78, 1.44)	0.578	1.12	(0.75,1.6)
PPARGC1A	rsl7590046	0.091	0.06/0.09	C	0.236	0.266	0.72	(0.41,1.25)	0.134	0.62	(0.33,1.1)

Candidate Gene	SNP	Genetic Power	Dominant Model (adjusted)b			Recessive Model			Recessive Model (adjusted)b
			p	OR	95%CI	p	OR	95%CI	p	OR	95%CI
LINGO1	rs1 1856808	0.105	0.586	0.87	(0.51, 1.46)	0.797	0.92	(0.49,1.67)	0.427	0.73	(0.33,1.5)
	rs9652490	0.050	0.759	0.92	(0.54, 1.55)	0.371	1.41	(0.65, 3.00)	0.555	1.33	(0.50, 3.4)
SLC1A2	rs3794087	0.151	0.231	1.37	(0.82, 2.31)	0.975	0.99	(0.37,2.43)	1.000	1.00	(0.28, 3.2)
DRD3	rs6280	0.060	0.697	0.83	(0.32,2.27)	0.742	0.93	(0.63, 1.40)	0.184	0.70	(0.42,1.1)
STK32B	rsl0937625	0.130	0.170	1.48	(0.84,2.60)	0.460	1.65	(0.40, 6.34)	0.794	1.26	(2.05, 7.2)
CTNNA3	rs7903491	0.124	0.138	1.57	(0.87,2.89)	0.191	1.40	(0.84,2.32)	0.181	1.54	(0.81,2.8)
	rsl0822974	0.118	0.142	1.68	(0.86, 3.46)	0.936	1.02	(0.66, 1.56)	0.689	0.89	(0.50,1.5)
	rsl2764057	0.057	0.317	1.30	(0.78, 2.19)	0.919	0.97	(0.49, 1.82)	0.351	1.45	(0.65,3.1)
PPARGC1A	rsl7590046	0.244	0.236	0.63	(0.28, 1.32)	0.559	1.57	(0.31,7.21)	0.268	2.67	(0.42,1.5)

Candidate Gene	SNP	Overdominant model			Overdominant model (adjusted)b			Number of sample tested
		P	OR	95%CI	p	OR	95%CI	Case	Control
LINGO1	rs1 1856808	0.271	1.26	(0.84, 1.90)	0.990	1.00	(0.59, 1.68)	143	298
	rs9652490	0.344	1.24	(0.80, 1.93)	0.510	1.20	(0.70, 2.12)	143	296
SLC1A2	rs3794087	0.025	0.61	(0.40, 0.94)	0.223	0.72	(0.43, 1.22)	142	297
DRD3	rs6280	0.843	0.96	(0.64, 1.45)	0.262	0.75	(0.45,1.25)	141	294
STK32B	rsl0937625	0.029	0.60	(0.38, 0.95)	0.184	0.67	(0.38,1.21)	142	290
CTNNA3	rs7903491	0.850	1.04	(0.69, 1.56)	0.788	0.93	(0.56,1.55)	140	295
	rsl0822974	0.130	0.73	(0.49, 1.10)	0.124	0.66	(0.39,1.12)	143	280
	rsl2764057	0.529	0.88	(0.59, 1.32)	0.684	0.90	(0.54,1.50)	143	296
PPARGC1A	rsl7590046	0.074	1.85	(0.97, 3.77)	0.090	2.10	(0.93, 5.24)	144	299

CI= confidence interval; HWE = Hardy‐Weinberg Equilibrium; MAF = minor allele frequency; OR = odds ratio; PD = Parkinson's Disease; SNP = single nucleotide polymorphism.

^a p value, OR and 95% CI were obtained from risk analysis and refer to the risk allele.

^bAdjusted for age and gender.

^c p value was calculated by Cochran‐Armitage trend test for additive model.

Table S5.

Association of SNPs of candidate genes and odds ratio to sporadic ET risk

Candidate Gene	SNP	HWE p value	MAF (case/ control)	Allele					Dominant Model
				Effect allele	p α	p trend c	ORa	95%CIa	p	OR	95%CI
LINGO1	rs1 1856808	0.766	0.37/0.34	T	0.405	0.412	1.12	(0.84,1.50)	0.388	1.19	(0.80,1.7)
	rs9652490	0.603	0.25/0.22	G	0.334	0.338	1.17	(0.85, 1.62)	0.173	1.31	(0.89,1.9)
SLC1A2	rs3794087	0.425	0.23/0.19	A	0.206	0.211	1.24	(0.89, 1.74)	0.083	1.43	(0.95,2.1)
DRD3	rs6280	0.173	0.21/0.28	T	0.035	0.037	1.42	(1.02, 1.97)	0.301	1.55	(0.70,3.7)
STK32B	rsl0937625	0.017	0.19/0.12	C	‐	‐	‐	‐	‐	‐	‐
CTNNA3	rs7903491	0.691	0.42/0.44	G	0.563	0.552	0.92	(0.70, 1.22)	0.116	0.72	(0.47,1.0)
	rsl0822974	0.947	0.45/0.46	G	0.975	0.976	1.00	(0.76, 1.33)	0.759	1.08	(0.67,1.7)
	rsl2764057	0.407	0.27/0.31	G	0.276	0.293	0.84	(0.62,1.14)	0.238	0.79	(0.53,1.1)
PPARGC1A	rsl7590046	0.754	0.07/0.09	C	0.354	0.369	0.78	(0.46, 1.32)	0.423	0.79	(0.44,1.3)

Candidate Gene	SNP	Genetic Power	Dominant Model (adjusted)b			Recessive Model			Recessive Model (adjusted)b
			p	OR	95%CI	p	OR	95%CI	p	OR	95%CI
LINGO1	rs1 1856808	0.088	0.347	1.22	(0.81,1.84)	0.687	1.12	(0.63, 1.96)	0.577	1.18	(0.65,2.1)
	rs9652490	0.120	0.190	1.31	(0.87,1.97)	0.691	0.84	(0.34, 1.92)	0.714	0.85	(0.33,2.0)
SLC1A2	rs3794087	0.148	0.143	1.37	(0.90, 2.08)	0.591	0.77	(0.27, 1.95)	0.442	0.67	(0.23,1.7)
DRD3	rs6280	0.182	0.499	1.34	(0.60,3.31)	0.038	1.53	(1.03,2.28)	0.047	1.52	(1.01,2.3)
STK32B	rsl0937625	‐	‐	‐	‐	‐	‐	‐	‐	‐	‐
CTNNA3	rs7903491	0.070	0.101	0.70	(0.45, 1.07)	0.395	1.24	(0.75,2.05)	0.415	1.24	(0.73,2.0)
	rsl0822974	0.050	0.786	1.07	(0.65, 1.78)	0.819	0.95	(0.62, 1.45)	0.829	0.95	(0.61,1.4)
	rsl2764057	0.116	0.284	0.80	(0.53, 1.20)	0.708	0.88	(0.45, 1.66)	0.823	0.93	(0.46,1.7)
PPARGC1A	rsl7590046	0.211	0.325	0.75	(0.41, 1.32)	0.512	0.48	(0.02, 3.27)	0.450	0.42	(0.02, 3.0)

Candidate Gene	SNP	Overdominant model			Overdominant model (adjusted)b			Number of sample tested
		p	OR	95%CI	p	OR	95%CI	Case	Control
LINGO1	rs1 1856808	0.559	0.89	(0.60, 1.32)	0.580	0.89	(0.60, 1.34)	156	298
	rs9652490	0.110	0.72	(0.48, 1.08)	0.128	0.72	(0.48, 1.10)	155	296
SLC1A2	rs3794087	0.043	0.65	(0.43, 0.97)	0.063	0.66	(0.43, 1.02)	138	297
DRD3	rs6280	0.112	1.39	(0.93,2.11)	0.093	1.44	(0.94, 2.21)	154	294
STK32B	rsl0937625	‐	‐	‐	‐	‐	‐	155	290
CTNNA3	rs7903491	0.036	1.52	(1.03, 2.26)	0.033	1.56	(1.04, 2.34)	154	295
	rsl0822974	0.638	0.91	(0.61, 1.35)	0.670	0.91	(0.61, 1.38)	153	280
	rsl2764057	0.329	1.22	(0.82, 1.84)	0.339	1.22	(0.81, 1.86)	155	296
PPARGC1A	rsl7590046	0.533	1.20	(0.68, 2.19)	0.436	1.27	(0.71,2.36)	155	299

CI= confidence interval; HWE = Hardy‐Weinberg Equilibrium; MAF = minor allele frequency; OR = odds ratio; PD = Parkinson's Disease; SNP = single nucleotide polymorphism.

^a p value, OR and 95% CI were obtained from risk analysis and refer to the risk allele.

^bAdjusted for age and gender.

^c p value was calculated by Cochran‐Armitage trend test for additive model.

Table S6.

Association of SNPs of candidate genes and odds ratio to the risk of sporadic ET relative to familial ET

Candidate Gene	SNP	HWE p value	MAF (case/control)	Allele					Dominant Model
				Effect allele	p α	p trend c	ORa	95%CIa	p	OR	95%CI
LINGO1	rs1 1856808	0.242	0.37/0.31	T	0.099	0.109	1.33	(0.95, 1.87)	0.066	1.54	(0.97,2.4)
	rs9652490	0.615	0.25/0.22	G	0.426	0.438	1.17	(0.80,1.70)	0.123	1.44	(0.91,2.31)
SLC1A2	rs3794087	0.671	0.23/0.25	A	0.618	0.605	0.91	(0.62, 1.33)	0.673	0.91	(0.57,1.4)
DRD3	rs6280	0.009	0.21/0.29	T	‐	‐	‐	‐	‐	‐	‐
STK32B	rsl0937625	0.349	0.19/0.18	C	0.813	0.804	1.05	(0.69, 1.59)	0.584	1.14	(0.71,1.8)
CTNNA3	rs7903491	0.206	0.42/0.49	G	0.104	0.104	0.76	(0.55, 1.06)	0.034	0.58	(0.35,0.9)
	rsl0822974	0.559	0.45/0.41	G	0.307	0.301	0.84	(0.61,1.17)	0.127	0.63	(0.34, 1.14)
	rsl2764057	0.282	0.27/0.32	G	0.205	0.218	0.80	(0.56,1.13)	0.135	0.71	(0.45, 1.1)
PPARGC1A	rsl7590046	1.000	0.07/0.06	C	0.795	0.809	1.09	(0.57,2.09)	0.505	1.27	(0.63,2.6)

Candidate Gene	SNP	Genetic Power	Dominant Model (adjusted)b			Recessive Model			Recessive Model (adjusted)b
			P	OR	95%CI	P	OR	95%CI	P	OR	95%CI
LINGO1	rs1 1856808	0.120	0.243	1.45	(0.78, 2.72)	0.570	1.22	(0.62,2.43)	0.575	1.27	(0.55,2.9)
	rs9652490	0.103	0.204	1.48	(0.81,2.73)	0.270	0.59	(0.23, 1.48)	0.350	0.58	(0.17,1.7)
SLC1A2	rs3794087	0.067	0.964	0.98	(0.54, 1.82)	0.657	0.78	(0.24,2.39)	0.160	0.35	(0.08,1.4)
DRD3	rs6280	‐	‐	‐	‐	‐	‐	‐	‐	‐	‐
STK32B	rsl0937625	0.053	0.840	0.94	(0.51, 1.72)	0.362	0.45	(0.06,2.35)	0.484	0.42	(0.02, 3.6)
CTNNA3	rs7903491	0.105	0.008	0.39	(0.19, 0.77)	0.679	0.89	(0.50, 1.57)	0.505	0.78	(0.38,1.6)
	rsl0822974	0.104	0.125	0.54	(0.24, 1.18)	0.788	0.93	(0.57, 1.53)	0.886	1.05	(0.55,1.9)
	rsl2764057	0.117	0.772	0.91	(0.50, 1.68)	0.816	0.91	(0.43, 1.96)	0.756	0.86	(0.33,2.2)
PPARGC1A	rsl7590046	0.060	0.120	2.11	(0.83, 5.58)	0.306	0.31	(0.02,2.41)	0.331	2.16	(0.004, 3.5)

Candidate Gene	SNP	Overdominant model			Overdominant model (adjusted)b			Number of sample tested
		P	OR	95%CI	P	OR	95%CI	Familial ET	Sporadic ET
LINGO1	rs1 1856808	0.143	0.71	(0.44, 1.12)	0.475	0.81	(0.44, 1.46)	143	156
	rs9652490	0.029	0.58	(0.36, 0.94)	0.073	0.57	(0.30, 1.05)	143	155
SLC1A2	rs3794087	0.808	1.06	(0.66, 1.69)	0.561	0.83	(0.45, 1.21)	142	138
DRD3	rs6280	‐	‐	‐	‐	‐	‐	141	154
STK32B	rsl0937625	0.403	0.81	(0.50, 1.32)	0.996	1.00	‐	142	155
CTNNA3	rs7903491	0.105	1.46	(0.92, 2.32)	0.065	1.74	(0.97,3.17)	140	154
	rsl0822974	0.350	1.24	(0.79, 1.97)	0.192	1.49	(0.82, 2.72)	143	153
	rsl2764057	0.165	1.39	(0.87, 2.22)	0.931	1.03	(0.56, 1.87)	143	155
PPARGC1A	rs1 7590046	0.269	0.65	(0.30, 1.38)	0.047	0.35	(0.12, 0.96)	144	155

CI= confidence interval; HWE = Hardy‐Weinberg Equilibrium; MAF = minor allele frequency; OR = odds ratio; PD = Parkinson's Disease; SNP = single nucleotide polymorphism.

^a p value, OR and 95% CI were obtained from risk analysis and refer to the risk allele.

^bAdjusted for age and gender.

^c p value was calculated by Cochran‐Armitage trend test for additive model.

Table S7.

Accelerated failure time model of genetic models of single nucleotide polymorphisms

		Models of SNPs	p value	Coefficients Value	95% CI	Loglik results of mod
ET vs.	Model 1	Dominant model of rs3794087	1.99 × 10‐2	‐3.77	(‐3.94, ‐0.60)	‐1434.4
Control	Model 2	Overdominant model of rs3794087	3.70 × 10‐2	3.46	(0.21,6.71)	‐1434.9
Familial ET vs. Control	Model 1	Dominant model of rs3794087	3.32 × 10‐2	‐5.03	(‐9.66, ‐0.40)	‐752.4
	Model 2	Overdominant model of rs3794087	3.85 × 10‐2	5.00	(0.26, 9.73)	‐752.5
	Model 3	Dominant model of rs1093 7625	1.24 × 10‐1	‐4.02	(‐9.15, 1.10)	‐760.6
	Model 4	Overdominant model of rsl0937625	1.82 × 10‐1	3.58	(‐1.68, 8.84)	‐760.9
	Model 5	Dominant model of rs10822974	2.69 × 10‐1	‐3.57	(‐9.91, 2.76)	‐762.1
	Model 6	Dominant model of rs3794087	3.42 × 10‐2	‐5.12	(‐9.86, ‐0.38)	‐740
		Dominant model of rs1093 7625	1.94 × 10‐1	‐3.38	(‐8.49, 1.72)
	Model 7	Overdominant model of rs3794087	3.17 × 10‐2	5.30	(0.46, 10.14)	‐739.9
		Dominant model of rs1093 7625	1.60 × 10‐1	‐3.65	(‐8.74, 1.45)
	Model 8	Dominant model of rs3794087	3.16 × 10‐2	‐5.19	(‐9.93, ‐0.46)	‐740.2
		Overdominant model of rsl0937625	2.53 × 10‐1	3.06	(‐2.18, 8.29)
	Model 9	Overdominant model of rs3794087	2.92 × 10‐2	5.38	(0.54, 10.21)	‐740.1
		Overdominant model of rsl0937625	2.06 ×10‐1	3.37	(‐1.85, 8.60)
	Model 10	Dominant model of rs3794087	3.56 × 10‐2	‐5.04	(‐9.74, ‐0.34)	‐741.7
		Dominant model of rs10822974	3.70 × 10‐1	‐2.87	(‐9.15, 3.41)
	Model 11	Overdominant model of rs3794087	4.63 × 10‐2	4.88	(0.08, 9.69)	‐741.9
		Dominant model of rs10822974	3.93 × 10‐1	‐2.74	(‐9.02, 3.55)
	Model 12	Do minant model of rs1093 7625	1.23 × 10‐1	‐4.08	(‐9.27,1.11)	‐754.4
		Dominant model of rs10822974	2.70 × 10‐1	‐3.59	(‐9.98, 2.79)
	Model 13	Overdominant model of rsl0937625	1.81 × 10‐1	3.64	(‐1.70, 8.97)	‐754.6
		Dominant model of rs10822974	2.77 × 10‐1	‐3.55	(‐9.95, 2.85)
		Dominant model of rs3794087	4.77 × 10‐2	‐4.82	(‐9.60, ‐0.05)	‐734.1
	Model 14	Dominant model of rs1093 7625	1.87 × 10‐1	‐3.48	(‐8.66, 1.69)
		Dominant model of rs10822974	3.68 × 10‐1	‐2.90	(‐9.23, 3.42)
		Overdominant model of rs3794087	4.90 × 10‐2	4.89	(0.02, 9.76)	‐734.1
	Model 15	Dominant model of rs1093 7625	1.51 × 10‐1	‐3.78	(‐8.94, 1.38)
		Dominant model of rs10822974	3.95 × 10‐1	‐2.74	(‐9.07, 3.58)
		Dominant model of rs3794087	4.39 × 10‐2	‐4.90	(‐9.67, ‐0.13)	‐734.3
	Model 16	Overdominant model of rsl0937625	2.42 × 10‐1	3.18	(‐2.14, 8.50)
		Dominant model of rs10822974	3.74 × 10‐1	‐2.87	(‐9.22, 3.46)
		Overdominant model of rs3794087	4.49 × 10‐2	4.98	(0.11,9.84)	‐734.3
	Model 17	Overdominant model of rsl0937625	1.93 × 10‐1	3.53	(‐1.78, 8.83)
		Dominant model of rs10822974	4.04 × 10‐1	‐2.70	(‐9.04, 3.64)
	Model 1	Recessive model of rs6280	8.94 × 10‐2	‐3.77	(‐8.13, 0.58)	‐810.7
Sporadic ET vs. Control	Model 2	Overdominant model of rs3794087	8.05 × 10‐2	4.02	(‐0.49, 8.52)	‐811.9
	Model 3	Overdominant model of rs7903491	1.56 × 10‐1	‐3.17	(‐7.54, 1.21)	‐815.6
	Model 4	Recessive model of rs6280	1.08 × 10‐1	‐3.56	(‐7.90, 0.78)	‐795.5
		Overdominant model of rs3794087	1.63 × 10‐1	3.17	(‐1.28, 7.62)
	Model 5	Recessive model of rs6280	1.24 × 10‐1	‐3.46	(‐7.86, 0.95)	‐799.2
		Overdominant model of rs7903491	2.68 × 10‐1	‐2.44	(‐6.77,1.88)
	Model 6	Overdominant model of rs3794087	1.06 × 10‐1	3.78	(‐0.80, 8.35)	‐799.9
		Overdominant model of rs7903491	1.46 × 10‐1	‐3.23	(‐7.59,1.13)
	Model 7	Recessive model of rs6280	1.55 × 10‐1	‐3.18	(‐7.57, 1.21)	‐783.9
		Overdominant model of rs3794087	1.96 × 10‐1	2.99	(‐1.54, 7.51)
		Overdominant model of rs7903491	2.43 × 10‐1	‐2.57	(‐6.89, 1.75)
Sporadic ET vs. Familial ET	Model 1	Dominant model of rs7903491	2.28 × 10‐1	2.70	(‐1.68, 7.07)	720.9
	Model 2	Overdominant model of rs9652490	1.43 × l0‐1	3.09	(‐1.05, 7.23)	‐724.2
	Model 3	Overdominant model of rsl 7590046	1.80 × 10‐1	4.40	(‐2.04,10.84)	‐725.5
	Model 4	Dominant model of rs7903491	2.53 × l0‐1	2.53	(‐1.80. 6.86)	‐713.5
		Overdominant model of rs9652490	1.70 × 10‐1	2.91	(‐1.25,7.08)
	Model 5	Dominant model of rs7903491	1.86 × l0‐1	2.96	(‐1.43. 7.36)	‐719.7
		Overdominant model of rsl 7590046	1.25 × 10‐1	5.16	(‐1.43, 11.74)
	Model 6	Overdominant model of rs9652490	1.29 × l0‐1	3.20	(‐0.93. 7.32)	‐717.8
		Overdominant model of rsl 7590046	1.89 × 10‐1	4.30	(‐2.11,10.72)
	Model 7	Dominant model of rs7903491	2.94 × 10‐1	2.82	(‐1.53,7.17)	‐712.3
		Overdominant model of rs9652490	1.84 × 10‐1	2.82	(‐1.34, 6.99)
		Overdominant model of rsl 7590046	1.30 × 10‐1	5.06	(‐1.50, 11.62)

CI: confidence interval: ET: essential tremor: SNP: single nucleotide polymorphisms;

Table S8.

Linkage Disequilibrium of CTNNA3 and LINGO1

Gene	L1	L2	D'	LOD	r^2	CIlow	Clhi	Dist	T‐int
LINGO1	rs9652490	rs11856808	1	117.84	0.582	0.98	1	8883	117.84
CTNNA3	rsl2764057	rs10822974	0.966	61.52	0.323	0.91	0.99	4704	126.48
	rsl2764057	rs7903491	0.852	64.96	0.389	0.79	0.9	71449	‐
	rs10822974	rs7903491	0.706	50.66	0.325	0.64	0.76	66745	115.62

Table S9.

Haplotype of CTNNA3 and LINGO1

LINGO1
rs11856808		rs9652490	p value	OR	95% CI
C		A	‐	1	‐
C		G	0.516	0.89	(0.63, 1.26)
T		A	0.867	1.02	(0.77, 1.37)
T		G	0.684	0.94	(0.69, 1.28)
CTNNA3
rsl2764057		rsl0822974	p value	OR	95% CI
T		A	‐	1	‐
T		G	0.676	0.94	(0.71,1.25)
G		A	0.620	1.10	(0.75,1.61)
G		G	0.831	1.03	(0.76,1.40)
rsl2764057		rs7903491
T		A	‐	1	‐
T		G	0.982	1.00	(0.76,1.31)
G		A	0.281	1.20	(0.86,1.67)
G		G	0.978	1.00	(0.74,1.34)
rsl0822974		rs7903491
A		A	‐	1	‐
A		G	0.909	1.02	(0.73,1.41)
G		A	0.810	0.96	(0.72, 1.30)
G		G	0.694	0.94	(0.71,1.26)
rsl2764057	rsl0822974	rs7903491
T	A	A	‐	1	‐
T	A	G	0.992	1.00	(0.72, 1.39)
T	G	A	0.734	0.95	(0.70,1.28)
T	G	G	0.679	0.94	(0.69,1.27)
G	A	A	0.453	1.17	(0.78,1.75)
G	A	G	0.768	1.06	(0.72, 1.57)
G	G	A	0.405	1.16	(0.82,1.65)
G	G	G	0.999	1.00	(0.73, 1.37)

Table S10.

Details of Meta Analysis

Author	Time	Gene	SNP	Case			Control			Method
				TT	TC	CC	TT	TC	CC
Bin Xiao	2017	PPARGC1A	rs17590046	405	63	1	383	81	6	TaqMan
Xing Zuo	2010	LINGO1	rs11856808	9	53	44	47	178	185	PCR
				AA	AG	GG	AA	AG	GG
Xing Zuo	2010	LINGO1	rs9652490	65	37	4	255	133	22	PCR
Y.‐w. Wu	2011	LINGO1	rs9652490	67	41	9	89	59	12	PCR
E.‐K. Tan	2009	LINGO1	rs9652490	114	52	24	451	244	39	MassARRAY
E.‐K. Tan	2007	DRD3	rs6280	72	76	15	85	87	20	5' nuclease activity assay
				AA	AC	CC	AA	AC	CC
Yaqian Xu	2016	SLC1A2	rs3 794087	1	44	67	23	174	240	MassARRAY
Shao‐wen Yu	2013	SLC1A2	rs3 794087	5	113	155	4	86	179	RFLP
E.‐K. Tan	2013	SLC1A2	rs3 794087	9	92	256	30	240	520	Sequencing
Yuan Cheng	2017	SLC1A2	rs3 794087	37	195	314	36	185	329	PCR

33

Proline‐rich transmembrane protein 2–negative paroxysmal kinesigenic dyskinesia: clinical and genetic analyses of 163 patients

Wo‐Tu Tian, Li Cao, Shengdi Chen (Shanghai, People's Republic of China)

Objective: The objective of this study was to investigate potential causative genes and clinical characteristics in proline‐rich transmembrane protein 2–negative patients with paroxysmal kinesigenic dyskinesia.

Background: Paroxysmal kinesigenic dyskinesia is the most common type of paroxysmal dyskinesia. Approximately half of the cases of paroxysmal kinesigenic dyskinesia worldwide are attributable to proline‐rich transmembrane protein 2 mutations.

Methods: We analyzed clinical manifestations and performed exome sequencing in a cohort of 163 prolinerich transmembrane protein 2–negative probands, followed by filtering data with a paroxysmal movement disorders gene panel. Sanger sequencing, segregation analysis, and phenotypic reevaluation were used to substantiate the findings.

Results: The clinical characteristics of the enrolled 163 probands were summarized. A total of 39 heterozygous variants were identified, of which 33 were classified as benign, likely benign, and uncertain significance. The remaining 6 variants (3 novel, 3 documented) were pathogenic and likely pathogenic. Of these, 3 were de novo (KCNMA1 c.1534A>G; SLC2A1 c.418G>A; SCN8A c.3640G>A) in 3 sporadic individuals, respectively. The other 3 (PNKD c.956dupA; KCNA1 c.765C>A; DEPDC5 c.3311C>T) cosegregated in 3 families. All 6 cases presented with typical paroxysmal kinesigenic dyskinesia characteristics, except for the DEPDC5 family, where the proband's mother had abnormal discharges in her temporal lobes in addition to paroxysmal kinesigenic dyskinesia episodes.

Conclusions: Our findings extend the genotypic spectrum of paroxysmal kinesigenic dyskinesia and establish the associations between paroxysmal kinesigenic dyskinesia and genes classically related to other paroxysmal movement disorders. De novo variants might be a cause of sporadic paroxysmal kinesigenic dyskinesia.

References: 1. Bruno MK, Hallett M, Gwinn‐Hardy K, et al. Clinical evaluation of idiopathic paroxysmal kinesigenic dyskinesia: new diagnostic criteria. Neurology 2004;63:2280‐2287.2. Wang JL, Cao L, Li XH, et al. Identification of PRRT2 as the causative gene of paroxysmal kinesigenic dyskinesias. Brain 2011; 134:3493‐3501.

Huntington's Disease

34

Systemic injection of exosomal siRNA significantly reduced huntingtin expression in transgenic mice of Huntington's disease

Wu Tengteng, Zhong Pei (Guangzhou, People's Republic of China)

Objective: To explore the therapeutic potential of exosome‐mediated siRNA delivery in BACHD and N171‐82Q mice model.

Background: Cell‐derived exosomes have been demonstrated to be efficient carriers of small RNAs into brain tissue. However, the therapeutic effect of exosome‐mediated siRNA has not been tested in Huntington's disease. In the present study we aimed to explore the therapeutic potential of exosome‐mediated siRNA delivery in BACHD and N171‐82Q mice model.

Methods: We employed modified exosomes expressing the neuron‐specific rabies viral glycoprotein (RVG) peptide to deliver siRNA into brain tissue (Fig. 1A). siRNA was loaded through electroporation. To determine the ability of modified exosomes selectively entering brain tissue, eGFP‐siRNA loaded exosome was administrated to eGFP transgenic mice. 5 siRNA targeting human huntingtin exon 1 (HuHtt) transcript were designed and then screened in SH‐SY5Y cells. To evaluate the in vivo efficiency, 2 HuHtt‐siRNA RVG‐exosomes were intravenously injected to BACHD mice at 10mg/kg every two days for 2 weeks. The most effective HuHtt‐siRNA RVG‐exosomes was then intravenously injected to wild type and N171‐82Q transgenic mice at 10mg/kg every two days for 2 weeks. Performance of rotarod test and balance beam test was determined post treatment.

Results: RVG modified exosomes efficiently and specifically delivered siRNA into the mouse brain. siRNA‐loaded RVG exosomes significantly reduced HuHtt mRNA and protein levels up to 46% and 54% respectively in transgenic animals. N171‐82Q mice receiving RVG exosomes showed improvement on the performance of Rotarod test and Balance beam test.

Conclusions: Our results demonstrate that RVG exosomes can efficiently transfer siRNA to the central nervous system and HuHtt‐siRNA RVG‐exosomes significantly reduce huntingtin expression. The present study indicates a therapeutic potential of HuHtt‐siRNA RVG‐exosomes in Huntington's disease.

35

Objective evaluation of bradykinesia in Huntington's disease using machine learning.

Siti Muhamed, Rachel Newby, Jeremy Cosgrove, Stephen Smith, Peter Kempster, Stuart Jamieson (Kedah, Malaysia)

Objective: To accurately classify Huntington's disease (HD) patients from healthy controls using machine learning on digitised kinematic data from MDS‐UPDRS conventional clinical motor tasks.

Background: Bradykinesia is a frequent finding in (HD) but is argued to be a compensatory adjustment in velocity to improve accuracy in the presence of choleric intrusions [1][2]. Using bradykinetic features of clinical motor tasks, machine learning is used to evolve classifiers that can differentiate HD patients from controls.

Methods: 20 healthy controls and 11 HD patients performed three motor tasks from MDS‐UPDRS: finger tapping (FT), hand opening‐closing (HO) and hand pronation‐supination (PS). Subjects were assessed clinically and measured using an objective motion tracking system with high sampling rate recordings. Selected movement features were extracted from the kinematic data based on the MDS‐UPDRS clinical definition of bradykinesia. Cartesian Genetic Programming (CGP) [3], a specific type of machine learning, was used to evolve classifiers. The fitness assigned to each classifier was the proportion of samples correctly classified. Results are averaged over ten iterations to provide statistical significance.

Results: Classification results between controls and HD patients were achieved as follows: for FT task, the highest averaged accuracy achieved was 82.42 %; for the PS task, 85.98%; for the HO, task 82.5%.

Conclusions: CGP machine learning can be used in a conventional clinical settings to provide more information on bradykinesia characteristics of HD. Classifiers evolved for all three motor tasks generated accuracies above 80%. The high accuracies of these classifications suggest that Bradykinesia characteristics are different in healthy people of old age and HD patients. Further analysis of evolved classifiers will reveal further information about the most discriminative movement features of controls and HD patients.

References: [1] A. Fenney, M. S. Jog, and C. Duval, “Bradykinesia is not a ‘systematic’ feature of adult‐onset Huntington's disease; implications for basal ganglia pathophysiology,” Brain Res., vol. 1193, pp. 67–75, 2008. [2] C. Duval, A. Fenney, and M. S. Jog, “The Dynamic Relationship Between Voluntary and Involuntary Motor Behaviours in Patients with Basal Ganglia Disorders,” pp. 521–534. [3] J. F. Miller and P. Thomson, “Cartesian genetic programming,” Genet. Program. Proc. Third Eur. Conf. Genet. Program. (EuroGP2000), vol. 1802, pp. 121–132, 2000.

234

This abstract has been withdrawn.

Myoclonus

36

Myoclonic tic in a patient with long standing psoriasis; unusual case presentation and review of literature

Wael Ibrahim (Giza, Egypt)

Objective: We discuss a unique and uncommon presentation of complex movement disorder in the form of Myoclonic Tic in a patient with long standing Psoriasis

Background: Tics are clinically indistinguishable from myoclonus, and Focal tics may resemble segmental myoclonus; but some differences are diagnostically helpful. Tics must be differentiated from myoclonic disorders, since drugs used for the treatment of myoclonus, whether cortical or subcortical are not usually effective for tic disorders.Psoriasis is a common, chronic inflammatory skin disease whose worldwide prevalence range from 0.1‐3%.

Methods: case presentation and review of literature

Results: A.A Male patient 50y old, with no special habits of medical importance. Know psoriasis 10 years ago with multiple skin lesions mainly in upper limbs (UL); and is on medical treatment in the form of methotrexate and antihistaminic.3 years ago, experienced abnormal involuntary movement with gradual and progressive course, disappears during sleep, increase with stress, and can be suppressed by contractions and/or certain posture. Asymmetrically involves both shoulders (more on right side) and rarely in abdomen.Magnetic resonant of brain and cervical spine revealed no abnormality.Electromyography of neck, shoulder and UL muscles showed mild C5‐C7 radiculopathy, and irregular firing motor unit potential coincides with irregular proximal movements, but no spontaneous discharges were recorded [figure#1,#2].All laboratory investigations were normal including thyroid function tests and Liver function tests. Discussion: Deneau and Farber study observed myoclonic jerk in two out of 25 psoriasis patients treated with Azaribine. Finsterer and Kovacs case, reported psoriasis as initial presentation in a patient with late onset myoclonic epilepsy with ragged‐red fibers‐syndrome. Sethi et al, case study; reported Juvenile Myoclonic epilepsy (JME) patient misdiagnosed as a Tic disorder. TABLE #3: Overview of Myoclonus/Tic disorder and psoriasis studies in the literature

Conclusions: Myoclonic Tic is term used when there is great overlap in semiology of abnormal movements and difficulty in differentiating Focal tics from segmental myoclonus; and the rarity of literature to report its occurrence in psoriasis

References: 1. Faught E. Clinical presentations and phenomenology of myoclonus. Epilepsia. 2003;44 Suppl 1:7‐12.2. Deneau DG, Farber EM. The treatment of psoriasis with azaribine. Dermatologica. 1975;151 (3):158‐163.3. Finsterer J, Kovacs GG. Psoriasis, bulbar involvement, and diarrhea in late myoclonic epilepsy with ragged‐red fibers‐syndrome due to the m.8344A > G tRNA (Lys) mutation. Iranian Journal of Neurology. 2017;16 (1):45‐49.4. Sethi NK, Labar D, Torgovnick J. Myoclonic epilepsy masquerading as a tic disorder. Clin Neurol Neurosurg. 2007;109 (6):509‐511.

Figure 1.

 

Figure 2.

 

Table 1.

Overview of Myoclonus/Tic disorder and psoriasis studies in the literature

Study ID (Author, year)	Study Design	Population		Comments
		Total Psoriasis patients	Psoriasis + Myoclonus/Tic disorder
Deneau and Farber 1975	Prospective interventional, open, single arm study	25	2	Patients were treated with Azaribine
Finsterer and Kovacs 2017	Case Report	1	1	patient w ith late onset MHRRF + psoriasis, bulbar & diarrhea
Sethi et al. 2007	Case Report	—	—	Patient misdiagnosed as Tics until a generalized seizure occurred → diagnosed as JME
Madhulik a et al. 1989	Prospective. observational study	127	—	‐patients with psoriasis ± pruritis ‐patients with pruritis reported more jerky movements cn awakening or during sleep
Güler et al. 2015	Observational study	70	28*	*RLS in psoriasis patients

Neuroimaging (Non‐PD)

37

Relapsed hemichorea‐hemiballism syndrome with diabetic striatopathy: MRI volumetric analysis for a case

Vinchi Wang, Shih‐Chung Chen, Yi‐Te Lin, Ping‐Keung Yip (New Taipei City, Taiwan)

Objective: To investigate the serial neuroimaging changes of MRI in a case with diabetic striatopathy who had clinical hemichorea‐hemiballism syndrome.

Background: Diabetic striatopathy is a movement disorder among diabetic patients characterized by clinical hemichorea‐hemiballism with neuroimage change of the striatum. It is an uncommon manifestation of diabetes mellitus. It is usually more tendency to occur in elderly female with non‐ketotic hyperglycemia. Here we report a case of diabetic striatopathy with relapsed hemichorea‐hemiballism attacks even during euglycemic period.

Methods: Diabetic striatopathy is a movement disorder among diabetic patients characterized by clinical hemichorea‐hemiballism with neuroimage change of the striatum. It is an uncommon manifestation of diabetes mellitus. It is usually more tendency to occur in elderly female with non‐ketotic hyperglycemia. Here we report a case of diabetic striatopathy with relapsed hemichorea‐hemiballism attacks even during euglycemic period.

Results: Three MRI examinations disclosed volume change of high‐signal T1 images from left striatum in a mode of crescendo and then decrescendo. The clinical symptoms paralleled with the neuroimage changes in striatum. The MR densitometric changes and high‐signal volume reduction were both valuable for the clinical course of the hemichorea‐hemiballism caused by diabetic striatopathy.

Conclusions: Serial MR images for the diabetic striatopathy may be warranted as a key pathognomic relationship for the clinical hemichorea‐hemiballism syndrome. Clinical involuntary movements may relapse and persist even with euglycemic condition, as our case reported here. The clinical movement disorder may correlate to the T1 image changes of striatum by our simplied volumetric analysis.

References: Lin CJ, Huang P. Delayed onset diabetic striatopathy: Hemichorea‐hemiballism one month after a hyperglycemic episode. Am J Emerg Med. 2017 Jul;35 (7):1036.e3‐1036.e4.Das L, Pal R, Dutta P, Bhansali A. "Diabetic striatopathy" and ketoacidosis: Report of two cases and review of literature. Diabetes Res Clin Pract. 2017 Jun;128:1‐5.

38

Humming bird sign in craniovertebral junction anomaly leading to misdiagnosis of progressive supranuclear palsy.

Devangi Desai, Dharak Pandya, Soaham Desai (Anand, India)

Objective: We present a case of Craniovertebral junction anomaly with Hummingbird sign on MRI leading to misdiagnosis of Progressive Supranuclear Palsy [PSP].

Background: Humming bird sign is used to describe sagittal view magnetic resonance image (MRI) of brainstem, looking like a bird. It occurs due to midbrain atrophy without pontine atrophy. It has been described to have high sensitivity and specificity for PSP.

Methods: A 49 year male presented with insidious onset gradually progressive imbalance, with slowness and stiffness of all limbs for 3‐4 years. He had mild rigidity, with restricted vertical eye movements with generalized hyperreflexia. He was initially evaluated at other centre and diagnosed as PSP based on humming bird sign on MRI brain. However, his detailed examination revealed short neck, low hairline, predominant spasticity rather rigidity. He actually had chronic nuclear left third nerve palsy leading to bilateral ptosis with left esotropia. A detailed review of MRI demonstrated occipitalisation of C1 vertebra, congenital fusion of C2 vertebra, odontoid process hypoplasia, Atlanto‐Axial Subluxation causing holoprosencephaly, moderate dilatation of 3rd Ventricle and Lateral Ventricles. This chronic compression of midbrain due to dilated 3rd ventricle was causing midbrain atrophy with preserved pons forming the Humming bird sign on sagittal MRI.

Results: Hummingbird is commonly considered to be associated with PSP, although it has also been described with Fragile X Associated Tremor/Ataxia syndrome and normal pressure hydrocephalus. We report a Humming Bird sign in cranio‐vertebral junction anomaly. The postulated mechanism for this phenomenon is Atlanto‐Axial Subluxation causing holoprosencephaly, moderate dilatation of 3rd Ventricle and Lateral Ventricles. This chronic compression of midbrain due to diLated 3rd ventricle was causing midbrain atrophy with preserved pons forming the Humming bird sign on sagittal MRI.

Conclusions: A detailed clinical examination and detailed review of imaging findings is essential. Just considering a radiological finding (Hummingbird sign) without detailed examination can lead to misdiagnosis of PSP as demonstrated in our case.

Neuropharmacology

39

Medication errors in hospitalized Parkinson's disease patients

Sarah Siddiqui (Karachi, Pakistan)

Objective: To determine frequency of medication errors in hospitalized patients with underlying Parkinson Disease and to determine their effect of length of hospital stay and mortality.

Background: Hospitalization of patients with underlying Parkinson's Disease (PD) from numerous causes is not uncommon. PD requires specialized patient specific medication regimen. PD patients when admitted to a hospital are prone to alterations in their routine medication timing or doses and addition of some inappropriate medications such as centrally acting antidopaminergics, making them vulnerable to polypharmacy and its side effects.

Methods: The study was conducted from May 2015 – April 2017 at a large tertiary care hospital of Pakistan. Data from electronic medical records was retrieved for all hospital admissions of patients with underlying diagnosis of Parkinson's disease. The frequency of medications errors (incorrect timing, complete omission PD drugs and administration of centrally acting anti‐dopaminergics) was determined. Logistic regression analysis was performed to determine the effect of medication errors on in‐hospital mortality and length of stay.

Results: A total of 680 PD patients were admitted to hospital during the study period. Most common causes of hospital admission were pneumonia (43%), urinary tract infection (31%) and falls (13.2%). In‐hospital consultation with a neurologist or PD specialist was done in only 192/ 680 (28.2%) patients. Overall, errors in medications were noted in a total of 327 (48%) patients, of which incorrect timing of PD medications was noted in 94 (28.7%), centrally acting anti‐dopaminergic administration in 201 (61.4%) and complete omission of PD drugs in 156 (47.7%). Of the 327 PD patients with medication errors, more than half were eventually given out‐patient follow‐up in PD clinic. On logistic regression, medication errors were associated with a longer length of hospital stay (median of 3 days), however, no significant effect was noted on mortality.

Conclusions: Conclusion: Pharmacological management of hospitalized PD patients is far from ideal with a high prevalence of medication errors. Physicians taking care of PD patients should seek expert help in scenarios requiring adjustment of medications during acute illness and should exercise extreme caution in prescription of medications known to aggravate PD symptoms. Educational programs should be developed for physicians taking care of PD patients in acute settings.

References: Lertxundi U, Isla A, Solinís MÁ, Domingo‐Echaburu S, Hernandez R, Peral‐Aguirregoitia J, Medrano J, García‐Moncó JC. Medication errors in Parkinson's disease inpatients in the Basque Country. Parkinsonism & related disorders. 2017 Mar 1;36:57‐62.Martinez‐Ramirez D, Giugni JC, Little CS, Chapman JP, Ahmed B, Monari E, Shukla AW, Hess CW, Okun MS. Missing dosages and neuroleptic usage may prolong length of stay in hospitalized Parkinson's disease patients. PloS one. 2015 Apr 17;10 (4):e0124356.

40

Discovery of Pyrazole (PP‐41) as dual A2A antagonists/MAO‐B inhibitors for the treatment of Parkinson's disease

Udaya Singh, Hans Bhat (Dibrugarh, India)

Objective: To develop pyrazoles as dual A2A antagonists/MAO‐B inhibitors for the treatment of Parkinson's disease.

Background: Parkinson's disease (PD) is a common neurodegenerative disease characterized by the progressive loss of dopaminergic neurons in the substantia nigra affecting motor function. The antagonism of Adenosine 2A (A2A) receptors offer prospective strategy to address motor instability, and as a consequence, numerous A2A antagonists have been accounted so far. The inhibition of dopamine degradation in brain by MAO‐B inhibitors also offers selective advantage for increasing the availability of dopamine and thereby modifying motor function. Our previous studies revealed that, dual inhibition of A2A and MAO‐B provides significant benefit than single therapy alone against PD. Thus, in present study, we intended to develop advanced analogues of DDTR502, high affinity potent dual A2A antagonists/MAO‐B inhibitors for the effective management of PD.

Methods: The compounds were synthesized via cyclo‐condensation reaction and subsequently evaluated for in vitro anti‐Parkinson's activity by free radical scavenging assay. Molecular docking of compounds with adenosine A2A receptor was also carried out with the aim to selectively antagonize its effect. The effect on MAO‐B was identified via enzyme based inhibitory assay using a luminogenic MAO substrate.

Results: Anti‐Parkinson's screening disclosed, PP‐30, PP‐32 with 67% and 75% free radical scavenging activity, with most potent activity in the case of PP‐41 with 93 %. In selective inhibition study with the adenosine A2A receptor, PP‐41 created H‐bonds with Glu169, Asn253 and p‐stacking interactions were formed with Ser67 and Tyr271 of A2A receptor protein domain with Ki (Inhibition constant) raging from 71.04nM to 216.43mM. The PP‐41 also showed inhibition of MAO‐B with IC50 of 37.27 μM.

Conclusions: The results of the present study suggests that PP‐41 as potent dual A2A antagonists/MAO‐B inhibitors for the treatment of Parkinson's disease.

41

An experimental study about neurotoxic potency of a novel botulinum toxin a free of neurotoxin‐associated proteins based on muscle strength measurement

Wuchao Liu, Ya Feng, Junhui Su, Zheng Zhang, Lizhen Pan, Libin Zou, Xueping Zhang, Lingjing Jin (Shanghai, People's Republic of China)

Objective: This study adopted a self‐developed system (CN102599921A) which could statistically measure the muscle strength of a rat's right gastrocnemius muscles to test the effect of different BoNT‐A products and different doses of the same product. Moreover, this study aimed to find the dose‐time effect curve of various BoNT‐A formulations.

Background: Currently, botulinum neurotoxin type A (BoNT‐A) is being widely used in a variety of areas, and warnings regarding the characteristics of different BoNT‐A products have emerged. In China, Chintox, a novel BoNT‐A product free of neurotoxin‐associated proteins, has been successfully developed. A few studies which focused on its molecular structure, pharmacology, and toxicity have been done.

Methods: 125 SD rats were randomly divided into 5 groups: chin‐tox group (n=30), Botulinum A Toxin group (n=30), onabotulinumtoxinA group (n=30), incobotulinumtoxinA group (n=30), and normal saline (NS) group (n=5). 6 different doses of BoNT‐A (0.01 mouse units [MU], 0.1 MU, 0.5 MU, 1 MU, 2 MU, and 4 MU) were applied for every 5 rats of the first 4 groups. BoNT‐A or NS was injected into the right gastrocnemius muscle of rats (with a volume of 100 μL) under anesthesia (Day 0). Then rats were secured on a special adjustable operating table with their feet closely keeping touch with the metal footboards (Figure 1). On sciatic nerve stimulation (28V over 0.4ms), plantar flexion and foot rotation were induced by gastrocnemius muscle contraction. Then muscle strength could be detected by metal footboards which could convert forces to electrical signals trough the muscular tension energy transducer and recorded by a specific computer (Figure 2). Time points for measurements were Day 0, Day 3, Day 7, Day 14, Day 21, Day 28, Day 42, Day 56, Day 70, and Day 84. We concluded the dose‐time effect curve of different BoNT‐A products by analyzing the muscle strength change at different time points.

Results: 91 rats completed the last measurement of muscle strength. The muscle strength of the rats in the BoNT‐A–treated groups was lower than those in the NS group, and reached a minimum from Day 3 to Day 14 (P<0.05). The minimum time for the rats' muscle strength to reach the minimum was 3 days for the chin‐tox group. The rats' muscle strength in all groups treated with BoNT‐A showed no statistical significance compared to the NS group 84 days after treatment (P >0.05), except for the chin‐tox group. We found statistical significance in rats' muscle strength between the various dosage groups in the Chintox group at all time points tested (P <0.05). Compared with the other doses in the chin‐tox group, the rats' muscle strength in the 4 MU group was significantly lower during 7 to 70 days after treatment (P <0.05). In a certain range, the high dose of chin‐tox showed a greater effect and a longer duration of effect than the low dose.

Conclusions: Our studies have shown that the effect of chin‐tox, the domestic NAP‐free BoNT‐A, on the rat lower limb gastrocnemius muscle strength, is similar to that of the three commonly used BoNT‐A products. It can effectively reduce the muscle strength of the rat gastrocnemius, and it has a fast onset and can achieve peak effect in a shorter time. At the maximum dose of 4 MU, of the different BoNT‐A products tested in this study, only chin‐tox maintained its effect of reducing the right gastrocnemius muscle strength of the rats at Day 84.

References: [1] Dover N, Barash JR, Hill KK, et al. Molecular characterization of a novel botulinum neurotoxin type H gene[J]. J Infect Dis, 2014, 209 (2): 192‐202. DOI:10.1093/infdis/jit450[2] Dressler D. Botulinum toxin drugs: brief history and outlook[J]. J Neural Transm (Vienna), 2016, 123 (3): 277‐279. DOI:10.1007/s00702‐015‐1478‐1[3] Jankovic J. Botulinum toxin in clinical practice[J]. J Neurol Neurosurg Psychiatry, 2004, 75 (7): 951‐957. [4] Ahn BK, Kim YS, Kim HJ, et al. Consensus recommendations on the aesthetic usage of botulinum toxin type A in Asians[J]. Dermatol Surg, 2013, 39 (12): 1843‐1860. DOI:10.1111/dsu.12317[5] Simpson DM, Hallett M, Ashman EJ, et al. Practice guideline update summary: Botulinum neurotoxin for the treatment of blepharospasm, cervical dystonia, adult spasticity, and headache: Report of the Guideline Development Subcommittee of the American Academy of Neurology[J]. Neurology, 2016, 86 (19): 1818‐1826. DOI:10.1212/WNL.0000000000002560[6] Dressler D. Clinical applications of botulinum toxin[J]. Curr Opin Microbiol, 2012, 15 (3): 325‐336. DOI:10.1016/j.mib.2012.05.012[7] 2008, (2): 100‐102. [8] Patil S, Willett O, Thompkins T, et al. Botulinum Toxin: Pharmacology and Therapeutic Roles in Pain States[J]. Curr Pain Headache Rep, 2016, 20 (3): 15. DOI:10.1007/s11916‐016‐0545‐0[9] Lee K, Zhong X, Gu S, et al. Molecular basis for disruption of E‐cadherin adhesion by botulinum neurotoxin A complex[J]. Science, 2014, 344 (6190): 1405‐1410. DOI:10.1126/science.1253823[10] Dressler D, Adib Saberi F, Bigalke H. Botulinum toxin therapy: reduction of injection site pain by pH normalisation[J]. J Neural Transm (Vienna), 2016, 123 (5): 527‐531. DOI:10.1007/s00702‐016‐1522‐9[11] Grein S, Mander GJ, Taylor HV. Xeomin® is stable without refrigeration: Complexing proteins are not required for stability of botulinum neurotoxin type A preparations[J]. Toxicon, 2008, 51: 13. DOI: https://doi.org/10.1016/j.toxicon.2008.04.038[12] Gardner AP, Barbieri JT. Light Chain Diversity among the Botulinum Neurotoxins[J]. Toxins (Basel), 2018, 10 (7). DOI:10.3390/toxins10070268[13] Frevert J. Content of botulinum neurotoxin in Botox (R)/Vistabel (R), Dysport (R)/Azzalure (R), and Xeomin (R)/Bocouture (R)[J]. Drugs R D, 2010, 10 (2): 67‐73. DOI:10.2165/11584780‐000000000‐00000[14]Meunier, F. A.; Lisk, G.; Sesardic, D.; Dolly, J. O., Dynamics of motor nerve terminal remodeling unveiled using SNARE‐cleaving botulinum toxins: the extent and duration are dictated by the sites of SNAP‐25 truncation. Mol Cell Neurosci 2003, 22 (4), 454‐66. [15] Lam KH, Jin R. Architecture of the botulinum neurotoxin complex: a molecular machine for protection and delivery[J]. Curr Opin Struct Biol, 2015, 31: 89‐95. DOI:10.1016/j.sbi.2015.03.013[16] Eisele KH, Fink K, Vey M, et al. Studies on the dissociation of botulinum neurotoxin type A complexes[J]. Toxicon, 2011, 57 (4): 555‐565. DOI:10.1016/j.toxicon.2010.12.019[17] Matsui T, Gu S, Lam KH, et al. Structural basis of the pH‐dependent assembly of a botulinum neurotoxin complex[J]. J Mol Biol, 2014, 426 (22): 3773‐3782. DOI:10.1016/j.jmb.2014.09.009[18] Kukreja R, Chang TW, Cai S, et al. Immunological characterization of the subunits of type A botulinum neurotoxin and different components of its associated proteins[J]. Toxicon, 2009, 53 (6): 616‐624. DOI:10.1016/j.toxicon.2009.01.017[19] Dressler D, Tacik P, Adib Saberi F. Botulinum toxin therapy of cervical dystonia: comparing onabotulinumtoxinA (Botox ((R))) and incobotulinumtoxinA (Xeomin ( (R)))[J]. J Neural Transm (Vienna), 2014, 121 (1): 29‐31. DOI:10.1007/s00702‐013‐1076‐z[20] Dong M, Richards DA, Goodnough MC, et al. Synaptotagmins I and II mediate entry of botulinum neurotoxin B into cells[J]. J Cell Biol, 2003, 162 (7): 1293‐1303. DOI:10.1083/jcb.200305098 2017, (7): 710‐717. [22] D. Dressler. Five‐year experience with incobotulinumtoxin A (Xeomin): the first botulinum toxin drug free of complexing proteins,European Journal of Neurology 2012, 19: 385–389[23]Dressler,2012,Clinical applications of botulinum toxin[24] [25]Pirazzini M, 2017 Botulinum Neurotoxins: Biology, Pharmacology, and ToxicologyLee JC, Yokota K, Arimitsu H, et al. Production of anti‐neurotoxin antibody is enhanced by two subcomponents, HA1 and HA3b, of Clostridium botulinum type B 16S toxin‐haemagglutinin. Microbiology.2005;151:3739–3747. [26] Guo Y, Pan L, Liu W, et al. Polyclonal neural cell adhesion molecule antibody prolongs the effective duration time of botulinum toxin in decreasing muscle strength[J]. Neurol Sci, 2015, 36 (11): 2019‐2025. DOI:10.1007/s10072‐015‐2291‐1[27]Dressler,D,2018,Antibody‐induced failure of botulinum toxin therapy: re‐start with low‐antigenicity drugs offers a new treatment opportunity[28]Pickett A, O'Keeffe R, Panjwani N. The protein load of therapeutic botulinum toxins. Eur J Neurol. 2007;14 (4):e11. [29]Bigalke H. Properties of pharmaceutical products of botulinum neurotoxins. In:Jankovic J, Albanese A, Zouhair Atassi M, Dolly JO, Hallett M, Mayer NH, eds.Botulinum Toxin: Therapeutic Clinical Practice and Science. Philadelphia, PA: Saunders, Elsevier; 2009:389–397. [30]J.A.M. KORFAGE, 2011 INFLUENCE OF BOTULINUM TOXIN ON RABBIT JAW MUSCLE ACTIVITY AND ANATOMY[31]Viviane B. Minamoto, P.T.,2015Dramatic Changes in Muscle Contractile and Structural Properties After Two Botulinum Toxin Injections[32]Meunier, F. A.; Lisk, G.; Sesardic, D.; Dolly, J. O., Dynamics of motor nerve terminal remodeling unveiled using SNARE‐cleaving botulinum toxins: the extent and duration are dictated by the sites of SNAP‐25 truncation. Mol Cell Neurosci 2003, 22 (4), 454‐66.

Figure 1.

 

Figure 2.

 

42

Neuroproductive of kolli hills wild plant centella asiatica extract on experimentally induced Parkinsonism in aged zebra fish

Matheswaran Ragadevi, Venkatachalam Uthayakumar, Ramachandran Chandirasekar, Chellamuthu Vasugi, Sithagounder Megala, Rajan Mathivanan, Kalimuthu Loganathan, Marimuthu Sakthivel (Erode, India)

Objective: Antioxidants play an important role in ageing and age related brain degenerative changes including Parkinson's disease. It is characterized by major oxidative stress and mitochondrial damage in Neurons and Acetyl Choline Esterase Enzymes (Muthusamy et al.,2006).

Background: The brain is responsible for survival, successful and healthy functioning of every single neurons. The neurotoxin and environmental stress can induce degeneration of nerve cells It can rectify the alternative herbals remedies by using brain stimulation against zebra fish model.

Methods: The Present study was designed to investigate the Kolli hills wild centella extract would prevent MPTP induced neurotoxicity in aged Zebra fish (Haleagrahara et al., 2010). Adult male zebra fish were divided into control and Centella asiatica alone MPTP (0.20mg,0.25mg, 0.30mg,0.35mg and 0.40mg) restricted for 30 days.

Results: Effect of ethanolic extract of C.asiatica on anti‐oxidant status levels of brain was examined (Subathra et al., 2005) MPTP challenged rats elicited a significantly increase in lipid hydro peroxide, protein carbonyl, xanthine oxidase when compared to control. There were significantly increase total antioxidants, SOD, GPx, and CAT level.

Conclusions: There results show that administration of wild Kolli hills C.asciatica was more effective in protecting the brain against neurodegenerative agents and disorder of Parkinsonism.

References: Haleagrahara and Ponnusamy (2010). Neroprodtctiveeffet of centella asiatica extract (CAE) on experimentally induced Parkinsonism in aged apraguedawley rats. Journal of Toxicological Sciences 35 (i) 41.7.SabthraM, shila s, Devi MA, Pannerselvem C. (2005).Emerging role of Centella asiatica in improving age related neurological antioxidant status. Experimntal gerontology, 40 (8‐9):707‐15.Muthusamy AD, Vedagiri K, Ganesan M, Chinnakannu P., 2006. Oxidative stress – mediated macromolecular damage and dwindle in antioxidant status in aged rat brain regions role of L‐Cartine and DL –alpha –lipoic acid. Clinica Chemica Acta, 368 (1‐2): 84‐92.

Neurophysiology (Non‐PD)

43

Effect of Parkinson's disease on nerve conduction studies

Nisar Ahmed (Aligarh, India)

Objective: The aim of our study was to evaluate the effect of Parkinson's disease on Nerve Conduction Studies.

Background: Studies showed abnormal nerve conduction, evidence of mixed sensorimotor axonal neuropathy was seen (generalized reduction or absence of sensory action potentials and reduced amplitude of compound muscle action potentials in arms and legs) in PD. In idiopathic PD, particularly in the patients with symptoms of rigidity and tremor, there are abnormalities in central motor conduction. Median nerve entrapment in Parkinson's Disease patients could be a risk factor in the development of Carpel Tunnel Syndrome due to recurrent tremor movements, others have found a significant correlation between the cross‐sectional area and distal motor nerve latency and also in the sensory nerve conduction velocity of the median nerve, other authors found a high concordance between sonography and median nerve conduction velocity, there a high prevalence of peripheral neuropathy in PD (up to 55 %) due to levodopa‐related hypovitaminosis. Nerve conductions studies of the sural nerve showed a reduction of SNAP amplitude in Parkinson's patients.

Methods: This study was done in the Neurophysiology Lab of JNMC, Aligarh India. Nerve Conduction Studies (Sensory/Motor) were done in 50 subjects (Control & Parkinson's disease). Age of Control Group was 61.2±11.6 & of Test Group 61.7±10.4. We aimed to find out the changes in the NCV, and in all the cases the assessment of neurological examination was performed & clinically evaluated the deficit in the Central Nervous System. Recordings were performed with Neurostim software and were plotted for statically analysis using, appropriate statistical tests with the help of SPSS Software.

Results: Results of NCV were interpreted, there was a bilateral reduction in Sural, Median and Ulnar Nerve Conduction Velocity, beside amplitude was decreased and latency was significantly delayed.

Conclusions: We concluded that myelinated and unmyelinated fibers show degeneration, along with basal ganglia, and there is an effect of Parkinson's disease on nerve conduction studies.

44

Temporal fluctuation of tremor magnitude is the promising physiological parameter for diagnosis of mild Parkinson disease tremor

Pattamon Panyakaew, Roongroj Bhidayasiri, Chusak Thanawattano, Chanawat Anan (Bangkok, Thailand)

Objective: To determine the sensitivity of wearable inertial sensors in detecting mild form of tremor amongst patients with Parkinson's disease (PD) and identify objective parameters that are characteristics for PD tremor.

Background: Mild parkinsonian tremor is barely visible and intermittent making it difficult to clinically distinguish in the elderly population.

Methods: 50 PD patients with non‐disabling hand tremor and 50 age‐matched healthy controls without any complaints of tremor were clinically evaluated using the UPDRS tremor scale. An in‐house wearable inertial sensor1 (fig 1) was placed at the wrist to measure hand tremor: bilaterally at rest; with postural arm holding; and during a kinetic finger to nose test. Outcomes included root mean square (RMS) angle, peak frequency (Fp), peak magnitude (Mp), dispersion of frequency (Q) and temporal fluctuation of tremor magnitude (TF)2. Data from the best axis on the dominant side was selected according to the best power of RMS angle and compared between groups. The RMS cut‐off point from the ROC at the maximum Youden index point was chosen to identify subgroup of pathologic tremor in PD.

Results: PD patients had very mild tremor with the total UPDRS tremor scale was 3.6 (2.3). RMS angle and Mp were significantly different between PD and controls both at rest and posture (p <0.01 at rest, p<0.01 at posture respectively) (fig 2). TF was higher in PD than controls only at posture (p=0.03) and for the TF ratio2 between rest and posture (p=0.04). ROC of RMS angle at rest and posture were plotted to define the cut‐off point in identifying pathologic tremor in PD group. Subgroup analysis with pathologic PD tremor (RMS angle > cut‐off points) at rest (N=31) and posture (N=34), RMS angle ratio, Q and TF were significantly higher in PD group (p<0.05). TF at rest and posture demonstrated a high sensitivity and specificity (92%, 84%, AUC = 0.93 at rest, 82% and 100%, AUC = 0.94 at posture) in discriminating mild PD tremor from controls (fig 3).

Conclusions: A wearable sensor at the wrist may well be sensitive enough to detect very mild and intermittent tremor in PD patients as well as physiologic tremor amongst control subjects. RMS angle reflects the severity of tremor, which may be used as an indicator in identifying pathologic tremor. Temporal fluctuation of tremor amplitude measuring at rest and postural holding might be the promising physiological parameter to discriminate pathologic PD tremor from physiologic tremor with high sensitivity and specificity.

References: 1. Bhidayasiri R, et al. Low‐cost, 3‐dimension, office‐based inertial sensors for automated tremor assessment: technical development and experimental verification. J Parkinsons Dis. 2014;4 (2):273‐82.2. Thanawattano C, Pongthornseri R, Anan C, Dumnin S, Bhidayasiri R. Temporal fluctuations of tremor signals from inertial sensor: a preliminary study in differentiating Parkinson's disease from essential tremor. Biomed Eng Online. 2015 Nov 4;14:101.

Figure 1.

A; The in‐house wearable inertial sensor containting of triaxial accelerometers and gyroscopes with outcomes, B; the example of tremor recording from PD patient and control

Figure 2.

A; The tremor parameters at rest, postural, kinentic tremor and temporal fluctucation of tremor at rest, posture and TF ratio at rest/posture in all PD group and B; in subgroup with pathologic tremor.

Figure 3.

A; ROC demonstrating sensitivity and specificity of TF at rest and B; posture to discriminate mild PD tremor from control.

Other

45

Acute Parkinsonism in a young adult following streptococcal infection: possible adult variant of PANDAS

Shahedah Koya Kutty, Wan Asyraf Wan Zaidi, Wan Nur Nafisah Wan Yahya, Tan Hui Jan, Rabani Remli, Norlinah Ibrahim (Kota Tinggi, Malaysia)

Objective: To describe streptococcal infection induced secondary Parkinsonism as a possible variant of Paediatric Autoimmune Neuropsychiatric Disorders Associated with Streptococcal infection (PANDAS) in adult.

Background: PANDAS is a recognized clinical entity in children and usually presented with hyperkinetic movement disorders. Neuropsychiatric symptoms include not only the tics and OCD, but depression, sleep disorders and parkinsonism were reported. Its presentation in adults is rarely described.

Methods: A previously well 18‐year‐old Malay lady presented with a two‐months history of intermittent fever associated with sore throat and one‐week history of behavioural changes. She was noted by her family members to be less talkative and less responsive to in the preceding week. Her movements had also become slower with right hand tremor. Apart from recurrent history of ‘sore throats’, her past medical history was unremarkable. On examination, she was febrile but other vital signs were normal. Throat examination revealed tonsillopharyngitis. There was intermittent resting tremor of the right hand and leg. There was hypomimia, rigidity of all her limbs and bradykinesia during finger and foot taps. She was unable to walk due to marked rigidity. Deep tendon reflexes and plantar responses were normal.

Results: Investigations revealed an elevated WCC, with normal renal and liver. Herpes Simplex Virology screen and anti‐NMDAR antibodies were negative. CSF findings were normal, with an opening pressure of 10 cm water. The ASO titre was elevated at 400IU/ml. Electroencephalogram (EEG) showed mild encephalopathic changes. Brain MRI plain and contrasted were unremarkable. She was treated with IV Ceftriaxone 2 g twice daily for total a week and later IV methylprednisolone 1g daily for 3 days. She was also given clonazepam 0.5mg once daily, 25/100 mg of carbidopa/levodopa thrice daily. Immune globulin (IVIG) therapy was commenced later in view of poor response to the above treatment, which resulted in significant and rapid clinical improvement. On clinic follow up 3 months later, she was well with complete resolution of her extrapyramidal symptoms.

Conclusions: This case highlights the importance of recognising post‐streptococcal infection as aetiology of acute parkinsonism in young adults, to avoid treatment delay. As illustrated in our case, the prognosis is good with immunomodulatory therapy.

References: 1. Dale, R.C., Post‐streptococcal autoimmune disorders of the central nervous system. Developmental Medicine & Child Neurology, 2005. 47 (11): p. 785‐791.2. Ben‐Pazi, H., Livne, A., Shapira, Y., & Dale, R. C. (2003). Parkinsonian features after streptococcal pharyngitis. The Journal of pediatrics, 143 (2), 267‐269.

46

This abstract has been withdrawn.

47

Computational model based analysis of multi‐electrode‐arrays placement and pulse amplitude for brain stimulation through neuromodulation

Venkateshwarla Rama Raju (Hyderabad, India)

Objective: The ideal form of a neural interfacing device is highly dependent upon the anatomy of the region with which it is meant to interface. MEAs provide a system that can be adapted to various neural geometries. Computational models of stimulating systems have proven useful for evaluating electrode placement and stimulation protocols, but have yet to be adequately adapted to the unique features of the hippocampus.

Background: In communicating with neural systems, there are few in vivo techniques more widely used than electrode‐based stimulation and recording. One of the greatest feats of neural engineering has been the development of implantable medical devices which use multi‐electrode‐arrays (MEAs) to acquire—record and stimulate neurons for the therapeutic treatment of brain disorders, whether through modulation (i.e., deep brain stimulation) or restoration (i.e., proposed hippocampal memory prosthesis) [1]. Advancements in medical implant technology have a trajectory toward “fewer and more”: smaller electronics and higher density MEAs [2]–[4]. However, the effectiveness of these engineering advances cannot be maximized without a fundamental understanding of the neural system that is the basis of the brain disorder, which includes the neuro‐electro‐physiology and anatomy of the neurons and their network topology. This knowledge can aid the design of MEAs by indicating the ideal location, orientation, number of electrodes, and stimulation pattern necessary to elicit a target response.

Methods: As an approach to understanding potential memory restorative devices, an admittance method‐NEURON model was constructed to predict the direct and synaptic response of a region of the rat dentate gyrus to electrical stimulation of the perforant path.

Results: A validation of estimated local field potentials against experimental recordings is performed and results of a bilinear electrode placement and stimulation amplitude parameter search are presented.

Conclusions: The parametric analysis presented herein suggests that stimulating electrodes placed between the lateral and medial perforant path, near the crest of the dentate gyrus, yield a larger relative population response to given stimuli. This study shows that the model performs the minimum functions necessary to improve electrical stimulation systems. Beyond deepening understanding of the hippocampal tissue system, establishment of this model provides a method to evaluate candidate stimulating devices and protocols.

References: [1] T. W. Berger et al., “A cortical neural prosthesis for restoring and enhancingmemory,” J. Neural Eng., vol. 8, no. 4, Aug. 2011, Art. no. 046017. [2] M. E. Spira and A. Hai, “Multi‐electrode array technologies for neuroscienceand cardiology,” Nature Nanotechnol., vol. 8, no. 2, pp. 83–94,2013.

48

Nurse‐led telephone consultation for patients with Parkinson disease and Parkinsonism

Wei Li, Hwee Lan Ng, Kay Yaw Tay, Wing Lok Au, Louis Tan (Singapore)

Objective: To review the purpose of various telephone calls so as to strategise and improve care for patients with Parkinsonism (PK).

Background: Telephone consultations are an important component in the care of patients with Parkinsonism. It has been shown to reduce morbidity, mortality, and healthcare utilization in many medical disciplines. The telephone consult service is manned by the specialised Parkinson nurses with the support of movement disorder neurologists in a tertiary Parkinson Disease and Movement Disorder (PDMD) centre. In order to better support patients with PK and to assess its cost‐effectiveness, an audit was carried out on the telephone consult service at the PDMD centre.

Methods: The telephone call‐back book was reviewed for the period: July to Sep 2017.

Results: 225 calls were received for the period 1 July to 30 Sep 2017. Of these, 126 calls were made by patients, 91 calls were from relatives or caregivers, and 8 calls were from community care partners. There were 103 calls related to the patients' condition such as to report slow movements, walking difficulty, hallucinations or leg swelling. 61 calls were medication‐related, to report side‐effects of medication, check medication dosage, or drug compatibility with other medications. 21 calls were to change appointments. 40 calls were for general enquiry or to speak to nurses. Over this period, 6 patients were identified as frequent callers who made phone calls more than 3 times within one month. Some patients just needed to speak with PD nurses to allay their anxiety.

Conclusions: Telephone consultation by nurses provides individualised care for patients with PK and their caregivers. Its significant utilisation warrants further studies to investigate follow‐up interventions and patient outcomes that will facilitate better resource planning so as to better support PK patients and their caregivers in the community.

49

This abstract has been withdrawn.

50

Comorbid cervical and lumbar spondylosis amongst patients with Parkinson's disease in a rural western Indian medical teaching hospital

Soaham Desai, Devangi Desai (Anand, India)

Objective: To assess frequency of co‐occurrence of cervical and lumbar spondylosis amongst patients with PD in Movement disorders clinic of rural medical teaching hospital in western India.

Background: Cervical and lumbar spondylosis and related issues are a frequent comorbidity in patients with Parkinson's disease. The association between these 2 disorders has not been evaluated adequately in scientific literature.

Methods: All patients with PD attending the Movement Disorders clinic between January 2015 to September 2018 were serially assessed for comorbid cervical and/ or lumbar spondylosis as well as frequency of associated symptoms of cervical and /or lumbar radiculopathy, myelo‐radiculopathy and lumbar canal stenosis were assessed. In the patients who had undergone a spinal imaging, the findings of Xray and MRI were ascertained to look for cervical as well as lumbar spondylosis, spondylolisthesis and lumbar canal stenosis.

Results: Amongst 180 patients [110 males] [mean age 71] with PD who attended the clinic, 120[66.6%] had comorbid symptoms related to cervical or lumbar spondylosis. 63 [35 %] had associated Cervical radiculopathy, 36[20%] had cervical spondylotic myelopathy, 117 [65%] had L5/S1 radiculopathy while 54 [30 %] had lumbar canal stenosis. Presence of lumbar radiculoparthy correlated with female gender, higher age, lumbar disease, higher weight while cervical spondylosis correlated with male gender, higher age and lower weight. 70 percent patients had either of cervical or lumbar disease while 20 percent patients had both cervical as well as lumbar spondylosis. Amongst these, 5 of the patients with cervical disease had undergone surgery and only one felt subjective recovery. Amongst patients with lumbar disease, 18 had undergone surgery in the past out of which only 5 felt subjective improvement post‐surgery.

Conclusions: Cervical and lumbar disc disease are a common comorbidity of PD. Significant needs of caring for this comorbidity by medications and rehabilitative measures are an important part of caring for patients with PD. Future research is needed on the prevalence of this comorbidity and its management in patients with PD.

51

Parkinson pharmacological problem in Indonesia's universal health coverage era

Andre Wijono (Salatiga, Indonesia)

Objective: Identify the problem of Parkinson disease pharmacological treatment in Indonesia

Background: Since 2014, Indonesia implements Universal Health Coverage. It is a social insurance for every Indonesian citizen. It covers in‐patient and out‐patient treatment. Parkinson disease treatment is also covered by the social insurance scheme. All oral medications for Parkinson disease are included in the national formulary. After 4 years of implementation, many patients complain about the sustainability of the program. The complaints also come from health practitioners. The previous studies about this topic are very limited.

Methods: This is a qualitative study with focus group discussion. The participants are representative from health authorities, practitioners (neurologist, pharmacist), experts from university (pharmacologist, epidemiologist), and patient representatives (2 patients). The focus of the discussion is concerning availability of the treatment, the problem with referral back system for Parkinson, and the limitations of current condition.

Results: The Parkinson disease patients feel helped with this program. The program covers all treatment. The common problem is the medication is not always available and sufficient. The number of patients covered by this social insurance program have been increasing. The stocks of the medication from the health district and hospital are not always enough for all the patients. Many patients do not receive medication for 1 month. The problem with referral system is also significant. Many hospitals do not have full time neurologist. The referral back system is not working properly. From the patients' point of view, the availability of medication for full period (one‐month medication) is very crucial.

Conclusions: This study showed that some problems encounter in pharmacological management of Parkinson disease in Indonesia's national health coverage era. The availability of medication and referral system are the main problem.

52

Prevalence and risk factors for early‐morning off in Chinese patients with Parkinson's disease

Shishuang Cui, Du Juanjuan, Shengdi Chen (Shanghai, People's Republic of China)

Objective: The aim of this study is to explore the prevalence of EMO and the risk factors for EMO in Chinese PD patients.

Background: Early‐morning off (EMO) is prevalent in Parkinson's disease (PD) patients with lowered quality of life and increased caregiver burden in European countries.

Methods: Idiopathic PD patients were enrolled in the present study. EMO was screened based on the Wearing‐Off Questionnaire (WOQ)‐19 and supplemented by presence of early morning dystonia. Disease history was collected, and scales of motor and non‐motor symptoms were assessed. Logistic regression was performed to find out risk factors for EMO.

Results: 543 patients were enrolled by the end of study. EMO was observed in 18.4% patients and about 61% of patients with EMO had NMS. The prevalence of EMO in patients with Hoehn &Yahr (H‐Y) stage 1, 1.5, 2, 2.5 and 3‐5 was respectively 4.8%, 13.0%, 17.1%, 35.5% and 37.3%. The most frequent motor symptom was bradykinesia and the most frequent NMS was pain. Early‐onset PD (EOPD), higher daily dose of levodopa and higher MDS‐UPDRS part 2 scores were associated with higher risk of EMO.

Conclusions: EMO was observed in 18.4% patients and about 61% of patients with EMO had NMS. The most frequent motor symptom is bradykinesia and the most frequent NMS is pain. EOPD, higher daily dose of L‐DOPA and severe motor impairment were risk factors for EMO.

Figure 1.

 

Figure 2.

 

53

Cannabinoids and parkinson disease with depression

Shan Li (Qingdao, People's Republic of China)

Objective: This review is mainly to examine the effect of cannabinoids to parkinson's disease with depression.

Background: Parkinson's disease is regarded as the second commonest neurodegenerative disorder and depression is a common non‐motor symptoms of it. Depression can impair the quality of life, coagonative function and physical flexibility of old patients who occurred Parkinson's disease.

Methods: In 1980, Cunha et al. reported the use of cannabis extract for anticonvulsant effects in 7/8 epidemiological patients in a phase I clinical trial. Since then, neurological applications have been the main focus of new research using medical cannabis and plant cannabinoid extracts.

Results: Cannabis is benefical to the development of parkinson disease's with depression.

Conclusions: In this review,we will list s series of evidence to demonstrate the good aspects of cannabinoid to depression.

References: Abush H, Akirav I. Cannabinoids Ameliorate Impairments Induced by Chronic Stress to Synaptic Plasticity and Short‐Term Memory. NeuropsychopharmacologyAso E, Juves S, Maldonado R, Ferrer I. CB2 cannabinoid receptor agonist ameliorates Alzheimer‐like phenotype in A beta PP/PS1 mice. J Alzheimers Dis.Bergamaschi MM, Queiroz RH, Zuardi AW, Crippa AJ. Safety and side effects of cannabidiol: A Cannabis sativa constituent. Curr Drug Saf. Bih CI, Chen T, Nunn AV, Bazelot M, Dallas M, Whalley BJ. Molecular targets of cannabidiol in neurological disorders. Neurotherapeutics. Campos AC, Fogaça MV, Scarante FF, Joca SRL, Sales AJ, Gomes FV, et al. Plastic and neuroprotective mechanisms involved in the therapeutic effects of cannabidiol in psychiatric disorders. Front Pharmacol. Campos AC, Moreira FA, Gomes FV, Del Bel EA, Guimarães FS. Multiple mechanisms involved in the large‐spectrum therapeutic potential of cannabidiol in psychiatric disorders. Camposa AC, Fogac MV, Sonegoa AB, Guimarãesa FS. Cannabidiol, neuroprotection and neuropsychiatric disorders. Pharmacol Res.

54

Altered expression levels of microRNA‐132 and Nurr1 in peripheral blood of Parkinson's disease: a potential disease biomarker

Zhaofei Yang, Tianbai Li, Song Li, Wei Min, Hongqian Qi, Bairong Shen, Weidong Le (Dalian, People's Republic of China)

Objective: To detemine whether peripheral miR‐132 expression level was significantly altered in patients with PD as compared with controls, and to evaluate whether peripheral miR‐132 had a negative correlation with Nurr1 in PD patients.

Background: MicroRNAs (miRNAs) are small and evolutionary conserved non‐coding RNAs that are involved in post‐transcriptional gene regulation. Differential expression levels of miRNAs can be used as potential biomarkers of disease. Previous animal studies has indicated that the expression level of miR‐132 is negatively correlated with its downstream molecule nuclear receptor related 1 protein (Nurr1), which is one of key factors for the maintenance of dopaminergic function and is particularly vulnerable to be affected in Parkinson's disease (PD). However, this correlation has not been confirmed in human patients with PD.

Methods: We determined the peripheral circulation levels of miR‐132 and Nurr1 in patients with PD (n=215), neurological disease controls (NDC, n=176) and healthy controls (HC, n=222) by reverse transcription real‐time quantitative PCR (RT‐qPCR).

Results: Our data demonstrated that the plasma miR‐132 level of PD patients was significantly higher than those of HC (194%, p < 0.01) and NDC (206%, p<0.01). No statistical difference was found in miR‐132 expression levels between PD patients with or without anti‐PD medications. When adjusted for gender and age, higher level of miR‐132 expression was associated with the significantly increased risk for PD in male, and was closely related with the disease stages and disease severity. Furthermore, peripheral Nurr1 was significantly decreased in PD compared with HC (56%, p<0.01) and NDC (55%, p<0.01). Interestingly, further analysis revealed a negatively correlation between the decreased Nurr1 level and the elevated miR‐132 level in patients with PD.

Conclusions: Our data demonstrated that the plasma miR‐132 level of PD patients was significantly higher than those of HC (194%, p < 0.01) and NDC (206%, p<0.01). No statistical difference was found in miR‐132 expression levels between PD patients with or without anti‐PD medications. When adjusted for gender and age, higher level of miR‐132 expression was associated with the significantly increased risk for PD in male, and was closely related with the disease stages and disease severity. Furthermore, peripheral Nurr1 was significantly decreased in PD compared with HC (56%, p<0.01) and NDC (55%, p<0.01). Interestingly, further analysis revealed a negatively correlation between the decreased Nurr1 level and the elevated miR‐132 level in patients with PD.

References: 1. Bartel D. P. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell. 2004; 116 (2): 281‐297. 2. Dong H, Wang C, Lu S, et al. A panel of four decreased serum microRNAs as a novel biomarker for early Parkinson's disease. Biomarkers. 2016; 21 (2): 129‐137. 3. Yang D, Li T, Wang Y, et al. miR‐132 regulates the differentiation of dopamine neurons by directly targeting Nurr1 expression. Journal of cell science. 2012; 125 (Pt 7): 1673‐1682.

55

Symptom of hemifacial spasm remained in a comatose patient

Tao Li, Chunli Song, Huiling Zhou, Zhanhua Liang (Dalian, People's Republic of China)

Objective: Unlike most movement disorders, contractions of hemifacial spasm persist during sleep which may add to the morbidity of the condition by predisposing the affected individual to disturbed sleep and insomnia. The nerve origin hypothesis or the peripheral theory and the nuclear origin hypothesis or the central theory are the two main Pathophysiology. Here we reported symptom of hemifacial spasm remained in a comatose patient.

Background: Hemifacial spasm is a movement disorder of the seventh cranial nerve which is characterised by either brief or persistent, intermittent twitching of the muscles innervated by the facial nerve. The hallmark of the disease is involuntary clonic and/or tonic contractions of the muscles of facial expression, usually unilaterally, beginning in the periorbital musculature, but later on progressing to involve the perioral, platysma and other muscles of facial expression as well. These contractions even though present at rest, worsened at times of stress.

Methods: A 74‐year‐old woman suffered from right side primary hemifacial spasm for 20 years. She were carried to emergency department after traumatic right pneumothorax by traffic accident. During emergency treatment, cardiac arrest and Spontaneous apnea happened. Cardiopulmonary resuscitation followed by tracheal intubation and closed drainage of pleural cavity were executed immediately. Heartbeat and breath resumed 3min later. However, her consciousness did not return to normal. Then she was hospitalized in intensive care unit for further therapy including tracheotomy. During hospitalization, symptom of hemifacial spasm remained. Right side facial musculature were involved. Either brief or persistent involuntary clonic or tonic contractions were seen, especially when medical operation was carried out as kind of stimulation. “ The other Babinski sign” exist when the orbicularis oculi contracts and the eye closes, the internal part of the frontalis contracts at the same time, and the eyebrow rises during eye occlusion (see video/picture).

Results: Most often we observe hemifacial spasm in an awakening situation. But actually it cannot only persist during sleep but also in patient with disturbance of consciousness.

Conclusions: It's better for non‐specialists to prompt diagnose instead of under or misdiagnose the symptom as Focal cortical seizures involving the facial muscles for example.

References: 1. Yaltho TC, Jankovic J. The many faces of hemifacial spasm: differential diagnosis of unilateral facial spasms. Mov Disord. 2011 Aug 1;26 (9):1582‐1592.2.Chaudhry N, Srivastava A, Joshi L. Hemifacial spasm: The past, present and future. J Neurol Sci. 2015 Sep 15;356 (1‐2):27‐31.

56

Differential diagnosis of bradykinesia in Parkinson's Disease and Huntington's disease using machine learning

Siti Muhamed, Rachel Newby, Jeremy Cosgrove, Stephen Smith, Peter Kempster, Jane Alty, Stuart Jamieson (Kedah, Malaysia)

Objective: To reliably distinguish between healthy controls, Parkinson's disease (PD) patients and Huntington's disease (HD) patients by using machine learning on digitised kinematic data from MDS‐UPDRS conventional clinical motor tasks.

Background: Bradykinesia is an important motor sign of PD and frequent found in HD. Observation of the characteristics of bradykinesia and how it differs between these groups will give a better understanding of bradykinesia in movement disorders.

Methods: 20 healthy controls, 22 PD and 11 HD patients performed three motor tasks from MDS‐UPDRS: finger tapping (FT), hand opening‐closing (HO) and hand pronation‐supination (PS). Subjects were assessed clinically and measured using an objective motion tracking system with high sampling rate recordings. Selected movement features were extracted from the kinematic data based on the current clinical definition of bradykinesia and used as inputs to the machine learning algorithms. Cartesian Genetic Programming (CGP) [1], was the specific type of machine learning used to evolve classifiers. The fitness assigned to each classifier was the proportion of samples correctly classified. Results are averaged over ten iterations to improve statistical significance.

Results: For FT task, the highest averaged accuracy achieved for the classification between controls and HD patients was 83.42%. Of all three tasks, best classification was achieved using the PS task: classification between controls and HD patients was 85.98%, for PD vs HD patients it was 87.20%. The majority of HO classifiers achieved lower scores from 75 % to 84%. An overview of the best performance for each motor task in all three classes is shown in Figure 1.

Conclusions: Hand opening‐closing and hand pronation‐supination have the same and, in some cases, better potential accuracies, than finger tapping as a tool for the characterisation of Bradykinesia using CGP machine learning. More than three‐quarters of all classifiers evolved for all tasks have consistent accuracies above 80%. These high accuracy classifications demonstrate that bradykinesia characteristics are different in healthy people of old age, PD patients and HD patients. Further analysis of discriminative features will provide more information about bradykinesia in these groups.

References: [1] J. F. Miller and P. Thomson, “Cartesian genetic programming,” Genet. Program. Proc. Third Eur. Conf. Genet. Program. (EuroGP2000)., vol. 1802, pp. 121–132, 2000.

Figure 1.

Best CGP machine learing classifiers accuracies by task

57

This abstract has been withdrawn.

236

Role of non‐dopaminergic system following repeated exposure to restraint stress and lambda‐cyhalothrin on the movement disorders in rats

Rajendra Shukla, Richa Gupta, Aditya Pant, Sudhir Goel, Vinay Khanna (Bhopal, India)

Objective: Impact of psychological stressors in modulating the toxicity of environmental chemicals has been significant, however the mechanism is still not explicable.

Background: Reiterated stress exaggerates the toxicity of environmental toxicants like metal, pesticides or drugs have been reported in number of studies although the correct mechanism associated with non‐dopaminergic system is not clearly understood.

Methods: Rats were encountered with restraint stress (RS), a psychological stressor (placed in plastic restrainer for 15 min/day; one session/day) for 28 days or exposed with lambda‐cyhalothrin (LCT), a new generation type‐II synthetic pyrethroid (3.0 mg/kg body weight, p.o.) for 3 days (on days 26, 27 and 28) or pre‐exposed to RS for 28 days followed by LCT treatment for 3 days. Plasma corticosterone, BBB permeability and cholinergic‐muscrainic receptors and immunoreactivity of ChAT in frontal cortex and hippocampus. Further, effect of dopamine signaling associated with motor functions was also assessed by standard protocol.

Results: Increased the levels of plasma corticosterone and alteration of BBB permeability was found in rats pre‐exposure to RS followed by LCT treatment as compared to RS or LCT alone. Additionally, decreased the cholinergic‐muscrainic receptors, immunoreactivity of ChAT and apoptosis markers in frontal cortex and hippocampus as compared to rats exposed to RS or LCT alone. These changes coupled with motor dysfunctions including grip strength. Marginal changes was observed in cholinergic‐muscrainic signaling and apoptosis markers in frontal cortex and hippocampus including plasma corticosterone levels and BBB permeability associated with motor functions in rats exposed to either RS or treated with LCT alone as compared to controls.

Conclusions: The results revealed that repeated stress considerably modulates the neurotoxicity of LCT through non‐dopaminergic signalling associated with motor activity with grip strength in rats. The study showed that cholinergic receptor and apoptosis proteins in frontal and hippocampus brain regions also played significant role in the movement disorders.

References: 1. Shukla RK, Dhuriya YK, Chandravanshi LP, Gupta R, Srivastava P, Pant AB, Kumar A, Siddiqui HS and Khanna VK. Influence of immobilization and forced swim stress on the neurotoxicity of lambda‐cyhalothrin in rats: Effect on brain biogenic amines and BBB permeability. Neurotoxicology 60 (2017) 187 – 196. 2. Fox SH1, Brotchie JM, Lang AE. Non‐dopaminergic treatments in development for Parkinson's disease. Lancet Neurol. 2008 Oct;7(10):927‐38. doi: 10.1016/S1474‐4422(08)70214‐X.

237

Alterations of NURR1 and cytokines in the peripheral blood lymphocytes: combined biomarkers for Parkinson's disease

Tianbai Li, Zhaofei Yang, Song Li, Cheng Cheng, Bairong Shen, Weidong Le (Dalian, People's Republic of China)

Objective: To determine whether the expression levels of NURR1 gene and inflammatory cytokines are altered in the peripheral blood lymphocytes (PBL) of PD patients, and to evaluate the relationship between NURR1 and cytokines expression levels in PBL.

Background: Nuclear receptor related 1 protein (NURR1), a transcription factor as key player for maintaining dopamine neuron functions and regulating neuroinflammation in the central nerves system, is a potential susceptibility gene for Parkinson's disease (PD). Neuroinflammation as a measurable driving force of PD pathology, could alter the levels of inflammatory cytokines in the brain and peripheral blood of PD.

Methods: We measured NURR1 and cytokines (TNF‐a, IL‐1ß, IL‐4, IL‐6 and IL‐10) mRNA expression levels in the PBL of 312 PD patients, 318 healthy controls (HC), and 311 non‐PD neurological disease controls (NDC) by quantitative real‐time PCR.

Results: Our data showed that NURR1 gene expression was significantly decreased in the PBL of PD as compared with that of HC and NDC (p < 0.01). The expression levels of all these five cytokines were significantly higher than those of HC and NDC. Statistical analysis revealed that NURR1 expression presented a negative correlation with the expression of TNF‐a, IL‐1ß, IL‐6 and IL‐10, and collectively the measurements of NURR1 plus those cytokines significantly improve the diagnostic accuracy.

Conclusions: NURR1 is likely to be involved in the process of PD by mediating the neuroinflammation, and the combination of NURR1 and cytokines assessment in the PBL can be potential biomarkers for PD diagnosis.

References: 1. Le, W., Conneely, O., Zou, L., He, Y., Saucedo‐Cardenas, O., Jankovic, J., et al. (1999). Selective agenesis of mesencephalic dopaminergic neurons in Nurr1‐deficient mice. Experimental neurology 159(2), 451‐458. doi: 10.1006/exnr.1999.7191. 2. Huang, Y., Cheung, L., Rowe, D., and Halliday, G. (2004). Genetic contributions to Parkinson's disease. Brain Research Reviews 46(1), 44‐70. doi: 10.1016/j.brainresrev.2004.04.007. 3. Saijo, K., Winner, B., Carson, C., Collier, J., Boyer, L., Rosenfeld, M., et al. (2009). A Nurr1/CoREST pathway in microglia and astrocytes protects dopaminergic neurons from inflammation‐induced death. Cell 137(1), 47‐59. doi: 10.1016/j.cell.2009.01.038. 4. Heneka, M., Kummer, M., and Latz, E. (2014). Innate immune activation in neurodegenerative disease. Nat Rev Immunol 14(7), 463‐477. doi: 10.1038/nri3705. 5. Reale, M., Iarlori, C., Thomas, A., Gambi, D., Perfetti, B., Nicola, M., et al. (2009). Peripheral cytokines profile in Parkinson's disease. Brain Behav Immun 23(1), 55‐63. doi: 10.1016/j.bbi.2008.07.003.

Parkinson's Disease: Clinical Trials, Pharmacology and Treatment

58

Role of Antidiabetic Drug As Antiparkinsons Potential

Dharmendra Khatri (Pune, India)

Objective: In the present study, we have investigated some of the marketed anti‐diabetic formulations for their Antiparkinsons activity in terms of improving motor behavior in Zebrafish.

Background: Currently, in many clinical trials at the different phase, several antidiabetic drugs demonstrated improvement in the motor, but not cognitive performance in patients. Therefore the role of anti‐diabetic agents in the treatment of PD is becoming of great interest. Hence, we hypothesized that anti‐diabetic medications help to improve symptoms or have neuroprotective effects in Parkinson's disease.

Methods: Adult zebrafish were exposed to rotenone (5 μl/L) into their water tank to produce locomotors deficits. Metformin (15, 30 and 60 mg/kg) and Glitazone (1.5, 3 and 6 mg/kg) was administered intramuscularly (i.m.) for 14 days. The number of the cross were counted in order to assess the locomotors behavior.

Results: Rotenone‐treated fish showed significant (P> 0001) reduction in the locomotor activity as compared to normal control fishes. Treatment with Metformin (15, 30 and 60 mg/kg) and Glitazone (1.5, 3 and 6 mg/kg) able improve the locomotor activity in zebrafish significantly as compared to the rotenone‐treated group of fish.

Conclusions: Based on the findings of the present study, it can be concluded that repositioning of the antidiabetic drug for treating Parkinson's disease associated behavioral deficits can be improved for better therapeutic management.

References: Brauer R, Bhaskaran K, Chaturvedi N, Dexter DT, Smeeth L, Douglas I. Glitazone treatment and incidence of Parkinson's disease among people with diabetes: a retrospective cohort study. PLoS medicine. 2015 Jul 21;12 (7):e1001854.Khatri DK, Juvekar AR. Abrogation of locomotor impairment in a rotenone‐induced Drosophila melanogaster and zebrafish model of Parkinson's disease by ellagic acid and curcumin. International Journal of Nutrition, Pharmacology, Neurological Diseases. 2016 Apr 1;6 (2):90.

59

Design and discovery of quinazoline‐triazine derivatives as adenosine A2A receptor antagonist against Parkinson disease

Amita Verma, Parjanya Shukla, Prateek Pathak, Vikas Kumar (Allahabad, India)

Objective: To develop quinazoline‐triazine derivatives as adenosine A2A receptor antagonist against Parkinson Disease.

Background: Parkinson's disease (PD) is the second most widespread neurodegenerative disorder, affecting upto 10 million people worldwide. It is characterized by a motor impairment caused by the degeneration of dopaminergic neurons. Adenosine is a neuro‐modulator that coordinates responses to dopamine and other neurotransmitters. The loss of drug effectiveness together with motor complications, lack of effect on non¬motor symptoms, and a failure to modify disease progression is deemed as a major hitch in the treatment of Parkinson's disease (PD). As a upshot, adenosine A (2A) receptors (A (2A) ARs) provide a possible target as novel approach in treatment of PD. Recent studies suggested the utility of the quinazoline and triazine as potent inhibitor of A (2A)ARs. Thus, we anticipated to synthesize novel quinazoline‐ triazine derivatives against A (2A) ARs in the benefit of PD.

Methods: Target compounds were designed by molinspiration software and all the quinazoline‐ triazine (QT) derivatives 8a‐o fulfill the criteria of Lipinski rule of five. The core scaffold of QT derivatives was synthesized by using substitution reaction with various amines which later underwent to nucleophlic substitution reaction with triazine yielding novel analogues of QT. All the synthesized compounds were characterized by UV, IR, NMR and Mass spectroscopy. Synthesized molecules were subsequently subjected for in‐vitro anti parkinson's activity by free radical scavenging assay. The molecular docking analysis was also carried out with adenosine A2A receptor to stipulate the imperative structural contacts responsible for activity.

Results: The synthesized molecules were found to have good drug likeliness and bioavailability. Anti parkinson's evaluation showed, 8a, 8b, 8 i, as potent compounds with 82%, 90 %, 86% free radical scavenging activity, respectively. Docking studies with the adenosine A2A receptor recommended that, above molecules efficiently and selectively make interaction with SER 67, ASP 170, TYR 271, PHE 168, LEU 167, MET 270, ALA 63, ILE66, ILE274, LYS153, GLU 169, HIS 278 of A2A receptor protein domain with Ki (Inhibition constant) raging from 105.67 nM to 197.35 nM disclosing 8 b as most potent analogue. In metabolic analysis, the skeleton of the hybrid compounds remained intact for the longer duration to exert its effect during metabolic assay.

Conclusions: Among the developed compounds 8 b was identified as potent A (2A)ARs antagonist against Parkinson's disease via significant free radical scavenging activity and favorable metabolic profile with excellent bioavailability.

References: 1. Sebastião AM, Ribeiro JA., Adenosine receptors and the central nervous system, Handb Exp Pharmacol. 2009; (193):471‐534. 2. Cacabelos R., Parkinson's Disease: From Pathogenesis to Pharmacogenomics., Int J Mol Sci. 2017; 4;18 (3).

60

Hypotension and Bradycardia, a serious adverse effect of piribedil, a case report and literature review

Piao Zhang, Yan Li, Lijuan Wang, Yuhu Zhang (Guangzhou, People's Republic of China)

Objective: We present a rarely reported case of exhibited hypotension and bradycardia that is significantly related to the dosage of piribedil. It reminds physicians that they should weigh the potential risk of hypotension and bradycardia against the benefits that can be derived from the use of this drug.

Background: Dopamine agonists (DAs) are efficacious for treatment of motor and nonmotor symptoms in patients with Parkinson's disease (PD). The treatment of PD with DAs is often complicated by adverse drug reactions (ADRs) of dopaminergic and non‐dopaminergic origin. The DA Piribedil is widely used in Asian, European, and Latin American countries and as such clinicians must pay great attention to its ADRs. Here we present a rarely reported case of exhibited hypotension and bradycardia that is significantly related to the dosage of piribedil.

Methods: Firstly, we presented a rare case in which a middle‐aged male, diagnosed with PD, received dopamine replacement with piribedil. When taking 50mg piribedil, there are no ADRs. But two hours after taking 100mg piribedil (the first dose change of piribedil) he presented with serious concomitant hypotension and bradycardia with a blood pressure (BP) reading of 85/48mmHg and heart rate (HR) of 45 beats/min when sitting. On taking 75mg piribedil (the second dose change of piribedil), the patient showed the same symptoms with BP reading at 70/45mmHg and HR of 47 beats/min in the same position. Upon receiving pramipexole 0.125mg, 0.25mg, and 0.375mg three times a day there were no cardiovascular effects. The process of the changes in hypotension and bradycardia are shown in Figure 1. Secondly, we compare roles of piribedil and pramipexole in BP and HR from their different pharmacokinetic and receptor characteristics by searching literature.

Results: On the one hand, from pharmacokinetic aspects, piribedil is hepatic metabolized (mainly demethylation, p‐hydroxylation, and N‐oxidation), and bring about many metabolites, one of which is D1 agonist that is possibly associative with hypotension as elaborated above. Unlike piribedil, pramipexole hardly metabolized and delivers unchanged from urine, which may be an explanation for the lack of hypotension with pramipexole, but it must be confirmed by more researches. On the other hand, comparing to piribedil, pramipexole has higher affinity for D3 receptors and acts as an agonist on alpha‐2 adrenoreceptor, and D3 receptors possibly explain why pramipexole shows fewer risk of appearing hypotension and bradycardia, this is possibly because D3 dopamine receptors show no major effects on the heart while D2 agonists would decrease heart rate as well as left ventricular contractility. But if different dose of alpha 2 agonist or antagonist doesn't produce dose‐dependent cardiovascular effects need further researches to terrify.

Conclusions: No studies have previously reported the synchronous appearance of position‐unrelated hypotension and bradycardia after taking small doses of Piribedil. More studies are needed to explore the effects of dopamine agonists, including piribedil, on blood pressure and heart rate. Piribedil is efficacious for the treatment of PD, but it is important to weigh the potential risk of hypotension and bradycardia against the benefits that can be derived from the use of this drug.

References: 1. Jenner P: Parkinson's disease: pathological mechanisms and actions of piribedil. Journal of neurology 1992, 239 Suppl 1:S2‐8.2. Wright CE, Sisson TL, Ichhpurani AK, Peters GR: Steady‐state pharmacokinetic properties of pramipexole in healthy volunteers. Journal of clinical pharmacology 1997, 37 (6):520‐525.3. Polakowski JS, Segreti JA, Cox BF, Hsieh GC, Kolasa T, Moreland RB, Brioni JD: Effects of selective dopamine receptor subtype agonists on cardiac contractility and regional haemodynamics in rats. Clinical and experimental pharmacology & physiology 2004, 31 (12):837‐841.

Figure 1.

Blood pressure and heart rate fluctuation

Abbreviations: SBP= systolic blood pressure, DBP= diastolic blood pressure, HR= heart rate

61

This abstract has been withdrawn.

62

This abstract has been withdrawn.

63

Osteocalcin ameliorates motor dysfunction in a 6‐hydroxydopamine hydrobromide‐induced Parkinson's disease rat model through AKT/GSK3ß signaling

Chang Shan, Xing‐zhi Guo, Yan‐fang Hou, Geng Zhu, Bei Tao, Li‐hao Sun, Hong‐yan Zhao, Guang Ning, Sheng‐tian Li, Jian‐min Liu (Shanghai, People's Republic of China)

Objective: The aim of our study is to explore whether osteoblasts derived osteocalcin (OCN) could exert protective effects on 6‐hydroxydopamine‐induced Parkinson's disease (PD) rat models and the related mechanisms.

Background: OCN is recently reported to be involved in dopaminergic neuronal development. As dopaminergic neuronal injury in the substantia nigra is a pathological hallmark of PD, we investigated whether OCN plays a novel protective role in PD.

Methods: To test the above hypothesis, we first compared the OCN level in 6‐ hydroxydopamine‐induced PD rat models and controls. OCN was later injected intrastriatally or intraperitoneally into 6‐hydroxydopamine‐induced PD rat models, followed by evaluation of behavioral deficits, dopaminergic neuronal loss and glia proliferation. PC12 cells were used to detect OCN's role against neurotoxicity of 6‐ hydroxydopamine and identify its target signaling pathways in vitro.

Results: Our data showed that the OCN level in the cerebrospinal fluid in PD rat models was significantly lower than that in controls. Intervention with OCN could improve the behavioral dysfunction in PD rat models and reduce the tyrosine hydroxylase loss in the nigrostriatal system. In addition, OCN could inhibit the astrocyte and microglia proliferation in the substantia nigra of PD rats. in vitro studies showed that OCN significantly ameliorated the neurotoxicity of 6‐hydroxydopamine through the AKT/GSK3ß signaling pathway.

Conclusions: OCN plays a protective role against parkinsonian neurodegeneration in the PD rat model, suggesting a potential therapeutic use of OCN in PD.

Figure 1.

 

64

This abstract has been withdrawn.

65

Low frequency repetitive transcranial magnetic stimulation of right dorsolateral prefrontal cortex for Parkinson's disease: a randomized, single‐blind, sham‐controlled study

Sheng Zhuang, Jing Chen, Chao Zhu, Fuyu Wang, Chunfeng Liu (Suzhou, People's Republic of China)

Objective: We aim to explore the role of 1 Hz repetitive transcranial magnetic stimulation (rTMS) over right dorsolateral prefrontal cortex (DLPFC) on both motor and non‐motor symptoms of Parkinson' disease (PD).

Background: rTMS over left DLPFC has demonstrated its efficacy in improvement of depression of PD. However, the contribution of right DLPFC in non‐motor as well as motor symptoms remain controversial.

Methods: A total of 28 individuals with idiopathic PD were randomized in 1:1 a fashion to active or sham group. For active group, 10 daily sessions of 1200 stimuli was administrated over right DLPFC using figure of 8 coil at 1Hz 110% resting motor threshold. Clinical assessments were completed at baseline, at 2 weeks, and at 1, 3, 6 and 12 months after treatment.

Results: All patients (14 male and 14 female) finished evaluation during visits and no side effects were observed. Compared to sham group, significant improvements were recorded in Unified Parkinson's Disease Rating Scale part III (UPDRS‐III), 10‐meter walking test, Hamilton Depression Rating Scale and Montreal Cognitive Assessment (MoCA) at 2 weeks, 1 and 3 months after treatment (P<0.05). For UPDRS part III and MoCA, beneficial effects still exist at 3 month and 6 month follow‐up respectively (P<0.05).

Conclusions: Our study suggests that low frequency right DLPFC rTMS is a potential target for benefiting motor symptoms, depression and cognitive performance for PD and its therapeutic effects persists for at least 3 months after treatment.

66

Three‐dimensional gait analysis in festination gait of patients with Parkinson's disease

Jianjun Lu (Guangzhou, People's Republic of China)

Objective: To investigate the characteristics of 3D gait analysis in patients with festination gait (FG) in Parkinson's disease (PD).

Background: Parkinson's disease is a progressive neurological disease, often characterized by bradykinesia, tremors, stiffness, and posture gait abnormalities. Festination gait is a common clinical symptom in patients with Parkinson's disease. The festination gait often shows that the pace is increased, the step size is reduced, and the center of gravity often falls in front of the two feet, but it is difficult to judge according to the naked eye in the early stage of the festination gait, and the change in short time is not observed. Although in the case of Parkinson's patients with a festination gait, experienced neurologists can observe that the patient has a gait, but few devices quantify it and quantify its changes over time. In comparison, this paper mainly uses the three‐dimensional motion capture system to perform three‐dimensional gait analysis on Parkinson's festination gait, analyzes the temporal and spatial parameters and the ankle joint kinematic parameters, and quantifies the festination gait through the device. It can provide a clinical reference for the early diagnosis and therapeutic observation of festination gait in the later stage.

Methods: 40 participants with PD (20 FG PD,20 non‐FG PD) (all tested ON medication) and 20 healthy controls were recruited to walk in a 3D gait laboratory.22 marker balls were put on the whole body according to the anatomic location. The path of subject movement was captured by the BTS motion capture system.3D reconstruction of marker balls?temporal‐spatial parameters and kinematic parameters of ankle joints were calculated by SmartAnalyzer application. All data were analyzed by the sofeware package of SPSS19.0.

Results: Stride time‐swing time of left side the maximum ankle dorsiflexion angle of the left side in FG were more sinificantly decreased than the non‐FG group, and the phase of the first peak ankle dorsiflexion was more advanced than the non‐FG group (P<0.05). Comparing with the normal controls,the stance phase was remarkably inceased (P<0.05), the swing phase stride length step length velocity and the maximum ankle plantarflexion were sinificantly decreased (P<0.05), the phase of the first peak ankle dorsiflexion was more advanced (P<0.05).

Conclusions: Parkinson patients with festination gait have small step length, fast step cadence and slow velocity. The phase of the first peak ankle dorsiflexion was more advanced due to the movement of the trunk and center of gravity. Due to the poor balance function,the maximum plantar flexion angle of the ankle was reduced,It is valuably for using 3D gait analysis to judge whether the patients with Parkinson's diesase have festination gait and prevention in advance.

References: Pistacchi M, Gioulis M, Sanson F, et al. Gait analysis and clinical correlations in early Parkinson's disease[J]. Functional Neurology, 2017, 32 (1):28.Zheng J, Yang X, Zhao Q, et al. Festination Correlates with SNCA Polymorphism in Chinese Patients with Parkinson's Disease[J]. Parkinsons Disease, 2017, 2017:3176805.Parkinson J. An assay on the Shakin Palsy. London: Sherwood,Neely and Jones,1817.Giladi N, Shabtai H, Rozenberg E, et al. Gait festination in Parkinson's disease. [J]. Parkinsonism Relat Disord, 2001, 7 (2):135‐138. Lin W Y, Chou W Z, Wu W S, et al. An accelerometer‐based festinating gait detection algorithm and its application to Parkinson's Disease development[C]// IEEE International Conference on Systems, Man, and Cybernetics. IEEE, 2017:003577‐003580.Hughes A J, Daniel S E, Kilford L, et al. Accuracy of clinical diagnosis of idiopathic Parkinson's disease: a clinico‐pathological study of 100 cases. [J]. Journal of Neurology Neurosurgery & Psychiatry, 1992, 55 (3):181.Ou R, Guo X, Wei Q, et al. Festination in Chinese patients with Parkinson's disease[J]. Clinical Neurology & Neurosurgery, 2015, 139:172.Delval A, Snijders A H, Weerdesteyn V, et al. Objective detection of subtle freezing of gait episodes in Parkinson's disease. [J]. Movement Disorders, 2010, 25 (11):1684–1693. [Moore S T, Macdougall H G, Ondo W G. Ambulatory monitoring of freezing of gait in Parkinson's disease[J]. Journal of Neuroscience Methods, 2008, 167 (2):340‐348. Iansek R, Huxham F, Mcginley J. The sequence effect and gait festination in Parkinson disease: contributors to freezing of gait?[J]. Mov Disord, 2006, 21 (9):1419‐1424.Ou R, Wei Q, Cao B, et al. Predictors of freezing of gait in Chinese patients with Parkinson's disease[J]. Brain & Behavior, 2018, 8 (3):e00931.Vercruysse S, Gilat M, Shine J M, et al. Freezing beyond gait in Parkinson's disease: a review of current neurobehavioral evidence[J]. Neurosci Biobehav Rev, 2014, 43:213‐227.Starkstein S, Dragovic M, Brockman S, et al. The impact of emotional distress on motor blocks and festination in Parkinson's disease. [J]. Journal of Neuropsychiatry & Clinical Neurosciences, 2015, 27 (2):121‐126. Kataoka H, Tanaka N, Kiriyama T, et al. Step Numbers and Hoehn‐Yahr Stage after Six Years[J]. European Neurology, 2018, 79 (3‐4):118. Coste C A, Sijobert B, Pissard‐Gibollet R, et al. Detection of freezing of gait in Parkinson disease: preliminary results[J]. Sensors, 2014, 14 (4):6819‐6827. [21] Lewis G N, Byblow W D, Walt S E. Stride length regulation in Parkinson's disease: the use of extrinsic, visual cues. [J]. Brain, 2000, 123 ( Pt 10) (10):2077‐2090.Mcauley J H, Daly P M, Curtis C R. A preliminary investigation of a novel design of visual cue glasses that aid gait in Parkinson's disease. [J]. Clinical Rehabilitation, 2009, 23 (8):687‐695.Lowry K A, Carrel A J, Mcilrath J M, et al. Use of harmonic ratios to examine the effect of cueing strategies on gait stability in persons with Parkinson's disease[J]. Arch Phys Med Rehabil, 2010, 91 (4):632‐638.Souza C D O, Voos M C, Chien H F, et al. Combined auditory and visual cueing provided by eyeglasses influence gait performance in Parkinson Disease patients submitted to deep brain stimulation: a pilot study[J]. International Archives of Medicine, 2015.Areerat S. Cueing Effect of Gait Ability in Parkinson's Disease[J]. Theranostics Brain Disord. 2017; 1 (4): 555568

67

East Indian sandalwood oil reduced Parkinson's disease associated pathologies in vitro and in vivo: a role of PI3K/Akt/Nrf2/HO‐1 signaling axis

Mohankumar Amirthalingam, Shanmugam Govindan, Kalaiselvi Duraisamy, Corey Levenson, Nivitha Sundararaj, Thiruppathi Govindhan, Sundararaj Palanisamy (Coimbatore, India)

Objective: This study was aimed to evaluate the in vitro and in vivo anti‐Parkinsonian effects and its underlying molecular mechanism of East Indian sandalwood oil and its active components a‐ and ß‐santalol.

Background: Parkinson's disease (PD) is one of the most prevalent neurological condition and is predominantly characterized as a movement disorder. Currently, no effective therapy is available for the treatment of PD pathologies. Hence, suitable drugs from a traditional origin that can delay or halt the onset and progression of PD are needed.

Methods: 6‐Hydroxydopamine (6‐OHDA) was used to selectively degenerate the dopaminergic neurons. SH‐SY5Y cells and Caenorhabditis elegans treated with various pharmacological doses of East Indian sandalwood oil (EISO), a‐ and ß‐santalol were subjected to analysis for stress resistance, apoptosis induction, neurodegeneration, a‐synuclein aggregation and other PD related functional deficits. The involvement of PI3K/Akt/Nrf2/HO‐1 signaling axis against PD pathologies in neuronal cells and C. elegans was examined using western blotting techniques and genetic and reporter gene expression analysis.

Results: EISO and its principal components significantly suppressed the cytotoxicity, apoptosis and intracellular ROS levels in SH‐SY5Y cells challenged with 6‐OHDA. EISO exhibits anti‐apoptotic activity by blocking the cyclic events of caspase‐dependent, mitochondrial‐mediated apoptosis and counteracted the p53 activation. Overall, in vitro results demonstrated that EISO protects SH‐SY5Y cells through acting on PI3K/Akt/Nrf2/HO‐1 signaling axis. in vivo assay system, EISO and santalol isomers likely acted through AKT‐1 and ERK MAPK mediated SKN‐1 dependent pathway in C. elegans, which transactivates the stress‐responsive genes gcs‐1 and gst‐4 that enhanced the tolerance to stress, extend the mean lifespan and reduced the PD pathologies.

Conclusions: In this study, we report the first demonstration of potential anti‐parkinsonian and anti‐aging effect of EISO and its active components using SH‐SY5Y cells and powerful genetics of C. elegans models. It was found that EISO and santalol isomers confer neuroprotection and geroprotection via switching the conserved cell survival signaling. Therefore, the results indicated that EISO is worth to explore further as a candidate to redox‐based neuroprotectant for the prevention and management of neurological diseases.

68

Assessment of balance and functional status in patients with Parkinson's disease: reliability and validity of the Russian version of the berg balance scale

Alexey Zimin, Dzhamilya Yusupova, Natalia Suponeva, Anastasia Butkovskaya (Moscow, Russia)

Objective: The aim was to perform a validation study of the Russian version of BBS.

Background: Imbalance is a significant symptom of Parkinson's disease (PD). There is a need for the standardized objective approach to assessing the stability of PD patients in Russian‐speaking countries as there is not validated scale for this purpose.

Methods: A randomized double‐blind control study was designed to validate the Russian version of the Berg Balance Scale (BBS). Fifty‐eight PD patients participated in the study had mild to moderate disability and could walk unassisted. The validation of BBS included translation by two independent medical transla¬tors and back translation by a native English speaker with fluent Russian, cultural adaptation and finally, assessment of psychometric parameters: Internal consistency (Cronbach's alpha coefficient) and Test‐retest consistency (two examinations by the same doctor with one‐hour interval), Inter‐rater reliability (two independent doctors' examinations with one‐day interval) and con¬current validity. To test concurrent validity of the scale, the Romberg Balance Test was performed on a stabilometric platform.

Results: The average BBS score for all subjects before balance training on the stabilometric platform was 38.4 (CI 29.3–48.7). All the psychometric parameters of the BBS were higher than a critical threshold (0.70). Internal consistency assessed by Cronbach's alpha was 0.82 (p<0.001). Inter‐rater reliability of the scale evaluated by the Cohen's kappa was 0.91 (p<0.001). Test‐retest consistency calculated by the Pearson's correlation co¬efficient was r=0.94 (?<0.0001), indicating permanence of doctors' assessment during the observation period. The BBS scores correlated significantly (r=0.78, p<0.05) with the Romberg Balance Test, indicating acceptable concurrent validity. The average BBS score after balance training course was 43.8 (CI 34.1–51.9) that is significantly higher (p=0.047) than before it.

Conclusions: Recovery of balance is a critical rehabilitation component for patients with all kind of movement disorders and particularly with PD. Good body balancing is needed for self‐care, everyday activities and especially during rehabilitation training. This study has proven the reliability and validity of the Russian version of the BBS in patients with PD and has shown feasibility for assessment of rehabilita¬tion progress. It is also a useful tool for the entire neurological examination of a PD patient.

References: 1. Li F, Harmer P, Fitzgerald K, et al. Tai Chi and postural stability in patients with Parkinson's disease. N Engl J Med. 2012; 366:511–9. 2. Sparrow D., DeAngelis T.R., et al. Highly Challenging Balance Program Reduces Fall Rate in Parkinson Disease. J Neurol Phys Ther. 2016; 40 (1): 24–30.

69

Neuromechanism of acupuncture on Parkinson's disease tremor: a resting state fMRI study

Zhe Li, Jun Chen, Jianbo Cheng, Bo Liu , Xian Liu, Xiaodong Luo, Pingyi Xu (Guangzhou, People's Republic of China)

Objective: To investigate the effect of acupuncture on Parkinson's disease (PD) patients with tremor and its potential neuromechanism by fMRI.

Background: Clinical studies have showed a positive benefit of acupuncture in treating PD tremor, but its underlying mechanism remains unknown.

Methods: Forty‐one PD patients with tremor were randomly assigned to true acupuncture group (TAG), sham acupuncture group (SAG) and waiting group (WG). All patients received levodopa for 12 week. The MDS‐UPDRS I and II subscales, and fMRI scans of the patients' brains were obtained before and after the treatment course. UPDRS I and II scores were analyzed by SPSS, while the degree centrality (DC), regional homogeneity (ReHo) and amplitude low‐frequency fluctuation (ALFF) were determined by REST.

Results: Acupuncture improved the UPDRS I and II scores in PD patients with tremor without placebo effect, only in tremor score. Acupuncture had specific effects on the cerebrocerebellar pathways as shown by the decreased DC and ReHo and increased ALFF values, and nonspecific effects on the spinocerebellar pathways as shown by the increased ReHo and ALFF values (P<0.05, AlphaSim corrected). Increased ReHo values were recorded within the thalamus and motor cortex of the PD patients (P<0.05, AlphaSim corrected). In addition, the default mode network (DMN), visual areas and insula were activated by the acupuncture with elevated DC, ReHo and (or) ALFF, while the prefrontal cortex (PFC) revealed significantly reduced ReHo and ALFF after acupuncture (P<0.05, AlphaSim corrected).

Conclusions: The cerebellum, thalamus and motor cortex, which are connected to the cerebello‐thalamo‐cortical (CTC) circuit, were modulated by the acupuncture stimulation to alleviate the PD tremor. The regulation of neural activity within the cognitive brain regions (the DMN, visual areas, insula and PFC) together with CTC circuit may contributes to enhancing movement and improving patients' activities of daily life.

70

The impact of early‐morning off on quality of life in early PD patients

Linyi Li, Wei‐wei Yan, Jian‐Jun Ma, Zhenxiang Zhao, Qi Gu, Si‐yuan Chen, Shen Huang, Shi‐yu Hu (Zhengzhou, People's Republic of China)

Objective: To explore the impact of early‐morning off on quality of life in early PD patients.

Background: Early morning off (EMO) is a symptom experienced by patients with Parkinson's disease (PD) .Ithas been happened in any stage of the illness. However, few studies have explored its prevalence and the impact on quality of life in early PD patients.

Methods: Sixty PD patients were randomly divided into early‐morning off group (n=30) and non early‐morning off group (n=30). The severity of disease in PD patients was scored by Unified Parkinson's Disease Rating Scale and Hoehn and Yahr Staging scale. The quality of life in PD patients was assessed by the 39‐item‐Parkinson's Disease Questionnaire. The non‐motor symptoms was assessed by The 14‐item Hamilton Anxiety Rating Scale, The 24‐item Hamilton Depression Rating Scale, Parkinson Disease Sleep Scale,the Epworth Sleepiness Scale, the non‐motor Symptoms Scale respectively. The differences of clinical information and clinical classification between two groups were compared and the correlation factors of quality of life was evaluated using multiple linear regression analysis.

Results: Compared with the non early‐morning group, the scores of PDQ‐39[(40.8±20.7)vs (14.4±11.0)]?UPDRSI[ (5.1±2.2)vs (2.9±2.2)] UPDRSII[ (12.8±6.1)vs (8.8±3.4)]? UPDRS[ (34.1±16.8) vs (25.3±9.0)]?Epworth[ (8.3±5.0)vs (4.6±4.5)] and NMSS[ (61.8±38.1) vs (35.4±25.6)] significantly increased and the scores of PDSS [(108.0±21.3)vs (128.6±24.8)] was significantly lowered in early‐morning group (P<0.05) . Multiple linear regression analysis showed that the factors affecting PDQ greatest was the H‐Y 2.5 stage,followed by early‐morning offH‐Y 1 stage?UPDRS and PDSS scores (P<0.05).

Conclusions: Early‐morning off was observed even in the early PD patients. It can be significantly affected the patients' quality of life.

References: [1]Martinez‐Martin P,Rodriguez‐Blazquez C.Quality of life and burden in caregivers for patients with Parkinson's disease: concepts, assessment and related factors[J].Expert Rev Pharmacoecon Outcomes Res,2012,12 (2):221‐230.DOI:10.1586/erp.11.106. [2]Ma Jian‐jun,Li Xue,Yang Hong‐qi, et al.Characteristics of non‐motor symptoms in untreated patients with Parkinson's disease at early stage (in Chinese)[J].Chin J Geriatr,2015,34 (1): 35‐39. DOI:10.3760/cma.j.issn.0254‐9026.2015.01.009. [3]Du Xiao‐jing,Sun Zheng,Ma Jian‐jun, et al.Effect of salivation on quality of life in PD patient (in Chinese)[J].Chin J Geriatr Heart Brain Vessel Dis,2017,19 (03):288‐291.DOI:10.3969/j.issn.1009‐0126.2017.03.016. [4] Tsugawa J,Onozawa R,Fukae J,et al.Impact of insufficient drug efficacy of antiparkinson agents on patient's quality of life: a cross‐sectional study[J].BMC neurology,2015,15:105. DOI:10.1186/s12883‐015‐0360‐y. [5]Onozawa R,Tsugawa J,Tsuboi Y, et al. The impact of early morning off in Parkinson's disease on patient quality of life and caregiver burden[J].Journal of the neurological sciences, 2016,364:1‐5.DOI:10.1016/j.jns.2016.02.066. [6]Postuma RB, Berg D, Stern M, et al. MDS clinical diagnostic criteria for Parkinson's disease[J]. Mov Disord, 2015, 30 (12): 1591‐1601. DOI: 10.1002/mds.26424. [7]Luo W,Gui XH,Wang B,et al.Validity and reliability testing of the Chinese (mainland) version of the 39‐item Parkinson's Disease Questionnaire (PDQ‐39)[J].J Zhejiang Univ Sci B,2010,11 (7):531‐538.DOI:10.1631/jzus.B0900380. [8]Johns M W.A new method for measuring daytime sleepiness: the Epworth sleepiness scale[J].Sleep,1991,14 (6):540‐545. [9]Martinez‐Martin P,Rodriguez‐Blazquez C,Abe K,et al.International study on the psychometric attributes of the non‐motor symptoms scale in Parkinson disease[J].Neurology,2009,73 (19):1584‐1591.DOI:10.1212/WNL.0b013e3181c0d416. [10]Chapuis S,Ouchchane L,Metz O,et al.Impact of the motor complications of Parkinson's disease on the quality of life[J].Mov Disord,2005,20 (2):224‐230.DOI:10.1002/mds.20279. [11]Rizos A,Martinez‐Martin P,Odin P,et al.Characterizing motor and non‐motor aspects of early‐morning off periods in Parkinson's disease: an international multicenter study[J].Parkinsonism Relat Disord,2014,20 (11):1231‐1235.DOI:10.1016/j.parkreldis.2014.09.013. [12]Todorova A, Jenner P, Chaudhuri KR. Non‐motor Parkinson's: integral to motor Parkinson's, yet often neglected[J]. Pract Neurol 2014; 14: 310‐322. Doi:10.1136/practneurol‐2013‐000741. [13] Global Parkinson's disease Survey Steering Committee, Factors impacting on quality of life in Parkinson's disease: results from an international survey[J].Mov Disord 2002;17:60‐67. DOI:10.1002/mds.10010. [14] Ray Chaudhuri K,Qamar MA,Rajah T,et al.Non‐oral dopaminergic therapies for Parkinson's disease: current treatments and the future[J].NPJ Parkinsons Dis,2016,2:16023.DOI:10.1038/npjparkd.2016.23. [15]Honig H,Antonini A,Martinez‐Martin P,et al.Intrajejunal levodopa infusion in Parkinson's disease: a pilot multicenter study of effects on nonmotor symptoms and quality of life[J].Mov Disord,2009,24 (10):1468‐1474.DOI:10.1002/mds.22596. [16]Trenkwalder C,Kies B,Rudzinska M,et al.Rotigotine effects on early morning motor function and sleep in Parkinson's disease: a double‐blind, randomized, placebo‐controlled study (RECOVER)[J].Mov Disord,2011,26 (1):90‐99.DOI:10.1002/mds.23441.

71

HDAc inhibitors might not upregulate DJ‐1 protein expression

Hong Pan, Rao Fu, Shengdi Chen (Shanghai, People's Republic of China)

Objective: To verify whether HDAc inhibitors would increase DJ‐1 expression effectively and further protect dopaminergic (DA) neurons under Parkinson's Disease (PD)‐related oxidative stress.

Background: Mutation or loss of DJ‐1 confronts DA neurons to exess oxidative stress, which is a basic pathogenic mechanism of PD. Therefore, overexpressing DJ‐1 might be a reasonable strategy for PD treatment. Recently, two broad‐spectrum HDAc inhibitors were reported to increase DJ‐1 expression.

Methods: We tried various HDAc inhibitors, from broad‐spectrum to narrow‐spectrum, to treat SH‐SY5Y cell line, and thus narrowed down the key HDAc according to the extent DJ‐1 promoter fluorescent reporter signal, as well as DJ‐1 expresion detected by qPCR and western blot. On the other hand, HDAc inhibitor was administrated to MPTP mice model of PD to evaluate the protection effect of HDAc inhibitor.

Results: Broad‐spectrum HDAc inhibitors like sodium butyrate, sodium phenylbutyrate, and SAHA colud increase DJ‐1 promoter activity and mRNA expression as expected. Then we found that MS‐275 can produce the most robost DJ‐1 promoter and mRNA increase among all the HDAc inbibitors we have tried. Nevertheless, none of the HDAc inhibitor cause significant increase of DJ‐1 protein expression. Sodium butyrate can alleviate the MPTP toxiticity to DA neurons indeed, while DJ‐1 protein increase was not observed.

Conclusions: HDAc inhibitors, especially MS‐275, can increase DJ‐1 expression transcriptionally, however, they are not able to affect DJ‐1 protein expression ultimately. And our results indicated that the protective effect of sodium butyrate may involve other mechanism other than the change in DJ‐1 expression.

References: Wenbo Zhou et al. Phenylbutyrate upregulates DJ‐1 and protects neurons in cell culture and in animal models of Parkinson's disease. doi: 10.1074/jbc.M110.211029.

72

Baicalein prevents dopaminergic neuron degeneration via inducing autophagy and a‐synuclein clearance in neuronal cells

Yijue Shen, Weifang Tong, Liting Jiang, Rongrong Zhu, Lingjing Jin (Shanghai, People's Republic of China)

Objective: The aim of this study was to investigate roles of baicalein in the autophagy pathway and clearance of a‐synuclein.

Background: Parkinson's disease (PD) is a neurodegenerative disease characterized by dopaminergic neuron damage in the substantia nigra (SN) and a‐synuclein accumulation. Autophagy is involved in the degradation of a‐syn and thought to be critical to the process of PD. Baicalein, a typical flavonoid compound, has been reported to have neuroprotective properties in several neurodegenerative disorders and be reported to induce autophagy recently. However, it is still unknown the neuroprotective roles of baicalein in the autophagy pathway and clearance of a‐synuclein.

Methods: 8‐week male C57BL/6 mice were injected with either saline or N‐methyl‐4‐phenyl‐1,2,3,6‐tetrahydropyridine (MPTP) at a dose of 30mg/kg. Baicalein were intraperitoneal injected for 14 days after saline or MPTP treatment. The motor ability was detected by rotarod test and pole test. SH‐SY5Y cells overexpressing either WT or A30P mutant a‐synuclein were treated with baicalein or the autophagy inhibitor 3‐methyladenine (3‐MA) or in combination. Immunofluorescence and western blot analysis were used to detect the number of survival dopaminergic neurons in SN, the levels of a‐synuclein, LC3‐I/II, p62, Beclin‐1, cleaved caspase‐3, Bax and Bcl‐2.

Results: Behavioral analysis showed the injection of baicalein significant ameliorated the motor damage induced by MPTP. Meanwhile, the number of survival dopaminergic neurons was increased after baicalein treatment. Then, the reduced expression of cleaved caspase‐3 and the ratio of Bax/Bcl‐2 revealed that the anti‐apoptotic effect of baicalein. Furthermore, the increased expression of Beclin‐1 and ratio of LC3‐II/LC3‐I, and the decreased expression of p62 indicated the enhanced level of autophagy in MPTP‐induced mice model. Importantly, western blot analysis showed that baicalein reduced MPTP‐induced a‐synuclein aggregation in mice, which is widely thought to trigger the pathogenesis of PD. In cell culture, the change of autophagy related proteins were also detected. Meanwhile, the reduced both WT and A30P a‐synuclein level was also observed in neuronal cell lines. Treatment of autophagy pathway inhibitor 3‐MA with baicalein, the beneficial effects of baicalein was reduced with western blot and immunofluorescence staining analysis.

Conclusions: Our results demonstrated that baicalein had a significant therapeutic effect on PD mice. And the neuroprotective mechanism of baicalein might be involved in inducing autophagy and a‐synuclein clearance.

73

Evaluation of therapeutic efficacy in treating depression in patients with Parkinson's disease by Wu Ling powder: a randomized, double‐blind, placebo‐controlled study.

Jing He, Wen Su (Beijing, People's Republic of China)

Objective: To study the efficacy of Wu Ling powder in treating depression in patients with Parkinson's disease.

Background: Depression is the most common nonmotor symptom of PD affecting approximately 40–70% of the patients. It may aggravate the motor symptoms and further decrease quality of life. Treatments are relatively limited. Evidences showed that dopamine agonist pramipexole and some of the antidepressant, including selective serotonin reuptake inhibitor paroxetine and serotonin‐norepinephrine reuptake inhibitor venlafaxine, were effective on depression while no evidences demonstrated the other antidepressants had the identical therapeutic effect. Moreover, some of the antidepressants have interaction with the antiparkinsonism drugs and cannot be applied. Thus, it is of great importance to find a more effective and tolerated therapy in treating depression in patients with PD. Wu Ling powder is a kind of proprietary Chinese medicine and contains multiple bioactivator (glycoside, sterols, amino acid). Wu Ling was firstly proposed to treat the symptoms of anxiety and depression with insomnia. In 2014, a meta‐analysis proved that Wu Ling powder were effective in treating post‐stroke depression. A randomized, double‐blind, placebo‐controlled study demonstrated Wu Ling powder had identical antidepression effect as Deanxit. A recent study found that Wu Ling powder have definitely effect in patients with seizure. Thus, we aim to identify the efficacy of this Chinese medicine in treating depression in patients with PD.

Methods: We conduct a multicenter, randomized, double‐blind and placebo‐controlled study. A total of 120 PD patients eligible for the inclusion criteria will be enrolled. All patients are diagnosed as clinically established/probable PD according to the 2015 MDS clinical diagnostic criteria for PD. The diagnosis of depression are based on clinical manifestations and a score of HAMD=13. Depressive symptoms were observable in both ON and OFF states, patients with clear‐cut OFF period‐relateddepression were not included. Personal informations and clinical informations will be obtained, including gender, age, disease duration, medicine therapy. Routine blood test and blood biochemical test are obtained at the beginning and the end of the research. All subjects should sign the informed consent forms and this study has already approved by the Ethical Review Board of Beijing Hospital. The 120 patients are randomly assigned to either a treated group (n=60) or a placebo group (n=60). Patients of treated groups are instructed to take three Wu Ling capsules a time, three times a day while patients in placebo group will take placebo, which are made exactly the same shape and taste as the Wu Ling capsule. Both the doctors and the patients don't known the condition of grouping. The whole study will last 12 weeks and the patients will be followed up and examined at 4 time point: baseline, week 4, week 8 and week 12. The evaluation includes part II (off period) and III (on period) of unified parkinson's disease rating scale (UPDRS), modified Hoehn‐Yahr Scale (HYS), minimental state examination (MMSE), hamilton depression scale‐17 (HAMD‐17), hamilton anxiety scale (HAMA), parkinson disease sleep scale (PDSS), apathy scale (AS) and clinical global impression (CGI). To improve reliability of measurements, the same investigator will evaluate all patients. The investigator is also blinded to the grouping condition. During the examination period, the medication of all subjects will be kept constant. The main effect index is the change of HAMD score at week 12. The second effect index includes the change of CGI score and UPDRS‐II (off period) at week 12.

Results: For the research is still in progress the expected results should be the change of HAMD score in treated group is significantly higher than the placebo group at week 12.

Conclusions: Wu Ling powder show satisfied therapeutic effect in treating depression in patients with PD.

74

Retinal nerve fiber layer thickness may predict cognitive progression in Parkinson's disease: a longitudinal study

Jin‐ru Zhang, Chunfeng Liu (Suzhou, People's Republic of China)

Objective: Retinal abnormalities measured by optical coherence tomography (OCT) have been detected in both Parkinson's disease (PD) and Alzheimer's disease (AD). We assessed whether baseline retinal nerve fiber layer (RNFL) thickness predicted worsening of cognitive status over time in PD.

Background: Optical coherence tomography (OCT) is a convenient method for measuring the neuronal layers of the retina, including the thickness of the retinal nerve fiber layer (RNFL) and macula. Researchers have found that retinal layers can act as biomarkers for identifying MCI with Alzheimer's disease (AD) [1]. Studies measuring RNFL thickness, macular thickness, or foveal thickness found significant decreases in patients with AD or PD compared with healthy controls [2]. Our previous research revealed that RNFL and macular degeneration are associated with age and disease progression in PD patients. Thinning of the RNFL reflects deterioration of the optic nerve and retinal ganglion; however, it remains unclear whether RNFL can predict cognitive decline in PD patients.

Methods: RNFL thickness was measured using high‐definition OCT in 80 non‐dementia PD patients. Clinical and cognitive assessments were performed at baseline and at 3.64±0.66 years follow‐up. Linear mixed‐effects models were used to examine associationsbetween RNFL thickness and rate of change in cognitive test scores, after adjustingforage, disease duration, education, and levodopa‐equivalent daily dose. Associations between RNFL thickness and annualized cognition changes wereevaluated using partial correlation analysis.

Results: Analysis of outcomes according to baseline RNFL tertiles showed worse performance in global cognitive tests, delayed memory, and executive functions in patients with a thin RNFL. During follow‐up, greater cognitive deterioration was found in thin RNFL tertile patients. Patients with worsening cognition had a lower baseline average RNFL thickness (P=0.002), especially in the superior and inferior quadrants.Lower baseline average RNFL thickness was associated with greater annualized decline in Mini‐Mental State Examination (r=‐0.241, P=0.036) and Montreal Cognitive Assessment (MoCA) (r=‐0.252, P=0.028). Annualized decrease in average RNFL thickness correlated with the decrease in annualized MoCA (r=0.476, P=0.046).

Conclusions: OCT provides an effective and noninvasive in vivo technique for evaluating RNFL structure. The correlation between RNFL thickness and cognitive dysfunction suggests that OCT may be useful for predicting cognitive dysfunction in PD patients.

References: 1. Lad EM, Mukherjee D, Stinnett SS, Cousins SW, Potter GG, Burke JR, et al. Evaluation of inner retinal layers as biomarkers in mild cognitive impairment to moderate Alzheimer's disease. PLoS One. 2018;13 (2):e0192646.2. Satue M, Garcia‐Martin E, Fuertes I, Otin S, Alarcia R, Herrero R, et al. Use of Fourier‐domain OCT to detect retinal nerve fiber layer degeneration in Parkinson's disease patients. Eye (Lond). 2013;27 (4):507‐14.

75

a symptom‐based approach using unilateral subthalamic nucleus and contralateral globus pallidus interna deep brain stimulation for Parkinson disease treatment

Linbin Wang, Dianyou Li, Yixin Pan, Bomin Sun, Zhang Cheng, Yingying Zhang (Shanghai, People's Republic of China)

Objective: To investigate the efficacy and safety issues of combined unilateral STN and contralateral GPi DBS in PD patients with asymmetric symptoms.

Background: GPi and STN are two well‐established targets of DBS surgery for advanced PD. The clinical heterogeneity and asymmetry of PD symptoms have spiked consideration of symptom‐based approach rather than determining a single best target.

Methods: Eleven patients who underwent combined unilateral STN and contralateral GPi DBS were included and reviewed in this retrospective study. The clinical decision‐making was based on general DBS criteria by comprehensive multidisciplinary patient evaluations. Critical factors included symptom asymmetry, e.g., unilateral tremor with contralateral dyskinesia, and cognitive profile. Efficacy of DBS measured by UPDRS‐and TUG were evaluated at pre‐surgery (baseline) and 1 month, 3 months, 6 months after surgery. UPDRS‐and PDQ‐8 were also collected at baseline and through 6‐month follow‐up.

Results: Compared with the off medication condition in the baseline, postoperative scores of total UPDRS‐ (off medication/on stimulation) were significantly reduced by 40.6% in 1 month, 43.3% in 3 months and 47.6% in 6 months. STN‐DBS (off medication/on stimulation condition) improved the stimulated contralateral scores of UPDRS‐ by 60.1% in 6 months, while GPi‐DBS reduced 38.4% of UPDRS‐scores. Significant improvements of axial symptoms as measured by axial subscores of UPDRS‐ (31.7% reduction) and TUG (43.4% reduction) were also observed. Moreover, motor complications were remarkably improved because of the significantly decreased duration of motor fluctuations, along with a better life of quality at 6‐month follow‐up. No significant adverse events were reported.

Conclusions: Our results offer the first evidence of effectiveness and safety for this patient‐specific approach of combined unilateral STN and contralateral GPi DBS. Future controlled studies are needed to further test its efficacy compared with bi‐GPi or bi‐STN therapy.

References: Ramirez‐Zamora, A., & Ostrem, J. L. (2018). Globus pallidus interna or subthalamic nucleus deep brain stimulation for parkinson disease: a review. Jama Neurology, 75 (3).Okun, M. S. (2012). The transition of deep brain stimulation from disease specific to symptom specific indications. Rinsho shinkeigaku = Clinical neurology, 52 (11), 891‐5.

76

The efficacy of STN‐DBS in patients with early‐onset PD after 13 years of stimulation

Linbin Wang, Zhang Cheng, Bomin Sun, Dianyou Li, Haiyan Zhou (Shanghai, People's Republic of China)

Objective: To illustrate whether STN‐DBS still work in EOPD patients who have received the treatment for average 13 years.

Background: STN‐DBS is an established and safe treatment for the management of advanced motor symptoms in PD patients. However, there is a lack of evidence regarding the efficacy of STN‐DBS in patients with EOPD after a prolonged period of stimulation.

Methods: We retrospectively reviewed 11 EOPD patients (9 men and 2 women; age at onset, 38.9 ± 7.5 years; disease duration at surgery: 4.9 ± 1.2 years) treated with bilateral STN‐DBS for an average of 13.4 ± 1.3 years after the surgery was performed upon the development of early motor fluctuations. UPDRS‐ scores as a measurement of motor symptoms were collected and analyzed.

Results: Significant immediate motor effects were obtained after 13 years of persistent STN stimulation (Table 1). We observed a 54% reduction in total UPDRS‐III scores due to STN‐DBS (MED OFF/STIM OFF versus MED OFF/STIM ON). Tremor and rigidity exhibited the most significant improvements (72% reduction in both), followed by axial motor symptoms (51% reduction) and bradykinesia (45% reduction). Further analysis of axial motor symptoms confirmed the efficacy of STN‐DBS on all axial subitems except posture.

Conclusions: This study elucidates STN‐DBS treatment (ON condition) is still effective in improving both cardinal and axial motor symptoms of patients who have been treated with STN‐DBS already for a prolonged (on average 13 years) period of time in this group of EOPD.

Table 1.

Motor and gait assessment in different conditions at the final follow‐up time point (mean and standard deviation)

	OFF MED OFF STIM	OFF MED ON STIM
UPDRS III
Total	58.18 ± 19.864	26.82 ± 14.105 a
Tremor (item 20, 21)	3.91 ± 3.673	1.09 ± 2.071 a
Rigidity (item 22)	12.64 ± 5.045	3.55 ± 3.297 a
Bradykinesia (item 19, 23‐26,31)	31.09 ± 8.994	17.00 ± 8.764 a
Axial symptoms (item 18, 27‐30)	10.55 ± 4.987	5.18 ± 2.483 a
Speech (item 18)	2.64 ± 1.120	1.91 ± 0.701 a
Gait (item 29)	2.45 ± 1.293	1.09 ± 0.944 a
Posture (item 28)	1.27 ± 0.647	0.82 ± 0.751
Postural stability (item 30)	2.36 ± 1.433	1.09 ± 1.044 a
Arise from chair (item 27)	1.82 ± 1.662	0.27 ± 0.467 a
Hoehn‐Yahr stage	3.318 ± 0.9558	2.54 ± 0.61 a

STN, subthalamic nucleus; UPDRS, United Parkinson Disease Rating Scale.

a: the letter a indicates a significant difference (p‐value < 0.05, paired sample two‐tail t‐tests) between OFF MED/OFF STIM and OFF MED/ON STIM conditions.

77

Enhancing the astrocytic clearance attenuates neural cell death induced by extracellular a‐synuclein aggregates

Qiang Chen, Jun Hua, Min Ye, Gang Hu, Yi Fan (Nanjing, People's Republic of China)

Objective: Astrocytes are the most numerous glia cells in the brain and play an essential role in supporting brain functions in the state of Parkinson's disease (PD). However, whether astrocytes contribute to the elimination of a‐Synuclein (a‐Syn), and exert the neuroprotection against a‐Syn aggradation are unclear.

Background: The accumulation of aggregated forms of the a‐Sy is associated with the pathogenesis of PD [1]. The efficient clearance of aggregated a‐Syn might represent a potential approach in PD therapy.

Methods: To investigate whether astrocytes engulf and eliminate extracellular a‐Syn, primary astrocytes were treated with recombinant human a‐Syn, followed by analyses of extracellular and intracellular a‐Syn protein by western blotting and immunocytochemistry. To identify the mechanisms of astrocytes clearing a‐Syn aggregates, cultured primary astrocytes were treated with proteasome inhibitor MG132 or/and autophagy inhibitor 3‐Methyladenine (3MA), and a‐Syn was also detected by western blotting and immunocytochemistry. In addition, Ginkgo biloba extract (GBE), including ginkgolide B (GB) and bilobalide (BB), was used to alter astrocytic uptake and degradation of a‐Syn aggregates, followed by assessment of proteasome and autophagy pathways and the protective properties to neurons.

Results: In the present study, we demonstrated that astrocytes engulfed and degraded extracellular aggregated recombinant human a‐Syn. Meanwhile, we observed that the clearance of a‐Syn by astrocytes was abolished by MG132 and 3MA. We further showed that intracellular a‐Syn was reduced after GB and BB treatment, and the decrease was reversed by MG132 and 3MA. More importantly, we found that GB and BB treatment reduced indirect neurotoxicity to neurons induced by a‐Syn‐stimulated astrocytic conditioned medium (CM).

Conclusions: Together, we firstly find that astrocytes engulf and degrade a‐Syn aggregates via the proteasome and autophagy pathways, and further show that GB and BB enhances astrocytic clearance of a‐Syn partially by promoting cell autophagy, which gives us an insight into the novel therapy for PD in future.

References: [1] Vekrellis K, et al. Pathological roles of alpha‐synuclein in neurological disorders. Lancet Neurol 2011;10 (11):1015‐25.

Figure 1.

 

Figure 2.

 

Figure 3.

 

78

Serum lipid levels are associated with Parkinson's Disease in Chinese populations

Chen Ying, Jiali Pu, Baorong Zhang (Hangzhou, People's Republic of China)

Objective: To assess the association of serum lipids levels, statins use and Parkinson's Disease (PD) in Chinese populations.

Background: The levels of serum lipids and the statins use are reported to be related to Parkinson's Disease (PD). However, the results are controversial and the association in Chinese populations remains unclear.

Methods: 454 PD patients and 409 age‐, gender‐matched healthy controls are enrolled in this study. For all participates, we assessed the statins use and the fasting serum lipid levels, including total cholesterol, low‐density lipoprotein (LDL‐C), high‐density lipoprotein (HDL‐C), triglycerides (TG), apolipoprotein A1 and apolipoprotein B. We compared the statins use and the fasting serum lipid levels between PD patients and healthy controls. Furthermore, we divided the patients using the disease duration into early‐stage PD patients (disease duration less than 5 years, n=234) and late‐stage PD patients (disease duration more than 5 years, n=220) and compared the fasting serum lipid levels.

Results: There was no significant difference in the statins use between PD patients and healthy controls. The serum levels of total cholesterol, LDL‐C, HDL‐C, TG and apolipoprotein B were remarkably lower in PD patients than in healthy controls. Furthermore, the serum levels of TG were significantly lower in late‐stage PD patients than in early‐stage PD patients. Other serum lipid levels had no significant difference between late‐stage and early‐stage PD patients.

Conclusions: PD patients have lower serum lipid levels and the serum levels of TG may be related to the disease duration and become a biomarker for PD.

References: [1] Huang X, Chen H, Miller WC et al. Lower low‐density lipoprotein cholesterol levels are associated with Parkinson's disease. Mov Disord. 2007 Feb 15;22 (3):377‐81. [2] Huang X, Alonso A, Guo X et al. Statins, plasma cholesterol, and risk of Parkinson's disease: a prospective study. Mov Disord. 2015 Apr;30 (4):552‐9.

79

Clinical analysis of serum uric acid levels in patients with Parkinson's disease and Parkinsonism

Jie Chen, Jun Ouyang (Guangzhou, People's Republic of China)

Objective: To study the levels of serum uric acid (UA) in the patients of Parkinson's disease (PD) and Parkinsonism.

Background: More and more researchs have shown that uric acid plays an important role in neurodegenerative diseases, low levels of uric acid are related to Parkinson's disease, and level of UA is in correlation with stage of Parkinson disease. These indicate that lower UA is a risk factor for PD, and UA may be used as predictive factors for monitoring the progression of PD.However little is known about UA in Parkinsonism. The inclusion criteria of these studies excluded patients with Parkinson's syndrome, so whether uric acid is also involved in the development of Parkinson's syndrome, whether patients with Parkinson's syndrome have the same abnormal UA levels, the results are still not clear.

Methods: All the patients were from the Neurology Out‐Patient Clinic and Neurology Department of Guangzhou First People's Hospital during the period from February 2010 to April 2018. Patients were included if they had a definitive diagnosis of idiopathic PD and Parkinsonism (including Vascular parkinsonism VP and Drug‐induced Parkinsonism DIP). Every research object were check the serum uric acid levels and serum creatinine (Cr) levels. The PD and Parkinsonism patients were divided into 3 groups, according to Hoehn–Yahr (H‐Y) classification: early stage (1–2 classification), medium stage (2.5–3 classification), and advanced stage (4–5 classification). The differences of serologic levels of UA and Cr levels between each group were retrospectively analyzed. All data were statistically analyzed using SPSS19.0. The comparison between groups was analyzed by one‐way ANOVA. The difference was statistically significant at P < 0.05.

Results: A total of 67 PD patients ( 35 men and 32 women,mean age: 70.2±10.5),51 Parkinsonism patients ( 33 men and 18 women,mean age: 74.1±9.2, 49 VP patients, 2 DIP patients) and 66 controls ( 35 men and 31 women, mean age: 73.1±10.3)were enrolled in the study. Compared with the control group, the levels of serum UA in PD patients were decreased significantly (316.09±96.98 and 364.27±110.36 P<0.05), but no significant differences between Parkinsonism and control group,and there's no significant differences between PD and Parkinsonism group neither. The level of serum Cr and UA/Cr were no significant different between the three group. No significant difference of the UA, Cr and UA/Cr levels between different stages of PD patients and PDS patients was found.

Conclusions: Lower levels of serum uric may be the risk factors of idiopathic PD, but not for Parkinsonism. The result remind us that maybe UA plays a different role in the development of PD and PDS. But the group of Parkinsonism patients is mainly composed of VP, means most of them had a history of cerebrovascular accident, as we know, high level UA is considered to be a risk factor for cerebrovascular accident. It is speculated that VP patients may have higher UA levels than control, but the results show no difference in UA levels between Parkinsonism and control group, suggesting that UA participates in the development of PD, and reduces UA level during PD formation, which offsets the possible high levels. Perhaps UA is also involved in the development of Parkinsonism, the possible high UA level gradually decreases in the process of those patients who attacked by a cerebrovascular accident and then gradually progressing to Vascular parkinsonism, which offsets the possible high level. Our study didn't find siginificant differences of UA, CR, and UA/CR levels in the PD patients and PDS patients with different stages. But we saw this trend, UA levels in the early and medium stage PD patients were higher than in the advanced stage ones. The expansion of the sample size may yield meaningful results.

References: [1] PTT Bich,TT Ngoc,M Le,et al.Association between serum uric acid levels and disease severity in Parkinson patients.Parkinsonism&Related Disorders 2018;46 (2), e11‐e12[2] S Cipriani, X Chen, MA Schwarzschild.Urate: a novel biomarker of Parkinson's disease risk, diagnosis and prognosis. Biomark Med 2010; 4:701–12. [3] LL Zhong, YQ Song, XY Tian, et al.Level of uric acid and uric acid/creatinine ratios in correlation with stage of Parkinson disease.Medicine, 2018;97 (26):e10967[4] Shen C, Guo Y, Luo W, et al.Serum urate and the risk of Parkinson's disease: results from a meta‐ analysis. Can J Neurol Sci2013;40:73–9. [5] JE Lee, SK Song, YH Sohn, et al. Uric acid as a potential disease modifier in patients with multiple system atrophy. Mov Disord 2011;26:1533–6.

80

Synthesis of L‐DOPA‐containing linear dipeptides as anti‐Parkinson prodrugs

Yanmiao He (HaiKou, People's Republic of China)

Objective: The objective is to synthesize a set of L‐DOPA‐containing dipeptides or tripeptides and screen against various anti‐Parkinson's models to search for the best L‐DOPA prodrug.

Background: Though L‐DOPA is regarded as the "gold standard" for treating Parkinson's disease, it is usually prescribed in large dosage due to low bioavailability and thus cause many side‐effects after long‐term administration.

Methods: Applying acetonide‐protection of the catechol group of L‐DOPA, more than 20 L‐DOPA‐containing dipeptides and tripeptides were synthesized, mainly through the liquid‐phase peptide synthesis protocol and some through the solid‐phase one (SPPS). Their stabilities in liver homogenate of Sprague Dawley rat were measured with HPLC.

Results: Liver homogenate can be found in scheme. The DPPH Free Radical scavenging experiments demonstrated that at 100μm L‐DOPA‐containing dipeptides H‐Gly‐Dopa‐OH (92.91%), H‐Dopa‐Val‐OH (90.27%), H‐Val‐Dopa‐OH (93.93%) higher than BHA (84.59%).

Conclusions: Liver homogenate data showed that the amino sequences do influence the stability of the oligopeptides.Linear dipeptides formed with negatively charged amino acids (Asp and Glu) are more stable than those formed with positively‐charge or nonpolar amino acids.

References: Liu, Z. et al. Tetrahedron Letters, 49 (38), 5519‐ 5521, 2008; Liu, Z. et al. Tetrahedron Letters, 51 (18), 2403‐2405, 2010 Liu, Z. et al. Patent: CN Audit period 2018; Zhou,T. et al. 2013, 23 (19):5279‐5282.

81

L‐DOPA‐containing oligopeptides as anti‐Parkinson prodrugs

Zhongqiang Liu (HaiKou, People's Republic of China)

Objective: The objective of this project is to discover an excellent antiparkinsonism L‐DOPA prodrug by screening a synthetic library of L‐DOPA‐containing oligopeptides, especially linear/cyclic dipeptides and tripeptides against various models.

Background: L‐DOPA, a rare amino acid, is converted into dopamine in the brain in the presence of aromatic L‐amino acid (AA) decarboxylase and thus has been used to treat the Parkinson's disease for long time and is regarded as “the gold standard”. Unfortunately, L‐DOPA is limited by it extremely low bioavailability and cytotoxicity and after long‐term administration side effects develop, such as on/off oscillation and end‐of‐dose deterioration. One approach is to fabricate L‐DOPA prodrugs that can resist enzymatic degradation, slowly release L‐DOPA into the blood, and in a more ideal way penetrates the blood‐brain barrier to function directly in the brain.

Methods: A small library of L‐DOPA‐containing linear/cyclic dipeptides and tripeptides was built either through solution‐phase or solid‐phase peptide synthesis (Scheme 1. Left). Since the catecholic side chain of L‐DOPA is readily oxidized and then crosslinked in basic conditions, acetonide protection was adopted to avoid the unfavorite side‐reactions. Various tests were carried out to measure their stabilities in liver homogenate of SD rats, cytotoxicity toward PC12 cells, radical‐scavenging ability toward DPPH, and neuroprotection properties against rotenone‐induced PC12 cells.

Results: Most linear L‐DOPA‐containing dipeptides showed no apparent improvement in DPPH radical‐scavenging, but cyclodipeptides with D‐Glu (86.23%), Glu (82.46%,), or Gln (91.28%) exhibited stronger scavenging ability than vitamin C (46.11%) and L‐DOPA (47.75%) at the concentration of 0.1mM (Scheme 1. Right).

Conclusions: Our current results showed that oligopeptides formed with L‐DOPA and negatively charged AAs are more stable in the liver homogenate than others, and cyclic oligopeptides are much more stable than the corresponding linear ones.

References: Liu, Z. et al. Tetrahedron Letters, 49 (38), 5519‐ 5521, 2008; Liu, Z. et al. Tetrahedron Letters, 51 (18), 2403‐2405, 2010; Messersmith, P. B. et al. Patent: US 8,227,628, 2012

82

Bioactivity study of DOPA‐containing cyclo‐dipeptides

Xiaoyan Zhang (HaiKou, People's Republic of China)

Objective: The objective is to screen a set of L‐DOPA‐containing cyclodipeptides for favorite bioactivities, especially for neuroprotection and anti‐parkinsonism.

Background: L‐DOPA has long been used as an effective drug to treat parkinsonism, but also blamed for its low bioavailability and adverse effects arising from long‐term administration. Cyclodipeptides, made from two amino acids connecting head‐to‐tail with each other, are structurally stable and highly promising in drug discovery for various purposes. L‐DOPA‐containing cyclodipeptides may exhibit higher stability than L‐DOPA itself against enzymatic degradation in the gastrointestinal tract and in blood, or may possess antibacterial or neuroprotection properties.

Methods: About 20 L‐DOPA‐containing cyclodipeptides have been successfully synthesized and were subject to bioactivity screening using Kit‐8 (CCK‐8) as cell counting method and using DPPH as Radical scavenging experiments.

Results: Cytotoxicity experiments showed that the L‐DOPA‐containing cyclopeptides was not cytotoxic to PC12 cells even at 160 μM. Cytotoxicity experiments showed that the L‐DOPA‐containing cyclopeptides was not toxic to PC12 cells even at 160 μM. Free Radical scavenging experiments showed that 0.1mM cyclo (L‐Dopa‐L‐Glu) (82.46%), Cyclo (L‐Dopa‐D‐Glu) (91.28%), Cyclo (L‐DOPA‐L‐Gln) (86.23%) removed more DPPH radicals than VC (46.11%) and L‐Dopa (47.75%).

Conclusions: Now, their various bioactivities in antibacterial, Liver homogenate degradation,antitumor, and bioinform‐ ation messaging were being done. New anti‐Parkinson's disease prodrugs may be discovered from this.

References: Manchineella.et al. Eur.J.Org.Chem,4363–4369, 2017; Liao S R,et al.Eur.J.Med.Chem, 121:500‐509,2016;

83

The systematic review on cannabinoids as a treatment of Parkinson's disease

Thanatat Boongmongkol, Onanong Jitkritsadakul, Roongroj Bhidayasiri (Bangkok, Thailand)

Objective: To conduct a systematic review on the therapeutic evidence of medical cannabinoids in the treatment of Parkinson's disease (PD).

Background: The endocannabinoid system is a modulator of neurotransmitter release, including dopamine, providing its potential pharmacological target for the treatment of PD.

Methods: Ovid MEDLINE, PubMed, EMBASE, Web of Science and Cochrane were searched to identify evidence published between January 1975 and September 2018. Only original, full‐text articles published in English that evaluated the therapeutic effects of cannabinoids in PD were included in this systematic review [Figure1]. Efficacies were categorised based on outcomes to include motor, non‐motor and its effect on dyskinesias.

Results: Of 334 abstracts screened from the searching process, of which 60 full‐length articles were selected for further review. Nine articles fulfilled the selection criteria [table1]. While two open‐label studies demonstrated a significant reduction of UPDRS‐III after smoking cannabis, similar effects were not replicated in randomised controlled trials involving different forms of cannabinoids. The evidence is also conflicting on its effect on dyskinesia when significant reduction of dyskinesia was seen with nabilone, but not in other forms of cannabinoids. However, significant improvement of quality of life, pain reduction and sleep‐related symptoms were observed across randomised controlled and open‐label trials.

Conclusions: Inconsistent results were demonstrated on the effect of cannabinoids on motor symptoms and dyskinesia amongst PD patients. However, benefits were observed on quality of life and a number of non‐motor symptoms, including pain and sleep dysfunction. Due to methodological heterogeneities, short duration of trial, and small number of subjects, it is difficult to provide established level of evidence on its efficacy in motor, non‐motor symptoms and dyskinesias in PD. Controlled studies involving large number of patients with standardised and objective outcomes should be considered in future trials.

References: 1. Sieradzan KA, Fox SH, Hill M, Dick JP, Crossman AR, Brotchie JM. Cannabinoids reduce levodopa‐induced dyskinesia in Parkinson's disease: a pilot study. Neurology. 2001;57 (11):2108‐11.2. Chagas MH, Zuardi AW, Tumas V, Pena‐Pereira MA, Sobreira ET, Bergamaschi MM, et al. Effects of cannabidiol in the treatment of patients with Parkinson's disease: an exploratory double‐blind trial. Journal of psychopharmacology (Oxford, England). 2014;28 (11):1088‐98.

Figure 1.

 

Table 1.

Summary of total nine studies of clinical trials and case series in medical cannabis therapeutics for PD patients

Study method	Authors, Year	Participants	Intervention	Study outcome	Key results
1.1 Randomized double‐blind placebo‐control crossover study 1.2 Randomized double‐blind placebo‐control study	Sieradzan K. A., 2001 (1)	7 PD patients: with stable levodopa‐induced dyskinesia present for 25% to 50% of the day	Nabilone (CBR agonist), or placebo (0.03 mg/kg, capsule) administered in two split doses 12 hours and 1 hour before levodopa 200 mg administration	‐ Rush Dyskinesia Disability Scale ‐ Modified Webster Scale (30 minutes after levodopa)	‐ Nabilone significantly reduced levodopa‐induced dyskinesia compared to placebo (p<0.05) ‐ Unchanged motor score
	Carroll C. B., 2004 (2)	19 PD patients: with stable levodopa‐induced dyskinesia (2 out of 12 on UPDRS part IV)	2.5mg of 9‐THC + 1.25mg of CBD per capsule (titrate to maximum dose 0.25 mg/kg of THC per day) or placebo for 4 weeks	‐ UPDRS‐IV ‐ ADL scale, UPDRS, PDQ‐39, Rush Dyskinesia Disability Scale, Bain dyskinesia scale, McGill Pain Scale ‐ Blood analysis for THC level	‐ Unchanged dyskinesia ‐ Up to 65% of patients (11/19 patients) did not reach the target dose of THC ‐ Analysis of THC in serum demonstrated a variability in level of THC.
	Mesnage V., 2004 (3)	16 PD patients: with motor fluctuations and levodopa‐induced dyskinesia for at least 6 months	SR 141716 (CBR antagonist) or placebo once daily for 16 days	‐ UPDRS‐III ‐ UPDRS‐IV	‐ Unchanged UPDRS‐III, UPDRS‐IV
	Chagas MH., 2014 (4)	21 PD patients: with Hoehn and Yahr stage 1‐3	‐ CBD 75 mg/day ‐ CBD 300 mg/day ‐ Placebo for 6 weeks	‐ Total UPDRS ‐ PDQ‐39 ‐ Plasma BDNF quantification ‐ H1‐MRS scans	‐ CBD dosing of 300 mg/day showed the significantly improved patient's quality of life determined by PDQ‐39 (p<0.05) ‐ Unchanged total UPDRS, plasma BDNF and H1‐MRS scans
2. Open‐Label Observational Study	Zuardi AW., 2009 (5)	6 PD patients: with psychosis	CBD 150 mg tablet (increased weekly by 150 mg depending on the clinical response) For 4 weeks	‐ BPRS ‐ PPQ ‐ UPDRS ‐ CGI‐I ‐ MMSE	‐ CBD significantly improved psychotic symptoms by BPRS (p<0.001) and PPQ (p=0.001) ‐ CBD significantly improved total UPDRS score (p=0.046)
	Lotan I., 2014 (6)	22 PD patients: treated with cannabis for at least 2 months	0.5 g of cannabis (smoking)	‐ UPDRS‐III ‐ Pain intensity scale ‐ Visual analog scale (VAS) (30 minutes after smoke)	‐ Significantly improved UPDRS‐III score (p<0.001) ‐ Significantly reduced Pain intensity scale and VAS (p<0.001)
	Shohet A., 2017 (7)	20 PD patients: with tremor or central pain with/without tremor	1g of cannabis (18 smoking+ 2 vaporizer)	‐ Thermal quantitative sensory testing (QST) ‐ UPDRS‐III ‐ Pain rating index (PRI) ‐ Visual analog scale (VAS) (30 minutes after smoke, at least 10 weeks later)	‐ Significantly improved UPDRS‐III score (p<0.0001) ‐ Significantly improved PRI (p=0.001) and VAS (p=0.0005) ‐ Unchanged QST
3. Case series	Frankel JP., 1990 (8)	5 PD patients: with severe tremor	‐ Cigarette containing 1g of marijuana (2.9% THC by weight)	‐ Modified Webster Scale	‐ Unchanged tremor and Modified Webster Scale
	Chagas MH., 2014 (9)	4 PD patients: with clinical RBD	‐ 3 patient CBD 75 mg/day ‐ 1 patients CBD 300 mg/day For 6 weeks	‐ Frequency of RBD‐related events	‐ CBD reduced sleep‐related symptoms that highly suggestive of RBD in all 4 PD patients.

BPRS; Brief Psychiatric Rating Scale, CBD; cannabidiol, CBR; cannabinoid receptor, CGI‐I; Clinical Global Impression‐Improvement scale, MRS; magnetic resonance spectroscopy, PD; Parkinson's disease, PDQ‐39; Parkinson's Disease Questionnaire, PPQ; Parkinson Psychosis Questionnaire, RBD; REM sleep behavior disorder, THC; tetrahydrocannabinol, UPDRS; Unified Parkinson's disease rating scale

84

This abstract has been withdrawn.

85

Analysis of clinical characteristics of patients with Parkinson's disease with mood disorders as the first‐episode symptom

Guihe Hu, Xiaoping Pan, Li Mengyan, Haobo Chen, Zhenhang Luo, Lingling Chen (Guangzhou, People's Republic of China)

Objective: To explore the clinical characteristics between Parkinson's disease (PD) with mood disorders as first‐episode symptom and other types of Parkinson's disease.

Background: Depression and anxiety disorders often coexist and can occur before Parkinson's disease symptoms, we studied the inuence of this kind of mood disorders on motor and non‐motor symptoms among PD patients.

Methods: 185 PD patients were recruited from the department of Neurology, Guangzhou First People's Hospital,and were divided into the PD group with mood disorders as the first‐episode symptom (group A), the PD group with the motor symptoms as the first‐episode symptom (group B), and the PD group without mood disorders (group C), according to the Hamilton Depression Scale 24 (HAMD > 7 points) and The Hamilton Anxiety Scale 14 (HAMA>7 points). What's more, all the patients underwent a standardized clinical assessment battery including motor and non‐motor scales.

Results: 1. The incidence of mood disorders was 79.46%, there are 29 patients in group A (15.7%), 118 patients in group B (63.8%), and 38 patients in group C (20.5%).Three groups show no statistical difference among the age (65.92±9.81years), starting age (61.16±9.75years), duration (0.10‐23.00 years, median 4.76 years), gender (91 males, 49.19%; 94 females, 50.81%) and years of education (0‐15Years, median 8.80 years). 2. Three groups show the significant statistical difference on UPDRS Sub‐item scoreI (median5.0vs2.0vs0), II (median 12.0vs11.0vs5.0), III (median 37.8vs31.0vs21.0), IV (median 0.5vs1.0vs0), H‐Y (median 2.5vs2.5vs2.0), Schwab (median 80%vs80%vs90%), HAMA‐14 (median 14vs14vs3) ), HAMD‐24 (median 18.5vs13vs3), NMSS degree (median 16.5vs17.0vs5) and frequency score (median 24.0vs24.0vs7), SCOPA‐AUT (median13vs15.5vs7), PDQ39 (median 28vs34.5vs7), fatigue 14 (median 9vs8vs5) ( all P<0.001); and show that,FSS (median 4.28vs4.10vs3.11), FOG (median 7vs5vs2), MoCA (median 22.5vs21vs25.5), MMSE (median 25vs26vs28), levodopa LED (median 399vs475vs275) (all P<0.05),but there has no statistical difference on ESS (median 7vs6vs5) compared with group B, group A patients had higher UPDRS I sub‐item scores (P<0.05), but UPDRS II, III, IV sub‐item scores, HY grades, Schwab scores, HAMA‐14, HAMD‐24, NMSS degree and frequency score, SCOPA‐AUT, PDQ39, fatigue 14, FS, FOG, MMSE, MoCA, LED did not show any statistical difference (all P> 0.05).

Conclusions: Mood disorders are high in patients with PD. This group of patients has more severe motor symptoms, long‐term motor complications, non‐motor symptoms and autonomic dysfunction.Their ability and quality of life are even worse, and the usage of levodopa is greater. PD patients with mood disorders as the first‐episode symptom are more likely to have abnormal mental behavior than other PD patients. Depressive symptoms are more prominent, which may lead to worse prognosis. So they should be treated differently in clinic.

References: [1]. Leentjens, A.F.G., et al., Anxiety and motor fluctuations in Parkinson's disease: A cross‐sectional observational study. Parkinsonism & Related Disorders, 2012. 18 (10): p. 1084‐1088. [2]. Hanna, K.K. and A. Cronin‐Golomb, Impact of Anxiety on Quality of Life in Parkinson's Disease. Parkinson's Disease, 2012. 2012: p. 1‐8. [3]. Ng, A., et al., Influence of depression in mild Parkinson's disease on longitudinal motor and cognitive function. Parkinsonism & Related Disorders, 2015. 21 (9): p. 1056‐1060. [4]. Wiesli, D., et al., Influence of Mild Cognitive Impairment, Depression, and Anxiety on the Quality of Life of Patients with Parkinson Disease. Dementia and Geriatric Cognitive Disorders Extra, 2018. 7 (3): p. 297‐308. [5]. Borgonovo, J., et al., Changes in neural circuitry associated with depression at pre‐clinical, pre‐motor and early motor phases of Parkinson's disease. Parkinsonism & Related Disorders, 2017. 35: p. 17‐24. [6]. Fan, J., B. Chang and Y. Wu, Relationships among Depression, Anxiety, Sleep, and Quality of Life in Patients with Parkinson's Disease in Taiwan. Parkinson's Disease, 2016. 2016: p. 1‐8. [7]. Pontone, G.M., et al., The longitudinal impact of depression on disability in Parkinson disease. International Journal of Geriatric Psychiatry, 2016. 31 (5): p. 458‐465

86

Analysis of risk factors of freezing gait effective drug treatment of Parkinson's disease

Li Mengyan, Hao Zheng, Haobo Chen, Zhenhang Luo, Guihe Hu, Guo Aihua (Guangzhou, People's Republic of China)

Objective: To summaize Clinical characteristics of effective drug therapy of freezing of gait (FOG) with Parkinson disease (PD),and compare the difference of laterally impaired motor symptoms and non motor symptoms between PD/FOG+ and PD/FOG‐. Further correlation analysis was performed to identify the risk factors of FOG.

Background: FOG was more common in patients with advanced, stiff and mixed sub‐type PD.

Methods: Our study recruited PD patients visiting the department of Neurology, Guangzhou First People's Hospital, all the patients were assessed with Freezing of Gait Questionnaire (FOGQ), and other related motor (MS) and non‐motor symptoms (NMS) scales including Schwab and PDQ39. We divided the patients into PD with frozen gait group (PD/FOG+) and PD without frozen gait group (PD/FOG‐) group based on their answer to the third item of the FOGQ. In group PD/FOG+), patients who were ineffective in medication were excluded according to the principle of effective treatment.

Results: 75 of 60 (46.88%) PD patients were recognized as PD/FOG+. Further PD sub‐types analysis showed an increased probability of FOG in stiff or mixed type of PD patients. Advanced PD patients had a higher incidence of FOG as well. Compared with PD/FOG‐ group, PD/FOG+ group (P <0.05) were older, had a longer course and a higher H‐Y scores. In terms of the evaluation of motor symptoms, The impairment of motor function and motor complications (Part of the left and middle axis of UPDRS III and IV) were more serious in PD/FOG + group, and the GFQ value was higher, which made it easier to fall down (P <0.05). Non motor symptoms in PD/FOG+ were more frequent,especially in the mental,behavioral,emotional score (UPDRS I),non motor symptoms score (NMSS), Parkinson disease autonomic symptoms scale (Scopa‐Aut), FS‐14 and Epworth Sleeping Scale (ESS) (P<0.05). There were no statistically significant difference in Frontal Assessment Battery (FAB), MMSE, MOCA, HAMA, and HAMD between the two groups (P>0.05). Compared with PD/FOG‐,the equivalent dose (LED) of levodopa in PD/FOG+ was higher. A correlation study demonstrated that PD/FOG+ had poorer life abilities and qualities (P<0.05). Logistic regression analysis indicated that higher H‐Y classification, UPDR III (middle axis),high score of UPDRS IV were risk factors of FOG.

Conclusions: FOG was more common in patients with advanced, stiff and mixed sub‐type PD. The impairment of left and middle axis motor function and non‐motor function in PD/FOG+ were more obvious, and they were more likely to fall down, and their living ability and quality were worse. The risk factors of FOG were severe condition, axial damage, and motor complication.

References: [1]. Shine, J.M., et al., Exploring the cortical and subcortical functional magnetic resonance imaging changes associated with freezing in Parkinson's disease. Brain, 2013. 136 (4): p. 1204‐1215. [2]. Shine, J.M., et al., Freezing of gait in Parkinson's disease is associated with functional decoupling between the cognitive control network and the basal ganglia. Brain, 2013. 136 (12): p. 3671‐3681. [3]. Chen, R., Paradoxical worsening of gait with levodopa in Parkinson disease. Neurology, 2012. 78 (7): p. 446‐447. [4]. Kostic, V.S., et al., Pattern of brain tissue loss associated with freezing of gait in Parkinson disease. Neurology, 2012. 78 (6): p. 409‐416. [5]. Anang, J.B.M., et al., Predictors of dementia in Parkinson disease: A prospective cohort study. Neurology, 2014. 83 (14): p. 1253‐1260. [6]. Lewis, S.J.G. and J.M. Shine, The Next Step. The Neuroscientist, 2015. 22 (1): p. 72‐82.

87

The rehabilitation effect of gating‐pad and healthy exercise on the balance and motor function of Parkinson's Disease

Qiong Liu, Yang Jiequn, Ying Cai (Shanghai, People's Republic of China)

Objective: To investigate the rehabilitation effect of gating‐pad and healthy exercise on the balance and motor function of Parkinson's Disease.

Background: Exercise may delay disease progression and has been used as an add‐on therapy for Parkinson's disease.

Methods: Fifty clinical patients of PD clinics of Ruijin Hospital, Shanghai were selected via convenience sampling. Inclusion criteria: 1) Meet the diagnostic criteria of Parkinson's disease. 2) Being able to utilize the PD gating‐pad for training and health exercising independently or with general assistance. 3) Informed consent and voluntary for participation. Exclusion criteria: 1) Along with severe heart, hepatic, nephritic diseases and etc. 2) Accompanied with impairment in speech or consciousness; 3)Being suffering bone fractures due to PD. 4) Being engaged in other rehabilitation program. The 50 cases were divide into control (27) and intervention (23) group randomly. All the 50 cases received the basic pharmaceutical therapy according to patients'states. The intervention group received the one‐month of gate‐pad and healthy exercise on the basis of pharmaceutical therapy. For the first time of intervention, the importance for taking healthy exercise and gate‐pad training were notified to the patients. Besides, all the patients of intervention group received a gate‐pad, a droplet for the guidance of healthy exercise, personal calendar for recording. After training for the first time by one‐to‐one instruction, patients of intervention group went on with the gate and healthy exercise training at home. The frequency and intensity were about 4~6times/week, 30‐45min/time, and 10moves/time. All the exercise were recorded onto to the patients' personal calendar accordingly. Researchers assessed all the intervention cases before and after exercise according to UPDRS 111 and mini‐balance evaluation systems test.

Results: There is no difference between the two groups on balance and motor function before intervention (P>0.05); The balance capacity and motor function of intervention group was greatly improved when compared with control group (P<0.05). And for the intervention group, one‐month exercise greatly enhanced their balance and motor function (P<0.05) while no significant improvement was observed in control group (P>0.05).

Conclusions: Adoption of gate‐pad and healthy exercise is able to help improve the balance and motor function of moderate Parkinson's Disease patients.

Parkinsonism, MSA, PSP (Secondary and Parkinsonism‐Plus)

88

A case of progressive supranuclear palsy from the geriatric perspective

Cha Chee Tan (Kuala Lumpur, Malaysia)

Objective:‐

Background: Progressive supranuclear palsy is an uncommon neurodegenerative taupathy that characterized by akinetic‐rigid form of parkinsonism, ophthalmoplegia, pseudobulbar palsy and subcortical dementia. The clinical manifestations of cognitive, speech, swallowing, fall and immobility lead to significant geriatric syndromes in older adults.

Methods: A 71 years old man presented with rapid progressive cognitive and functional decline within a year. He first developed visual disturbance, clumsiness and slowness in movement. Then he was found forgetful, excessive sleepy, slow mentation, apathy and low volume of speech. It was associated with postural instability and fall. There was no tremor, hallucination or abnormal behavior. On examination, this gentleman was hypomimia, hypophonia and exhibited spastic dysarthria. There were downward gaze palsy, neck dystonia, bradykinesia and rigidity of the trunk more than limbs. His gait was ‘freezing’, unsteady and reduced in arm swings. There was no resting tremor or hyperreflexia, and absent Babinski's. He scored 17/30 in Mini Mental State Examination with 11 years of education. Both trail making test and clock drawing test scores were zero. Functional assessment of activities of daily living by modified Barthel index was 25/100. Laboratory tests for secondary dementia screening were all normal.

Results: Patient was admitted for a brain magnetic resonance imaging which showed midbrain atrophy with appearance of ‘hummingbird’ sign. A comprehensive geriatric assessment was performed. He was reviewed by a speech therapist for swallowing assessment. For rehabilitation purpose, physiotherapist team incorporated limb coordination exercise, balance and transfer training. Occupational therapist also involved in prescribing assistive device and home care equipment, with a follow‐up home visit.

Conclusions: Although there is no cure for progressive supranuclear palsy, multidisciplinary team approach is essential in management of the symptoms and care of the patient for better quality of life.

89

Prevalence and associated factors of postural deformities in Chinese patients with multiple system atrophy

Lingyu Zhang, Bei Cao, Yutong Zou, Qianqian Wei, Ruwei Ou, Bi Zhao, Jing Yang, Ying Wu, Huifang Shang (Sichuan Sheng, People's Republic of China)

Objective: The objective of our study was to investigate the prevalence and associated factors of the postural deformities in Chinese MSA patients.

Background: The objective of our study was to investigate the prevalence and associated factors of the postural deformities in Chinese MSA patients.

Methods: A total of 732 MSA patients were consecutive enrolled in the current study. Clinical data including age, sex, age of onset, disease duration, onset symptom and treatment were collected. The Unified Multiple System Atrophy Rating Scale (UMSARS) was used to evaluate severity of the disease.

Results: 114 (15.6%) patients presented with camptocormia. 31 (4.2%) patients manifested with Pisa syndrome. 24 (3.3%) patients presented with antecollis. Patients exhibited postural deformities were more common in the MSA patients with predominant parkinsonism (MSA‐P) (P<0.05). In addition, MSA patients with postural deformities had longer disease duration compared to those without (P<0.001). After adjusted for disease duration, compared with patients without postural deformities, MSA patients with postural deformities presented with higher score of UMSARS‐I (P<0.001), UMSARS‐II (P<0.001), UMSARS‐IV (P<0.001), and total UMSARS (P<0.001). By the binary logistic regression model, the associated factors of postural deformity in MSA patients were total UMSARS score (OR=1.076, P<0.001) and MSA‐P subtype (OR=3.870, P<0.001).

Conclusions: Postural deformities were common in Chinese MSA patients. Camptocormia comes to the first followed by Pisa syndrome and antecollis. The associated factors of postural deformity were the severity of the disease and MSA‐P subtype.

References: Postural deformities were common in Chinese MSA patients. Camptocormia comes to the first followed by Pisa syndrome and antecollis. The associated factors of postural deformity were the severity of the disease and MSA‐P subtype. van de Warrenburg, B.P., Cordivari, C., Ryan, A.M., Phadke, R., Holton, J.L., Bhatia, K.P., et al. (2007). The phenomenon of disproportionate antecollis in Parkinson's disease and multiple system atrophy. Mov Disord 22 (16), 2325‐2331. doi: 10.1002/mds.21634.

90

Frontal lobe function, behavioral changes and quality of life in patients with multiple system atrophy

Lingyu Zhang, Bei Cao, Yutong Zou, Qianqian Wei, Ruwei Ou, Bi Zhao, Jing Yang, Ying Wu, Huifang Shang (Sichuan Sheng, People's Republic of China)

Objective: The objective of the study was to explore the potential relationships among frontal lobe function, behavior changes and quality of life (QoL) in patients with MSA.

Background: It has been noticed that cognitive impairment is an important and common symptom in patients with multiple system atrophy (MSA).

Methods: A total of 203 MSA patients were enrolled and evaluated using the Frontal Assessment Battery (FAB), the Frontal Behavioral Inventory (FBI) and the Parkinson's Disease Questionnaire‐39 item version (PDQ‐39). Seventy‐eight age‐, sex‐, and education‐ matched healthy controls were recruited to perform FAB scale.

Results: Patients with frontal lobe dysfunction were older (P=0.005), had older age of onset (P=0.002), lower education level (P<0.001), higher scores of PDQ‐39 domains of mobility (P=0.042), ADL (P=0.020), cognition (P<0.001) and communication compared to those with normal frontal lobe function. The most common frontal behavioral changes were logopenia. The severity of frontal behavioral changes was associated with MSA subtype (P=0.015), disease severity (P<0.001), orthostatic hypotension (P=0.022), severity of depression symptoms and total score of PDQ‐39 (P<0.001). Binary logistic regression showed the determinants of poor QoL in patients with MSA were disease severity (P<0.05), depression (P=0.013) and total FBI score (P=0.003).

Conclusions: Frontal behavioral change was the potential determinant of poor QoL in MSA besides the disease severity and depression symptom. Early discovery and management of frontal behavioral changes besides motor and depression symptoms will help to improve the QoL of the MSA patients.

References: Siri, C., Duerr, S., Canesi, M., Delazer, M., Esselink, R., Bloem, B. R., Antonini, A. (2013). A cross‐sectional multicenter study of cognitive and behavioural features in multiple system atrophy patients of the parkinsonian and cerebellar type. J Neural Transm, 120, 613‐618. Kawamura, K., Shimohata, T., Nakayama, H., Tomita, M., Ozawa, T., & Nishizawa, M. (2010). Factors influencing the cognitive function in patients with multiple system atrophy. Mov Disord, 25, 2891‐2892.

91

Detection of microbial 16s rRNA gene in the feces and blood of Chinese patients with multiple system atrophy

Juanjuan Du, Pei Huang, Shengdi Chen (Shanghai, People's Republic of China)

Objective: To explore the alterations of microbial 16s ribosomal (rRNA) gene in the feces and blood of Chinese patients with multiple system atrophy (MSA) and its relationships with clinical features.

Background: Microbial dysbiosis in gut was reported to be associated with MSA. However, the alterations of the microbiota in the blood and microbial dysbiosis between different subtypes of MSA remain unknown.

Methods: 40 MSA patients (MSA‐P/MSA‐C: 23/17) and their healthy spouses were recruited. Fecal and blood microbiota were investigated by high‐throughput IllUmina Miseq sequencing targeted on the V3‐V4 functional region of 16s rRNA gene. The relationships between microbiota and clinical characteristics were analyzed.

Results: The abundances of Lactobacillus, Gordonibacter, Phascolarctobacterium, and Haemophilus in feces and abundances of Leucobacter, and Bacteroides in blood were different between MSA patients and healthy controls (HC). Combining the taxa from feces and blood, six genera were identified to be predictive of MSA, achieving an area under the curve (AUC) of 0.853. The abundances of Phascolarctobacterium and Ruminococcus in feces were lower in MSA‐P than those in MSA‐C. The abundances of Blastococcus, Bacillus, and Acinetobacter in blood were different between MSA subtypes. These five genera differentiated MSA subtypes with an AUC of 0.898. Additionally, the findings in feces were validated in fecal samples of 40 MSA patients and 40 HCs using real‐time PCR targeting genus‐specific 16S rRNA genes. Functional predictions indicated that gene functions involving biosynthetic metabolism and bacterial secretion systems were significantly different between the MSA and HC. The differential genera were associated with disease duration, anxiety, and autonomic dysfunctions.

Conclusions: Alterations of microbiota may play an important role in the diagnosis of MSA and differential diagnosis of MSA subtypes. Microbiota dysbiosis was closely related to MSA clinical manifestations. Elucidating these differences in microbiomes will be helpful to improve our knowledge of the microbiota in the pathogenesis of MSA.

References: [1] Tan AH, Chong CW, Song SL, Teh CSJ, Yap IKS, Loke MF, et al. Altered gut microbiome and metabolome in patients with multiple system atrophy. Movement disorders: official journal of the Movement Disorder Society. 2018;33:174‐6. [2] Engen PA, Dodiya HB, Naqib A, Forsyth CB, Green SJ, Voigt RM, et al. The Potential Role of Gut‐Derived Inflammation in Multiple System Atrophy. Journal of Parkinson's disease. 2017;7:331‐46. [3] Qian Y, Yang X, Xu S, Wu C, Song Y, Qin N, et al. Alteration of the fecal microbiota in Chinese patients with Parkinson's disease. Brain, behavior, and immunity. 2018;70:194‐202[4] Qian Y, Yang X, Xu S, Wu C, Qin N, Chen S‐D, et al. Detection of Microbial 16S rRNA Gene in the Blood of Patients With Parkinson's Disease. Frontiers in Aging Neuroscience. 2018;10:156.

92

Oromandibular manifestations in Parkinson's disease and atypical parkinsonian disorders: A video case‐series analysis

Yuwadee Thongchuam, Pattamon Panyakaew, Roongroj Bhidayasiri (Bangkok, Thailand)

Objective: To delineate clinical characteristics of oromandibular movements in patients with PD, PSP and MSA through expert reviews of video clips taken during standard UPDRS examinations.

Background: Orofacial dystonic form of oromandibular manifestation is a supportive red flag in multiple system atrophy (MSA). However, its manifestations in Parkinson's disease (PD) and progressive supranuclear palsy (PSP) have not been well characterized.

Methods: Video clips and medical records of patients diagnosed with PD, PSP and MSA according to standard clinical diagnostic criteria were reviewed by two experts in movement disorders who were blind to their underlying diagnosis. Oromandibular manifestations were characterised based on four patterns of movements as shown in figure 1. Disagreements between two raters if occurred regarding movement patterns were resolved by consensus. Clinical demographics, including relationship to dopaminergic medications were obtained in all patients.

Results: Eleven patients (PD =3, PSP =5, MSA =3) were included (table1). Oromandibular manifestations in PD patients were dystonic with concomitant oral dyskinesia during peak‐dose dyskinesia (Fig. 1A). MSA patients exhibited orofacial dystonia with side pulling of the mouth resembling ‘Risus sardonicus’, following levodopa initiation (Fig.1D). PSP patients, oromandibular movements were characterised in two forms of either puckered (n=3) or compressed lips (n=2), irrespective of dopaminergic therapy (Fig. 1B‐C). Snouting and sucking reflexes were also observed in 3 patients. The onset was late amongst PSP patients while the occurrence amongst PD and MSA patients were usually related to dopaminergic medications in the intermediate disease stage.

Conclusions: Although limited by small number of patients, different forms of oromandibular manifestations were observed amongst PD, PSP, and MSA, posing its value for differential diagnosis. Moreover, recognition of oromandibular symptoms can lead to potential treatment, which may result in improved speech, swallowing and patient's quality of life. We are currently recruiting more subjects where full descriptive and statistical analysis will be available shortly.

References: 1. Rivest J, Quinn N, Marsden CD. Dystonia in Parkinson's disease, multiple system atrophy, and progressive supranuclear palsy. Neurology 1990;40 (10):1571‐8. 2. Barclay CL, Lang AE. Dystonia in progressive supranuclear palsy. J Neurol Neurosurg Psychiatry 1997;62 (4):352‐6

Table 1.

Demographic data of patients with oromandibular movement disorders

No. of patient	Underlying disease	Sex	Age of onset (years)	Oromandibular movement disorders	Etiology (suspected from)	Dystonia onset after diagnosis (years)	H&Y
1	PD	F	54	Dystonia, dyskinesia	Motor complication	7	3
2	PD	F	73	Dystonia, dyskinesia	Motor complication	10	4
3	PD	F	63	Dystonia, dyskinesia	Motor complication	7	3
4	PSP	M	68	Puckered lip	Frontal lobe releasing sign	7	5
5	PSP	F	65	Puckered lip	Frontal lobe releasing sign	8	5
6	PSP	M	65	Puckered lip	Frontal lobe releasing sign	7	4
7	PSP	M	80	Compressed lip	Frontal lobe releasing sign	3	3
8	PSP	M	65	Compressed lip	Frontal lobe releasing sign	2	3
9	MSA‐C	F	63	Perioral dystonia, Dysarthria	Levodopa‐induced	2	2
10	MSA‐P	F	70	Lower face and platysma dystonia, Dysarthria	Levodopa‐induced	4	2.5
11	MSA‐P	F	62	Facial dystonia, Dysarthria	Levodopa‐induced	2	3

Figure 1.

Concluded pattern of oromandibular movement disorders in PD, PSP and MSA patients

93

Whether symptoms of levodopa intolerance during acute levodopa challenge test can predict MSA in early years of Parkinsonism

Mrinal Acharya, Atanu Biswas, Gautam Gangully, Shyamal Das (Kolkata, India)

Objective: To investigate whether the appearance of symptoms of levodopa intolerance (anyone of nausea, vomiting, hypotension, and profuse perspiration) during acute levodopa challenge can predict future development of MSA during early days of parkinsonism.

Background: MSA is characterized by early development of autonomic dysfunction. Also, development of nausea, vomiting, hypotension, and profuse perspiration during acute levodopa challenge are common in parkinsonian patients even if pre‐treated with domperidone to prevent the acute dopaminergic effects of levodopa.

Methods: In this prospective cohort study, acute levodopa challenge test were performed on 89 patients presenting with parkinsonism (duration<2yrs) for diagnostic purpose. Presumptive diagnosis for each patient was performed using accepted clinical criteria after a significant follow‐up period of 18 months. Only patients who have completed 18 months' follow‐up were included for analysis irrespective of the types of parkinsonism.

Results: Nine (10.1%) out of the 89 patients [women:33 (37%)] developed symptoms of levodopa intolerance. Four out the seven patients with intolerance (57.4%) and five out the 68 patients from the control (without levodopa intolerance) group (5.9%) received a diagnosis of MSA (p =0.0). Overall sensitivity and specificity of the presence of symptoms of levodopa intolerance to predict the diagnosis of MSA were 50% and 95.5%respectively.

Conclusions: Development of levodopa intolerance during an acute levodopa challenge increases the probability of diagnosing MSA, but the absence of levodopa intolerance during the acute levodopa challenge could be less helpful in excluding a diagnosis of MSA.

References: 1. GILMAN S, WENNING GK, LOW PA et al. Second consensus statement on the diagnosis of multiple system atrophy. Neurology 2008;71:670–6.2. EstéVez S, Perez‐Lloret S, Merello M, Does clinical intolerance to a diagnostic acute levodopa challenge differentiate multiple system atrophy from PD? International Journal of Neuroscience 2009, 119:2257–2261.

Figure 1.

 

Table 1.

Demographic characteristics of the patients

Final diagnosis	No of Pts	Sex (Female/ Male)	Age (years) (SD)	Disease duration (month) (SD)	Acute challenge response (N/Y)	SCI (N/Y)	Dyskinesia during challenge (N/Y)	LID (N/Y)	Long term levodopa response (N/Y)
IPD	34	14/20	69.2 (7.9)	17.8(3.8)	14/20	32/2	30/4	21/13	2/32
MSA	9	5/4	59.8(7.1)	17 (3.7)	7/2	5/4	5/4	5/4	4/5
PSP	4	1/3	63 (3.6)	16.2(3.9)	3/1	4.‐0	4/0	4/0	4/0
DLB	2	1/10	64 (8.5)	15 (2.8)	1/1	2/0	2/0	2/0	1/1
CBD	1	1/0	65	23	1/0	1/0	1/0	0/1	0/1
FTD‐P	2	1/1	57.5 (4.9)	16 (4.2)	1/1	2/0	2/0	2/0	2/0
NPH	7	2/5	67.7 (8.1)	13.4 (4.4)	6/1	7/0	7/0	7/0	7/0
DIP	1	1/0	63	15	1/0	1/0	1/0	0/1	0/1
VaP	0	l/l	66.5 (6.4)	17 (2.8)	1/1	2/0	2/0	2/0	2/0
OD/EPM	1	1/0	70	10	1/0	1/0	1/0	1/0	1/0
UcPD	12	5/7	58.7 (13.6)	17.2(4.8)	7/5	11/1	11/1	10/2	7/5
Total	75	33/42	65.3 (9.4)	16.9(4.1)	43/32	68/7	66/9	54/21	30/45

Parkinson's Disease: Cognition

94

Effect of erythropoietin on cognitive function in Parkinson's disease

Shengnan Liu, Ivonne Pedroso, Arnoldo Padrón, Enrique Casabona Fernandez, Daniel Amaro, Marjan Jahanshahi, Maria L. Bringas (Chengdu, People's Republic of China)

Objective: The aim of our study was to assess the effect of erythropoietin EPO on cognitive function in Parkinson's disease (PD).

Background: Cognitive impairment, particularly executive dysfunction is a feature of PD from the early stages (Dirnberger & Jahanshahi, 2013). While the motor symptoms of PD are well controlled initially by dopaminergic medication (Lees et al, 2009) and later with deep brain stimulation (Deuschl et al, 2006), currently no treatment for cognitive deficits in PD are available. EPO has been studied for its potential neuroprotective properties in neurologic disorders. In a review of 180 studies (Sargin et al. 2010) the beneficial action of EPO, including on cognition, has been demonstrated. Here we are testing the effect of NeuroEPO, a new formulation of EPO with low content of sialic acid.

Methods: This study is a phase I‐II trial developed in collaboration between three institutions: International Center for Neurological Restoration, Center for Molecular Immunology, Cuba, and Clinical Hospital of Chengdu Brain Sciences, China. 15 PD patients (8 females, H&Y stages I‐II, mean age 56.4 (SD 7.8) duration 5.4 (SD 3.2) years) received a weekly 1mL dose of intranasal neuroEPO for 5 weeks. Patients were assessed on tests of cognitive function before and 6 months after treatment. The assessment included measures of global cognitive functioning (Mini Mental State Examination, Dementia Rating Scale), episodic verbal memory (Rey Auditory Verbal Learning test) visuospatial ability and non‐verbal memory (Rey Complex Figure, copy and delayed recall/reproduction), executive function (Delis‐Kaplan verbal fluency, trail‐making and Stroop, Frontal Assessment Battery). Mood (Hospital Anxiety & Depression Scale) was also assessed.

Results: After Bonferroni correction for multiple comparisons, compared to baseline performance, at 6 months follow‐up the patients showed significant improvement on the Dementia Rating Scale total score, the Rey Auditory Verbal Learning recognition test, recall of the Rey Complex Figure, he Frontal Assessment Battery, the category switching verbal fluency and the speed of the control colour naming task on the Stroop.

Conclusions: These results are suggestive of improvement of aspects of cognitive function particularly verbal recognition memory, non‐verbal memory and executive function following treatment of PD with erythropoietin. These results require further confirmation in a double‐blind randomized placebo controlled study.

References: Deuschl, G., Schade‐Brittinger, C., Krack, P., Volkmann, J., Schafer, H., Botzel, K., . . . German Parkinson Study Group, N. S. (2006). A randomized trial of deep‐brain stimulation for Parkinson's disease. N Engl J Med, 355 (9), 896‐908. doi:10.1056/NEJMoa060281Dirnberger, G., & Jahanshahi, M. (2013). Executive dysfunction in Parkinson's disease: a review. J Neuropsychol, 7 (2), 193‐224. doi:10.1111/jnp.12028Lees, A., Hardy, J., & Revesz, T. (2009). Parkinson's disease. The Lancet, 373 (9680), 2055‐2066. Sargin, D., Friedrichs, H., El‐Kordi, A. and Ehrenreich, H. 2010. Erythropoietin as neuroprotective and neuroregenerative treatment strategy: comprehensive overview of 12 years of preclinical and clinical research. Best Pract Res Clin Anaesthesiol 24 (4): 573‐94.

95

This abstract has been withdrawn.

96

This abstract has been withdrawn.

97

Cortical reorganization with cognitive restructuring & visual‐feedback in freezing of gait

Sunita Gudwani, Prabhakar Upadhyay, Kamlesh Sharma, Shanmugam Kumaran, Rajesh Sagar, Rajinder Dhamija (New Dehli, India)

Objective: To unfold the mechanism of volitional motor execution by cognitive restructuring and visual‐feedback of FOG.

Background: In Parkinson's Disease (PD) freezing of gait (FOG) involves hypoactivation in bilateral orbitofrontal, parietal areas and basal ganglia, compared to patients without FOG or healthy subjects which may affect the executive control [1,2].

Methods: Pilot study comparing PD with healthy controls pre‐ and post‐ cognitive restructuring Rx. Clinical assessments included UPDRS, H&Y, FOGQ Scale, DASS‐21, with MRI & functional MRI (fMRI). Acquisition of MRI & fMRI was done at 3T MR scanner using 12‐channel head coil, Invivo Corp (Ingenia, Philips Healthcare) and MR compatible LCD monitor. fMRI (BOLD) paradigm was block design with 3 cycles AX AY AZ where XYZ were videos of the same subject with “FOG” (preRx), “session+collective walk with therapist” (Rx), postRx “walk with reduced freezing in PD” respectively. Parameters in fMRI were TR 2s, dynamic 360, acquisition time 12 min.

Results: In “drug‐on state” PD before cognitive restructuring Rx, clinically had severe FOG and post‐Rx session had minimal FOG, it was video‐recorded and displayed during fMRI task. In PD visual processing of the preRx FOG recruited activity in areas BA 2, 6, 9, 10, 11, 40, 43, 46 and cerebellum. PostRx processing in PD confined activation in left hemispheric occipital, right frontal (BA 8,9,46) and cerebellum [Table 1, Table 2, Figure 1].

Conclusions: PostRx session‐ gait improvement associated with BA 8, 46, inferior occipital, fusiform, cerebellum activity with better motor planning and executive control. Cuneus with inferior occipital play role in visuo‐spatial movement planning observed as hypoactive during FOG and increased activity with improvement. Maladaptive neural compensation may transiently result in conflicting motor, cognitive, emotional stimulus overload resulting in FOG [1,2]. Cognitive restructuring therapy facilitates dynamic cortical reorganization and reducing executive conflict during walk that may attribute to neural‐plasticity with consistent therapeutic remediation.

References: 1. Fasano A, Herman T, Tessitore A, Strafella AP, Bohnen NI. J Parkinson's Disease, 2015,5:241–2542. Ricciardi L, Bloem BR, Snijders AH, Daniele A, Quaranta D, Bentivoglio AR, Fasano A, 2014. Parkinsonism Relat Disord, 20, 824‐829

Figure 1.

BOLD activation in PD

Table 1.

Visual processing of Pre‐Rx FOG in PD

No of clusters	Z score	MN1 Coordinates	Hemisphere	Area	Brodmann Area
123	6.01	62‐18 36	Right	Postcentral Gyms	BA 2
		58‐28 46		Inferior Parietal Lobule	BA 40
24	5.32	‐50 36 10	Left	Middle Frontal Gyrus	BA 46
55	4.96	‐58‐56 12	Left	Superior Temporal Gyms	BA 39
		‐58‐60 4		Middle Temporal Gyrus	BA 37
18	4.93	‐54‐10‐32	Left	Inferior Temporal Gyrus	BA 20
12	4.74	‐60 4 12	Left	Precentral Gyrus	BA 6
17	4.63	‐64‐16 20	Left	Postcentral Gyrus	BA 40
17	4.47	64‐42 4	Right	Middle Temporal Gyrus	BA 22
17	4.41	6 56 30	Right	Medial Frontal Gyrus	BA 6
99	4.41	40‐10‐28	Right	Fusiform Gyrus	BA 20
13	4.37	‐60 ‐2‐14	Left	Middle Temporal Gyrus	KA 21
25	4.28	64‐12 18	Right	Postcentral Gyrus	BA 43
19	4.20	‐36 56 ‐1	Left	Middle Frontal Gyrus	BA 10
27	4.14	‐48‐68‐16	Left	Cerebellar Declive
44	4 09	60‐38 38	Right	Supramarginal Gyrus	BA 40
22	4.05	50‐24 56	Right	Postcentral Gyrus	BA 2
10	4.04	‐62‐30‐16	Left	Middle Temporal Gyrus	BA 21
14	4.02	4 60 10	Right	Medial Frontal Gyrus	BA 9
32	3.99	50‐58 2	Right	Middle Temporal Gyrus	BA 37
32	3.97	42‐20 ‐2	Right	Lingual Gyrus	BA 18
15	3.90	58‐30 26	Right	Inferior Parietal Lobule	BA 10
15	3.65	‐16‐21‐22	Left	Parahippocampal Gyrus	BA 36
43	3 58	54‐16 16	Right	Insula	BA 13
12	3 44	‐52‐56‐22	Left	Cerebellar Declive

Table 2.

Visual processing of Post‐Rx Walk in PD

No of clusters	Z score	MNI Coordinates	Hemisphere	Area	Brodmann Area
162	4 26	‐38 ‐84‐12	Left	Fusiform Gyros	BA 19
		‐44 ‐80 ‐1		Inferior Occipital Gyrus	BA 18
		‐32‐90 ‐8
35	1.21	21‐78‐16	Right	Cerebellar Declive
77	4.13	‐18‐72‐10	Left	Cerebellar Declive
128	1.06	52 32 28	Right	Superior Frontal Gyrus	BA 9
		48 46 12		Middle Frontal Gyms	BA 46
28	3 66	‐14‐96 16	Left	Cumeus	BA 18
11	3.60	50 18 40	Right	Middle Frontal Gyrus	BAS
13	3.47	‐10 ‐82 8	Left	Middle Occipital Gyrus	BA 19

98

Mild cognitive impairment in de novo Parkinson's disease: a neuromelanin MRI study in locus ceruleus

Changpeng Wang, Yuanfang Li, Jian Wang, Lirong Jin (Shanghai, People's Republic of China)

Objective: To investigate neuromelanin‐sensitive MRI (NM‐MRI) features in the locus ceruleus (LC) of de novo Parkinson's disease (PD) patients with different cognitive states and to clarify if these features are associated with cognitive impairment.

Background: Cognition impairment appears early in PD. The LC is the major origin of noradrenergic neurons and is involved in cognitive function. NM‐MRI can detect neuromelanin (NM), a by‐product of noradrenaline metabolism, in the LC in vivo.

Methods: Three groups of subjects were recruited in this study, including patients with de novo PD with mild cognitive impairment (PD‐MCI, n=24), patients with de novo PD without cognitive impairment (PD‐NC, n=49) and control subjects (n=32). All subjects underwent motor and cognitive evaluations, as well as NM‐MRI scanning. The contrast‐to‐noise ratios (CNRs) of the LC‐NM on the NM‐MRI images were measured.

Results: The CNRs of the LC‐NM in PD‐MCI patients were significantly lower than those in controls (P=0.012), while no significant difference was found when compared with those in PD‐NC patients (P=0.304). In addition, the LC CNRs in PD‐NC patients were not different from those in controls (P=0.172). Furthermore, multiple linear regression analysis showed that the LC‐NM CNRs were negatively associated with performance on the Trail Making Test B in both all PD patients and PD‐MCI patients, when controlling for age, years of education, Part III of the UPDRS scores and Geriatric Depression Rating Scales scores.

Conclusions: NM loss in the LC may play an important role in the early stage of de novo PD patients and contribute to cognitive impairment, especially executive dysfunction. In the future, the LC‐norepinephrine system might be targeted in early intervention strategies in PD‐MCI patients.

99

Factors associated with brittle response of patients in Parkinson disease

Yun Yan, Yan Li, Yuan Li, Feng Liu, Ying Chang (Changchun, People's Republic of China)

Objective: Retrospectively evaluate the related factors of “brittle response (BP)” in patients with PD, and assess its potential risk factors and possible effective treatment methods.

Background: Recently, a particular group of PD female patients with lower body weight was reported to be at higher risk of levodopa‐induced dyskinesia. The name “brittle” has been used in these group patients. But it is not yet well described the clinical characteristics of PD patients with this “brittle response (BP)” up to now.

Methods: 100 PD patients were enrolled in this study. BR patients were defined as taking 100 mg or less of levodopa per dose and were required to report symptoms of disabling dyskinesia (s) in their most recent visit. Basic demographic information, current treatment doses, levodopa equivalent dosage daily, Unified Parkinson's Disease Rating Scale (UPDRS) scores in the “off” medication state, Hoehn‐Yahr (HY) stage, Schwab and England scale (SE), the 39‐item Parkinson's Disease Questionnaire (PDQ‐39), Hamilton Anxiety Scale, Hamilton Depression Scale, Mini‐mental State Examination and Montreal cognitive assessment scale were all extracted from each patient's chart.

Results: Of 100 PD patients, 11 (11%) met criteria for the BR group, and 89 (89%) for non‐BP (NBR) group. Compared to the NBR group, the BR group had a lower body weight, a lower BMI, longer disease duration, higher UPDRS II score, higher LEDD, higher levodopa per unit body weight than the NBR group. The BR group had higher UPDRSIII and PDQ‐39 scores. Motor complication was more likely in the BR group. There was no significant difference in height,disease type, mental state (HAMA?HAMD), intelligence (MMSE?MOCA), age and age of onset. Multivariate logistic regression analysis showed that the lower BMI, and higher levodopa per unit body weight were independent risk factors for BR group .The quality of life of patients met BR group was worse.

Conclusions: Female, lower body weight, a lower BMI, longer disease duration, higher UPDRS II score, higher LEDD, higher levodopa per unit body weight were associated with BP. We suggest that a lower BMI and higher levodopa per unit body weight may be independent risk factors for BR. BR group patients had worse quality of life.

References: 1. Jankovic J. Parkinson's disease: clinical features and diagnosis. J Neurol Neurosurg Psychiatr, 2008;79: 368‐376.2. Ahlskog JE, Muenter MD. Frequency of levodopa related dyskinesia and motor fluctuations as estimated from the cumulative literature. Mov Disord 2001;16:448e58.3. O'Sullivan SS, Williams DR, Gallagher DA, Massey LA, Silveira‐Moriyama L,Lees AJ. Nonmotor symptoms as presenting complaints in Parkinson's disease: a clinicopathological study. Mov Disord 2008;23:101‐106. 4. Cenci MA, LindgrenHS. Advances in understanding L‐DOPA induced dyskinesia. Current Opinion inNeurobiology, 2007,;17 (6): 665‐671.5.Nutt JG.Levodopa‐induced dyskinesia: Review, observations, and speculations. Neurology 1990, 40, 340‐345.6. Durif F .Treating and preventing levodopa‐induced dyskinesias: Current and future strategies. Drugs Aging 1999,;14 (5), 337‐345.7. Mones RJ, Elizan TS, & Siegel G .L‐dopa induced dyskinesias in 152 patients with Parkinson's disease. Trans Am Neurol Assoc 1970; 95, 286‐287.8. Olanow CW, Obeso JA, Stocchi F. Continuous dopamine receptor treatment of Parkinson's disease: scienti?c rationale and clinical implications. Lancet Neurol 2006;5:677–687. 9. Grace AA. Phasic versus tonic dopamine release and the modulation of dopamine system responsivity: a hypothesis for the etiology of schizophrenia. Neuroscience 1991;41:1–24.10. Grace AA, Bunney BS. The control of ?ring pattern in nigral dopamine neurons: single spike ?ring. J Neurosci 1984;4: 2866–2876.11. Schultz W. Predictive reward signal of dopamine neurons. J Neurophysiol 1998;80:1–27. 12. Miller DW, Abercrombie ED. Role of high‐af?nity dopamine uptake and impulse activity in the appearance of extracellular dopamine in striatum after administration of exogenous L‐DOPA: studies in intact and 6‐hydroxydopamine‐treated rats. J Neurochem 1999;72:1516–1522. 13. Sage JI, Trooskin S, Sonsalla PK, et al. Long‐term duodenal infusion of levodopa for motor ?uctuations in parkinsonism. Ann Neurol 1988;24:87–89. 14. Syed N, Murphy J, Zimmerman T, et al. Ten years' experience with enteral levodopa infusions for motor ?uctuations in Parkinson's disease. Mov Disord 1998;13:336–338.15. Antonini A, Isaias IU, Canesi M, et al. Duodenal levodopa infusion for advanced Parkinson's disease: 12‐month treatment outcome. Mov Disord 2007;22:1145–1149. 16. Stocchi F, Vacca L, Ruggieri S, Olanow CW. Intermittent vs continuous levodopa administration in patients with advanced Parkinson disease: a clinical and pharmacokinetic study. Arch Neurol 2005;62:905–910. 17. Kumar N, Van Garpen JA, Bower JH, Ahlskog JE. levodopa dyskinesia incidence by age of Parkinson's disease onset. Mov Disord 2005;20:342‐346.18. Quinn N, Critchely P, Marsden CD. Young onset Parkinson's disease. Mov Disord 1987;2:73‐91.19. Rascol O, Brooks DJ, Korczyn AD, DeDeyn PP, Clarke CE, Lang AE. A five‐year study of the incidence of dyskinesia in patients with early Parkinson's disease who were treated with ropinirole or levodopa. N Engl J Med 2000;342:1481‐1491.20. Blin J, Dubois B, Bonnet AM, Vidailhet M, Brandabur M, Agid Y. Does age aggravate Parkinsonian disability? J Neurol Neurosurg Psychiatr 1991;54:780‐782.21. Lyons KE, Hubbie JP, Troster AI, Pahwa R, Koller WC. Gender differences in Parkinson's disease. Clin Neuropharmacol 1998;21:118‐121.22. Zappia M, Annesi G, Nicoletti G, Arabia G, Annesi F, Messina D, et al. Sex Differences in clinical and genetic determinants of levodopa peak‐dose dyski?nesias in Parkinson disease: an exploratory study. Arch Neurol 2005;62:601‐605.23. Aubert I, Guigoni C, Hakansson K, Li Q, Dovero S, Barthe N, et al. Increased D1 dopamine receptor signaling in levodopa‐induced dyskinesia. Ann Neurol 2005;57:17‐26.24. Bachmann CG, Zapf A, Brunner E, Trenkwalder C. Dopaminergic treatment is associated with decreased body weight in patients with Parkinson's disease and dyskinesias. Eur J Neurol 2009;16:895‐901.25. Arabia G, Zappia M, Bosco D, Crescibene L, Bagalà A, Bastone L, et al. Body weight, levodopa pharmacokinetics and dyskinesia in Parkinson's disease.Neurol Sci 2002;23:S53‐54.26. Zappia M, Crescibene L, Arabia G, Nicoletti G, Bagalà A, Bastone L, et al. Body weight influences pharmacokinetics of levodopa in Parkinson's disease. Clin Neuropharmacol 2002;29:79‐82.27. Mills KA, Scherzer R, Starr PA, Ostrem JL (2012) Weight change after globus pallidus internus or subthalamic nucleus deep brain stimulation in Parkinson's disease and dystonia. Stereotact Funct Neurosurg 90: 386–393. 28. Rascol O, Brooks DJ, Korczyn AD, De Deyn PP, Clarke CE, Lang AE, et al.Development of dyskinesia in a 5 year trial of ropinirole and L‐dopa. Mov Disord 2006;21:1844‐1850.29. Parkinson's Study Group. Pramipexol vs levodopa as initial treatment for Parkinson's disease. JAMA 2000;284:231‐238.30. Bracco F, Battaglia A, Chouza C, Dupont E, Gershanik O, Marti Masso JF, et al.PKDS009 study group. The long acting DA cabergoline in early Parkinson's disease: final results of five year, levodopa controlled study. CNS Drugs 2004;18:733‐746.31. Hauser RA, Rascol O, Korczyn AD, Jon Stoessl A, Watts RL, Poewe W, et al. Ten year follow up of Parkinson's disease patients randomised to initial therapy with ropinirole or levodopa. Mov Disord 2007;22:2409‐2417.32. Fahn S, Oakes D, Shoulson I, Fahn S, Oakes D, Shoulson, et al. Levodopa and the progression of Parkinson's disease. N Engl J Med 2004;351:2498‐2508.33. Kostic VS, Marinkovic J, Svetel M, Stefanova E, Przeborski S. The effect of stage of Parkinson's disease at the onset of levodopa therapy on development of motor complications. Eur J Neurol 2002;9:9‐14.34. Grandas F, Galiano ML, Tabernero C. Risk factors for levodopa induced dyskinesia. J Neurol 1999;246:1127‐1133.35. Hauser RA, McDermott MP, Messing S. Factors associated with the develop?ment of motor complications and dyskinesias in Parkinson disease. Arch Neurol 2006;63:1756‐1760.36. Onofrj Marco, Paci C, Thomas A. Sudden appearance of invalidating dyskinesia‐dystonia and off fluctuations after the introduction of levodopa in two dopaminomimetic drug naive patients with stage IV Parkinson's disease.J Neurol Neurosurg Psychiatr 1998;65:605‐606.37. Mouradian MM, Juncos JL, Fabbrini G, Chase TN. Motor fluctuations in Parkinson's disease. Ann Neurol 1989;25:633‐634.38. Fuente‐Fernandez RD, Sossi V, Huang Z, Furtado S, Lu J, Calne DB, et al.Levodopa induced changes in synaptic dopamine levels increase with progression of Parkinson's disease: implications for dyskinesia. Brain 2004;127:2747‐2754.39. Clissold BG, McColl CD, Reardon KR, Shiff M, Kempster PA. Longitudinal study of motor response to levodopa in Parkinson's disease. Mov Disord 2006;21:2116‐2121.40. Calabresi P, Di Philippo M, Ghiglieri V, Picconi B. Molecular mechanisms underlying levodopa‐induced dyskinesia. Mov Disord 2008;23 (Suppl. 3):S570‐579.41. Karamohamed S, DeStefano AL, Wilk JB, Shoemaker CM, Golbe LI, Mark MH,et al. A haplotype at the PARK3 locus influences onset age for Parkinson's disease: the gene Parkinson's disease study. Neurology 2003;61:1557‐1561.42. Wang J, Liu ZL, Chen B. Association study of dopamine D2, D3 receptor gene polymorphisms with motor fluctuations in Parkinson's disease. Neurology 2001;56:1757‐1759. 43. Wang J, Liu ZL, Chen B. Dopamine D5 receptor gene polymorphism and the risk of levodopa‐induced motor fluctuations in patients with Parkinson's disease. Neurosci Lett 2001;308:21‐24.44. Kaiser R, Hofer A, Grapengiesser A, Gasser T, Kupsch A, Roots I, et al. Dopa‐induced adverse effects in Parkinson's disease and dopamine transporter gene polymorphism. Neurology 2003;60:1750‐1755.45. Martinez‐Ramirez D1, Giugni J1, Okun MS2,et al. The "brittle response" to Parkinson's disease medications: characterization and response to deep brain stimulation. PLoS One. 2014 Apr 14;9 (4):e94856.

100

The cognitive dysfunction in early Parkinson's disease with obstructive sleep apnea hypopnea syndrome

Kangping Xiong, Jin‐ru Zhang, Jun‐ying Huang, Cheng Jie Mao, Chunfeng Liu (Suzhou, People's Republic of China)

Objective: This study aimed to investigate the cognitive function in early Parkinson's disease (PD) with Obstructive sleep apnea hypopnea syndrome (OSAHS) and determine the relationship between cognitive function and sleep apnea.

Background:‐

Methods: We recruited 152 early PD patients, 44 age‐ and sex‐matched OSAHS patients and 17 controls. All participants underwent clinical investigation, Mini‐mental state examination (MMSE), Montreal cognitive assessment Beijing version (MoCA) and polysomnography (PSG). All PD patients were assessed motor and non‐motor symptoms by unified Parkinson's disease rating (UPDRS), Hoehn and Yahr Stage (H‐Y), Hamilton rating scale for depression (HRSD), Hamilton rating scale for anxiety (HAMA), Epworth sleepiness scale (ESS), 39‐items Parkinson's Disease Questionnaire (PDQ‐39). Then, we investigated the clinical characteristics especially the cognitive function and determine the relationship between cognitive function and sleep apnea in early PD patients with OSAHS.

Results: The incidence of OSAHS in early PD was 34.9% (53/152). The percentage of mild OSAHS was 54.7% (29/53) and the percentage of moderate and severe OSAHS was 45.3% (24/53). The body mass index (BMI) of PD patients with OSAHS was higher than PD patients without OSAHS. The MMSE score and MoCA score were both lower in PD with ((25.72±2.13) and (23.02±2.38)) and without OSAHS patients ((26.43±2.26) and (23.43±2.72)). The MMSE score of PD patients with OSAHS was significant lower than PD patients without OSAHS. There was a lower trend of the scores of visuospatial/executive, attention, and delayed recall domains in PD patients with OSAHS compared to PD patients without OSAHS. The MMSE score and MoCA score of PD patients with mild OSAHS ((24.63±2.08) and (22.21±2.55)) were significant lower than PD patients with moderate and severe OSAHS ((26.62±1.74) and (23.69±2.04)) (p=0.001 and p=0.039). Decreased MoCA scores in early PD patients with OSAHS were significantly associated with higher apnea and hypopnea index (AHI) and oxygen desaturation index (ODI) (p=0.002 and p<0.001). There were no significant differences on total sleep time (TST) sleep efficiency (SE) sleep latency (SL) awakenings percentage of time spent in NREM and REM sleep, the index of periodic limb movements, the tonic chin electromyography activity density and the phasic chin electromyography between PD patients with and without OSAHS.

Conclusions: The incidence of OSAHS in early PD was high. The severity of OSAHS in early PD patients was mild dominated. Compared to PD patients without OSAHS, the PD patients with OSAHS had lower MMSE scores and a trend of decline on the scores of visuospatial/executive, attention, and delayed recall domains. Decreased MoCA scores were significantly associated with higher AHI and ODI in early PD patients with OSAHS. OSAHS played an important role in cognitive dysfunction by chronic intermittent hypoxia in early PD patients.

101

Association of apolipoprotein E gene polymorphism, serum uric acid, homocysteine level with cognitive impairment of Parkinson's disease

Xu Ziqian (Guiyang, People's Republic of China)

Objective: To observe the association of apolipoprotein E (ApoE) gene polymorphism, uric acid (UA), homocysteine (Hcy) and cognitive dysfunction in patients with Parkinson's disease (PD).

Background:‐

Methods: 110 patients with sporadic PD were selected to record the general case data. These PD patients were evaluated with Unified Parkinson Disease Rating Scale? (UPDRS‐ III), Revised Hoehn and Yahr staging (H‐Y), Activity of Daily Living Scale (ADL), Geriatric Depression Scale (GDS), The Scale For Outcomes in PD For Autonomic Symptoms (SCOPA‐AUT) and Pittsburgh sleep quality index. The PD patients were divided into PD cognitive function group (PDNC), PD mild cognitive impairment group (PDMCI) and PD dementia group (PDD) by using the Montreal cognitive assessment scale (MoCA) and MMSE score. ApoE genotypes, blood uric acid and blood homocysteine were measured in the three groups.

Results: (1) The distribution of ApoE genotypes in the three groups of PDNC, PDMCI and PDD was not identical, and the difference was statistically significant (P<0.05). The distribution of ApoE genotypes in PDNC group and PDD group was different (P<0.017). The distribution frequency of epsilon 2/epsilon 3 in the PDNC group was significantly higher than that of PDD group (P<0.017), while the distribution frequency of epsilon 3/epsilon 4 was significantly lower in PDNC group than that in PDD group (P<0.017). The distribution of 3 allele frequencies of ApoE in different cognitive subgroups of PD was not identical, and the difference was statistically significant (P<0.05). In the further two groups, the distribution frequency of the epsilon 2 allele and epsilon 2 (+) genotype in the PDNC group was significantly higher than that in the PDD group (P<0.017), while the epsilon 4 was significantly lower than that in the PDMCI group and PDD group (P<0.017), but the distribution frequency of the epsilon 4 (+) genotype was significantly higher in the PDD group than in the PDNC and PDMCI group (P<0.017). (2) The level of UA in the three groups of PDNC, PDMCI and PDD was not completely consistent (P<0.05), and the UA level in PDNC group was significantly higher than that in PDMCI group and PDD group (P<0.017). There was no significant difference in the level of HCY between the three groups (P>0.05). (3) The level of cognitive function of PD patients was negatively correlated with age, age, UPDRS‐III score, Hoehn‐Yahr staging, ADL score, senile depression score, and PSQI score (P<0.05), and was positively correlated with the degree of education (P<0.01), but had no significant correlation with the course of disease, the onset side, the dominant side of movement disorder, clinical subtype and autonomous score (P>0.05).

Conclusions: (1) PD cognitive dysfunction is related to ApoE epsilon 4 allele and epsilon 2 allele. (2) PD cognitive dysfunction was associated with a decrease in serum uric acid level, but not with homocysteine level. (3)The degree of education is a protective factor for PD cognitive dysfunction. (4) The onset age, age, severity of dyskinesia, severity of disease, daily living ability, depression severity and sleep quality affect the changes of cognitive function in patients with PD.

102

Study on functional near infrared spectroscopy imaging of the frontal cortex executive function in Parkinson's disease

Xu Wang, Li Na Zhou, Xiao‐Feng Huang (Dalian, People's Republic of China)

Objective: Functional near‐infrared spectroscopy (fNIRS) was used to assess the activation of frontal cortex in the task state of PD patients to determine changes in executive function.

Background: At present, the diagnosis rate of mild cognitive impairment in PD (PD‐MCI) is low. Clinicians often overlook the possibility that patients with Parkinson's disease may have visual space executive function in the early stage of the disease, and even decline in cognitive function. Studies have shown that executive function and attention are significantly associated with bradykinesia and athletic ability.Functional Near Infrared Spectroscopy Imaging (fNIRS) is an emerging functional neuroimaging technique that can detect brain function non‐invasively and can reflect changes in cerebral blood volume in resting or task states.

Methods: Fifty patients with PD were enrolled, and according to the MOCA median space/execution function group, the language fluency task test (VFT) was used to detect whether there was significant activation or inhibition in the prefrontal cortex using fNIRS.

Results: 1. PD patients with executive dysfunction score of MOCA is generally low, and the reaction lower peak, the initial activation is slow. 2. The activation patterns were different between the two groups in the 11 channels of the prefrontal cortex, and max and initial activation were more positive for reflecting activation.

Conclusions: 1. PD patients with executive dysfunction fNIRS task state frontal lower peak activation reaction, slow initial activation, front left prefrontal cortex activation more pronounced reduction. 2. The initial activation and peak duration of the task in the VFT model can assess the severity of cognitive dysfunction in PD patients.

References: [2]Svenningsson P, Westman E, Ballard C, Aarsland D. Cognitive impairment inpatients with Parkinson's disease: diagnosis, biomarkers, and treatment. LancetNeurol. 2012 Aug;11 (8):697‐707. doi: 10.1016/S1474‐4422 (12)70152‐7. Review.PubMed PMID: 22814541. [3]Monchi, O., Hanganu, A., & Bellec, P. Markers of cognitive decline in PD: The case for heterogeneity. Parkinsonism Relat Disord. 2016 Mar;24:8‐14. doi:10.1016/j.parkreldis.2016.01.002. Epub 2016 Jan 7.

103

No significant correlation between hyposmia and visuospatial functions in Parkinson's disease by event‐related potential study

Yiqi Lin, Shishuang Cui, Juanjuan Du, Gen Li, Yixi He, Pingchen Zhang, Yang Fu, Pei Huang, Chao Gao, Binyin Li, Shengdi Chen (Shanghai, People's Republic of China)

Objective: The aim of our study was to investigate abnormal ERP components in PD with hyposmia and its association with specific impaired cognitive domains.

Background: Hyposmia is one of the most important clinical markers of Parkinson's disease (PD) and is found in up to 96% of PD patients. Hyposmia is associated with cognitive impairment of PD and may be a risk factor for PD dementia. However, the impaired cognitive domains in PD patients with hyposmia are not yet clear.

Methods: Olfactory functions were assessed by Sniffin' Sticks test‐16 (SS‐16). Twenty‐four subjects were included in PD with hyposmia group and nineteen were in PD without hyposmia group. ERP measures were recorded during a delayed match to sample (DMS) task with Chinese characters. ERP component parameters in retrieval epoch were compared between two groups and their relation with MOCA item and total score were analyzed.

Results: No significant difference of ERP performance was found between these two groups. N1 latency was significantly negatively related to visuospatial item score of MOCA (rs =‐0.381, P=0.012). A significant positive correlation was found between P1 amplitude and language item score of MOCA (rs =0.302, P=0.049).

Conclusions: N1 latency and P1 amplitude may be used in visuospatial function and language assessment in PD patients tested with DMS task. Hyposmia in PD patients is not associated with visuospatial or language impairment. More complete neurocognitive battery with high reliability and validation are needed in Chinese PD patients and other types of olfactory dysfunctions are expected to be studied in the future.

Figure 1.

 

Figure 2.

 

104

The diagnostic value of visual and auditory evoked potentials in Parkinson with dementia and without dementia

Guan Huizhong, Yuling Tian (Taiyuan, People's Republic of China)

Objective: The diagnosis of Parkinson's disease now depends on clinical symptoms,medical history,physical examination and ruling out other diseases. In the present study, we conducted auditory evoked potential and visual evoked potentials to patients who were diagnosed with Parkinson's disease and Parkinson with dementia and healthy controls to investigate the changes of visual evoked potential (VEP)and auditory evoked potential (BAEP)in patients with Parkinson disease and patients with Parkinson disease dementia.

Background: Parkinson's disease dementia is mainly characterized by memory and executive dysfunction, as well as fictional and misconstructive mental symptoms and other cognitive impairment [1]. It is believed that Parkinson's disease only has extrapyramidal damage, but in recent years, with the study of neuroelectrophysiology, there are still other transmission pathways. So far, brainstem auditory evoked potentials, visual evoked potentials, Parkinson's disease, Somatic sensory evoked potentials, cognitive evoked potentials, motor evoked potentials, electromyograms, and electroencephalograms were found to be abnormal. At present, there are many studies on Parkinson's disease and normal control group, but Parkinson's disease is divided into dementia type and non‐dementia type Parkinson's disease and normal control group.

Methods: To collect 20 PDD‐patients (PDD), 40 PD‐patients without dementia (n‐PDD) and 16 controls. 20 PDD‐patients (PDD) and 40 PD‐patients without dementia (n‐PDD) were from the first Hospital of Shanxi Medical University. All the patients were examined by an experienced neurologist and the diagnostic criteria for PD were according to the Movement Disorder Society Clinical Diagnostic Criteria for Parkinson's disease. The controls were healthy volunteers.All the people were examined by the mini‐mental state examination (MMSE), activity of daily living (ADL), brainstem auditory evoked potential (BAEP) and visual evoked potentials (VEP). The PDD group were examined by the neuropsychiatric inventory (NPI). In the shielding room, we used the evoked potential instrument to record the VEP and BAEP while the people were taking a comfortable lying position. The brainstem auditory evoked potential test is using the headphones to alternately stimulate the subjects years, and the recording electrode is placed on the perietal region and the reference electrode is placed in the same lobe. The visual evoked potential was stimulated by a inversion pattern which was a black and white checkerboard pattern of 16 x 16 size, and the recording electrode was placed in the parietal occiput area, and the reference electrode was placed in the forehead area. Each groups did visual and brainstem auditory evoked potential tests.Then recorded the P100 latency in VEP and recorded the latency of and the interpeak latency of in BAEP.The statistical analysis was carried out using SPSS 17 Statistics software. The measurement data was indicated the mean and standard deviation.Independent‐samples T Test and One‐Way ANOVA were used in the study.

Results: There was no statistically significant difference in latency of visual evoked potentials in the right and left eyes between the PDD group, the n‐PDD group and the control group (P>0.05). Compared with the control group,the latency of O1,OZ and O2 in n‐PDD group and PDD group were prolonged (P<0.05). The latency of evoked potentials in PDD group was prolonged when compared with the n‐PDD group (P<0.05). The latency of brainstem auditory evoked potential in right and left ears were not prolonged significantly (P>0.05). There were statistical significance in the prolonged latency of and in PD group compared with the control (P<0.05). No statistical differences in the interpeak latency of were found among PD group and control group (P>0.05). There was no statistically significant difference in the latency of the BAEP between the PDD group and the n‐PDD group (P > 0.05).

Conclusions: The latency of P100 in patients with Parkinson's disease was prolonged. The latency of P100 in PDD was more prolonged than that in n‐PDD.We knew that there was damage on visual pathway in patients with Parkinson's disease. The latency of P100 provide a basis of the diagnosis for Parkinson's disease and Parkinson's disease dementia. The latency of and were prolonged in patients with Parkinson's disease. We knew that there was damage on auditory pathway in patients with Parkinson's disease.

References: [1]de Rijk MC,Launer LJ,Berger K,et al.Prevalence of Parkinson's disease in Europe:a collaborative study of population‐based cohorts[J]. Neurology,2000,54 (11):S21‐3. [2] [J],2014,26 (6):560‐570. [3] [M] 2009:276. [4] [M] 2000:4. [5] [J],2007,42 (3):558‐560. [6] [J],2010,42 (4):395‐397. [7] [J],2009,29 (16):2033‐2035. [8][J],2011,18 (3):134‐136. [9] [J],2000,19 (6):408‐410. [10][J],2014,23 (1):38‐40. [12] [J],2004,3 (5):356‐358. [13][J],2004,44 (1):6‐8. [14][J],2013,20 (4):202‐204 . [15]Muthane UB, Satishchandra P, Subhash MN. Visual and auditory evoked potentials in early onset Parkinson's disease and their relationship to cerebrospinal fluid monoamine metabolites[J]. Mov Disord,1993,8 (3):344‐348. [16]B.Okuda, H.Tachibana, K.Kawabata, M.Takeda, et al. Visual evoked potentials (VEPs) in Parkinson's disease: Correlation of Pattern VEPs Abnomality with dementia[J]. Alzheimer Disease and Associated Disorders,1995,9 (2):68‐72. [17]Takeda M, Tachibana H, Sugita M. Multimodal evoked potentials in patients with dementia[J]. Nippon Ronen Igakkai Zasshi.Japanese Journal of Geriatrics,1993,30 (12):1058‐1067. [18]Takeda M, Tachibana H, Oruda B, et al. Event‐related potential and visual evoked potential in patients with Parkinson's disease[J]. Nippon Ronen Lgakkai Zasshi,1993,30 (5):363‐368. [19][J],2009,18 (3)148‐150. [20][J],2009,4 (4):251‐255. [21]Rossini PM, Babiloni F, Bernardi G, et al.Abnormalities of short‐lateny somatosensory evoked potentials in pakinsonia patients[J].Electroencephalogr Clin Neurophysiol,1989,74 (4):277‐289. [22]Rossini PM, Bassetti MA, Pasqualetti P.Median nerve somatosensory evoked potentials.Apomorphine‐induced transient potentiation of frontal components in Parkinson's disease and in parkinsonism[J]. Electroencephaloqr Clin Neurophysiol, 1995,96 (3):236‐247. [23][J],2010,17 (6):389‐392. [24][J],2006,13 (2):67‐72. [25]Alexander GE,Delong MR,Strick PL,et al. Parallel organization of functionally segregated circuits linking basal ganglia and cortex[J]. Annual Review of Neuroscience,1986,48 (3):357. [26][J],2000,9 (3):155‐157. [27]Süleyman Yýlmaz,Elif Karalý,Abdurrahman Tokmak,et al.Auditory evaluation in Parkinsonian patients[J].European Archives of Oto‐Rhino‐Laryngology,2009,266 (5):669‐671. [28]V. V. Garkavenko, I. N. Karaban, M. Ya. Voloshin, et al. Parkinson's Disease and Aging:Changes of Somatosensory Evoked Potentials in Humans[J].Neurophysiology,1994,26 (2):114‐118. [29]Rossini PM, Paradiso C, Zarola F,et al. Brain excitability and long latency muscular arm responses:non‐invasive evaluation in healthy and Parkinsonian subject [J]. Electroencephaloqr Clin Neurophysiol,1991,81 (6):454‐465. [30]S.Bostantjopoulou, Z.Katsarou, D.Zafiriou, et al. Abnormality of N30 somatosensory evoked potentials in Parkinson's disease: a multidisciplinary approach[J].Neurophysiol Clin 2000;30:368‐376. [31]H. Özden Sener,Muhittin C. Akbostanci, Canan Yücesan, et al.Visual evoked potentials in Parkinson's disease‐correlation with clinical involvement[J].Clinical Neurology and Neurosurgery,2001,103:147‐150. [32]Braak H, Muller CM, RubU, et al. Pathology associated with sporadic Parkinson's disease‐where does it end[J]. J Neural Transm Supp,2006 (70):89.

105

The factors influencing the cognition of patients with Parkinson's disease in the northeast of China

Hong Lv, Xiaoguang Luo (Shenyang, People's Republic of China)

Objective: Cognitive dysfunction of Parkinson's disease (PD) affects life quality a lot. And sex has been confirmed to affect cognition. This study was to explore and quantitate the influencing factors of cognitive impairment in PD patients and to find out whether the sex would affect the impact of those factors on the cognition.

Background: Cognitive dysfunction of Parkinson's disease not only affects the quality of life of PD patients, but also is burdensome for their families and the society. Previous studies have explored the incidence of dementia3, 7 and its influencing factors 3, 25, 27, 29in PD patients. However, the impacts of these factors on cognition have not been quantified. Moreover, many studies 2, 21, 31 have confirmed that sex is an influencing factor on cognitive impairment in neurodegenerative diseases because of the differences of hormone levels, 21 brain anatomy, brain metabolism 9 between male and female patients. While no such study specifically investigate the impact of sex on the cognition

Methods: A total of 1258 PD patients were recruited from the outpatient of Neurology Department of the First Affiliated Hospital of China Medical University. Demographic data were collected in all PD patients. UPDRS and MOCA were assessed to evaluate the severity of Parkinsonism and cognition, respectively. The statistical analyses including univariate analysis, multivariate analysis and stratified analysis were performed.

Results: One independent protective factor and eight independent risk factors were found. Education was the only protective factor with a knee point of 12 education years (ß=0.5,p<0.001) and the top three risk factors in order were family history of extrapyramidal symptoms (ß=‐1.2,p=0.031), H‐Y stage (ß=‐0.9,p<0.001) and UPDRS I (ß=‐0.3,p<0.001). Stratified analysis showed that sex differentially influenced the effect of onset age (p<0.0001), education (p<0.0001), UPDRS I (p<0.0001) and II (p<0.0001) on cognitive function in PD patients.

Conclusions: Cognitive impairment is more common and severe in PD patients with older age, older onset age, longer disease duration, shorter education years, severe motor symptoms and positive family history of extrapyramidal symptoms. In addition, female and male PD patients are affected differentially by each influencing factor of the cognitive state.

Table 1.1.

Demographic and clinical characteristics of studied PD patients

Characteristics	N	PD
Male: female ratio	627:631
Disease duration(years)#	1086	4.2 ± 3.4
Age (years)#	1248	63.8 ± 9.7
Onset age (years)#	1080	59.4 ± 10.1
Education (years)#	1243	9.5 ± 3.9
UPDRS part I#	1126	4.0 ± 2.7
UPDRS part II#	1226	14.0 ± 7.1
UPDRS part III#	1231	30.6±15.9
UPDRS part IV#	1088	1.6 ± 2.6
MoCA #	1201	20.6 ± 5.0
Mean H‐Y stage#	1120	1.9 ± 0.8
Family history*	1246	71 ( 5.7%)
Pesticide exposure*	475	62 (13.1%)
LRRK2 G2385R*	613	82 (13.4%)

UPDRS: Unified Parkinson's Disease Rating Scale; MoCA: Montreal Cognitive Assessment; H‐Y stage: Hoehn Yahr stage; N: number of patients with reliable information; # values present means ± SDs; * values present number of patients with a percentage in parenthesis.

Table 1.2.

Demographic and clinical characteristics of male and female patients with PD.

	Male patients	Female patients
	(N=627)	(N=631)	P value
Disease duration(years)#	4.2 ± 3.4	4.2 ± 3.4	0.712
Age (years)#	64.5 ± 10.1	63.2 ± 9.2	0.023
Onset age (years)#	60.0 ± 10.7	58.8 ± 9.5	0.043
Education(years)#	10.2 ± 3.7	8.8 ± 3.9	<0.001
MoCA #	21.0 ± 4.5	20.3 ± 5.5	0.014
LRRK2 G2385R*	41 (13.7%)	41 (13.1%)	0.836
Family history*	39 ( 6.3%)	32 ( 5.1%)	0.392
UPDRS I#	3.9 ± 2.5	4.2 ± 2.8	0.045
UPDRS II#	14.2 ± 7.0	13.7 ± 7.2	0.167
Inclination to depression#	1.8 ± 1.7	2.2 ± 2.0	0.003

UPDRS: Unified Parkinson's Disease Rating Scale; MoCA: Montreal Cognitive Assessment; N: number of patients with reliable information; # values present means ± SDs; * values present number of patients with a percentage in parenthesis.

Table 2.

Univariate and multivariate analysis of the association between MoCA and the influencing factors.

	Univariate analysis		Multivariate analysis
Variable	β	P	β	P
age	‐0.2 (‐0.3,‐0.1)	<0.001	‐0.1 (‐0.2,‐0.1)	<0.001
Onset age	‐0.1 (‐0.2,‐0.1)	<0.001	‐0.1 (‐0.2,‐0.1)	<0.001
Duration	‐0.2 (‐0.3,‐0.1)	<0.001	‐0.1 (‐0.2,0.0)	0.05
Sex	‐0.7 (‐1.3,‐0.1)	0.014	‐0.1 (‐0.8,0.6)	0.764
education	0.6 (0.5,0.6)	<0.001	0.5 (0.4,0.6)	<0.001
H‐Y stage	‐1.8 (‐2.2,‐1.5)	<0.001	‐0.9 (‐1.2,‐0.5)	<0.001
UPDRS part I	‐0.6 (‐0.7,‐0.4)	<0.001	‐0.3 (‐0.4,‐0.2)	<0.001
Depression inclination	‐0.5 (‐0.7,‐0.4)	<0.001	‐0.2 (‐0.3, 0.0)	0.04
UPDRS part II	‐0.3 (‐0.3,‐0.2)	<0.001	‐0.2 (‐0.2,‐0.1)	<0.001
UPDRS part III	0.0 (0.0, 0.0)	0.087	0.0 (0.0, 0.0)	0.975
UPDRS part IV	‐0.3 (‐0.4,‐0.2)	<0.001	‐0.1 (‐0.2,0.1)	0.332
Pesticide exposure	‐0.8 (‐2.0, 0.4)	0.206	‐0.2 (‐1.3,0.9)	0.692
LRRK2 variant	0.2 (‐0.9, 1.3)	0.718	0.0 (‐1.0,1.0)	0.971
Family history	0.5 (‐0.7, 1.7)	0.420	‐1.2 (‐2.3,‐0.1)	0.031

UPDRS: Unified Parkinson's Disease Rating Scale; Figures in parentheses indicate 95% confidence intervals.

Figure 1.

The relationship between MoCA score and education years.

Table 3.

Sex differences in the relations between MoCA scores and some influencing factors.

Variable	Male	Female	P value
Age	‐0.1 (‐0.2,‐0.1)	‐0.2 (‐0.4,‐0.1)	<0.0001
Onset age	‐0.1 (‐0.2,‐0.1)	‐0.2 (‐0.4,‐0.1) {OA<=49}	<0.0001
		0.0 (‐0.1, 0.1) {49<OA<64}
		‐0.3 (‐0.5,‐0.1) {0A>=64}
Education	0.4 (0.3, 0.5)	0.6 (0.4,0.7)	<0.0001
UPDRS part I	0.0 (‐0.2,0.3)	‐0.3 (‐0.5,‐0.1)	<0.0001
UPDRS part II	‐0.2 (‐0.3,‐0.2)	‐0.1 (‐0.1,0.0)	<0.0001

UPDRS: Unified Parkinson's Disease Rating Scale; OA: onset age.

Figure 2.

The relationship between MoCA and onset age in male and female patients.

Pediatric Movement Disorders

106

Movement disorders in pediatric anti‐NMDAR encephalitis: Myanmar experience

Ayemu Saan, Eihnin Kyu (Yangon, Myanmar)

Objective: To study the spectrum of movement disorders with different ages manifested in patients with anti‐NMDAR encephalitis admitted to Yangon Children Hospital, Myanmar.

Background: Anti‐N‐methyl‐D‐aspartate (NMDAR) encephalitis is one of the common cause of autoimmune encephalitis that presents with a wide variety of movement disorders especially in children and has potential reversibility with treatment in time.

Methods: We prospectively studied 16 cases of confirmed anti‐NMDAR encephalitis of non paraneoplastic etiology admitted to our hospital from January 2017 to August 2018. Total 16 patients (6 females and 10 males) with age ranging from 1‐12 years were enrolled. They were categorized into 3 age groups: 4 patients were 1‐5 years, 8 patients were 5‐10 years, and 4 patients were >10 years. Demographic and clinical characteristics with focus on the movement disorders was recorded. Neuroimaging [CT and brain magnetic resonance imaging (MRI)], cerebrospinal fluid analysis (CSF), and tumor screening were done. Patients were treated with immunomodulating drugs like steroids, intravenous immunoglobulin and were followed up.

Results: Hyperkinetic movement disorders were observed in all patients, especially orofacial‐lingual dyskinesia (OFLD) (87%), dystonia (37%), tremor (25%), stereotypies (25%) and choreoathetosis (25%). Hypokinetic disorder was not seen. 50% of patients presented with at least 2 types of disorders including OFLD, dystonia, stereotypes and choreoathetosis. OFLD, dystonia and choreoathetosis were common in all age groups. Stereotypes was seen on age between 5‐10 years. All patients received immunomodulatory therapy. 25% were received both steroid and immunoglobulin therapy. 93% has good response and significant decrease in movement disorders. One patient with different movement disorders of OFLD, tremor and choreoathetosis was died.

Conclusions: The movement disorders associated with anti‐NMDAR encephalitis is heterogeneous and predominantly hyperkinetic with chorea, dystonia and stereotypies. OFLD is prevalent in all age groups. High index of suspicion in patients presenting with movement disorders along with cognitive decline and seizures will be important in early diagnosis and treatment of autoimmune encephalitis.

References: 1. Baizabal‐Carvallo JF, Stocco A, Muscal E, et al. The spectrum of movement disorders in children with anti‐NMDA receptor encephalitis. Mov Disord 2013; 28:543–547.2. Varley JA, Webb AJS, Balint B, et al. The Movement disorder associated with NMDAR antibody‐encephalitis is complex and characteristic: an expert video‐rating study.J Neurol Neurosurg Psychiatry Published Online First: 21 July 2018. doi: 10.1136/jnnp‐2018‐318584.

107

This abstract has been withdrawn.

Phenomenology and Clinical Assessment of Movement Disorders

108

Mimics and chameleons presenting as blepharospasm

Soaham Desai, Shravan Thota, Devangi Desai (Anand, India)

Objective: To describe cases which are mimics and chameleons which were initially confused to be blepharospasm and discuss how to diagnose them correctly based on clinical phenomenology.

Background: Blepharospasm is a focal dystonia involving the orbicularis oculi and other periocular muscles characterized by increased blinking and spasms of periocular muscles. As the diagnosis is essentially clinical, often patients with other disorders are misdiagnosed to have blepharospasm.

Methods: We collected data of cases with other disorders which were misdiagnosed and referred as blepharospasm to our clinic between Jan 2012 to Oct 2017. We have excluded cases with apraxia of eyelid opening along with other degenerative diseases who are also often misdiagnosed as blepharospasm in this review of patients with isolated ocular symptoms. The most important causes of misdiagnosis are probably the phenomenological variability of blepharospasm upon presentation and the existence of a number of neurological and non‐neurological conditions that mimic blepharospasm.

Results: We report 6 cases with initial misdiagnosis of blepharospasm, 2 of such patients had myasthenia gravis. Myasthenia gravis patients have been rarely reported to present with excessive blinking as a compensatory adaptation for ptosis and fatigability. 2 of the patients had primary ocular pathology [chronic dacrocystitis and conjunctivitis] leading to frequent blinking because of eyelid irritation. Other 2 patients had functional blepharospasm. This was diagnosed by presence of only blinking without eyelid contraction, suggestibility, change with diverting attention and improvement with counselling. While one patient with conjunctivitis was referred by general practitioner directly, all other patients had consulted another neurologist and were advised trihexy‐phenidyl and botulinum toxin. In this paper would describe videos/ images of these patients with important clinical features to identify mimics and chameleons of blepharospasm.

Conclusions: Blepharospasm is a clinical diagnosis, one should be careful before labeling it and need to rule out its mimickers as we have described in this case series.

109

Study on the clinical and genetic association in Parkinson's disease risk of diabetes mellitus patients with high cholesterol level

Sithagounder Mekala, Ramachandran Chandirasekar, Venkatachalam Uthayakumar, Rajan Mathivanan, Matheswaran Ragadevi, Eswaran Anitha, Kalimuthu Loganathan (Erode, India)

Objective: Parkinson's disease (PD) and Diabetes mellitus (DM) in both conditions are involved in similar protein misfolding and genetic factors can influence. Aim of the study examined the risk of PD in DM using physical, clinical and genetic evaluation.

Background: PD is neurodegenerative disorder (ND) (MP, 2017) and glucose intolerance (Janson et al., 2004). DM can lead to brain changes (Reijmer et al., 2010). And risk for ND. DM may influence the Clinical presentation of PD (Ong et al., 2017).

Methods: We recruited 100 patients with (20 years of exposure with higher LDL) DM and ND risked samples and 100 samples of healthy normal controls with age matched. Confirmed DM using serum glucose levels (>126 mL/dL). Clinical examines in PD symptoms like Tremor or shaking, slow movement, Stiff, legs, CT and X‐rays in DM patients. The study was examination the chromosome damage (CD) using lymphocyte culture method and Genomic DNA was extracted from lymphocytes using HiPurA Genomic DNA kit, Himedia, India. ApoE and LRPAP1gene polymorphic variants were detected using PCR‐RFLP technique and odds ratio was estimated in DM patients.

Results: In the demographic characters were documented in male (28) and female subjects (72). Physical symptom was analyzed the DM patients and identified the tremor (25%), striff legs and X‐rays results and indicated the risk of PD (38%) in DM patients. In cytogenetic analysis find the minor CDs and result of the gene polymorphic variants like ApoE gene have the 6 type of genotypes and ApoE‐E2 type of alleles is higher risk factor for PD. in study also analyzed the 31% of ApoE‐E2 genotype. LRPAP1 I genotype was higher risk factor for PD, in study indicate the LRPAP1 I genotype was higher in DM subjects compared to controls. PD risk was found in DM patients.

Conclusions: The highest prevalence rate of PD was among persons aged over above 55 years. Our results confirm that the risk of PD increases with age, disease duration and cholesterol levels. In this disorders influenced by genetic and environmental factors and numerous genes indicated to risk of PD. The APOE and LRPAP1 genes play an important role in the lipid metabolism and APOE‐E2 and LRPAP1 I genotypes was risk factor for susceptibility to PD. However, we found an unexpected higher prevalence of PD in females. Early prediction of PD is better to manage.

References: 1. Medline Plus, U.S. National Library of Medicine. Accessed online on 2/28/17 at https://www.nlm.nih.gov/medlineplus/. 2. Janson J, Laedtke T, Parisi JE, O'Brien P, Petersen RC, Butler PC 2004. Increased risk of type 2 diabetes in Alzheimer disease. Diabetes. 53 (2):474‐81.3. Reijmer Y, van den Berg E, Ruis C, Kappelle L, Biessels G 2010. Cognitive dysfunction in patients with type 2 diabetes. Diabetes Metab. Res. Rev. 26, 507e519.4. Ong M, Foo H, Chander RJ, et al. Influence of diabetes mellitus on longitudinal atrophy and cognition in Parkinson's disease. J Neurol Sci 2017;377:122–126.

110

Validating the Vietnamese version of wearing – off 19 questionnaire for patients with Parkinson's disease

Le Uyen Ha Ngoc (Ho Chi Minh, Viet Nam)

Objective: This study was undertaken to determine the quality attribute of the questionnaire as a tool for early detection of wearing off (WO) in the Vietnamese population with Parkinson disease (PD). We also sought the relationship between the WO phenomenon and factors concerning the clinical condition and course of the disease.

Background: The disease progression and levodopa therapy in patients with Parkinson disease (PD) are usually combined with the development of various complications including wearing‐off phenomenon. A validated Vietnamese version of WO19 questionnaire is necessary to optimize the Vietnamese PD treatment.

Methods: This is an observational, cross‐sectional study. Patients diagnosed with PD under dopaminergic treatment were asked to complete the Vietnamese WO19 questionnaire. A neurologist specialized in movement disorders assessed the patient and determined whether he/she had experienced wearing off or not. The questionnaire results were then compared to the clinical opinion of the expert which is considered the gold standard for diagnosing wearing off. The reliability of the questionnaire is evaluated by Cronbach'a and Cohen's kappa coefficient. The validity is measured by the sensitivity and the specificity of the instrument in comparison with the gold standard. The relationship between associated factors and wearing off phenomenon is examined by using multivariate logistic regression analysis.

Results: We performed a cultural adaptation of the WO19 questionnaire into Vietnamese by following required steps in Principles of Good Practice for the Translation and Cultural Adaptation Process for Patient‐Reported Outcomes Measures (ISPOR). All the participants found the questionnaire comprehensible and feasible with clear instruction. Most of them spent less than 10 minutes answering the questionnaire independently. 98 patients with the mean age 59.12 ± 10,99 have joined our study; 58.2% are male; and the mean disease time is 6.32 years. The Vietnamese version of the WO19 questionnaire has a good reliability (Cronbach'a = 0.778) and the agreement with the expert assessment (the diagnostic accuracy) is at a substantial level (Kappa value = 0.618). The sensitivity and specificity of the questionnaire resulted 89.71% and 71.43% respectively. The multivariate logistic regression analysis revealed a long disease duration (= 6 years) (OR: 16.96; 95% CI: 2.17 – 132.57; p=0.007), a high daily levodopa dosage (= 400mg/day) (OR: 6.31; 95% CI: 1.36 – 29.23; p=0.019) and high score of MDS‐UPDRS part IV (= 4) (OR: 15.36; 95% CI: 2.13 – 110.58; p=0.007) has a significant and positive association with wearing off in Vietnamese PD patients.

Conclusions: Vietnamese – WO19 is a reliable and effective tool which should be used in clinical practice for early detecting PD patients with wearing off.

References: 1. Stacy M, Hauser R (2007), "Development of a Patient Questionnaire to facilitate recognition of motor and non‐motor wearing‐off in Parkinson's disease", J Neural Transm (Vienna), 114 (2), pp. 211‐2172.Martinez‐Martin P, Tolosa E et al. (2008), "Validation of the "QUICK" questionnaire ‐ a tool for diagnosis of "wearing‐off" in patients with Parkinson's disease", Mov Disord, 23 (6), pp. 830‐836

111

Impaired fine motor function of the asymptomatic hand in unilateral Parkinson's disease

Xiaojuan Dan, Jia Liu, Liang Sun, Jinghong Ma, Piu Chan (Beijing, People's Republic of China)

Objective: To examine whether Purdue Pegboard Test (PPT) could be served as an objective auxiliary clinical marker for early Parkinson's disease (PD) patients. Particularly, we investigated the dual‐task effect on PPT performance and its association with clinical conversion in drug naive patients with idiopathic unilateral PD and age matched healthy controls.

Background: Parkinson's disease (PD) is characterized by progressive neurodegeneration and motor deficit [1]. Although studies have reported abnormality of motor function of the asymptomatic side of unilateral PD [2,3], the dual‐task interference and its association with clinical conversion remains rarely investigated.

Methods: Forty drug naive patients with idiopathic unilateral PD and 32 age matched healthy controls were enrolled in the study. All participants performed Purdue Pegboard test (PPT) alone (uni‐task) and followed by adding a serial 3 subtraction concurrently (dual‐task). A telephone follow‐up was carried out 4 years later to identify the symptomatic conversion of the unaffected hand.

Results: The symptomatic and asymptomatic lateral performance showed markedly reduced pegboard dexterity as compared with the healthy controls for both uni‐task and dual‐task tests, while dual‐task had more interference effect on the dominant right hand PPT performance (Table 1). The PPT scores of both hands had an area under the receiver operating characteristic curve of 0.822 (75% sensitivity; 84% specificity) for diagnosing PD (Figure 1). The PPT scores in PD patients were well correlated with their UPDRS motor scores after adjusted for age, gender and disease duration (ß = ‐0.540, P <0.0001). In the 4‐year telephone follow‐up, right‐onset PD (PD‐R) patients remained unilateral affected had significant higher baseline PPT score in their asymptomatic hand as compared to that of PD‐R patients converted to bilaterally affected (P = 0.007) (Table 2). Further correlation analyses showed the baseline PPT performance of the asymptomatic hands was positive correlated with the conversion intervals from unilateral affected to bilateral affected (r =0.62, P = 0.031) (Figure 2).

Conclusions: This study demonstrated PPT performance impaired even before clinical motor manifestation and associated with symptomatic conversion. Whether PPT could be served as an potential auxiliary tool in diagnosing and monitoring disease progression of PD patients warrants further investigation.

References: [1] J. Wang, Q.X. Yang, X. Sun, J. Vesek, Z. Mosher, M. Vasavada, J. Chu, S. Kanekar, V. Shivkumar, K. Venkiteswaran, T. Subramanian, MRI evaluation of asymmetry of nigrostriatal damage in the early stage of early‐onset Parkinson's disease, Parkinsonism Relat Disord 21 (2015) 590‐596. [2] P. Lee, C.H. Liu, C.W. Fan, C.P. Lu, W.S. Lu, C.L. Hsieh, The test‐retest reliability and the minimal detectable change of the Purdue pegboard test in schizophrenia, J Formos Med Assoc 112 (2013) 332‐337. [3] C.A. Haaxma, B.R. Bloem, G.F. Borm, M.W. Horstink, Comparison of a timed motor test battery to the Unified Parkinson's Disease Rating Scale‐III in Parkinson's disease, Mov Disord 23 (2008) 1707‐1717.

Table 1.

Uni‐ and dual tasks of subtract 3 and Purdue Pegboard performance in the hemiparkinsonia patients and normal controls

	PD‐R	PD‐L	Control	P
Single‐task
PPT performance
Left hand	12.83±1.77	11.97±1.97	14.47±1.36	<0.001
Right hand	12.19±2.09	14.22±1.59	15.60±1.77	<0.001
Both hands	19.94±4.07	19.84±3.29	24.42±2.98	<0.001
3 subtraction	11.83±3.07	11.75±3.45	13.38±4.33	0.217
Dual‐task
PPT performance
Left hand	11.19±1.91	10.56±1.91	12.48±2.21	0.006
Right hand	9.83±2.39	11.59±1.96	13.36±2.13	<0.001
Both hands	16.94±3.45	18.62±3.15	22.83±3.96	<0.001
3 subtraction
Left hand	10.60±2.22	10.69 ±2.78	10.98±3.01	0.862
Right hand	9.29 ±2.78	10.94 ±2.36	11.58±4.14	0.077
Both hands	9.71 ±2.60	9.97 ±2.68	11.22±3.90	0.193
Dual‐effect (PPT performance)
Left hand	‐12.16%	‐11.28%	‐13.58%	0.834
Right hand	‐19.31 %	‐17.49 %	‐14.17%	0.354
Both hands	‐14.32%	‐5.47%	‐6.44%	0.029
Dual‐effect (3 subtraction)
Left hand	‐7.9%	‐6.58%	‐15.69%	0.160
Right hand	‐14.62%	‐7.98%	‐10.52%	0.091
Both hands	‐15.40%	‐12.92%	‐14.53%	0.927

Abbreviations: PD‐R= right‐onset Parkinson's disease; PD‐L = left‐onset Parkinson's disease; PPT = Purdue Pegboard Test.

Table 2.

Information for the patients in the 4‐year follow‐up

Groups	PPT performance	Converted to bilateral affected		P value
		No	Yes
PD‐L (N=9; 2:7)a	unaffected hand	13.25±1.77	13.71±1.95	0.773
	both hands	20.75±3.89	18.21±2.51	0.288
PD‐R (N=14; 9:5)b	unaffected hand	13.56±1.36	11.20±1.15	0.007
	both hands	20.67±5.12	18.40±2.27	0.372

^a2 patients unconverted to bilateral affected versus 7 patients converted to bilateral affected

^b9 patients unconverted to bilateral affected versus 5 patients converted to bilateral affected

Figure 1.

ROC curve for both hands of PPT performance under uni‐task and dual‐task conditions

The single task (dotted line) and dual task (continuous line) of the purdue pegboard test for all PD scores versus all control scores.

Figure 2.

The correlation between the patients' unaffected hands baseline PPT scores and their unilateral affected to bilateral affected conversion interval

112

Oculomotor performance in Chinese Parkinson's disease patients

Yu Zhang, Ai Juan Yan, Zhenguo Liu (Shanghai, People's Republic of China)

Objective: To study the character of oculomotor in Chinese Parkinson's disease (PD) patients.

Background: Parkinson's disease (PD) is a common neurodegenerative disease that could severely affect the motor system, including oculomotor performance. However, the character of oculomotor in Chinese PD patients has not been reported.

Methods: We designed a case‐control study and clinical manifestations of PD patients were collected. Oculomotor performance was measured.

Results: We found that fixation stability, saccadic latency, saccade frequency, viewing range and saccade frequency during free‐viewing context, were significantly different between PD patients and control group.

Conclusions: Our study reveals abnormal oculomotor behavior is common in early PD and demonstrated remarkable correlations with several key clinical variables. The oculomotor behavior might contribute to diagnosis and prognostic of PD.

References: Anderson TJ, MacAskill MR (2013). Eye movements in patients with neurodegenerative disorders. Nat Rev Neurol, 9:74‐85

113

A pilot study to evaluate the severity of motor dysfunction in patients with Parkinson's disease based on AI non‐wearable motion capture of video analysis

Bo Shen, Fang Peng, Yusheng Xie, Yifei Chen, Hui Tang, Shiyao Lin, Lin Zhang, Jianjun Wu, Zhengtong Ding, Wei Fan, Jian Wang (Shanghai, People's Republic of China)

Objective: This pilot study was mainly to evaluate the accuracy of specific pattern movement after video‐based quantitative methods in assessing motor dysfunction in patients with Parkinson's disease.

Background: Evaluation of motor symptoms of Parkinson's disease usually requires specialists to perform1. Artificial intelligence (AI)‐assisted video analysis are promising to deliver immediate, stable, and objective measures of disease severity 2,3.

Methods: 236 PD patients were recruited and rated by 3 independent specialists of movement disorder using Unified Parkinson's Disease Rating Scale (UPDRS III), The videos from 208 patients were used to train the AI algorithm, and the other 28 samples were used as the testing set to evaluate the consistency with the specialist rating score. The patient would perform the motor test in under the guidance and recorded by a high‐speed camera, motion features would be automatically identified by AI video analysis. Five motor items that were both disease‐characteristic and easy to visualize were screened out as subscales, including finger tapping (FT), hand movements (HM), pronation‐supination movements (PSM) of hands with stretching or bend arms and gait test. The rating score from both specialist or AI ranged from 0 to 4, higher score represented a worse motor performance.

Results: The testing set had a similar demographic background to the training set, and the distribution of motor symptoms was consistent with clinical practice [table 1]. In the total score of 9 motor items assessments, the AI rating based on video analysis were closely related to specialist rating (r=0.862, p=0.000, Pearson's correlation). Under the condition that the total score difference was not more than 3 points (max score is 36), the accuracy could reach 82.14%, this accuracy could not be achieved by random scoring (simulated data, 10,000 times) [figure1].I n the subscale score, the AI rating based on video analysis were still related to specialist rating (r=0.537, p=0.000, Pearson's correlation). The heat map showed that the rating between AI and specialist were rarely different by more than 2 points on all the sub‐items, which was obviously better than the simulated rating [figure2].

Conclusions: This technology has the potential to be a novel approach for severity assessment and early diagnosis in PD. As a pilot study, the sample size is not sufficient to conclude the reliability and effectiveness of the technology. AI rating has not yet achieved the same resolution as the specialist rating, mainly due to the insufficient number of samples with extreme symptoms in the training set. The results of this study will be useful for sample size estimation and algorithm optimization of subsequent large‐scale multi‐center clinical PD trials in the future.

References: 1. Postuma, R. B. et al. MDS clinical diagnostic criteria for Parkinson's disease. Mov. Disord. 30, 1591–1601 (2015).2. Li, M. H., Mestre, T. A., Fox, S. H. & Taati, B. Automated assessment of levodopa‐induced dyskinesia: Evaluating the responsiveness of video‐based features. Parkinsonism Relat. Disord. (2018). doi:10.1016/j.parkreldis.2018.04.0363. Arora, S., Baig, F., Lo, C. & Hons, B. Smartphone motor testing to distinguish idiopathic REM sleep behavior disorder, controls, and PD. Neurology 0, 1–12 (2018).

Table 1.

		Training Set	Testing Set
N		208 (96 females)	28 (13 female)
Age (years)		57.6= 12.1	58.9 ± 11.7
Hoehn & Yahr		2.38 = 0.83	1.79 ±1.37
UPDRS score (subscale)	0	79	31
	1	557	106
	2	737	116
	3	259	65
	4	27	8

Table 1.

 

Table 2.

 

114

Detection of impaired finger dexterity by objective keyboard typing test in Parkinson's Disease: a feasibility study

Kotchakorn Duangjino, Pattamon Panyakaew, Roongroj Bhidayasiri (Pattani, Thailand)

Objective: To objectively evaluate finger dexterity in Parkinson's disease (PD) patients by keyboard typing test.

Background: Impaired motor dexterity is a type of bradykinesia which is commonly rated by finger tapping test. Although widely used in clinical practice, finger tapping evaluation is frequently subjective, limiting its applications in future clinical trials where objective outcomes are increasingly considered.

Methods: 18 PD patients and 17 age‐matched healthy controls without any complaints of fine motor skills were recruited in this pilot study. Subjects with poor finger dexterities due to non‐neurological causes (e.g. joint deformities) were excluded. Objective evaluation of finger dexterity was assessed by two in‐house wearable sensors, placed on the dorsum of index and middle fingers of their most affected side by PD (fig 1). To determine typing performance, two paradigms were conducted, including side‐by‐side typing where M/N keystrokes were measured and far‐reach typing where P/Q keystrokes were evaluated. The tests were performed during the ‘off’ period in all PD patients, together with standard rating scales. Objective outcomes include typing frequency (F; keys), typing velocity (V; keys/s), keystrokes (K; s), repetition of keyboard tapping (R; keys) and typing error (E; keys).

Results: PD patients had a mean H&Y stage of 2.8 (1.1), with a mean UPDRS III and bradykinesia scores of 25 (11.35) and 6.6 (3.1) respectively, indicating a mild disease severity. None of control subjects exhibited bradykinesia or any signs of parkinsonism. Typing frequency (F) and velocity (V) were significantly higher in controls compared with PD in both the side‐by‐side (M/N) and far‐reach (P/Q) keyboard typing. (p <0.01 respectively) The duration of each keystroke (K) was significantly longer in PD than control subjects for both tasks (p <0.01). The repetition of keyboard typing (R) as well as the number of error (E) were greater in side‐by‐side (N/M) than far‐reach (P/Q) typing but statistically insignificant (p = 0.24, 0.25). (fig 2) The number of K positively correlated with levodopa equivalence dose (LED) (r=0.59, p <0.01). (fig 3)

Conclusions: Our pilot study demonstrated the feasibility of finger sensors on keyboard typing in the objective evaluation of impaired finger dexterity in PD. Impaired finger dexterity was objectively demonstrated in PD patients as manifested by slower typing velocity, longer keystroke duration, and higher number of errors than control subjects. Objective keyboard typing test is a promising test, which should be further validated in PD clinical trials.

Figure 1.

The in‐house wearable sensors for detecting finger dexterity while keyboard typing.

Figure 2.

Summary of outcomes of keyboard typing tasks in PD and controls. (MN = near keyboard typing task, PQ = far keyboard typing task)

Figure 3.

The correlation between duration of keystroke and LED.

Parkinson's Disease: Genetics

115

Novel DJ‐1PARK7 mutation and its relation to Lewy body accumulation

Mehri Salari, Alexander Lehn (Tehran, Iran)

Objective: We reported a patient with parkinsonism and cognitive decline, who had a‐synuclein in brain pathology, and genetic analysis showed a novel mutation in the PARK7 gene.

Background: Parkinson's disease (PD) is the second most frequent neurodegenerative disorder, and it seemed to be the idiopathic disorders but over 20 years ago this view has been changed and nowadays 10% of PD is monogenetic.

Methods: Evaluate the mutant gene and brain biopsy.

Results: The second case of PARK7 mutation with a‐synuclein brain pathology has been reported, which can contribute to better understanding of the underlying pathogenesis of Parkinson disease.

Conclusions: The PARK7 mutation might be another genetical culprit which causes a‐synucleinopathy.

Figure 1.

 

116

The involvement of long non‐coding RNA of microglia derived exosomes in Parkinson's disease

Yanran Liang, Danyu Lin, Yingyu Xie (Guangzhou, People's Republic of China)

Objective: This study investigated the effect of exosomes released by dopaminergic neuron overexpressing a‐synuclein on lncRNA profile of microglia‐derived exosomes in PD.

Background: Parkinson's disease (PD), the second most common neurodegenerative disease, is a progressive age‐related debilitating movement disorder. Long noncoding RNAs (lncRNAs) are selectively packaged into exosomes and may regulate the onset and progression in PD.

Methods: Both lentivirus expressing wild‐type human SNCA and control lentivirus were constructed and used to transfect SH‐SY5Y cells. Then their derived exosomes were cocultured with human microglia (HM) for 24h, respectively. The original media were replaced with fresh exosome‐free media for another 24h, then the microglia derived exosomes were collected and isolated by differential and buoyant density centrifugation.

Results: The expression of characteristic markers for exosome (CD63 and Alix) were confirmed by Western blot. Cup‐shaped structures of the characteristic size for exosomes were found by electron microscopy. The different expression of lncRNAs and mRNA in this model was studied by using microarray analysis. Several differentially expressed lncRNAs were identified, including ENST00000507782, uc.246, NR_046820, T379873, and ENST00000563243. Subsequent lncRNA‐associated competitive endogenous RNA regulatory network was constructed using bioinformatics methods to reveal the potential relationships between these lncRNAs and their associated mRNAs and microRNAs.

Conclusions: In summery, our study provides a deeper understanding of the role of exosomal lncRNAs in neuron‐microglia communication network in PD may help to find out new diagnostic and prognostic markers for PD.

117

A meta‐analysis of phenome and microarray data identifies gene regulatory networks in Parkinson disease (PD)

Gowdham Manivel, Shanmughavel Piramanayagam, Meyyazhagan Arun, Murugesh Easwaran (Coimbatore, India)

Objective: The present study to identify the candidate disease‐associated genes for Parkinson disease (PD) using a network based gene prediction strategy.

Background: Parkinson disease (PD) is a neurodegenerative disorder which causes dopaminergic neuronal loss in the nigro striatal pathway. It is a heterogeneous disease, is described as a genetic psychiatry disorder, affecting at least 1% of the population over age of 55. The association of genes and their regulators that control the progression and development of PD might provide deeper insights, which helps to discover new drug targets.

Methods: We have screened common differentially expressed genes (DEGs) from many PD blood microarray datasets and disease phenotype networks database by meta‐analysis. In addition we analyze the PD‐specific genes from common DEGs and phenotype networks database by using GCBI and phenome‐based gene prediction strategy. Furthermore, we used many bioinformatics software to analyze the lncRNAs,miRNAs and SNPs linked with the PD‐specific genes, and which will identify the integrated multiple disease phenotype networks, mTF‐miRNA‐gene‐gTF network, gene functional relationship networks. Later we investigate functional annotations of PD‐specific genes and predict the translational potential genes in drug discovery.

Results: Our outcome identifies the common DEGs in PD blood datasets and PD‐associated genes detected from phenotype networks database. Moreover this study identified the PD‐specific genes associated from long non‐coding RNAs (lncRNAs), the regulatory miRNAs study, and mTF‐miRNA‐gene‐gTF networks. GO enrichment and pathways analysis shows the top ranked genes from both gene sets of DEGs and phenome.

Conclusions: The Present identified DEGs datasets in PD patients were compared with healthy controls in blood dataset to discover the novel PD‐specific genes. Regulatory network analysis (miRNAs,lncRNAs,SNP) identify specific‐PD genes which contribute to understanding PD mechanisms. Overall, these findings impart a better comprehension complex molecular mechanism of PD and also facilitate discovering new targets for drugs.

References: 1.Chatterjee, Paulami, et al. “Biological networks in Parkinson's disease: an insight into the epigenetic mechanisms associated with this disease.” BMC genomics 18.1 (2017): 721.2.Diogo, Dorothee, et al. “Phenome‐wide association studies (PheWAS) across large” real‐world data” population cohorts support drug target validation.” bioRxiv (2017): 218875.

118

PDE8B mutation is not associated with Parkinson's disease in a Taiwanese population

Tian‐Sin Fan, Ruey‐Meei Wu, Han‐I Lin, Chieh Cheng, Chin‐Hsien Lin (Taipei, Taiwan)

Objective: We aim to address the genetic contribution of PDE8B in early‐onset and familial PD in a Taiwanese population.

Background: Mutations in the phosphodiesterase 8B gene (PDE8B) were recently linked to autosomal‐dominant striatal degeneration clinically presenting as slowly progressive parkinsonism. PDE8B degrades cyclic adenosine monophosphate (cAMP), a second messenger involved in dopamine signaling. Dopamine deficiency is the pathognomonic feature of Parkinson's disease (PD). Few studies have explored the role of PDE8B in PD.

Methods: Among 642 participants, we sequenced the exon containing previously reported mutations and exon‐intron boundaries of PDE8B in 196 PD pedigrees without known PD‐causative gene mutations, 207 patients with early‐onset PD (age of onset <50 years), and 239 ethnicity‐matched controls.

Results: We did not find any coding variants or previously reported mutations.

Conclusions: PDE8B mutations are not a common cause of familial or early‐onset PD in this Taiwanese population.

119

Substantia nigra hyperechogenicity of Parkinson's disease with LRRK2 variants in Chinese Han population

Chen‐chen Gu, Kai Li, Jin‐ru Zhang, Hong Jin, Chunfeng Liu (Suzhou, People's Republic of China)

Objective: We aimed to explore the associations between SN hyperechogenicity and LRRK2‐PD.

Background: Many efforts have been paid to the genotype‐phenotype analyses in Parkinson's disease (PD) with LRRK2 variants (LRRK2‐PD). Interestingly, we found PD with predisposing common and rare LRRK2 variants (common LRRK2‐PD, rare LRRK2‐PD) were more likely to have motor fluctuation and non‐motor symptoms previously. Substantia nigra (SN) hyperechogenicity is related to an increased iron content, and it is a risk marker of PD.

Methods: We enrolled 198 PD patients undergoing next generation sequencing and TCS examination. Demographic information was recorded, and United Parkinson's Disease Rating Scale (UPDRS) was also performed.

Results: Of 198 PD patients, 12 were rare LRRK2‐PD, 37 were common LRRK2‐PD including 32 G2385R‐PD and 5 R1628P‐PD. No significant difference was found between LRRK2‐PD and IPD, common LRRK2‐PD and IPD, G2385R‐PD and IPD in terms of TCS parameters (P>0.05, Mann‐Whitney U test/student t‐test).

Conclusions: LRRK2‐PD patients in Chinese Han population were similar to IPD as to TCS profiles, which was consistent to previous studies.

References: 1.N. Brüggemann, J. Hagenah, K. Stanley, C. Klein, C. Wang, D. Raymond, L. Ozelius, S. Bressman, R. Saunderspullman, Substantia nigra hyperechogenicity with LRRK2 G2019S mutations, Movement Disorders 26 (2011) 885.2.M. Sierra, P. Sánchez‐Juan, M.I. Martínez‐Rodríguez, I. González‐Aramburu, I. García‐Gorostiaga, M.R. Quirce, E. Palacio, J.M. Carril, J. Berciano, O. Combarros, Olfaction and imaging biomarkers in premotor LRRK2 G2019S‐associated Parkinson disease, Neurology 80 (2013) 621‐626.

120

Study on the genetic material alteration in the exposure of fluoride content drinking water and adverse risk of neurological disorders — A case control study

Rajan Mathivanan, Ramachandran Chandirasekar, Sithagounder Megala, Eswaran Anitha, Matheswaran Ragadevi, Kalimuthu Loganathan, C. Vasugi, Venkatachalam Uthayakumar (Erode, India)

Objective: The prime aim of the study was to assess the prevalence, physiological and genetic analysis of spinal cord irregularity in the exposure of fluoride (FLU) content water consumer and to find out the risk of Parkinson disease (PD).

Background: Environmental and oxidative stresses are risk factor for development of PD (Wird et al., 2011). FLU was significantly decreasing the expression of TGF‐B1 gene (Zhou 2014). It damage brain cell (Samanta, 2016). FLU causes the DNA damage (Tiwari 2010).

Methods: The study conducted by the rich content of fluoride in the drinking water consumer area and we recruited the 50 fluoride exposure and spinal cord irregularity samples with the above 55 years of age and 50 non exposure samples was taken. We documented the PD symptoms like Tremor or shaking, slow movement, legs, CT scan and X‐rays. After with informed written consent form was obtained from participating subjects. Chromosome aberration (CA), Micronuclei and comet assay conducted by the standard method and Genomic DNA was extracted HiPurA Genomic DNA kit, Himedia, India. It was find out the gene polymorphisms. RNA was isolated using TRIZOL reagent method and TGF‐B1 gene expression level was analysed in the experimental and controls.

Results: Study peoples residing in areas with naturally fluoridated (>1.5 ppm) drinking water. Most of the peoples consuming fluoride water. High level of fluoride is disturbing the neuronal and renal system so the study was to conduct this area. than to documented the PD risk factors levels in fluoride exposures and the spinal card, fluoride deposit in teeth and poor oral health status, Tremor and shaking symptom was documented in the 25% of the experimental subjects and significantly elevated level of CA and DNA damages were documented in the higher age group and RAGE gene polymorphisms (SNP) showed significant differences between PD patients and controls. Gene expression level was different in experimental compared to controls.

Conclusions: PD can be accelerated through a genetic predisposition to the disease or exposure to an environmental risk factor (Farrer, 2006). Fluorine is the world 13th most abundant element. It is neurotoxin so drinking fluorinated water is caused by a number of neurological problems and nerve cell damages in the human body. Such neurological disorders lead to Parkinson's disease. The present study identified that the chance of suffering from spinal cord and PD risk. Further, need future studies should measure the pathophysiology of this phenomenon, as well as the impact of Fluoride level in water on the survival and functional ability of patients with PD. The people having the risk of brain damage, spinal cord and neurological disorders.

References: Wirde K, Adami HO, Cole P, Trichopoulos D, Mandel J. Epidemiology and etiology of Parkinson's disease: a review of the evidence. Eur J Epidemiol. 2011;26 Suppl 1:S1–S58.Farrer MJ. Genetics of Parkinson disease: paradigm shifts and future prospects. Nat Rev Genet. 2006;7:306–318.Zhou, Guangying Luo,a Chong Wang,a Ruiyan Niu,a Jundong Wanga,* Shanxi, PR China. effects of fluoride on expression of cytokines in the hippocampus of adult rats. Research report Fluoride 47 (3)191–198.Debangshu Samanta, Youngrok Park, Shaida A. Andrabi, Laura M. Shelton, Daniele M. Gilkes, and Gregg L. Semenza, PHGDH Expression Is Required for Mitochondrial Redox Homeostasis, Breast Cancer Stem Cell Maintenance, and Lung Metastasis, Res; 76 (15) August 1, 2016.

121

Cytogenetic, gene mutation (alpha‐synuclein (SNCA) and parkin (PRKN) gene) and gene expression analysis of chewing tobacco exposures and the risk of Parkinson's disease

Ramachandran Chandirasekar, Eswaran Anitha, Venkatachalam Uthayakumar, C. Vasugi, Sithagounder Megala, Rajan Mathivanan, Matheswaran Ragadevi, Kalimuthu Loganathan, S Aanand Kumar (Erode, India)

Objective: We aimed to find out the cytogenetic and molecular examination of the risk of Parkinson's disease (PD) in chewing tobacco exposure through the chromosomal aberration (CA) gene mutation and gene expression (SNCA and PRKN genes) studies.

Background: Cigarette smoking and chewing tobacco uses are associated with a risk of PD (Li et al., 2015). Genetic and environmental factor are link to PD (Wirdefeldt et al., 2011). PD includes mitochondrial dysfunction and oxidative stress (Zuo et al., 2013).

Methods: This was a cross sectional study conducted a total number of 200 chewing tobacco exposures and 200 controls. The study was approved by the Medical Review Committe; informed written consent form was obtained from them. A demographic data was collected information regarding the duration of tobacco use, oral health, type of tobacco use, Tremor, Stiffness, Slowness and Impaired balance. CA assay was done in lymphocyte culture method and Genomic DNA was extracted from lymphocytes using gene mutation and gene polymorphic variants analysis using PCR‐RFLP technique. RNA was extracted by the TRIZOL method and analysis of gene expression (alpha‐synuclein (SNCA) and parkin (PRKN), studies.

Results: Although demographic results were indicated that tobacco chewers having the risk PD. Among the Tremor, Stiffness, Slowness and Impaired balance was documented tobacco chewers compared controls. Chromosome aberrations such as gaps, breaks and dicentic were observed in tobacco chewers. And elevated levels of CA were found in the higher aged group with PD symptom samples when comparison with controls and mild chewers. SNP analysis there is no novel mutation was found in the mild chewers and controls. Gene expression profiling of SNCA and PRKN genes a significant alterations were identified in tobacco users with the PD risk samples.

Conclusions: In the present analysis mild associations were found in the tobacco chewer and PD. Poor oral health is associated with inflammation it can promote the risk of PD. it associated with poor oral health. Significance of gene‐environment interactions was reported. The SNCA gene is located on the long arm of chromosome 4 (4q21.3‐22). The first described point mutation of SNCA determining the manifestation of PD. Further, the study populations need to be taken to educate or create awareness about the effects of the tobacco usage. Determination in biological mechanism of disease condition is very useful to understand and manage the pathogenesis of PD. Furthermore, it may be exploiting in the development of new targeted drug analysis for PD.

References: Wirdefeldt K, Adami HO, Cole P, Trichopoulos D, Mandel J. Epidemiology and etiology of Parkinson's disease: a review of the evidence. Eur J Epidemiol. 2011;26 (Suppl 1):S1–58.Zuo L, Motherwell MS. The impact of reactive oxygen species and genetic mitochondrial mutations in Parkinson's disease. Gene. 2013;532:18–23.12. Li X, Li W, Liu G, Shen X, Tang Y. Association between cigarette smoking and Parkinson's disease: A meta‐analysis. Arch Gerontol Geriatr. 2015;61:510–516.

122

Association of BDNF rs6265 polymorphism with mental disorders in Parkinson's disease

Yunfei Long, Wen Su, Fei Xiao, Yanyan Jiang, Xin Xin Ma, Huijing Liu, Haibo Chen (Beijing, People's Republic of China)

Objective: We attempted to elucidate the relationship between the BDNF rs6265 and mental disorder in PD.

Background: The genetic risk of mental symptoms in Parkinson's disease (PD) has not been fully demonstrated. Brain‐derived neurotrophic factor (BDNF) may play an important role in emotional symptoms.

Methods: A total of 77 PD patients and 38 controls were recruited. United Parkinson's Disease Rating Scale (UPDRS), Brief Psychiatric Rating Scale (BPRS), the 24‐item Hamilton Rating Scale for Depression (HAMD‐24), Hamilton Anxiety Scale (HAMA) were collected. Samples were screened for BDNF rs6265 on the Sequenom MassArray system. Chi‐square test was used in allele and genotype analysis.

Results: 39% of PD patients suffered from depression, 31.2% anxiety and hallucination 14.3%. The BDNF rs6265 variants was not a risk factor for PD (allele, p=0.227; genotype, p=0.470). It was associated with mental disorder in PD patients (C allele, p=0.009, OR=2.357; CC/CT genotype, p=0.004, OR=5.543), and depression (C allele, p=0.029, OR=2.008; CC/CT genotype, p=0.020, OR=4.473) and anxiety (CC/CT genotype, p=0.006, OR=11.314). No significant differences happened in hallucination.

Conclusions: This study provides evidence for the association between rs6525 polymorphism and the mental disorders of PD comorbidities, including depression and anxiety, except hallucination.

Table 1.

Association analysis of allele and genotype in BDNF rs6265 using groups (PD and control, PD with and without mental disorder, depression, anxiety or hallucination) as response variable

Groups	Allele		p	0R (95% CI)	Genotype			p
	C	T			CC	CT	TT
PD	72	80	0.261	0.729 (0.419‐1.267)	15	42	19	0.470
Control	42	34			10	22	6
Mental disorder(s)	44	32	0.009	2.357 (1.229‐4.522)	10	24	4	0.012
No mental disorder	28	48			5	18	15
Depression	34	24	0.029	2.088 (1.073‐4.061)	8	18	3	0.053
No depression	38	56			7	24	16
Anxiety	27	19	0.065	1.926 (0.955‐3.887)	5	17	1	0.013 a
No anxiety	45	61			10	25	18
Hallucination	11	11	0.789	1.131 (0.458‐2.793)	1	9	1	0.200a
No hallucination	61	69			14	33	18

^a We used Fishers' Exact Test results, due to expected count < 5.

Table 2.

Association analysis of the genetic contrast (CC/CT vs. TT) in BDNF rs6265 using groups as response variable

Groups	Genotype		p	0R (95% CI)
	CC/CT	TT
PD	57	19	0.263	0.563 (0.204‐1.552)
Control	32	6
Mental disorder(s)	34	4	0.004	5.543 (1.631‐18.839)
No mental disorder	23	15
Depression	26	3	0.020	4.473 (1.173‐17.062)
No depression	31	16
Anxiety	22	1	0.006	11.314 (1.409‐90.845)
No anxiety	35	18
Hallucination	10	1	0.347	3.830 (0.457‐32.105)
No hallucination	47	18

123

PGC‐1a promoter methylation in peripheral blood leukocytes of patients with Parkinson's disease

Xiaodong Yang, Qin Xiao (Shanghai, People's Republic of China)

Objective: In our study, we aimed to explore the hypothesis that the PGC‐1a variants are associated with its promoter methylations level thus affecting the PGC‐1a mRNA expression. We performed a study of PGC‐1a risk‐SNP genotypes, methylation levels, and mRNA expression in blood from PD patients and healthy controls.

Background: PGC‐1a was implicated in the pathophysiology of PD. However, the mechanism of regulating PGC‐1a expression is still limited. We sought to determine whether epigenetic modification of the PGC‐1a gene could account for diminished expression.

Methods: A total of 90 Chinese PD patients and 81 age‐ and gender‐matched controls of Han ancestry were included in the study. PGC‐1a promoter DNA methylation patterns and Single nucleotide polymorphisms (SNPs) of the PGC‐1a were assessed using high‐throughput mass spectrometry on a matrix‐assisted laser desorption/ionization time‐of‐flight mass array. PGC‐1a mRNA expression levels were detected in leukocytes.

Results: The mean DNA methylation level of PGC‐1a intron‐1 in PD patients was higher compared to controls (7.18±1.74 vs 6.36±1.28, p=0.007). As the results in our previous study, we also found the PGC‐1a mRNA level was significantly decreased in PD patients (2.85±3.30 vs 0.99±1.61, p=0.000) . We found a significant negative correlation between the mean DNA methylation level of PGC‐1a and PGC‐1a mRNA levels (r=‐0.448, p=0.000). We found no correlations between methylation level and clinical features including age of disease onset, disease duration, H‐Y stage, UPDRS III scores, HAMA, HAMD, MMSE, MoCA scores and LED. PGC‐1a mean methylation levels did not differ between different PGC‐1a rs2970870, rs2970848 and rs6821591 genotypes.

Conclusions: Taken together, our results revealed hypermethylation of PGC‐1a in peripheral blood leukocytes of PD patients and confirmed the effect ofDNA methylation of PGC‐1a on its mRNA expression. These findings may contribute to better understanding of the mechanisms underlying the associations between methylation and PD.

124

Gender differences in prevalence of LRRK2 associated Parkinson disease:A meta‐analysis

Chen Weitao, Xiaoguang Luo (Shenyang, People's Republic of China)

Objective: To examine the hypothesis of a sex effect in prevalence of Parkinson patients who carried LRRK2 mutation.

Background: Gender effect in prevalence of leucine‐rich repeat kinase 2 (LRRK2) associated Parkinson disease (PD) had been reported. While some studies observed a female preponderance in LRRK2‐PD, others failed to make such conclusion.

Methods: PubMed and EMBASE databases were searched for English articles published before 2018. All case‐control studies with separated data of sex and mutation status were included in further analyses of female to male relative risk (RR) and 95% confidence intervals (CI) using fixed effect model. The heterogeneity, publication bias and sensitivity analyses were also performed.

Results: Sixty‐four studies with 32452 patients diagnosed with PD were included. A higher prevalence of female patients with LRRK2‐related PD was shown by a pooled RR of 1.22 ( 95% CI 1.14–1.30, P<0.0001). Further analysis was performed in segregation of specific point mutation including p.G2019S and p.G2385R, higher prevalence of female patients was seen in p.G2019S mutation with a pool RR of 1.32 (95% CI 1.23–1.43, P<0.0001), but not in p.G2385R (RR=1.03, 95% CI 0.91–1.17, P=0.651). No significant heterogeneity and publication bias were observed in all analyses.

Conclusions: Higher female prevalence of LRRK2 mutation suggests roles of gender‐related risk factors in PD patients, especially who carried p.G2019S mutation. Contrary to idiopathic PD, no sex difference was observed in prevalence of patients carried p.G2385R mutation.

125

Variants in SNCA Gene are associated with Parkinson's disease risk and Progression in China: A 3.5‐years follow‐up study

Peng Li, Weiguo Liu (Nanjing, People's Republic of China)

Objective: To evaluate the association of different variants in SNCA gene with disease risk and progression in patients with PD in China.

Background: Parkinson's disease (PD) is a progressive neurodegenerative disorder recognized in terms of prominent motor impairments and numerous non‐motor symptoms (NMS). Before the onset of the classical motor symptoms, prodromal non‐motor features are frequently present in PD including impaired olfaction, constipation, depression, excessive daytime sleepiness, and rapid eye movement sleep behaviour disorder (RBD). It's generally accepted that alpha‐synuclein encoded by SNCA plays a key role in the pathogenesis of PD. Here we for the first time examined the association of SNCA variants with progression of motor and non‐motor symptoms, as measured by the Movement Disorder Society–sponsored version of the UPDRS III (MDS‐UPDRS III), and NMSQuest, in a single center longitudinal cohort of patients with PD in China.

Methods: 171 Chinese patients with PD and 197 controls were included in this study. 136 patients were assessed motor and non‐motor symptom at baseline and follow‐up visit (3.4± 1.0 years) using UPDRS‐III, H&Y stage and NMSQuest. To evaluate the association between SNCA genotype and motor progression while accounting for the effects of DRT, we performed a 2‐stage, adjusted‐outcome linear regression using R software (version 3.2.3) with the lme4 package as described previously. We used an multinomial logistic regression model to analyze the associations between SNCA polymorphism and non‐motor progression subgroups (worsening, stability, and improvement), adjusted for sex, age, disease duration, age of onset, LEDD, UPDRS at baseline.

Results: Results showed that the T‐rs6532194, G‐rs3857059 and T‐rs11931074 alleles were associated with increased risk of PD, after correcting, these associations also appeared. After correcting, SNCA genotype had no correlation with motor progression. However, SNCA rs3857059 and rs11931074 were associated with PD drooling progression (OR=0.38, 95% CI=0.16‐0.91, p=0.031, OR=0.38, 95% CI=0.16‐0.92, p=0.031).

Conclusions: This finding added substantially to our understanding that common genetic variants regulate specific PD phenotypes, with SNCA variants associating with disease risk, drooling progression while no association with motor progression. Abnormally phosphorylated a‐synuclein encoded by SNCA variants could become a potential Saliva‐based biomarker for early diagnosis, monitoring disease progression and target for therapeutic intervention. Further deep studies will be needed to characterize the mechanism of SNCA gene variants in prodromal drooling progression for candidate disease‐modifing therapeutic strategies for PD.

References: (1) M.Y. Davis, Association of GBA mutations and the E326K polymorphism with motor and cognitive progression in Parkinson disease, JAMA Neurol. 73 (2016) 1217–1224. (2) M. Moccia, Presence and progression of non‐motor symptoms in relation to uric acid in de novo Parkinson's disease, Eur. J. Neurol. 22 (2015) 93–98. doi:10.1111/ene.12533.

Table 1.

Genotypic and allelic frequencies of single nucleotide polymorphisms (SNPs) in alpha‐synueJein gene (SNCA) gene in PD cases (n=151) and controls (n =194).

Genotype	PD n(%)	Control n(%)	Unadjusted analysis OR (95% CI)	P value	Adjusted analysis OR (95% CI)	P value
rs6532194
CC	20(12)	43(22)	1.00 (reference)
CT	S1(4S)	101(52)	1.72(0.94‐3.16)	0.078	1.76(0.96‐3.24)	0.06S
T/T	69(40)	51(26)	2.91(1.53‐5.53)	0.001	2.88(1.51‐5.50)	0.001
C allele	121(39.3)	187(60.7)
T allele	219(51.9)	203(48.1)	1.67(1.24‐2.25)	0.001
rs356219
A/A	32(21)	46(23)	1.00 (reference)
AG	74(4S)	103(53)	0.70(0.43‐1.16)	0.169	0.71(0.43‐1.18)	0.191
GG	48(31)	47(24)	0.70(0.38‐1.28)	0.250	0.72(0.39‐1.33)	0.300
A allele	138(41.4)	195(58.6)
G allele	170(46.3)	197(53.7)	1.22(0.90‐1.65)	0.190
rs3S57059
A/A	26(15)	45(23)	1.00 (reference)
AG	81(47)	100(51)	1.40(0.80‐2.47)	0.241	1.38(0.78‐2.43)	0.269
GG	64(38)	50(26)	2.21(1.21‐4.07)	0.010	2.17(1.18‐4.00)	0.013
A allele	133(41.2)	190(58.8)
G allele	209(51.1)	200(48.9)	1.49(1.11‐2.00)	0.008
rs11931074
GG	26(15)	45(23)	1.00 (reference)
GT	80(47)	101(52)	1.37(0.78‐2.41)	0.274	1.34(0.76‐2.37)	0.313
T/T	«4(38)	4S(25)	2.31(1.25‐4.25)	0.007	2.26(1.22‐4.18)	0.009
G allele	132(40.9)	191(59.1)
T allele	208(51.4)	197(48.6)	1.53(1.14‐2.05)	0.005

PD, Parkinson's disease; OR, odds ratio; CL, confidence interval; p, significance level.

Significant p‐values are indicated in bold.

p value is calculated from binary logistic regression model, adjusted for age and gender.

Table 2.

Association of SNCA Variants With Motor Progression

		Measure, β Coefficient (95%CI)
SNCA	Genotype	Total MDS‐UPRDS III Scorea	P Value	PIGD Scoreab	P Value	Tremor Score ac	P Value
rs6532194	CC/CT+TT	0.00B(‐2.324 to 2.308)	0.994	1.69K‐4.961 to 1.580)	0.304	1.007(‐3.249 to 1.234)	0.371
	TT/CT+CC	0.485(‐2.036 to 1.065)	0.533	1.501 (‐0.712 to 3.714)	0.179	0.341(‐1 167 to 1.850)	0.652
rs3S57Q59	AA/AG+GG	1.139(43.835 to 3.113)	0.252	0.952C‐3.S12 to 1.909)	0.507	1.225(‐3.1S7 to 0.736)	0.216
	GG/AG+AA	1.018(‐2.620 to 0.584)	0.20S	0.761 (‐3.068 to 1.547)	0.511	0.658 (‐2.231 to 0.915)	0.405
rs11931074	GG/GT+TT	1.057(43.875 to 2.990)	0.277	1.227(‐3.914 to 1.460)	0.364	1.261(‐3.241 to 0.718)	0.207
	TT.GT+GG	1143(2704 to 0.419)	0.148	1.060(‐3.229 to 1.110)	0331	0.704(‐2.296 to 0.889)	0.379

Abbreviations: MDS‐UPDRS IE. Movement Disorder Society‐sponsored version of the Unified Parkinson's Disease Rating Scale Part III: PIGD, postural instability‐ and gait difficulty; UPDRS III. Unified Parkinson's Disease Rating Scale Part III.

^aBased on levodopa equivalent dose‐adjusted scores.

^bCalculated from the sum of items 3.10 and 3.12 of the MDS‐UPDRS III or items 3.29 and 3.30 of the UPDRS III.

^cCalculated from the sum of items 3.16 and 3.17 of the MDS‐UPDRS III or items 3.20 and 3.21 of the UPDRS III.

Table 3.

Progression of non motor symptoms for baseline and the follow‐up and the relationship with the polymorphisms of SNCA gene.

	Baseline n (%)	Follow‐up n (%)		rs6532194		rs3857059		rs11931074
			P	TT/CT+CC	CC/CT+TT	GG/AG+AA	AA/AG+GG	TT/GT+GG	GG/GT+TT
Dribbling	48 (28.6)	72 (47.1)	0.001	0.865	0.252	0.701	0.037	0.700	0.039
Taste/smelling	52 (31.0)	54 (32.1)	0.476
Swallowing	40 (23.8)	55 (32.7)	0.020	0.382	0.263	0.696	0.074	0.670	0.050
Vomiting	21 (12.5)	20 (11.9)	1.000
Constipation	89 (53.0)	116 (82.4)	<0.001	0.828	0.950	0.463	0.810	0.434	0.821
Bowel incontinence	4 (2.4)	10 (6.5)	0.099
Bowelemptying incomplete	51 (30.4)	51 (33.3)	0.631
Urgency	86 (51.2)	83 (54.2)	0.827
Nocturia	65 (38.7)	73 (47.7)	0.115
Pains	55 (32.7)	71 (46.4)	0.016	0.117	0.824	0.308	0.844	0.252	0.881
Weight	41 (24.4)	28 (18.3)	0.221
Remembering	119 (70.8)	117 (76.5)	0.258
Loss of interest	71 (42.3)	78 (51.0)	0.145
Hallucinations	17 (10.1)	43 (28.1)	<0.001	0.433	0.581	0.126	0.900	0.137	0.900
Concentrating	88 (52.4)	74 (48.4)	0.503
Sad, blues	74 (44.0)	82 (53.6)	0.094
Anxiety	67 (39.9)	65 (42.5)	0.651
Sex drive	62 (36.9)	34 (22.2)	0.005	0.348	0.801	0.470	0.858	0.495	0.859
Sex difficulty	56 (33.3)	40 (26.1)	0.180
Dizzy	66 (39.3)	69 (45.1)	0.310
Falling	22 (13.1)	35 (22.9)	0.028	0.296	0.521	0.283	0.484	0.289	0.486
Daytime sleepiness	50 (29.8)	39 (25.5)	0.454
Insomnia	72 (42.9)	83 (54.2)	0.045	0.884	0.815	0.827	0.401	0.876	0.377
Intense vivid dreams	72 (42.9)	99 (64.7)	<0.001	0.992	0.876	0.425	0.900	0.400	0.869
Acting out duringdreams	56 (33.3)	83 (54.2)	<0.001	0.913	0.054	0.806	0.577	0.801	0.593
Restless legs	73 (43.5)	83 (54.2)	0.058
Swelling	41 (24.4)	43 (28.1)	0.525
Sweating	68 (40.5)	76 (56.2)	0.116
Diplopia	34 (20.2)	52 (34.0)	0.006	0.892	0.216	0.808	0.062	0.824	0.067
Delusions	6 (3.6)	15 (9.8)	0.040	0.195	0.549	0.240	0.810	0.240	0.800

Bold represents the significance level was set at p≤ 0.05.

p value is calculated from Chi‐square test.

126

Association between HNMT C314T polymorphisms and the risk of Parkinson's disease: a Meta‐analysis

Ying Wang, Anmu Xie (Qingdao, People's Republic of China)

Objective: There were numerous case‐control studies centered on the association between histamine N‐methyltransferase (HNMT) C314T polymorphisms and the risk of Parkinson's disease (PD), however the results of those studies were inconsistent. As a result, we performed the meta‐analysis to assess the association of HNMT C314T polymorphisms with the risk of PD.

Background: The preonunced etiology of PD is not clear, but it's well known that genetic factors along with environmental elements lead to PD. The disequilibrium of histamine decarboxylase (HDC) and histamine N‐methyltransferase (HNMT) would lead to abnormalities of histamine system, which have been reported in PD. Mutations in HNMT gene may change the activity of the enzyme and further cause metabolic disturbance of histamine.

Methods: We proceeded a systemic online search on Pubmed, Science Direct and EMBASE databases up to 20 June 2018 to identify available articles. A total of 5 papers containing 2994 healthy persons and 3345 PD cases were included in the article according to the strict criteria. STATA 12.0 statistics was the software to calculate available data from each study.

Results: Significant association was detected between HNMT C314T polymorphisms and PD (T vs C OR=0.692, 95%CI 0.544~0.882, P=0.003; TT vs CC OR=0.572, 95%CI 0.336~0.975, P=0.040; TC vs CC OR=0.698, 95%CI 0.541~0.902, P=0.006; TC+TT vs CC OR=0.684, 95%CI 0.529~0.885, P=0.004).

Conclusions: The data from our meta‐analysis suggested that the T allele, TT and TC genotype of HNMT C314T polymorphisms may be association with a decreased risk of PD.

127

Genetic association of GAK rs1564282 polymorphism and Parkinson's disease susceptibility in Asian populations: a meta‐analysis

Xue Zhang, Xie Anmu (Qingdao, People's Republic of China)

Objective: In this meta‐analysis, we aim to evaluate the possible association between the polymorphism of the Cyclin G‐associated kinase (GAK) rs1564282 (C/T) and PD in Asian populations.

Background: Numerous published case‐control studies have investigated a role of GAK gene in susceptibility to Parkinson's disease (PD), but results from genetic association studies to date are inconsistent.

Methods: We searched the PubMed, Web of Science, EMBASE, CNKI, Weipu database, and Wanfang database up to August 2018 for related studies. A total of 5 studies with 3041 PD cases and 2810 controls were included in the meta‐analysis based on the strict inclusion and exclusion criteria. STATA 12.0 statistics software was used to calculate available data from each study. The pooled odds ratios (OR) and 95% confidence interval (CI) were calculated to assess the genetic association between GAK rs1564282 polymorphism and the risk of PD.

Results: GAK rs1564282 variants were increased risk of PD when all studies were pooled (T vs. C:OR = 1.270, 95%CI: 1.133‐1.425, P = 0.000;TTvs.CC:OR = 3.304, 95%CI: 1.882‐5.800, P = 0.000; TC vs. CC:OR = 1.179, 95%CI: 1.038‐1.339, P = 0.011;TT+ TC vs. CC:OR = 1.238, 95%CI:1.093–1.403, P = 0.001; TTvs.TC + CC:OR = 3.184, 95%CI:1.814–5.590,P = 0.000). But the subgroup analysis stratified by ethnicity showed GAK rs1564282 was associated with increased risk in the allele mode (Tvs.C:OR = 1.294, 95%CI: 1.145‐1.463, P = 0.000) and dominant model (TT+ TCvs.CC:OR = 1.266, 95%CI:1.107–1.447, P = 0.001) in Chinese, but not in non‐Chinese Asian races.

Conclusions: The data of our meta‐analysis indicates that the T allele, TT and TC genotype of rs1564282 (C/T) polymorphism may increase the risk of PD.

References: 1. P.A. Kempster, B. Hurwitz, A.J. Lees, A new look at James Parkinson's Essay on the Shaking Palsy, Neurology 69 (2007) 482‐485.2. K. Steece‐Collier, E. Maries, Kordower JH, Etiology of Parkinson's disease: genetics and environment revisited, Proc. Natl. Acad. Sci. U. S. A 99 (2002) 13972–13974.3. J. Gao. M.A. Nalls, M. Shi, et al, An exploratory analysis on gene‐environment interactions for Parkinson disease, Neurobiol Aging 33 (2012) 2528e2521–2526.

Table 1.

 

Table 2.

Meta‐analysis of the association between the rsl564282 gene polymorphism and PD

Model	Fix‐Effect model			Heterogeneity	Begg's test
	OR	95%CI	P	I2	z	p
Overall
T vs C	1.270	1.133‐1.425	0.000	0.144	0.19	0.851
TT vs CC	3.304	1.882‐5.800	0.000	0.000	1.32	0.188
TC vs CC	1.179	1.038‐1.339	0.011	0.000	‐0.56	0.573
TT+TC vs CC	1.238	1.093‐1.403	0.001	0.000	‐0.19	0.851
TT vs TC+CC	3.184	1.814‐5.590	0.000	0.000	1.32	0.188
Chinese
T vs C	1.294	1.145‐1.463	0.000	0.224	‐	‐
TT vs CC	3.186	1.777‐5.713	0.000	0.000	‐	‐
TC vs CC	1.205	1.015‐1.382	0.008	0.000	‐	‐
TT+TC vs CC	1.266	1.107‐1.447	0.001	0.039	‐	‐
TT vs TC + CC	3.062	1.708‐5.491	0.000	0.000	‐	‐
Non‐chinese
T vs C	1.117	0.809‐1.542	0.500		‐	‐
TT vs CC	5.082	0.590‐43.749	0.139		‐	‐
TC vs CC	1.016	0.714‐1.447	0.928		‐	‐
TT+TC vs CC	1.068	0.755‐1.513	0.709		‐	‐
TT vs TC+CC	5.065	0.589‐43.557	0.139		‐	‐

128

Combined Klinefelter syndrome and hereditary early‐onset Parkinson's disease: A case report

Wenfei Yu, Yuxi He, Yiming Liu (Jinan, People's Republic of China)

Objective: To explore the clinical and genetic features in a case of combined Klinefelter syndrome and hereditary early‐onset Parkinson's disease.

Background: Klinefelter syndrome (KS) is a common sex chromosome aneuploidy in man most often characterized as 47, XXY karyotype. Infertility, hypergonadotropic hypogonadism and small firm testicles are the typical features included in KS.KS‐associated tremor can also be present in 63.4% KS patients. However, the tremor in KS is usually considered as essential tremor (ET) like tremor rather than typical rest tremor in Parkinson's disease (PD). Even if there are two reports of KS with PD, the results screening for pathological mutations in PD associated genes are negative.

Methods: We firstly report a KS patient with PD and specific pathogenic mutation in PRKN gene. Brain magnetic resonance imaging (MRI) and magnetic sensitive weighted imaging (SWI) were conducted. The next‐generation sequencing and chromosomal analysis were also performed.

Results: Neurological examination showed rest tremor in the right lower extremity and rigidity of the extremities especially the right upper limb. Frozen gait could been seen during walking. Based on the manifestations and examination, diagnosis of clinically established PD was established. Then a chromosomal analysis revealed the diagnosis of KS with a 47, XXY karyotype. Besides, genetic analysis for pathological mutations in major PD associated genes (SNCA, LRRK2, PRKN, PINK1, GBA, DJ‐1, ATP13A2, VPS35) was performed showing there were 2 single base exchanges at PRKN gene associated with autosomal recessive PD.

Conclusions: The patient who was ever diagnosed as Klinefelter syndrome, can also presented as parkinsonism. Among them, the diagnosis of Parkinson's disease might be ignored. In this way, the conducting of next generation sequencing could be helpful.

References: 1. Bonomi M, Rochira V, Pasquali D, et al. Klinefelter syndrome (KS): genetics, clinical phenotype and hypogonadism. J Endocrinol Invest 2017;40:123‐134.2. Harlow TL, Gonzalez‐Alegre P. High prevalence of reported tremor in Klinefelter syndrome. Parkinsonism Relat Disord 2009;15:393‐395.3. Koegl‐Wallner M, Katschnig‐Winter P, Pendl T, et al. Tremor associated with Klinefelter syndrome—a case series and review of the literature. Parkinsonism Relat Disord 2014;20:323‐327.4.

Bach JP, Sommer N, Moller JC, Oertel WH, Dodel R, Gasser T. Parkinson's syndrome in a young patient with Klinefelter's syndrome—a case report. Mov Disord 2008;23:771‐772.5. Fabbri M, Zibetti M, Martone T, Lopiano L. Expanding the spectrum of movement disorders in Klinefelter syndrome. Neurol Sci 2018;39:1303‐1304.

129

Haplotype analysis on the relationship of the DNAJC6 gene with early‐onset Parkinson's disease risk in a Chinese population

Ting Shen (Hangzhou, People's Republic of China)

Objective: The aim of this study is to examine whether or not genetic variations in DNAJC6 gene are also associated with idiopathic early‐onset Parkinson's disease (EOPD) in the Chinese population.

Background: DNAJC6 gene is one of the Parkinson's disease (PD) related genes, but relationship between DNAJC6 polymorphisms and PD remains unclear.

Methods: Exons and intron/exon boundaries of DNAJC6 gene was amplified by polymerase chain reaction (PCR) and then directly sequenced in 135 EOPD patients and 212 healthy controls. Single nucleotide polymorphisms (SNP)‐based and haplotype‐based association study between EOPD and DNAJC6 gene was conducted. SNP‐SNP interactions were investigated using the generalized multifactor dimensionality reduction (GMDR) method among detected SNPs of DNAJC6 gene. We further evaluated the effect of variants on gene function and expression using online in silico algorithms and databases.

Results: We detected fourteen SNPs (Fig.1) in the DNAJC6 gene, all were in the Hardy–Weinberg equilibrium in the healthy control group, while five SNPs, rs432517, rs11208644, rs12077111, rs4582839 and rs4592284 did not fit with Hardy‐Weinberg equilibrium in EOPD group. The frequencies of variant alleles in rs11208644, rs4582839 and rs4915691 were observed significantly higher in EOPD group compared to healthy controls, while the frequency of variant allele in rs6588144 was significantly lower in EOPD group. Additionally, haplotype analysis indicated that the CTCACTCGGC, CTTACTCGGC and TTTGTTCGAC haplotypes were associated with higher EOPD risk in EOPD patients compared to healthy controls (Table 1). SNP‐SNP interaction analysis showed that rs12077111‐rs4592284 SNP combination was the best model with higher EOPD risk (Table 2). Based on the results of the in silico analysis, we found that these SNPs were predicted to be no harm to the protein function, but most of them might lead to possible changes in splice site and alter the expression level of DNAJC6 in several region.

Conclusions: Our study indicated that EOPD was associated with several SNPs and haplotypes of DNAJC6 gene.

References: [1] Tian YY, Tang CJ, Wu J, Zhou JS (2011) Parkinson's disease in China. Neurol Sci 32, 23‐30. [2] Koroglu C, Baysal L, Cetinkaya M, Karasoy H, Tolun A (2013) DNAJC6 is responsible for juvenile parkinsonism with phenotypic variability. Parkinsonism & Related Disorders 19, 320‐324. [3] Olgiati S, Quadri M, Fang M, Rood JP, Saute JA, Chien HF, Bouwkamp CG, Graafland J, Minneboo M, Breedveld GJ, Zhang J, International Parkinsonism Genetics N, Verheijen FW, Boon AJ, Kievit AJ, Jardim LB, Mandemakers W, Barbosa ER, Rieder CR, Leenders KL, Wang J, Bonifati V (2016) DNAJC6 Mutations Associated With Early‐Onset Parkinson's Disease. Ann Neurol 79, 244‐256. [4] Foo JN, Liany H, Tan LC, Au WL, Prakash KM, Liu J, Tan EK (2014) DNAJ mutations are rare in Chinese Parkinson's disease patients and controls. Neurobiol Aging 35, 935 e931‐932. [5] Shi CH, Li F, Yang J, Zhang SY, Mao CY, Wang H, Shi MM, Liu YT, Song B, Xu YM (2016) DNAJC6 mutations are not common causes of early onset Parkinson's disease in Chinese Han population. Neuroscience Letters 634, 60‐62. [6] Barrett JC, Fry B, Maller J, Daly MJ (2005) Haploview: analysis and visualization of LD and haplotype maps. Bioinformatics 21, 263‐265. [7] Lou XY, Chen GB, Yan L, Ma JZ, Zhu J, Elston RC, Li MD (2007) A generalized combinatorial approach for detecting gene‐by‐gene and gene‐by‐environment interactions with application to nicotine dependence. Am J Hum Genet 80, 1125‐1137.

Table 1.

Distribution of Haplotypes in EOPD patients and controls.

Haplotype	EOPD (freq)	Control (freq)	Chi Square	p‐value
TTTGTCCGAC	0.499	0.544	1.203	0.2727
CTCACTCGGC	0.052	0.170	18.956	0.000013*
CCTGCTACGT	0.068	0.100	1.811	0.1784
CCTGCTACGC	0.042	0.050	0.245	0.6209
TCTGCTACGT	0.027	0.025	0.011	0.9159
CTTACTCGGC	0.065	0.000	27.731	0.00000014*
CTTGTTAGAC	0.026	0.010	2.532	0.1116
CTTGTCCGAC	0.014	0.015	0.019	0.8896
TTTGTCCGGC	0.017	0.008	1.154	0.2826
TTCACCAGGC	0.013	0.010	0.142	0.7066
TTCGCTCGAC	0.000	0.017	3.969	0.0463
TTTGTTCGAC	0.029	0.000	12.234	0.0005*

Abbreviations: freq, frequency; p‐value≤0.05 considered as statistically significant (in bold). * means the p‐values still maintained their significant after Bonferroni correction (0.05/12=0.0042).

Table 2.

GMDR analysis on the best SNP‐SNP interaction models.

No. of Loci	Best combination	Cross‐validation consistency	Testing accuracy	p‐value
2	rs12077111 rs4592284	7/10	0.6451	0.0010
3	rs6588144 rs4582839 rs4915691	5/10	0.6494	0.0010
4	rs6588144 rs11208644 rs4582839 rs4915691	4/10	0.651	0.0010
5	rs10889546 rs6588144 rs432517 rs12077111 rs4592284	5/10	0.6776	0.0010

Figure 1.

 

130

LAG3 is associated with Parkinson disease in Chinese people.

Wenyuan Guo, Pingyi Xu, Xiang Chen (Guangzhou, People's Republic of China)

Objective: The present study is aimed to investigate LAG3 possible roles in the chinese PD patients.

Background: Accumulating evidence suggests that deletion of lag3 can limits a‐syn spread and alleviates a‐syn induced biochemical and behavioral deficits . However, there is little known about association between LAG3 and PD.

Methods: We enrolled 637 PD patients and 535controls in a case‐control study. All participants were genotyped by using a Mass ARRAY System or a TaqMan assay. Serum IGF1 levels of 57 PD patients, and 20controls were also measured by the Meso Scale Discovery (MSD) electrochemiluminescent (ECL) immunoassay.

Results: Distributions of rs19922452‐AA (p<0.000), rs951818‐AA (p<0.001) genotype frequencies were found higher in female patients than controls. Within PD patients, the sLAG3 levels were declined in CSF compared with controls.

Conclusions: This study suggest that LAG3 SNPS is associated with PD in chinese people. Moreover, sLAG3 may be a potential diagnostic biomarker for PD in the Han Chinese population.

References: 1.Trinh J, Farrer M. Advances in the genetics of Parkinson disease. Nat Rev Neurol. 2013;9:445‐454.2.V. M. Lee, J. Q. Trojanowski, Mechanisms of Parkinson's disease linked to pathological alpha‐synuclein: New targets fordrug discovery. Neuron 52, 33–38 (2006).3. Warner TT and Schapira AH: Genetic and environmental factors in the cause of Parkinson's disease. Ann Neurol 53 Suppl 3: S1 6‐23,discussion S23‐1 5, 2003. 4. Triebel, F. et al. LAG3, a novel lymphocyte activation gene closely related to CD4. J. Exp. Med. 171, 1393–1405 (1990).5.Mao X, Ou MT, Karuppagounder SS, et al. Pathological a‐synuclein transmission initiated by binding lymphocyte‐activation gene 3[J]. Science (New York, N.Y.), 2016, 353 (6307):aah3374‐aah3374.6.Huard, B., Tournier, M., Hercend, T., Triebel, F. &Faure, F. Lymphocyte‐activation gene 3/major histocompatibility complex class II interaction modulates the antigenic response of CD4+ T lymphocytes. Eur. J. Immunol. 24, 3216–3221 (1994).7.Workman, C. J. et al. Lymphocyte activation gene‐3 (CD223) regulates the size of the expanding T cell population following antigen activation in vivo. J. Immunol. 172, 5450–5455 (2004).8. Huang, C. T. et al. Role of LAG3 in regulatory T cells. Immunity 21, 503–513 (2004).9.Chen Y, Qi B, Xu W, et al. Clinical correlation of peripheral CD4+‐cell sub‐sets, their imbalance and Parkinson's disease. [J]. Molecular Medicine Reports, 2015, 12 (4):6105.10. Brochard V, Combadiere B, Prigent A, Laouar Y, Perrin A, Beray‐Berthat V, Bonduelle O, Alvarez‐Fischer D, Callebert J, Launay JM, Duyckaerts C, Flavell RA, Hirsch EC, Hunot S. Infiltration of CD4+ lymphocytes into the brain contributes to neurodegeneration in a mouse model of Parkinson disease. J Clin Invest. 2009;119:182–192.11.Sulzer D, Alcalay R N, Garretti F, et al. Erratum: T cells from patients with Parkinson's disease recognize a‐synuclein peptides. [J]. Nature, 2017, 546 (7660):656. 12.Lundmark F, Harbo H F, Celius E G, et al. Association analysis of the LAG3 and CD4 genes in multiple sclerosis in two independent populations[J]. Journal of Neuroimmunology, 2006, 180 (1–2):193‐198.13.Z Zhang, K Duvefelt, F Svensson, et al. Two genes encoding immune‐regulatory molecules (LAG3 and IL7R) confer susceptibility to multiple sclerosis[J]. Genes and immunity, 2005, 6 (2):145.14. Lassmann H. Neuropathology in multiple sclerosis: new concepts. Multiple Sclerosis 1998; 4: 93–98.

131

Relationship between polymorphisms of 17 newly discovered loci and risk of Parkinson's disease in a Chinese population

Xiang Chen, Yousheng Xiao, Wenyuan Guo, Shuxuan Huang, Miaomiao Zhou, Pingyi Xu (Guangzhou, People's Republic of China)

Objective: The objective of our study was to investigate the association of 17 single nucleotide polymorphisms (SNPs) with the risk of PD in Chinese population.

Background: Genetic factors play significant roles in the causes of PD. Recently, a meta‐analysis of genome‐wide association study (GWAS) has identified 17 loci associated with Parkinson's Disease (PD).

Methods: We performed a case‐control association study and 1189 subjects comprised of 652 PD patients and 537 controls were genotyped by using a Mass ARRAY System or a TaqMan assay.

Results: The rs601999 (OR (95%CI)= 3.378 (2.273‐5.051), p<0.001,), rs11343 (OR (95%CI)=0.426 (0.210‐0.862), p=0.018), rs353116 (OR (95%CI) =0.738 (0.577‐0.943), p=0.015) and rs2280104 (OR (95%CI)= 1.371 (1.078‐1.743), p=0.010)were significantly associated with PD in Chinese population. Besides, the rs2694528 (OR (95%CI)= (0.019, 1.693 (1.085‐2.641),p=0.019) was identified with an increased risk of PD in dominant model in male subgroup.

Conclusions: we have confirmed that rs601999, rs11343, rs353116, rs2280104, and rs2694528 were associated with PD in Chinese population.

132

Association of mutations of SNCA with motor and non‐motor symptoms progression in Parkinson disease

Ningdi Luo (Shang Hai, People's Republic of China)

Objective: The aim of this study was to determine whether the Parkinson's disease (PD) risk single nucleotide polymorphisms (SNPs) of the Alpha‐synuclein (SNCA) can cumulate the progression of motor and non‐motor symptoms, including olfactory loss, cognitive decline and autonomic disorder in patients with PD.

Background: Carriers of mutations in the SNCA have a well‐known influence on PD susceptibility. But at present, few studies have investigated the influence of SNCA mutations on severity of symptom progression association with genetic factors of using prospective follow‐up.

Methods: We recruited 50 patients with a diagnosis of PD. Among them, all patients have been conducted a comprehensive clinical evaluation and six SNPs of SNCA (rs356165, rs3857053, rs1045722, rs894278, rs356186, rs356219) were also analyzed. The median follow‐up period was 2.6 years (30 months). We set the progression of motor symptoms related assessment as primary endpoints, including Hoehn & Yahr Scale (H&Y Scale), UPDRS II and UPDRS III. At the same time, non‐motor symptoms transform as secondary endpoints, including NMSQ, SCOPA, SS‐16 and MOCA. To assess associations between the SNCA variation and progression outcomes, we used Cox proportional hazards regression models to estimate hazard ratios (HRs) with 95% CI adjusted for age and sex, and Kaplan‐Meier plot and Log rank test to analyze disease risk.

Results: PD patients at the last visit presented with a higher H&Y stage, higher scores of UPDRS II‐III, LEDD and NMSQ (p=0.001) than baseline (Table 1). Kaplan‐Meier analysis indicated a longer Median PFS time to SS‐16 1‐point decrease with T dominant of rs894278 (p=0.024, Figure. b). Patients with A allele of rs356219 appeared longer PFS time to reach HY 0.5‐point increase (p=0.002, Figure. a) and MOCA 1‐point decrease (p=0.002, Figure. c).

Conclusions: Three susceptibility SNPs (rs356219 and rs894278) of SNCA for PD were associated with faster motor, olfactory loss and cognitive decline in patients. This indicate that these genetic markers are associated with disease progression.

References: Association of Polygenic Risk Score With Cognitive Decline and Motor Progression in Parkinson Disease. JAMA Neurol. 2018 Mar 1;75 (3):360‐366

Table 1.

Demographic and Clinical Features of PD Patients

	Baseline (n=50)	Follow up (n=50)	p value
Age, y	64.6±5.4		/
Sex, n (%)	/
Male	34 (68)		/
Femal	16 (32)		/
H‐Y Stage	1.5 (0.5)	2.0 (0.5)	<.001
UPDRS II	8.9±4.2	13.1±5.3	<.001
UPDRS III	16.6±10.1	26.1±12.1	<.001
LEDD (mg/day)	270.4±286.9	433.0±235.6	<.001
NMSQuest	8.6±4.2	10.6±4.7	0.001
SS‐16	8.2±3.3	7.3±3.4	0.022
RBDSQ	5.6±3.3	6.4±3.7	0.070
SCOPA‐AUT	13.0±8.7	15.4±8.7	0.056
MMSE	28.1±1.9	28.0±2.1	0.584
MoCA	25.3±3.3	24.7±4.2	0.194

133

Early‐onset Parkinson disease with cervical dystonia caused by exon 6 homozygous multiplication in PARK2 gene: a case report

Shanglin Li, Xinhua Wan (Beijing, People's Republic of China)

Objective: To report and follow up a case of early‐onset Parkinson disease (EOPD) with cervical dystonia caused by homozygous duplication in exon 6 PARK2 gene, together with heterozygous duplication of the same exon in affected father and unaffected mother in order to extend the understanding of EOPD patients.

Background: PARK2 mutation is one of the main cause of autosomal recessive early‐onset Parkinson disease. Many phenotypes and mutation loci have been described. Among Duplication of PARK2 exon 3, deletion of exon 2, and the joint deletion of exons 2 and 3 are relatively common. Duplication of exon 7 occurs less frequently. However, no duplication in exon 6 have been reported.

Methods: The proband is a 32 year‐old female presented with cervical dystonia, progressive bradykinesia in walking, drag‐to gait and rigidity of four limbs with diurnal fluctuation at 17. RBD was described at 10. Low doses dopa showed significant effect on all symptoms. In 2 years resting‐ tremor began to occur from left hand to right one, which is more obvious in left side. Slight foot dystonia also occurred. Vocal slowness with low voice and dysarthria began to appear, but swallowing and drinking liquids were not limited. Brain CT was normal. With progression of the disease, imbalance began to appear. The dose of Madopar and dopamine agonists were added. She responded to levodopa but wearing‐off phenomenon and dopa‐induced dyskinesias occurred gradually. Non‐motor symptoms such as depression, pain, constipation also appeared. GWAS testing showed homozygous duplication in PARK2 exon 6. Her parents were heterozygous for duplication of the same loci in PARK2 exon 6. Her 65‐year‐old father began to show cognitive decline, memory loss followed by festinating gait, bradykinesia, rigidity and resting‐tremor in recent 2 years. Her father also responded to dopa with no dyskinesia or wearing‐off phenomenon. Excessive daytime sleepiness, urinary incontinence were presented. However, her mother was unaffected till now.

Results: Duplication of exon 6 in PARK2 gene could be a cause of EOPD. In this case, clinical symptoms showed diurnal fluctuations and relatively unfrequent cervical dystonia initially, which may be tricking to make misdiagnosis of isolated dystonia or DRD. The heterozygous carrier for deletion in the same loci showed susceptibility to PD with a late onset.

Conclusions: EOPD can be caused by duplication of exon 6 in PARK2 and Park2 duplication heterozygous carrier might develop late‐onset PD.

References: 1. Kilarski LL, Person JP, Newswy V. et al. Systematic review and UK‐based study of PARK2 (parkin), PINK1, PARK7 (DJ‐1) and LRRK2 in early‐onset Parkinson's disease. Mov Disord. 2012 Oct;27 (12):1522‐9. 2. Huttenlocher J, Stefansson H, Steinberg S. et al. Heterozygote carriers for CNVs in PARK2 are at increased risk of Parkinson's disease. Hum Mol Genet. 2015 Oct 1;24 (19):5637‐3. 3. Khan NL, Scherfler C, Graham E. et al. Dopaminergic dysfunction in unrelated, asymptomatic carriers of a single parkin mutation. Neurology. 2005 Jan 11;64 (1):134‐6.

235

Association of various genetic polymorphisms with Parkinson's disease in Indian population

Tazeem Syed, Tasneem S.D., Rukmini Kandadai, Rupam Borgohain, Vijay Kutala, Santosh Kumar (Hyderabad, India)

Objective: To identify the prevalence, frequency and association of Dopaminergic receptor genes, Dopamine transporter genes and Brain‐Derived Neurotrophic Factor, eukaryotic translation initiation factor 4‐gamma, Vacuolar Protein Sorting‐Associated Protein 35 in Indian population.

Background: Various genetic polymorphisms seem to play role in pathogenesis of PD which includes Dopamine receptor and transporter genes rs393795, rs28363170, rs6280, rs12720373, 5HTT, BDNF, EIF4G1, VPS35. The prevalence of these polymorphisms is not well documented in Indian population.

Methods: A total of 168 PD patients attending Department of Neurology, NIMS, Hyd, and 151 age and ethnicity matched controls were included in the study after obtaining the consent. DNA isolated and genotyping was performed using RFLP method.

Results: The frequency of genotypic distribution of BDNF (Val66Met) polymorphism among the PD cases and controls were: C/C – 60.1 % and 67.5%, C/T – 28.6% and 26.4%, and T/T was 11.3 % and 5.9% respectively. The Allelic frequency distribution of C & T alleles in cases and controls were C‐ 74.4 % and 80.7%, T allele – 25.5% and 19.2% respectively. The Fishers exact test revealed that, there is a borderline significant difference between cases and controls (C/C versus C/T+T/T, OD 1.44, CI at 95% 0.95‐2.18, P value 0.058) and there is a significant difference existing when wild type allele C/C compared with the mutant allele T/T for cognitive impairment and inverse was noted with tremor predominance. The EIF4G1 and VPS35 were not associated with PD in Indian population. Whereas the dopamine receptor genes and the Dopamine transporter genes are showing association with Parkinson's disease.

Conclusions: Results from the current study indicate that EIF4G1 (R1205H) and VPS35 (D620N) polymorphisms are not associated with the PD risk in Indian population. BDNF (Val66Met) T/T variant associated with cognitive impairment, non tremor predominance and poor quality of life.

Parkinson's Disease: Neuroimaging and Neurophysiology

134

This abstract has been withdrawn.

135

Uneven disruptive patterns in the striatum of young‐onset Parkinson's disease: a dual‐tracer PET imaging study.

Fengtao Liu, Jian Wang, Chuan‐Tao Zuo, Yu‐jie Yang, Jing‐Jie Ge (Shanghai, People's Republic of China)

Objective: Parkinson's disease (PD) is a highly heterogeneous clinical entity. The patients of young‐onset PD (YOPD) show some characteristic manifestations to late‐onset PD (LOPD). The current study aimed to investigate the cerebral metabolic characteristics in YOPD with positron emission tomography (PET) imaging.

Background: Parkinson's disease (PD) is a highly heterogeneous neurodegenerative disorder with variable clinical features. This heterogeneity has prompted numerous classifications to delineate PD subtypes. Although none of the proposed subtype is robust enough to warrant formal delineation, some suggest that young‐onset and late‐onset classification are acceptable in clinical practice.

Methods: 103 subjects with both 11C‐CFT and 18F‐FDG cerebral PET imaging were investigated to compare 42 YOPD and 61 LOPD patients. The differences in cognitive functioning were examined in a subset of the subjects. In 11C‐CFT PET, regional dopaminergic deficiency in caudate and putamen was calculated. In 18F‐FDG PET, regional metabolic characteristics were extracted using statistical parametric mapping (SPM). Finally, the interactions of dopaminergic deficiency and metabolic values in YOPD were analyzed.

Results: The YOPD patients performed better in the cognitive tests than LOPD patients of similar disease duration. In 11C‐CFT imaging, the DAT binding in caudate was relatively spared in YOPD compared to the lesions in putamen. In 18F‐FDG PET, YOPD patients showed increased metabolism in basal ganglia relative to the healthy controls. When comparing with LOPD patients, the YOPD patients exhibited hypermetabolism in caudate and hypometabolism in putamen. Furthermore, the regional metabolic values in caudate correlated moderately with the dopaminergic binding deficiency in caudate.

Conclusions: YOPD exhibited uneven dopaminergic dysfunction in striatum, with caudate relatively spared compared to putamen. The glucose metabolism in YOPD was higher in caudate and lower in putamen than LOPD. The correlation between regional metabolism and dopaminergic binding in caudate supported the uneven striatal disruption in YOPD. The findings in this imaging study might offer new perspectives in understanding the characteristic manifestations in YOPD in light of better‐preserved cognition function.

136

EEG source analysis can distinguish differential effects of NeuroEPO in Parkinson disease

Min Zhang, Ivonne Pedroso, Lilia Morales Chacon, Peng Ren, Eduardo Gonzalez Moreira, Marjan Jahanshahi, Maria Bringas Vega (Chengdu, People's Republic of China)

Objective: The aim of our study was to assess the effect of erythropoietin (EPO) on the EEG in Parkinson's disease (PD).

Background: EPO has been shown to be a promising molecule in clinical trials for the treatment of neurological diseases (Sargin et al. 2010). Neuroprotection with intranasal Neuro‐EPO emerged as a therapy that plays a significant role in neural survival and functional recovery in Parkinson animal models.

Methods: The study was conducted at the CIREN, Cuba, Movement Disorders Clinics, with the cooperation of the Center for Molecular Immunology. Twenty five PD patients (Hoehn&Yahr stages I‐II), randomly received NeuroEPO or placebo for five weeks. The study was a physician proof of concept, with a double blind design, with two EEG evaluations: before intervention and 6 months after administration. The EEG was recorded from 19 electrodes using the 10‐20 system in eyes‐closed condition (2.56 sec) free‐artefact segments. Source analysis was calculated by BC‐Vareta developed by Gonzalez‐Moreira (2018). Statistical analysis was performed using 4 EEG bands (0‐20 Hz) for 74 structures from MNI atlas. We conducted ANOVAs with Group (EPO vs placebo) and Time (baseline vs 6 months) as the factors.

Results: The Group x Time interactions were significant in the (i) lower delta frequencies (1‐3Hz) in the angular gyrus (p=0.024), precuneus (p=0.002) and cuneus (p=0.004) of the left hemisphere (ii) theta band (4‐7 HZ) in the right Inferior frontal gyrus (IFG), opercular part (p=0.033) (iii) alpha band (8‐13 Hz) in the gyrus rectus (p=0.042) and left middle occipital cortex (p=0.041) (iv) beta band (14‐20 Hz) in the left inferior occipital gyrus (p=0.015). For most of these significant interactions in the delta, alpha and beta bands the placebo group showed increase in EEG amplitude from baseline to 6 months, whereas the NeuroEPO group showed no change. By contrast, for the right IFG, the NeuroEPO group showed increased EEG amplitude in the 4‐7 Hz theta range, whereas the placebo group showed decrease in EEG amplitude from baseline to 6 months assessment.

Conclusions: The main effect of EPO was on a source of the theta rhythm located at IFG opercular part, which includes the analogue of the speech motor area, albeit in the right hemisphere, which may reflect the effect of EPO on dysarthria and speech intelligibility in PD. In addition, the right IFG is considered to be involved in attention and is also part of the inhibition network of IFG‐pre‐SMA‐subthalamic nucleus (Aron et al; 2007) and the increased EEG amplitude in the theta band over this area may be associated with improved cognitive executive control (Cavanagh 2013) Tomographic EEG using source analysis is a useful tool and in conjunction with neuropsychological assessment in the same cohort may help identify the mechanisms of action of NeuroEPO in PD.

References: Eduardo Gonzalez‐Moreira, Deirel Paz‐Linares, Eduardo Martinez‐Montes, Pedro Valdes‐Hernandez, Jorge Bosch‐Bayard, Maria Luisa Bringas‐Vega, Pedro Valdes‐Sosa doi: https://doi.org/10.1101/346569. BIORXVIX Sargin, D., Friedrichs, H., El‐kordi, A., & Ehrenreich, H. (2010). Erythropoietin as neuroprotective and neuroregenerative treatment strategy: Comprehensive overview of 12 years of preclinical and clinical research. Best Practice & Research Clinical Anaesthesiology, 24 (4), 573–594. http://doi.org/10.1016/j.bpa.2010.10.005 Aron AR et al triangulating a cognitive control network using diffusion‐weighted magnetic resonance imaging (MRI) and functional MRI. J Neurosci, 27, 3743‐3752.Cavanagh JF, Frank MJ Frontal theta as a mechanism for cognitive control. Trends Cogn Sci. 2014 Aug; 18 (8): 414–421.

137

Quantifying iron deposition within the substantia nigra of Parkinson's disease by quantitative susceptibility mapping

Dongya Huang, Xiaoyan Zeng (Shanghai, People's Republic of China)

Objective: The aim of this study was to explore the inherent link of PD patients between their substantia nigra iron accumulation and clinical status using quantitative susceptibility mapping (QSM) which is now considered to be the only quantitative imaging technique of brain iron deposition.

Background: Iron deposition within the substantia nigra (SN) may play a vital role in Parkinson's disease (PD). However, owing to technological obstacles, we still don't know the interrelationship between brain iron content and the progression of PD. Quantitative susceptibility mapping (QSM) is a novel post‐processing technique which has now been considered to be the only quantitative imaging technique of brain iron deposition.

Methods: 44 PD patients and 31 age‐ and gender‐matched healthy controls underwent quantitative susceptibility mapping (QSM) were recruited in this study. We firstly divided the patients into mild symptom severity (MSP) and advanced symptom severity (ASP) groups concerning their disease stage, aiming to illuminate the re‐ lationship between iron deposition in SN of PD and disease progression. Then, we classified the patients with Parkinson's disease into three subgroups: tremor‐dominant PD (TD), akinetic/rigidity‐dominant PD (AR), mixed‐PD (M) according to their dominant motor symptoms in order to investigate whether there are any effects of SN iron accumulation to different subtypes of PD patients.

Results: Compared to healthy controls, patients with PD have increased QSM magnetic values in the substantia nigra (138.039 ± 37.320 vs 179.553 ± 65.715; P = 0.001). More prominent statistically significance of the difference of SN iron deposition between healthy controls (HC) and advanced symptom severity (ASP) subgroup was displayed (138.039 ± 37.320 vs 232.827 ± 92.040; P < 0.001). Besides, among the three clinical phenotypes both TD and AR subgroup showed significant difference compared with healthy controls concerning the QSM values (138.039 ± 37.320 vs 185.864 ± 99.851; P = 0.013; 188.148 ± 52.958 vs 138.039 ± 37.320; P = 0.001). Furthermore, the iron content in the SN of PD patients was significantly cor‐ related with the Hoehn‐Yahr stage, the Unified Parkinson's Disease Rating Scale (UPDRS), Montgomery Asberg Depression Rating Scale (MADRS) and Hamilton Anxiety Scale (HAMA) scores (r = 0.417, P = 0.005; r = 0.300, P = 0.048; r = 0.540, P < 0.001; r = 0.553, P < 0.001). In MSP the significantly correlation was displayed only in MADRS, HAMA scores (r = 0.429, P = 0.013; r = 0.492, P = 0.004), when disease progressed into advanced severity stage all these clinical measures (Hoehn‐Yahr stage, UPDRS‐3, UPDRS, HAMA, and MADRS scores) we had recruited into this study shown prominent correlation to SN iron content (r = 0.650, P=0.030; r=0.709, P=0.015; r=0.708, P=0.015; r=0.758, P=0.007; r=0.683, P=0.020). In the three phenotypes the correlation between iron content and MADRS, HAMA scores (r = 0.686, P = 0.002; r = 0.633, P = 0.006) was found in AR subgroups exclusively.

Conclusions: Patients with PD exhibited significantly higher magnetic susceptibility values, especially in those who are in advanced disease severity stage, which confirmed that iron accumulation in the SN is in line with Parkinson's disease progression. Furthermore, we testified that there are actually some inherent effects of sub‐stantia nigra iron deposition to the clinical symptoms of Parkinson's disease. Moreover, it seems that akinetic/ rigidity‐dominant PD subgroup was affected most by SN iron accumulation.

138

High iron content in the substantia nigra differentiates Parkinson's disease patients from healthy controls

Naying He, Kiarash Ghassaban, Sean Sethi, Pei Huang, Shengdi Chen, Fuhua Yan, Ewart Haacke (Shanghai, People's Republic of China)

Objective: The goal of this work is to show that there is a non‐uniform distribution of high iron content in the substantia nigra that can be monitored using magnetic resonance imaging and is representative of Parkinson's disease (PD).

Background: It is well known that iron increases in the SN of patients with PD. It is thought that this might be due to the depigmentation of neuromelanin and the deposition of iron in that process. MRI offers the ability to map out iron content.

Methods: We developed a two region of interest (1), quantitative susceptibility mapping (QSM) technique to measure abnormally high levels of iron as a function of age in the deep gray matter (DGM) nuclei. We evaluated 25 PD cases and 24 healthy controls (HC) and compared the results to a baseline of 174 HC to map out iron as a function of age. This approach was used to evaluate the distribution of iron in the DGM including the: caudate nucleus, putamen, globus pallidus, red nucleus, substantia nigra (SN) and the dentate nucleus. An age dependent background iron level was used to determine the normal levels of iron. We used a threshold of three standard deviations above the background iron content to determine the high iron content region.

Results: Specifically, the substantia nigra was the only structure showing significantly higher susceptibility values in PD patients compared to the healthy controls both globally (p‐values < 0.05) and regionally (p‐values < 0.01) with the regional analysis showing more prominent significance. It also appeared that there are two populations of PD patients, those that increase their iron content in the SN and those that don't. A linear trend could be seen for those with high iron content increasing as a function of age and duration of the disease. The high iron content regions showed a much tighter fit (much less spread at a given age) than the usual total region analysis that is usually performed.

Conclusions: Abnormal iron deposition in the substantia nigra, especially where it is locally high, could serve as a new biomarker to assess the disease severity and progression for Parkinson's disease and to discriminate between patient subgroups.

References: 1) Haacke EM, Liu S, Buch S, Zheng W, Wu D, Ye Y. Quantitative susceptibility mapping: current status and future directions. Magnetic resonance imaging. 2015;33 (1):1‐25.2) Liu M, Liu S, Ghassaban K, Zheng W, Dicicco D, Miao Y, et al. Assessing global and regional iron content in deep gray matter as a function of age using susceptibility mapping. Journal of magnetic resonance imaging : JMRI. 2016;44 (1):59‐71.

139

Brain microstructural abnormalities in relation to serotonergic terminals density in Parkinson's disease: a combined DTI and 11C‐DASB PET study

Weihua Li, Nick Lao‐Kaim, Andreas Antonios Roussakis, Antonio Martin‐Bastida, Natalie Valle Guzman, Thomas Foltynie, Roger Barker, Adam Hampshire, Paola Piccini (London, United Kingdom)

Objective: To estimate DTI alterations in PD patients, and to correlate microstructural abnormalities with measures of motor disability and Serotonergic Terminals (SERT) availability determined with 11C‐DASB PET.

Background: DTI is increasingly used as a non‐invasive tool to investigate microstructure changes associated with PD. Previous studies suggest that serotonergic dysfunction has a direct relevance to non‐motor symptoms (such as depression, fatigue, and weight changes) commonly associated with PD. To date, no previous DTI study in patients with PD investigated the degree to which variations in serotonergic dysfunction may modulate the FA/MD values.

Methods: For each subject, values of FA and MD within each Region‐of‐Interest (ROI) were calculated. For 11C‐DASB the regional non‐displaceable binding potential BPND was calculated using the SRTM with cerebellar grey matter as the reference.

Results: In the PD patients, 11C‐DASB BPND showed a significant negative correlation with MD value in the amygdala (rs=‐0.37, p=0.047). There was a significant negative correlation between FA value and UPDRS‐III (r = ‐0.514, p = 0.0044) as well as between FA value and bradykinesia‐rigidity sub‐scores (r = ‐0.516, p = 0.0042) in the Insula. Furthermore, there was a significant negative correlation between FA value and UPDRS‐III (r = ‐0.517, p = 0.0041) as well as between FA value and bradykinesia‐rigidity sub‐scores (r = ‐0.478, p = 0.0087) in the hypothalamus.

Conclusions: In conclusion, FA/MD alterations were correlated with motor symptoms of PD. Furthermore, the FA/MD values are closely associated with serotonergic terminal density, as measured using 11C‐DASB PET. The results of this study indicate that the altered microstructural integrity as measured by DTI may represent PD serotoninergic pathology and its progression. The results suggest that DTI may offer a new method of investigating pathological changes and in some circumstances where cost and scan duration are an issue, may supersede 11C‐DASB PET in the detection of serotoninergic degeneration in PD.

References: Politis, M., K. Wu, C. Loane, L. Kiferle, S. Molloy, D. J. Brooks and P. Piccini (2010). "Staging of serotonergic dysfunction in Parkinson's Disease: An in vivo 11C‐DASB PET study." Neurobiology of Disease 40 (1): 216‐221.

140

Parkinson disease: diagnostic utility of iron deposition quantification in the lateral‐ventral substantia nigra pars compacta

Naying He, Jason Langley, Shengdi Chen, Pei Huang, Fuhua Yan, Xiaoping Hu (Shanghai, People's Republic of China)

Objective: To quantify Parkinson's disease (PD) related iron deposition in the lateral‐ventral substantia nigra pars compacta (SNpc) and evaluate the diagnostic utility of this measure.

Background: A primary characteristic of PD is depigmentation of melanized neurons in SNpc, with the lateral and ventral portions of SNpc experiencing the greatest loss of melanized neurons. It has also been shown that iron deposition occurs in conjunction to the loss of melanized SNpc neurons. However, the role iron plays in relation to this loss remains unclear.

Methods: In this prospective study, 39 PD patients and 33 gender‐ and age‐matched healthy controls were recruited. All subjects were scanned at 3.0‐T using a 16‐echo gradient echo sequence to create R2* maps for the evaluation of iron content to find the overlap with NM in the SNpc. This measure of NM was obtained using a standardized SNpc mask from previous work. The SNpc normalized volume overlap (NVO) with the R2* map, and the R2* values in both the whole SNpc and the overlap volume were compared between PD and control groups, and correlated with clinical features including disease duration, UPDRS‐III, H&Y in PD patients for PD patients. Finally, the diagnostic performance of the NVO measure was evaluated using ROC analysis.

Results: The overlap region was located in the lateral‐ventral part of the SNpc. The R2* values in the whole SNpc (p=0.002) and the NVO (p=2.35×10‐13) were significantly larger in PD patients than in HC. Furthermore, the NVO was significantly positively correlated with the disease duration in PD (p=0.007; r2=0.424), but neither of the R2* values in the whole SNpc or the overlap volume were significantly correlated with any clinical features. We found that the SNpc NVO provided excellent diagnostic accuracy for discriminating PD patients from HC (AUC=0.93), while the R2* values in the whole SNpc (AUC=0.71) or the overlap volume (AUC=0.65) were less effective.

Conclusions: The overlap between the iron content and NM which is located in the lateral‐ventral part of the SNpc has the potential to be a neuroimaging biomarker for monitoring PD.

References: 1) Fearnley JM, Lees AJ. Ageing and Parkinson's disease: substantia nigra regional selectivity. Brain. 1991;114 ( Pt 5):2283‐301.2) Langley J, Huddleston DE, Sedlacik J, Boelmans K, Hu XP. Parkinson's disease‐related increase of T2*‐weighted hypointensity in substantia nigra pars compacta. Movement disorders : official journal of the Movement Disorder Society. 2017;32 (3):441‐9.

141

Regulatory mechanism of a‐lipoic acid on iron efflux in Parkinson's disease model

Cai Ting (Guiyang, People's Republic of China)

Objective: To observe the effect of a‐lipoic acid (a‐LA) on the expressions of ferroportin1 (FP1), iron regulatory protein 1 (IRP1) and iron regulatory protein 2 (IRP2) in substantia nigra (SN) of Parkinson's disease (PD) rat models and in the cell model of PD and explore the mechanism by which a‐LA regulates iron efflux in PD model.

Background:‐

Methods: Animal experiment: 60 healthy male SD rats were randomly divided into sham operation group (15 rats) and model group (45 rats). The model group was established by injecting 6‐hydroxydopamine (6‐OHDA) into the right striatum of rats by stereotactic technique, and the sham operation group was injected with the same dose of normal saline. After 4 weeks, the successful models (30 rats) were screened by rotation experiments and randomly divided into PD model group (15 rats) and PD treatment group (15 rats). The PD treatment group was intraperitoneally injected with a‐LA (50 mg/kg) daily for 2 weeks, PD model group given the same dose of saline. After 14 days of treatment, the left forelimb use rate was tested by cylinder test. The right midbrain substantia nigra was taken in each group, the expression and distribution of tyrosine hydroxylase (TH) was detected by immunohistochemical staining, the number of iron positive cells were detected by Prussian blue staining, and the levels of FP1, IRP1, IRP2 were detected by Western Blot. Cell experiment: PC12 cells were cultured in vitro. The optimum concentration of 6‐OHDA and a‐LA were screened by MTT method. It was divided into 3 groups: the normal control group, the model group (100μmol/L 6‐OHDA), the a‐LA intervention group (100μmol/L a‐LA +100μmol/L 6‐OHDA). The concentrations of malondialdehyde (MDA) and iron were measured by colorimetric method, and the expressions of FP1, IRP1 and IRP2 were examined by Western Blot.

Results: Animal experiment: (1) compared with the sham operation group, the left forelimb use rate of PD model group was significantly reduced (P<0.01), the number of TH positive cells decreased significantly (P<0.01), the number of iron positive cells in the substantia nigra significantly increased (P<0.01), the expression of FP1 was significantly reduced (P<0.01), the expression of IRP2 was significantly increased (P<0.01), and the expression of IRP1 had no difference statistical significance (P>0.05). (2) Compared with the PD model group, the left forelimb use rate of the PD treatment group was significantly raised (P<0.01), the number of TH positive cells was significantly increased (P<0.01), the number of iron positive cells in the substantia nigra was significantly reduced (P<0.01), the expression of FP1 was significantly increased (P<0.01), the expression of IRP2 was significantly decreased (P<0.01), and the expression of IRP1 had no difference statistical significance (P>0.05). Cell experiment: (1) compared with normal control group, the cell viability of model group was significantly decreased (P<0.01), the concentrations of MDA and iron were significantly increased (P<0.01), the expression of FP1 was significantly decreased (P<0.01), and the expressions of IRP1 and IRP2 were significantly increased (P<0.01). (2) Compared with the model group, the cell viability of a‐LA intervention group was significantly increased (P<0.01), the concentrations of MDA and iron were significantly reduced (P<0.01), the expression of FP1 was significantly increased (P<0.01), the expression of IRP1 was reduced (P<0.05), and the expression of IRP2 was significantly decreased (P<0.01).

Conclusions: (1) In PD model rats, a‐LA can reduce the expression of IRP2 in the midbrain SN, pass the IRP2/IRE pathway, increase FP1 level, promote the outflow of iron ions from cells, and reduce iron deposition. (2) In the PD cell models, a‐LA can reduce the expressions of IRP1 and IRP2 in the cell, increase the expression of FP1 through IRPs/IRE pathway, promote the outflow of iron ions from cells, and inhibit iron deposition.

References: [1] Lill CM. Genetics of Parkinson's disease[J]. Mol Cell Probes, 2016, 30 (6):386‐396. [2] Foltynie T, Kahan J. Parkinson's disease: an update on pathogenesis and treatment. [J]. Journal of Neurology, 2013, 260 (5):1433‐1440. [3] Gao F, Yang J, Wang D, et al. Mitophagy in Parkinson's Disease: Pathogenic and Therapeutic Implications[J]. Frontiers in Neurology, 2017, 8:527‐532. [4] Rouault T. Iron on the brain. [J]. Nature Genetics, 2001,28 (4):299‐300. [5] Altamura S, Muckenthaler MU. Iron toxicity in diseases of aging: Alzheimer's disease, Parkinson's disease and atherosclerosis[J]. Journal of Alzheimers Disease Jad,2009,16 (4):879‐895. [6] Arreguin S, Nelson P, Padway S, et al. Dopamine complexes of iron in the etiology and pathogenesis of Parkinson's disease[J]. Journal of Inorganic Biochemistry, 2009,103 (1):87‐93. [7]Oakley AE, Collingwood JF, Dobson J, et al. Individual dopaminergic neurons show raised iron levels in Parkinson disease[J]. Neurology, 2007,68 (21):1820‐1825. [8][J], 2009,38 (4):527‐530. [9][J], 2010,29 (12):980‐983. [10]Rhodes SL, Ritz B. Genetics of iron regulation and the possible role of iron in Parkinson's disease[J]. Neurobiology of Disease, 2008,32 (2):183‐195. [11]Qian ZM, Shen X. Brain iron transport and neurodegeneration[J]. Trends in Molecular Medicine, 2001,7 (3):103‐108. [12]Benarroch EE. Brain iron homeostasis and neurodegenerative disease[J]. Neurology, 2009,72 (16):1436‐1440. [13]Singh N, Haldar S, Tripathi AK, et al. Brain Iron Homeostasis: From Molecular Mechanisms To Clinical Significance and Therapeutic Opportunities[J]. Antioxidants & Redox Signaling, 2014,20 (8):1324‐1363. [14]Ke Y, Ming QZ. Iron misregulation in the brain: a primary cause of neurodegenerative disorders. [J]. Lancet Neurology, 2003,2 (4):246‐253. [15]Berg D, Hochstrasser H, Schweitzer KJ, et al. Disturbance of iron metabolism in Parkinson's disease ‐‐ ultrasonography as a biomarker. [J]. Neurotoxicity Research, 2006, 9 (1):1‐13. [16]He Y, Lee T, Leong SK. Time‐course and localization of transferrin receptor expression in the substantia nigra of 6‐hydroxydopamine‐induced parkinsonian rats[J]. Neuroscience, 1999,91 (2): 579‐585. [17]Faucheux BA, Herrero MT, Villares J, et al. Autoradiographic localization and density of [125I]ferrotransferrin binding sites in the basal ganglia of control subjects, patients with Parkinson's disease and MPTP‐lesioned monkeys[J]. Brain Research, 1995, 691 (1‐2):115‐124. [18] Lu LN, Qian ZM, Wu KC, et al. Expression of Iron Transporters and Pathological Hallmarks of Parkinson's and Alzheimer's Diseases in the Brain of Young, Adult, and Aged Rats[J]. Molecular Neurobiology, 2016, 54 (7):1‐12. [19] Song Y, Chen X, Li C, et al. Divalent metal transporter 1 expression and iron deposition in the substantia nigra of a rat model of Parkinson's disease[J]. Neural Regeneration Research, 2010, 05 (22):1701‐1705. [20] Salazar J, Mena N, Hunot S, et al. Divalent metal transporter 1 (DMT1) contributes to neurodegeneration in animal models of Parkinson's disease[J]. Proc Natl Acad Sci U S A, 2008, 105 (47):18578‐18583. [21] Dexter D T, Dsc P J, Schapira A H V, et al. Alterations in levels of iron, ferritin, and other trace metals in neurodegenerative diseases affecting the basal ganglia[J]. Annals of Neurology, 1992, 32 (S1):S94‐S100. [22] Jellinger K, Paulus W, Grundkeiqbal I, et al. Brain iron and ferritin in Parkinson's and Alzheimer's diseases[J]. Journal of Neural Transmission Parkinsons Disease & Dementia, 1990,2 (4):327‐340. [23]Abboud S, Haile DJ. A novel mammalian iron‐regulated protein involved in intracellular iron metabolism[J]. Journal of Biological Chemistry, 2000,275 (26):19906‐19912. [24]Donovan A, Brownlie A, Zhou Y, et al. Positional cloning of zebrafish ferroportin1 identifies a conserved vertebrate iron exporter[J]. Nature, 2000,403 (6771):776‐781. [25] Mckie AT, Marciani P, Rolfs A, et al. A Novel Duodenal Iron‐Regulated Transporter, IREG1, Implicated in the Basolateral Transfer of Iron to the Circulation[J]. Molecular Cell, 2000,5 (2): 299‐309. [26] Drakesmith H, Nemeth E, Ganz T. Ironing out Ferroportin[J]. Cell Metab, 2015, 22 (5):777‐87. [27] Ganz T. Cellular iron: Ferroportin is the only way out[J]. Cell Metabolism, 2005,1 (3): 155‐157. [28] Ghosh MC, Zhang L, Rouault TA. Iron misregulation and neurodegenerative disease in mouse models that lack iron regulatory proteins. Neurobiology of Disease, 2015, 81:66‐75. [29] C K. Iron regulatory proteins and their role in controlling iron metabolism[J]. Metallomics, 2015,7 (2):232‐243. [30] Rouault TA. The role of iron regulatory proteins in mammalian iron homeostasis and disease[J]. Nature Chemical Biology, 2006,2 (8):406‐414. [31] Kühn LC. Iron regulatory proteins and their role in controlling iron metabolism[J]. Metallomics, 2015, 7 (2):232‐243. [32] 2008. [33] Zhang Z, Hou L, Song JL, et al. Pro‐inflammatory cytokine‐mediated ferroportin down‐regulation contributes to the nigral iron accumulation in lipopolysaccharide‐induced Parkinsonian models[J]. Neuroscience, 2014,257 (2):20‐30. [34][36]2017,24 (6): 571‐573. [37] Jagadeesan AJ, Murugesan R, Vimala DS, et al. Current trends in etiology, prognosis and therapeutic aspects of Parkinson's disease: a review[J]. Acta Biomed, 2017, 88 (3):249‐262. [38] Hider RC, Roy S, Ma YM, et al. The potential application of iron chelators for the treatment of neurodegenerative diseases[J]. Metallomics, 2011,3 (3):239‐249. [39] Reed LJ, Debusk BG, Gunsalus IC, et al. Crystalline alpha‐lipoic acid; a catalytic agent associated with pyruvate dehydrogenase[J]. Science, 1951,114 (2952):93‐94. [40] Moura FA, de Andrade KQ, Dos Santos JC, et al. Lipoic Acid: its antioxidant and anti‐ inflammatory role and clinical applications[J]. Current Topics in Medicinal Chemistry, 2015, 15 (5):458‐483. [41] Tibullo D, Li VG, Giallongo C, et al. Biochemical and clinical relevance of alpha lipoic acid: antioxidant and anti‐inflammatory activity, molecular pathways and therapeutic potential[J]. Inflammation Research, 2017, 66 (11):947‐959. [42] Kamchatnov PR, Abusueva BA, Kazakov AY. Alpha‐lipoic acid in treatment of nervous system diseases [J]. Zh Nevrol Psikhiatr Im S S Korsakova, 2014, 114 (10):131‐135. [43] Skibska B, Goraca A. The protective effect of lipoic acid on selected cardiovascular diseases caused by age‐related oxidative stress[J]. Oxidative Medicine and Cellular Longevity, 2015, 2015 (5):1‐11. [44]2015 (6):562‐564. [45] Rochette L, Ghibu S, Muresan A, et al. Alpha‐lipoic acid: molecular mechanisms and therapeutic potential in diabetes[J]. Can J Physiol Pharmacol, 2015, 93 (12):1021‐1027. [46]Venigalla M, Sonego S, Gyengesi E, et al. Novel promising therapeutics against chronic neuroinflammation and neurodegeneration in Alzheimer's disease[J]. Neurochem Int, 2016, 95: 63‐74. [47], 2015. [48] 2016. [49] 2016,41 (7):821‐825. [50] Bove J, Perier C. Neurotoxin‐based models of Parkinson's disease[J]. Neuroscience, 2012, 211 (211):51‐76. [51] 2017,42 (3):249‐252. [52] Paxinos G, Watson CR, Emson PC. AChE‐stained horizontal sections of the rat brain in stereotaxic coordinates[J]. Journal of Neuroscience Methods, 1980,3 (2):129‐149. [53],2017, 42 (3):258‐262. [54], 2017,55 (8):18‐23. [55] Su RJ, Zhen JL, Wang W, et al. Time‐course behavioral features are correlated with Parkinson's disease‐associated pathology in a 6‐hydroxydopamine hemiparkinsonian rat model[J]. Molecular Medicine Reports, 2018, 17 (2):3356‐3363. [56] Dabbeni‐Sala F, Di Santo S, Franceschini D, et al. Melatonin protects against 6‐OHDA‐induced neurotoxicity in rats: a role for mitochondrial complex I activity[J]. FASEB J, 2001,15 (1):164‐170. [57] Liu H, Jia L, Chen X, et al. The Kv7/KCNQ channel blocker XE991 protects nigral dopaminergic neurons in the 6‐hydroxydopamine rat model of Parkinson's disease[J]. Brain Research Bulletin, 2018,137: 132‐139. [58] Yaghoob F, Alireza S, Mojtaba D, et al. Ellagic Acid Protects the Brain Against 6‐Hydroxydopamine Induced Neuroinflammation in a Rat Model of Parkinson's Disease[J]. Basic Clin Neurosci, 2015, 6 (2):83‐89. [59] Decressac M, Mattsson B, Bjorklund A. Comparison of the behavioural and histological characteristics of the 6‐OHDA and a‐synuclein rat models of Parkinson's disease[J]. Experimental Neurology, 2012,235 (1):306‐315. [60] Sarkaki A, Farbood Y, Dolatshahi M, et al. Neuroprotective Effects of Ellagic Acid in a Rat Model of Parkinson's Disease[J]. Acta Med Iran, 2016,54 (8):494‐502. [61] Lee CS, Sauer H, Bjorklund A. Dopaminergic neuronal degeneration and motor impairments following axon terminal lesion by intrastriatal 6‐hydroxydopamine in the rat[J]. Neuroscience, 1996,72 (3):641‐653. [62] Acton PD, Mozley PD. Single photon emission tomography imaging in parkinsonian disorders: a review[J]. Behavioural Neurology, 2000,12 (1‐2):11‐27. [63] Thiele SL, Warre R, Nash JE. Development of a unilaterally‐lesioned 6‐OHDA mouse model of Parkinson's disease[J]. Journal of Visualized Experiments Jove, 2012,60 (60):e3234‐e3234. [64] Heikkila R E, Shapiro B S, Duvoisin R C. The relationship between loss of dopamine nerve terminals, striatal [3H]spiroperidol binding and rotational behavior in unilaterally 6‐hydroxydopamine‐lesioned rats[J]. Brain Research, 1981,211 (2):285‐292. [65] Ba XH. Therapeutic effects of GM1 on Parkinson's disease in rats and its mechanism[J]. Int J Neurosci, 2016,126 (2):163‐167. [66] Wang JJ, Zhang T, Niu DB, et al. Doxycycline‐regulated co‐expression of GDNF and TH in PC12 cells[J]. Neuroscience Letters, 2006,401 (1‐2):142‐145. [67] 2011,19 (6):511‐514. [68] Olatunji OJ, Feng Y, Olatunji OO, et al. Cordycepin protects PC12 cells against 6‐hydroxydopamine induced neurotoxicity via its antioxidant properties[J]. Biomedicine and Pharmacotherapy, 2016,81:7‐14. [69] Rodriguez‐Huaman A, Casimiro‐Gonzales S, Chavez‐Perez JA, et al. Antioxidant and neuroprotector effect of Lepidium meyenii (maca) methanol leaf extract against 6‐hydroxy dopamine (6‐OHDA)‐induced toxicity in PC12 cells[J]. Toxicol Mech Methods, 2017,27 (4):279‐285. [70] 2012 (17):5212‐5215. [71] Hare DJ, Double KL. Iron and dopamine: a toxic couple[J]. Brain, 2016,139 (4):1026‐1035. [72] Jiang H, Wang J, Rogers J, et al. Brain Iron Metabolism Dysfunction in Parkinson's Disease[J]. Molecular Neurobiology, 2016,54 (4):1‐24. [73] Zhu Y, Wang B, Tao K, et al. Iron accumulation and microglia activation contribute to substantia nigra hyperechogenicity in the 6‐OHDA‐induced rat model of Parkinson's disease[J]. Parkinsonism & Related Disorders, 2017,36:76‐82. [74] Virel A, Faergemann E, Oradd G, et al. Magnetic resonance imaging (MRI) to study striatal iron accumulation in a rat model of Parkinson's disease[J]. PLoS One, 2014,9 (11):e112941. [75] Moos T, Morgan EH. The metabolism of neuronal iron and its pathogenic role in neurological disease: review[J]. Ann N Y Acad Sci, 2004,1012 (1):14‐26. [76] Soto‐Otero R, Mendez‐Alvarez E, Hermida‐Ameijeiras A, et al. Autoxidation and neurotoxicity of 6‐hydroxydopamine in the presence of some antioxidants: potential implication in relation to the pathogenesis of Parkinson's disease[J]. J Neurochemistry, 2000,74 (4):1605‐1612. [77] Borisenko GG, Kagan VE, Hsia CJ, et al. Interaction between 6‐hydroxydopamine and transferrin: "Let my iron go"[J]. Biochemistry, 2000,39 (12):3392‐3400. [78] Wang W, Song N, Zhang H, et al. 6‐Hydroxydopamine upregulates iron regulatory protein 1 by activating certain protein kinase C isoforms in the dopaminergic MES23.5 cell line[J]. Int J Biochem Cell Biol, 2012,44 (11):1987‐1992. [79] Jia W, Xu H, Du X, et al. Ndfip1 attenuated 6‐OHDA‐induced iron accumulation via regulating the degradation of DMT1 [J]. Neurobiology of Aging, 2015,36 (2):1183‐1193. [80] Singh N, Haldar S, Tripathi AK, et al. Brain Iron Homeostasis: From Molecular Mechanisms To Clinical Significance and Therapeutic Opportunities[J]. Antioxid Redox Signal, 2014,20 (8): 1324‐1363. [81] Wang J, Jiang H, Xie JX. Ferroportin1 and hephaestin are involved in the nigral iron accumulation of 6‐OHDA‐lesioned rats[J]. European Journal of Neuroscience, 2007,25 (9): 2766‐2772. [82] Pang L, Wang J, Huang W, et al. A study of divalent metal transporter 1 and ferroportin 1 in brain of rats with manganese‐induced parkinsonism[J]. Zhonghua Lao Dong Wei Sheng Zhi Ye Bing Za Zhi, 2015,33 (4):250‐254. [83] Chen D, Kanthasamy AG, Reddy MB. EGCG Protects against 6‐OHDA‐Induced Neurotoxicity in a Cell Culture Model[J]. Parkinson's Disease, 2015,2015 (6):1‐10. [84] Song N, Wang J, Jiang H, et al. Ferroportin 1 but not hephaestin contributes to iron accumulation in a cell model of Parkinson's disease[J]. Free Radical Biology and Medicine, 2010,48 (2):332‐341. [85] Jiang H, Song N, Xu H, et al. Up‐regulation of divalent metal transporter 1 in 6‐hydroxydopamine intoxication is IRE/IRP dependent[J]. Cell Research, 2010,15 (3):345‐356. [86] 2012,32 (5):32‐34. [87] Jalali‐Nadoushan M, Roghani M. Alpha‐lipoic acid protects against 6‐hydroxydopamine‐ induced neurotoxicity in a rat model of hemi‐parkinsonism[J]. Brain Research, 2013,1505 (6):68‐74. [88] 2014,31 (5):419‐421. [89] Li DW, Li GR, Lu Y, et al. a‐lipoic acid protects dopaminergic neurons against MPP+‐induced apoptosis by attenuating reactive oxygen species formation[J]. International Journal of Molecular Medicine, 2013,32 (1):108‐114.

142

Abnormal effective connectivity within and between several brain networks in Parkinson's disease: a spectral dynamic causal modeling study

Xiangzhe Qiu, Sunpei Huang, Maria L. Bringas, Marjan Jahanshahi (Chengdu, People's Republic of China)

Objective: To investigate the effective connectivity within and between five brain networks in patients with Parkinson's disease relative to healthy controls.

Background: Parkinson's disease (PD) is a neurodegenerative disorder characterized by nigrostriatal dopamine depletion. There is evidence for context‐specific changes in brain effective connectivity in PD relative to relative healthy controls (Rowe et al., 2002, 2010). Dysfunction of key networks such as the default mode network (DMN) have also been previously reported in PD (Rektorova et al., 2014; van Eimeren et al., 2009). However, it is unclear how causal influences among large‐scale networks are disrupted in PD. In this study, we examined the hypothesis that there is aberrant effective connectivity within and between five brain networks, namely the default mode network (DMN), the control executive network (CEN), the dorsal attention network (DAN), sensorimotor network (SMN) and salience network (SN) in PD.

Methods: Nine patients with PD and nine sex and age‐matched healthy controls were recruited and assessed with resting fMRI in the Cuban Neuroscience Center. The resting fMRI data were analyzed using spectral dynamic causal modeling (Friston et al., 2014; Razi et al., 2017).

Results: Our results showed that relative to age‐matched healthy controls effective connectivity was reduced in PD in the DMN, in the CEN, and in the SMN. Furthermore, the connectivity pattern between the five networks was altered in PD relative to healthy controls.

Conclusions: Our results indicate abnormal information communication within and between age‐matched brain networks in PD relative to healthy controls, suggesting that PD is a disconnection disorder. Such changes in effective connectivity contribute to the motor and cognitive symptoms of PD.

References: Friston, K. J., Kahan, J., Biswal, B., and Razi, A. (2014). A DCM for resting state fMRI. Neuroimage 94, 396–407. doi:10.1016/j.neuroimage.2013.12.009.Razi, A., Seghier, M. L., Zhou, Y., McColgan, P., Zeidman, P., Park, H.‐J., et al. (2017). Large‐scale DCMs for resting state fMRI. Netw. Neurosci. 1, 1–41. doi:10.1162/NETN_a_00015.Rektorova, I., Krajcovicova, L., Marecek, R., Novakova, M., and Mikl, M. (2014). Default Mode Network Connectivity Patterns associated with Visual Processing at Different Stages of Parkinson's Disease. J. Alzheimers. Dis. 42, S217‐28. doi:10.3233/JAD‐132684.Rowe, J. B., Hughes, L. E., Barker, R. A., and Owen, A. M. (2010). Dynamic causal modelling of effective connectivity from fMRI: Are results reproducible and sensitive to Parkinson's disease and its treatment? Neuroimage 52, 1015–1026. doi:10.1016/j.neuroimage.2009.12.080.Rowe, J., Stephan, K. E., Friston, K., Frackowiak, R., Lees, A., and Passingham, R. (2002).

Attention to action in Parkinson's disease: Impaired effective connectivity among frontal cortical regions. Brain 125, 276–289. doi:10.1093/brain/awf036.van Eimeren, T., Monchi, O., Ballanger, B., and Strafella, A. P. (2009). Dysfunction of the Default Mode Network in Parkinson Disease. Arch. Neurol. 66, 1316. doi:10.1001/archneurol.2009.97.

143

Influence of regional iron deposition on the clinical motor symptoms of Parkinson's disease

Xiaojing Du, Jian‐Jun Ma (Zhengzhou, People's Republic of China)

Objective: To investigate the character of iron deposition in the cerebrum, midbrain and cerebellum in the patients of Parkinson's disease (PD), and analyze the correlations of regional iron content and clinical features.

Background: Brain iron deposition is correlated with the pathophysiology of the neurodegenerative diseases due to the iron‐related oxidative stress damage and neurotoxicity1, 2. However, there is no study to investigate the correlation between clinical symptoms and regional iron content at different stages of PD.

Methods: In this cross‐sectional study, 109 patients with PD and 104 age‐ and sex‐matched healthy controls were recruited. Brain iron deposition is measured with Quantitative susceptibility mapping (QSM),which is a post processed MRI technique to measure susceptibility values of different forms of irons (see Figure 1). Motor symptoms were evaluated by Unified Parkinson's Disease Rating Scale (UPDRS) III. The intergroup differences of QSM values were compared among the controls, early PD (EPD) and advanced PD (APD) patients. In addition, correlations were separately assessed between QSM values and tremor or akinetic/rigid scores to confirm whether potential relationships existed between iron content in the remaining regions and motor impairment.

Results: Compared with normal controls, the QSM values of EPD patients significantly increased in the substantia nigra pars compacta (SNc) and putamen (PU). In APD patients, the regions of SNc, substantia nigra pars reticulata (SNr), caudate nucleus (CN), red nucleus (RN) and PU also showed increased QSM values compared with those of the controls. Besides, the absence of differences of QSM values in the globus pallidus (GP) and thalamus (TH) among the controls, EPD, and APD groups were noted throughout our data. Pair‐wise comparisons showed that the area under the curves (AUC) for SNc was significantly larger than that for PU. Significantly positive correlations between tremor scores and QSM values were observed in the RN, SNc and PU, while QSM values in the CN was positively associated with the severity of akinetic/rigid.

Conclusions: In PD patients, iron selectively accumulate in SNc, SNr, CN, RN and PU, especially in SNc, which may help to diagnose PD. Our data indicates that iron accumulation in RN, SNc and PU is positively correlated with the severity of tremor, and iron accumulation in CN is positively associated with the severity of akinetic/rigid.

References: 1. Ward RJ, Dexter DT, Crichton RR. Neurodegenerative diseases and therapeutic strategies using iron chelators. J Trace Elem Med Biol 2015;31:267‐73.2. You LH, Li F, Wang L, Zhao SE, Wang SM, Zhang LL, et al. Brain iron accumulation exacerbates the pathogenesis of MPTP‐induced Parkinson's disease. Neuroscience 2015;284:234‐46.

Figure 1.

QSM images (A and B) and selected regions of interest (C and D). SNc: substantia nigra pars compacta; SNr: substantia nigra pars reticulata; GP: globus pallidus; CN: caudate nucles; PU: putamen; TH: thalamus; RN: red nucleus.

144

Alterations of left prefrontal lobe, limbic system and sensory cortex in white matter network topology contribute to depression in Parkinson s disease

Yihui Qiu, Nie Kun, Gao Yuan, Zhang Hu, Lijuan Wang (Guangzhou, People's Republic of China)

Objective: The aim of this study was to assess whether depression is associated with disruption in white matter (WM) networks in PD patients.

Background: Depression is one of the the most common non‐motor symptoms in patients with parkinson's disease (PD) and may be an independent risk factor for PD, with a negative effect on quality of life, motor function and disability. However, the underlying pathophysiology of depression PD (DPD) patients is complex and still unclear. The aim of this study was to assess whether depression is associated with disruption in white matter (WM) networks in PD patients.

Methods: Graph theoretical analyses were applied to 3T MRI data from 66 PD patients and 16 healthy controls. Twenty‐five PD patients were classified as having depression using the Diagnostic and Statistical Manual of Mental Disorders, 4th edition (DSM‐IV) criteria. global measures (clustering coefficient, shortest path length, local effciency, global effciency, the small‐world properties) and regional measures (regional efficiency, hubs) were assessed in the white matter networks that were constructed based on Diffusion tensor imaging (DTI) tractography and graph theoretical approaches.

Results: All the DPD patients, non‐depression PD (NDPD)patients and healthy controls exhibited the small‐world attributes, but there was no difference in global measures between them. Moreover, higher regional effciency in the auditory cortex (the bilateral heschl gyrus (HES), superior temporal gyrus (STG) and the left middle temporal lobe (MTG.L) were found in the DPD patients group groups, meanwhile, compared with healthy controls group,the increase of the regional effciency was found in DPD patients group in the right cuneus (CUN.R). In addition, there was a negative correlation between severity of depression and the regional efficiency of several cortical regions which mainly located in the striatum (bilateral caudate nucleus (CAU) and lenticular nucleus, putamen (PUT)), prefrontal (e.g.,left superior frontal gyrus, dorsolateral (SFGdor.L), left middle frontal gyrus, orbital part (ORBsup.L), left superior frontal gyrus, medial (SFGmed.L) and limbic system (bilateral Insula (INS), left median cingulate and paracingulate gyri (DCG.L) and right thalamus (THA.R) in PD patients.Finally, compared with the other groups,DPD patients group lacked three hub regions in WM networks consisting of SFGdor.L and bilateral INS.

Conclusions: The results suggest a disrupted integrity which was mainly focused on left prefrontal lobe, limbic system and sensory cortex in the large‐scale brain systems in DPD patients, thus providing new insights into the understanding of DPD connectome. Our data also suggest that a topology‐based brain network analysis can provide potential biomarkers for disease diagnosis and therapeutic targets for patients with DPD.

Figure 1.

 

Figure 2.

The hub region distribution in the WM structure networks of the NDPD patients, DPD patients and healthy controls group. A hub region for node i, was identified if the mean of Enodal(i) was larger than the sum of the mean and SD of Enodal(i). (A) The normalized regional efficiency (divided by mean of all nodes, Enodal) for all 90 regions sorted by the mean in a descensing order, the dashed line indicated the threshold (mean) for hub identification. (B) B rendering plot of the differential hub regions of the anatomical networks between any two groups. Nodes color‐coded in red represent increased hub regions, while Nodes color‐coded in black indicates decreased hub regions. The location of the region was visualized with the BrainNet View software (http://www.nitrc.org/projects/bnv)

145

Altered global synchronization of spontaneous brain activity in Parkinson's disease patients: a resting‐state fMRI study

Yanjun Liu, Li Mengyan, Guihe Hu, Shaode Yu, Haobo Chen, Yaoqin Xie (Shenzhen, People's Republic of China)

Objective: To explore the alterations of global synchronization of brain activities and investigate the neural correlation of cognitive and movement function in people with Parkinson's disease (PD), using functional MRI (fMRI).

Background: Abnormalities of cognitive and movement functions are widely reported in PD [1]. The mechanisms therein are complicated and assumed to a coordination of various brain regions.

Methods: Age‐match of 36 people with PD and 35 normal controls (NC) were enrolled in resting‐state MRI scanning without any tasks. Degree of centrality (DC) were calculated to measure the global functional connectivity[2] of two groups respectively. Two sample t‐test was performed on the DC maps of NC and PD to evaluate group differences (Gray matter mask, GRF correction, voxel p<0.005, cluster p<0.05, T>2.91). Additionally, for PD group, DC signals were extracted form Anatomical Automatic Labeling (AAL116) templates and then correlated with cognitive function scores (frontal assessment battery, FAB) and movement function scores (Unified Parkinson's Disease Rating Scale, UPDRS‐III) to investigate the neural correlations.

Results: Group differences analysis of DC were showed in [Figure1]. PD group was observed with increased DC in left middle temporal gyrus/angular gyrus and middle right frontal gyrus, while decreased in right inferior orbital‐frontal gyrus and left postcentral gyrus [Figure1]. The FAB scores of PD were significantly lower than NC [Figure2A]. Correlative analysis of PD between DC and cognitive function (FAB) showed negative results in bilateral superior frontal gyrus and left thalamus, and positive in left cerebellum [Figure2]. As for the correlations between DC and movement function (UPDRS‐III), it was observed negative in bilateral inferior parietal lobule, whereas positive in bilateral hippocampus and para‐hippocampus[Figure3].

Conclusions: Decreased global synchronizations in orbital‐frontal cortex and postcentral gyrus reveal altered cognitive and movement functions in PD. The findings of positive correlations suggest that the global functional connectivity in cerebellum and hippocampus/para‐hippocampus are critical in the identification of cognitive and movement functions in PD. This study provides new insights on the interaction among global coordination of brain activity, cognitive function and movement function in PD.

References: [1] A. Kudlicka, L. Clare, and J. V. Hindle, “Executive functions in Parkinson's disease: Systematic review and meta‐analysis,” Movement Disorders, vol. 26, no. 13. pp. 2305–2315, 2011. [2]R. L. Buckner et al., “Cortical Hubs Revealed by Intrinsic Functional Connectivity: Mapping, Assessment of Stability, and Relation to Alzheimer's Disease,” J. Neurosci., vol. 29, no. 6, pp. 1860–1873, 2009.

Figure 1.

 

Figure 2.

 

Figure 3.

 

146

Localization of stimulating electrodes in post‐DBS surgery PD patients using MRI

Yan Li, Ewart Haacke, Naying He, Fuhua Yan (Shanghai, People's Republic of China)

Objective: The aim of this study was to set up the best MRI protocol for postoperative visualization of the DBS electrodes for the post‐DBS PD patients.

Background: Parkinson's disease (PD) is a long‐term degenerative disorder of the central nervous system that mainly affects the motor system. Deep brain stimulation (DBS) is the most effective treatment for advanced PD, and subthalamus nucleus (STN) and global pallidus internal (GPi) are the most commonly used two targets [1]. The most widely used DBS electrode has a linear array of 4 cylindrical contacts that can be selectively turned on depending on the placement of the electrode and the specific area of the brain to be stimulated. Doctors need to know the exact location of the electrodes relative to the target of interest to select appropriate stimulus parameters for the patient [2].

Methods: Imaging was performed using a 1.5‐T MR scanner. Phantom experiments using a clinical DBS wire were performed to determine the precise characteristics of the artifact of the electrodes. Five post‐DBS PD patients were also scanned. High resolution in plane thin slice (1.5mm) T1W MP‐RAGE and spin echo (SE) sequences were used with an in‐plane resolution of 0.75mm x 0.75mm for magnitude images and a conventional gradient echo with the same imaging parameters except with an echo time of 5ms for the phase data.

Results: Both SE and high resolution gradient echo imaging were able to visualize the electrodes through the unique geometric distortion artifacts that highlight each electrode, as shown in Fig 1. Further, the end of the wire could be determined using the phase information highlighting the dipole effect, as shown in Fig 2. In all cases with DBS treatment, the artifacts were consistently seen and the end of the wire identified.

Conclusions: The banding artifacts caused by the susceptibility changes in the electrode material and the abutting material separating the 4 electrodes prove to be a useful means by which to localize and separate the four electrodes of the DBS wire. The high resolution helps constrain the artifacts exactly in the area of the electrodes. This is important because it helps to ascertain which electrodes should be used to treat the patient. The end of the wire itself acts like a dipole source and that effect in the phase image was used to ensure that the end position of the wire was known. In conclusion both 3D T1 MPRAGE and SE imaging provide a rapid imaging protocol for imaging the brain for patients post‐DBS treatment.

References: [1] Yelnik J, Damier P, Demeret S, et al. Localization of stimulating electrodes in patients with Parkinson disease by using a three‐dimensional atlas‐magnetic resonance imaging coregistration method [J]. Journal of Neurosurgery, 2003, 99 (1):89. [2] Lee M W, De Salles A A, Frighetto L, et al. Deep brain stimulation in intraoperative MRI environment ‐ comparison of imaging techniques and electrode fixation methods [J]. Minim Invasive Neurosurg, 2005, 48 (01):1‐6.

Figure 1.

 

Figure 2.

 

147

fMRI imaging changes in Parkinson's disease patients treated with MAO‐I

Ting Gao (Hangzhou, Zhejiang, People's Republic of China)

Objective: To identify the differences between patients with PD (Parkinson's Disease) treated with MAO‐I (Monoamine Oxidase‐B Inhibitor) or not via fMRI (functional MRI).

Background: Although clinical trials have failed, it's possible that MAO‐I might be the only one that has the potential of neuroprotection compared to all other PD‐related drug therapies. Taking MAO‐I, patients with PD show more positive reaction to drugs than those without MAO‐I.

Methods: According to treatment more than 6 months with MAO‐I, patients divided into PD‐MAO, PD‐C groups, along with HC (healthy controls) were enrolled from outpatient and local societies. Diagnosis were made by two neurospecialists stick to UK Brain Bank Parkinson's disease diagnosis criteria respectively. Subjects were assessed with motor and non‐motor symptoms by two neurologists. Demographics and images produced by 3.0T GE750 MR were collected in all subjects. Between‐group differences for continuous variables were investigated using one‐way analysis of variance. Between‐group differences for categorical variables were investigated using the or Kruskal‐Wallis H test and 2 tests for proportion comparisons. MRI data analysis were performed using DPARSF and included the following steps: (1) removal of the first ten volumes of the functional scan, (2)slice timing and head motion correction, (3) normalization of the signal, (4) registration of each volume to the middle volume, (5) co‐registration of the functional scan with the structural scan, (6) spatial normalization of the structural scan to the MNI152 template, (7) smoothing of the functional scan with a Gaussian kernel of 6 mm FWHM (full width at half‐maximum) but not before the calculation of ReHo. (8) calculating of fALFF (fractional Amplitude of Low Frequency Fluctuation), ReHo (Regional Homogeneity), DC (Degree Centrality), FC (Functional Connectivity). (9) comparing all images between groups with covariates of those differed between groups using GRF correction with voxel p = 0.001, cluster p =0.05 two‐tailed. (10) finding correlation between image differences and demographics using Befferoni correction.

Results: 18HC, 16PD‐C and 9PD‐MAO were enrolled. All demographics showed no significant differences among three groups except for HAMD and HAMA. Scores of tremor in UPDRS was significantly lower in PD‐MAO than PD‐C. PD‐MAO showed higher fALFF in right superior temporal gyrus compared to PD‐C and in pons compared to HC. The fALFF signals of that differed between PD‐MAO and PD‐C were significantly related to MAO‐I dosage and dosage with duration. There was significant difference of DC between PD‐MAO and HC in inferior cerebellum, inferior cerebellar peduncle and medulla oblongata. As for FC, based on the region which is differed between PD groups in fALFF, showed significant higher connectivity between these two groups in left superior temporal gyrus. Moreover, that connectivity significantly had a positive correlation with LEDD (levodopa equivalent daily dose), and a negative correlation with onsetage.

Conclusions: Taking MAO‐I can improve symptoms of tremor and have impact on certain regions of brain which might be used as target for PD therapy.

148

Characteristics of spontaneous brain activity in left‐ and right‐onset Parkinson's disease patients

Kai Li, Wen Su, Hong Zhao, Min Chen, Haibo Chen, Rui Wang, Chunmei Li, Baohui Lou, Xin Xin Ma (Beijing, People's Republic of China)

Objective: To explore the characteristics of spontaneous brain activity in left‐ and right‐onset Parkinson's disease (PD) patients.

Background: It is well‐know that PD patients often present with unilateral motor symptoms which gradually progress to the other side (1). Correspondingly, dopaminergic degeneration is also asymmetric shown by dopamine transporter (DAT) SPECT and PET imaging (2). In addition, studies using magnetic resonance spectroscopy (MRS) and diffusion tensor imaging (DTI) have demonstrated more severe involvement of the basal ganglia structures contralateral to the motor symptom onset side, and this laterality may affect cortical activity detected by magnetoencephalography (3). Resting state functional magnetic resonance imaging (rs‐fMRI) estimates the brain blood oxygen level dependent (BOLD) signal while the subjects are awaking and not performing any specific task. The amplitude of low‐frequency fluctuations (ALFF) is a useful tool to reflect brain activity during the resting state (4). ALFF has been used to investigate the mechanism of various symptoms of PD, but not been used to investigate the influence of laterality in PD. Especially ALFF can measure the activity of a wide range of cortical and subcortical structures, it is very useful to elucidate the characteristics of spontaneous brain activity in left‐ and right‐onset Parkinson's disease (PD) patients. This study employed rs‐fMRI using ALFF to measure the brain activities of Parkinson's patients with left‐ and right‐onset.

Methods: Twenty‐five left‐onset and 26 right‐onset PD patients were included in the study, the two groups of patients had similar age and disease severity. Thirty‐two healthy controls with comparable age and sex distribution were recruited. All the subjects underwent rs‐fMRI examination. The fMRI data were processed using restplus (https://restfmri.net/forum/rest). The results were corrected by AlphaSim. The difference between the two PD groups and the healthy controls were analyzed by 2‐sample t test. p<0.05 was viewed as statistically significant.

Results: Compared with the healthy controls, left‐onset PD patients had decreased ALFF in the bilateral occipital lobes, the left temporal lobe, the left inferior frontal gyrus, and the right parietal lobe. In comparison with the healthy controls, right‐onset PD patients had decreased ALFF in the left inferior frontal gyrus, anterior part of the right temporal gyrus, and the right parietal lobe. Compared with left‐onset PD patients, right‐onset PD patients had decreased ALFF in the left thalamus, the right putamen, and the right cingulate gyrus, as well as increased ALFF in the left occipital lobe.

Conclusions: The present study demonstrated significant decrease of ALFF in multiple cortical regions in both left‐ and right‐onset PD patients compared with the healthy people. Furthermore, there were significant differences in brain activity in multiple cortical and subcortical structures.

References: 1. Hughes AJ, Daniel SE, Kilford L, Lees AJ. Accuracy of clinical diagnosis of idiopathic Parkinson's disease: a clinico‐pathological study of 100 cases. J Neurol Neurosurg Psychiatry 1992;55 (3):181‐184.2. Ba F, Martin WR. Dopamine transporter imaging as a diagnostic tool for parkinsonism and related disorders in clinical practice. Parkinsonism Relat Disord 2015;21 (2):87‐94.3. Heinrichs‐Graham E, Santamaria PM, Gendelman HE, Wilson TW. The cortical signature of symptom laterality in Parkinson's disease. Neuroimage Clin 2017;14:433‐440.4. Zang YF, He Y, Zhu CZ, et al. Altered baseline brain activity in children with ADHD revealed by resting‐state functional MRI. Brain Dev 2007;29 (2):83‐91.

149

Alterations of regional homogeneity in Parkinson's disease patients with freeze of gait: a resting‐state fMRI study

Li Mengyan, Yanjun Liu, Guihe Hu, Xiuhang Ruan, Zhenhang Luo, Shaode Yu, Haobo Chen, Xinhua Wei, Yaoqin Xie (Guangzhou, People's Republic of China)

Objective: To investigate the alterations of regional homogeneity of spontaneous brain activities in Parkinson's disease (PD) patients with freeze of gait (FOG) using functional magnetic resonance imaging (fMRI).

Background: Movement functions in PD with FOG and without FOG are commonly reported with different performances in various studies. The neural mechanisms therein still remain mysterious.

Methods: Three groups, 37 normal controls (NC), 35 PD patients with FOG (FOG+), 37 PD patients without FOG (FOG‐), were enrolled in resting‐state fMRI scanning without any tasks. Regional homogeneity (ReHo) was calculated to evaluate regional synchronization[1] for three groups respectively. ANOVA was performed on the ReHo maps of three groups to evaluate group differences (Gray matter mask, with covariates of age and head motion, GRF correction, voxel p<0.001, cluster p<0.05, T>3.45). Post‐hoc analysis was performed within the significant regions. Additionally, for FOG+, ReHo values were extracted from significant regions and AAL116 templates, then correlated with movement scores (FOG questionnaire, FOGQ; Gait and falls questionnaire, GFQ).

Results: Results of group ReHo differences were showed in [Figure 1]. Higher ReHo was observed in left angular gyrus in FOG+/FOG‐ than NC, while lower ReHo in left postcentral gyrus (PostC), left inferior orbital‐frontal cortex. Compared to FOG‐, ReHo in FOG+ was observed decreased in left PostC. While there was no significant correlation between movement score and ReHo within significant brain regions. Whereas negative correlations were observed between ReHo and GFQ/FOGQ (r= ‐0.36/‐0.38, p<0.05) in left superior temporal gyrus [Figure2] of whole brain AAL116 templates analysis.

Conclusions: Group differences of ReHo analysis demonstrated that, the regional signal synchronization of brain activities in left PostC of three groups were: FOG+ < FOG‐ < NC [Figure 2]. It suggests that ReHo in left PostC are critical features in the identifying the comparative correlations of three groups. And the correlations between ReHo and movement scores (GFQ) in left superior temporal gyrus provides potential in classifying FOG+ and FOG‐. This study provides new insights on the interaction between regional homogeneity of brain activity and and movement function in PD of FOG+ and FOG‐.

References: [1] Y. Zang, T. Jiang, Y. Lu, Y. He, and L. Tian, “Regional homogeneity approach to fMRI data analysis,” Neuroimage, vol. 22, no. 1, pp. 394–400, 2004.

Figure 1.

ReHO differences among NC, FOG+ and FOG‐ group

Figure 2.

Correlations between RaHo and movement scores in left superior temporal gyrus

Parkinson's Disease: Non‐Motor Symptoms

150

Types of dysautonomic disorders in parkinson's disease patients

Igor Petrov (Skopje, Macedonia)

Objective: The aim of the article is to present the patients with parkinson's disease and different types of autonomic disorders and the influence of autonomic disorders on the course and the progression of the parkinson's disease.

Background: In parkinson's disease many dysfunctions of the vegetative nervous system are occurring such as: syalorea, gastrointestinal disturbances, dysphagia, genitourinary dysfunction, orthostatic hypotension, cardiovascular disorders, excessive sweating, sexual dysfunction.These dysfunctions progress during the time with the progression of parkinson's disease and they influenced on the course and progression of the disease, causing the reduction in the quality of life and increasing the mortality. Autonomic dysfunctions can occur in the early phase of the disease can be the prodromal symptom, before the occurrence of the motor symptoms of parkinson's disease. It is considered that alpha‐synuclein itself has affinity towards the autonomic vegetative nervous system.

Methods: Examined were 110 patients with parkinson's disease of which 52 (51%) had dysautonomic symptoms. The patients were followed in the period of 5 years at the movement disorders department,by the university neurology clinic in Skopje, Republic of Macedonia. The controls and the follow up of the patients were made on every three months in the first year and than two times per year. In the patients with orthostatic hypotension blood pressure was measured in rest position when they seat in the chair at least 10 minutes and in the standing position at least 5 minutes. Cardiologic examination was also made, as well as detailed neurological examination, dopler sonography of the carotids and previous internal examination.

Results: 26 (51%) of the patients had constipation, 5 (0,9%) had excessive sweating,12 (23%) had urinary incontinence and 9 (17%) had orthostatic hypotension. The blood pressure (BP) in the patients in the standing position, was with falling of more than 20mmHg for systolic and more than 10 mmHg for diastolic by standing from supine position in to standing position for more than 5 minutes. Dysautonomic symptoms progressed in the follow up period and this patients with these symptoms had faster progression of the parkinson's disease.

Conclusions: In the presented series of patients with Parkinson's disease and autonomic disorders the most common were gastrointestinal disorders, urinary incontinence,orthostatic hypotension and excessive sweatingAutonomic vegetative disorders are common feature in the patients with parkinson's disease. They had influence on the course and the progression of the parkinson's diseases and they have a tendency of worsening with the development of the disease.

References: 1. Aristide Merola MD,PhD,Alberto Romagnolo MD,Michela Rosso MD et al. Autonomic dysfunction in Parkinson's disease:A prospective cohort studyMovement Disorders:Volume 33 (3);372‐390,2018 2. Jose‐Alberto Palma MD,PhDAutonomic dysfunction in Parkinson's disease and other synucleopathies:Introduction to the seriesMovement Disorders:Volume 33 (3);347‐348,2018 3.Liepelt‐Scarfone I, Pilotto A, Muller K, et al. Autonomic dysfunction in subjects at high risk for Parkinson's disease. J Neurol 2015;262:2643‐2652.

151

Using measurement of the current perception threshold to assess the effect of levodopa on peripheral nerve function in patients with Parkinson's disease

Yitong Xiong, Cheng Jie Mao, Chunfeng Liu, Hanying Gu (Suzhou, Jiangsu, People's Republic of China)

Objective: The aim of this study is to evaluate the role of levodopa exposure as a potential risk factor of neuropathy in patients with Parkinson's disease (PD) and to evaluate the role of current perception threshold (CPT)measurement in peripheral neuropathy in PD patients by using the Neurometer, a nerve measuring instrument.

Background: In recent years, many studies have shown that PD not only affects the central nervous system, but also involves the peripheral nervous system. Whether there is a causal relationship between the treatment of LD in PD patients and the occurrence of PN has been a hot topic of research. However, these studies rarely exclude other factors, including the possibility that PD disease itself causes peripheral neuropathy. We stratified PD patients according to LD medication time to determine the pathogenic effect of levodopa on peripheral neuropathy. We used Neurometer to detect the sensory thresholds of three types of afferent nerve fibers in PD patient, the only detection method which can comprehensively evaluate sensory nerve function.

Methods: We enrolled 55 patients with idiopathic PD. With respect to levodopa exposure, 20 PD patients had long exposure (>3 years) to levodopa (LELD), 16 PD patients had short exposure (<3 years) to levodopa (SELD), and 19 PD patients had no exposure to levodopa (NOLD). Measurement of CPT using the Neurometer at 2000, 250 and 5 Hz assesses function in the bilateral median nerve in all studied cases. We also evaluated the level of homocysteine, Vitamin B12, folic acid of all patients. Data were compared with those obtained from sex‐and age‐coparable heathy controls.

Results: CPT was higher at 250 Hz and 5 Hz in LELD group versus healthy controls (HCs) (P < 0.05). CPT was lower at 5 Hz in NOLD group versus HCs group (P < 0.05). After excluding the factors, such as the disease duration, etc., the CPT value of the sides of LELD group was higher than NOLD group (P=0.003, P=0.008), and CPT value of the more affected side of the SELD group was higher than NOLD group (P=0.031). The CPT value at 5 Hz on the more affected side of PD patients was significantly positively correlated with H‐Y stage (r=0.278, p=0.040). Moreover, By comparing LELD group and HCs group, the serum homocysteine levels were higher (P < 0.05).

Conclusions: Our results suggest that peripheral neuropathy can occur in the early stage of PD, which may be related to the disease itself. Long‐term use of LD is an important risk factor for PDPN, especially for Ad and C fibers. In addition, PD sensory afferent disorder may be associated with dyskinesia, and early detection and treatment of PDPN has great clinical significance. Patients with PD who are taking levodopa treatment should be monitored for HCY, vitamin B12 and folate levels. We recommend early clinical and neurophysiological assessment of PD patients. The use of the Neurometer to measure CPT is a simple and reliable method to assess the early stages of neurological status around the PD.

References: [1] Shahrizaila N, Mahamad UA, Yap AC, Choo YM, Marras C, Lim SY. Is chronic levodopa therapy associated with distal symmetric polyneuropathy in Parkinson's disease. Parkinsonism Relat Disord. 2013. 19 (3): 391‐3. [2] Toth C, Breithaupt K, Ge S, et al. Levodopa, methylmalonic acid, and neuropathy in idiopathic Parkinson disease. Ann Neurol. 2010. 68 (1): 28‐36. [3] de Araújo DF, de Melo Neto AP, Oliveira ÍS, et al. Small (autonomic) and large fiber neuropathy in Parkinson disease and parkinsonism. BMC Neurol. 2016. 16: 139. [4] Doppler K, Ebert S, Uçeyler N, et al. Cutaneous neuropathy in Parkinson's disease: a window into brain pathology. Acta Neuropathol. 2014. 128 (1): 99‐109. [5] Giannoccaro MP, Donadio V, Incensi A, et al. Skin biopsy and I‐123 MIBG scintigraphy findings in idiopathic Parkinson's disease and parkinsonism: a comparative study. Mov Disord. 2015. 30 (7): 986‐9.

152

A‐synuclein‐inducing unstability of BMAL1 mRNA leads to circadian rhythm disruption in Parkinson's disease animal model

Yali Wang, Xin‐xin Gu, Fen Wang, Chunfeng Liu (Suzhou, People's Republic of China)

Objective: This research was to investigate whether the circadian dysfunction can be induced by over‐expression of a‐synuclein and to uncover the underlying mechanism.

Background: Circadian dysfunction are commonly observed in Parkinson's disease (PD) and other synucleinopathy. However, whether the aggregation of a‐synuclein (SNCA) is related with the circadian disruption is unclear.

Methods: The transgenic mice with SNCAA53T over‐expression and littermates are applied in our studies. And the free‐running system was used to detect the period of rest‐activity cycle. The activity amount per hour was measured by the energy metabolism cage system. In the molecular level, western blotting and QPCR were to determine the alterations of clock genes, respectively. The stable PC12 cell with SNCA and vector over‐expression was obtained by the lenti‐virus infection method. The BMAL1 protein degradation rate was measured by western blotting and the stability of BMAL1 mRNA was determined by QPCR. At last, the miR‐155 level was checked and its inhibitor was used to further confirm whether BMAL1 was regulated by the miR‐155.

Results: Both in the 3‐month‐old and 5‐month‐old mice, the period of rest‐activity cycle did not differ in the SNCAA53T mice from that of wild‐type littermates. But the energy metabolism cage test showed that the 24‐hour activity pattern in the SNCAA53T mice was different from that of wild‐type littermates. And in the 5‐month‐old SNCAA53T mice, the BMAL1 mRNA and BMAL1 protein was significantly lower than that in the age‐matched littermates. In vitro, the expression of BMAL1 protein and mRNA was inhibited induced by the SNCA expression in the PC12 cell line. When compared with the Vector group, the degradation of BMAL1 did not change after the SNCA over‐expression. Importantly, we found the stability of BMAL1 mRNA decreased, especially at 3‐hour after the Dactinmycin treatment. Furthermore, we found that miR‐155 increased induced by SNCA over‐expression and the decreased BMAL1 level could be partially reversed by the inhibitor of miR‐155.

Conclusions: Our study indicated that the biorhythm disruption and abnormal expression pattern of clock genes could be induced by SNCA over‐expression. The underlying mechanism may be due to the decreased unstability of BMAL1 mRNA resulted by the miR‐155.

References: 1.A. Videnovic, G.L. Willis, Circadian system ‐ A novel diagnostic and therapeutic target in Parkinson's disease?, Mov Disord 31 (2016) 260‐269.2.A. Videnovic, A.S. Lazar, R.A. Barker, S. Overeem, 'The clocks that time us'‐‐circadian rhythms in neurodegenerative disorders, Nat Rev Neurol 10 (2014) 683‐693.

Figure 1.

 

153

Sleep disorders in Parkinson's disease, depending on the form, stage and level of the neuron specific protein S100B

Rustambek Matmurodov, Khanifa Khalimova, Eldor Abdukadirov (Tashkent City, Uzbekistan)

Objective: To study the clinical manifestations of sleep disorders in Parkinson's disease depending on the form and stage of the disease and of level of the neuron specific protein S100B.

Background: Parkinson's disease is characterized by sleep disorders, which progresses the course of the disease.

Methods: 51 patients with PD (mean age 47.8+7.1 years) were examined. The control group consisted of 20 patients without PD, coinciding with the main groups by age and sex. All patients underwent a clinical neurologic examination, including a detailed assessment of motor disorders using the unified Parkinson's disease Assessment Scale. To determine the violation of sleep, special questionnaires were used. The level of S100B of neuron‐specific protein was determined by the method of enzyme immunoassay.

Results: According to the results of our scientific research, we show that 21 (51.2%) patients had insomnia, 12 (29.2%) had parasomnia and 8 (19.6%) had hypersomnia. In the control group, these indicators were 4‐5 times less than the main group. Analysis of our study shows that the structure of sleep disturbance depends on the form of PD. Thus, insomnia was more common in akinetic‐rigid form (57.1%), when, as with a mixed form, hypersomnia (62.5%) was more observed than an akinetic‐rigid and trembling form. The degree of sleep disturbance in PD depends on the form and stage of the disease, so in the akinetic‐rigid‐jittery‐mixed series, the progression of sleep disturbance is observed, which leads to the development in the developed stages of the disease of dementiaviolations. A comparison of somnolence on the Epworth scale that, with PD, the mean score was 2.6±1.4, in the control group 0.8±1.7. In the next stage of the study, we carried out an analysis of the relationship in 51.2% of patients, sleep disturbance occurred in the form of insomnia, in 29.2% in the form of parasomnia, in 1.6% in the form of hypersomnia, and the amount of S100B protein was 118.6±8.5, 99.24±4.8?and 158.6±5.6 ng/l.

Conclusions: Depending on the amount of S100B protein in the serum of the blood, conclusions can be drawn about the severity of sleep disturbance. This can also be confirmed by the fact that deep disorders lead to hypersomnia, and the corresponding increase in the amount of protein corresponds to each other. In the mixed form of the unfolded stage, deep sleep disturbances are observed with an increase in the level of the neuron of a specific protein in the blood plasma.

154

Assessment of pain and its correlation with quality of life in Parkinson's disease – an experience from tertiary care centre in India

Arun Agrawal, Kuljeet Anand, Jyoti Garg (New Delhi, India)

Objective: To assess the prevalence and character of pain, and its correlation with quality of life (QoL) and severity of motor symptoms in Parkinson's disease (PD) patients.

Background: Pain is a common and distressing non‐motor symptom in PD but often overlooked even by experts. Even in a recent review of practice standards by the American Academy of Neurology, pain was not even mentioned in the treatment guidelines for non‐motor symptoms of PD. Many studies have suggested a relation between pain and motor fluctuations in PD while others haven't found that. Pain in PD is associated with reduced QoL, but in some studies they have found no correlation between pain and QoL in PD, despite pain being very frequent and troublesome. There have been very few studies on this aspect particularly from India.

Methods: In this cross‐sectional study 100 PD patients diagnosed based on UK brain bank criteria were selected and recruited as per certain inclusion and exclusion criteria. Disease severity and staging was assessed by Unified Parkinson's Disease Rating Scale (UPDRS) III, V and VI. Pain was evaluated by King's Parkinson Disease Pain Scale (KPPS). QoL was assessed using Parkinson disease questionnaire‐8 (PDQ‐8).

Results: Mean age of subjects was 62.70 ± 11.18 years with age range of 38‐85 years. Men: women ratio was 73:27. Mean duration, age of onset and levodopa equivalent daily dose (LEDD) were 56.94 ± 46.22 months, 57.77 ± 12.05 years, 414.11 ± 318.99 mg respectively. Mean ± SD of UPDRS III, V and VI scores were 15.01 ± 7.55, 2.39 ± 0.72 & 79.57 ± 18.70 respectively. Prevalence of pain was 70% with mean KPPS of 5.23 ± 6.42. Different types of pain included musculoskeletal pain (53%, most common) followed by fluctuation related pain (35%), nocturnal pain (27%), radicular pain (17%), chronic pain (13%), orofacial pain (12%), and discoloration related pain (11%). Subjects with pain had lower mean age, more disease duration, younger age of onset, high LEDD and higher UPDRS III scores compared to subjects without pain but the scores didn't differ significantly (p > 0.05) between two groups, however the difference in mean UPDRS V and VI between the two groups was significant statistically (p < 0.05). KPPS scores had a positive correlation with UPDRS III and V with correlation coefficient (r) = +0.494 and +0.347 respectively while correlation with UPDRS VI was negative with r = ‐0.461 and all these correlations were significant (p < 0.05). The mean ± SD of PDQ‐8 and PDQ‐8 SI (summary index) in subjects with pain were 8.71 ± 5.30 and 27.23 ± 16.57 respectively and were significantly higher (indicating poor QoL) than those without pain having 3.30 ± 4.10 and 10.31 ± 12.82 respectively (p < 0.0001). (Table 1) The difference in mean PDQ‐8 and PDQ‐8 SI values for each type of pain character also differed significantly between two groups (p < 0.05). (Table 2)

Conclusions: Our study revealed high prevalence of pain (70%) among patients with Parkinson's disease (PD). Different pain types included musculoskeletal, chronic, fluctuation‐related, nocturnal, oro‐facial, discoloration and Radicular pains. Musculoskeletal pain (53%) was most common type of pain followed by fluctuation related pain (35%). Majority of PD patients had one or more types of pain symptoms which significantly affected their quality of life. There was no statistically significant correlation of pain with age, disease duration, age of onset and levodopa equivalent daily dose. There was statistically significant correlation of pain with motor disability, staging of disease and functional disability (UPDRS III, V and VI) respectively.

References: 1. Valkovic P, Minar M, Singliarova H et al. Pain in Parkinson's Disease: A Cross‐Sectional Study of Its Prevalence, Types, and Relationship to Depression and Quality of Life. PLoS ONE 2015; 10 (8): 0136541.2. 2.Roh JH, Kim B‐J, Jang J‐H, et al. The relationship of pain and health‐related quality of life in Korean patients with Parkinson's disease. Acta Neurol Scand 2009: 119: 397–403.

Table 1.

Comparison of QoL indices between study subjects with and without pain

	Pain present N = 70		Pain Absent N = 30		p	All subjects N = 100
	Range	Mean ± SD	Range	Mean ± SD		Mean ± SD
PDQ‐8	0‐20	8.71 ±5.30	0‐17	3.30 ±4.10	<0.0001	7.09 ± 5.55
PDQ‐8 SI (%)	0‐62.50	27.23 ± 16.57	0‐53.12	10.31 ± 12.82	<0.0001	22.15 ± 17.33

Table 2.

PDQ‐8 and PDQ‐8 SI according to different types of pain in KPPS

Type of pain		N	PDQ‐8		PDQ‐8 SI
			Mean ± SD	p‐value	Mean ± SD	p‐value
Musculoskeletal Pain	Present	53	9.17 ±5.60	<0.05	28.65 ±17.50	<0.05
	Absent	47	4.74 ± 4.48		14.82 ± 14.01
Chronic Pain	Present	13	11.0 ±5.85	<0.05	34.37 ± 18.27	<0.05
	Absent	87	6.51 ±5.29		20.32 ± 16.53
Fluctuation‐related Pain	Present	35	9.86 ±5.24	<0.05	30.80 ± 16.38	<0.05
	Absent	65	5.60 ±5.15		17.50 ± 16.09
Nocturnal Pain	Present	27	10.59 ±4.99	<0.05	33.10 ± 15.61	<0.05
	Absent	73	5.79 ±5.19		18.11 ± 16.23
Oro‐facial Pain	Present	12	11.33 ±5.14	<0.05	35.41 ± 16.06	<0.05
	Absent	88	6.51 ±5.37		20.35 ± 16.78
Discolouration; Oedema/swelling	Present	11	11.55 ±4.59	<0.05	36.08 ± 14.35	<0.05
	Absent	89	6.54 ± 5.42		20.43 ± 16.95
Radicular Pain	Present	17	11.12 ± 5.18	<0.05	34.74 ± 16.20	<0.05
	Absent	83	6.27 ±5.28		19.58 ± 16.49

155

Bone mineral density, osteoporosis and fracture risk in Parkinson's disease

Yan Jing Tan, Yong Wei, Yi‐De Ng, Xing Yan Choo, Kavita Sugumaran, Mohammad Nazri Md Shah, Raja Rizal Azman Raja Aman, Norlisah Mohd Ramli, Shen‐Yang Lim, Mathis Grossmann, Ai Huey Tan (Triang, Malaysia)

Objective: To investigate the differences in bone mineral density and ten‐year probability risk of major osteoporotic fracture and hip fracture between Parkinson disease (PD) patients and controls; and their correlates.

Background: PD patients are at increased risk of recurrent falls. Results of previous studies on bone mineral density (BMD) and prevalence of osteoporosis in PD are conflicting, and to our knowledge, no studies evaluated risk of major fractures in PD.

Methods: Consecutive PD patients and spousal/sibling controls underwent dual‐energy X‐ray absorptiometry (DEXA) to evaluate bone mineral density (BMD) of the femoral neck, forearm radius and lumbar spine. Osteopenia and osteoporosis were defined according to the World Health Organization (WHO) diagnostic classification. Ten‐year probability of major osteoporotic and hip fracture was calculated using the Fracture Risk Assessment Tool (FRAX). Additionally, PD patients underwent assessment of disease severity and blood analysis of vitamin D, homocysteine, luteinizing hormone (LH), follicle‐stimulating hormone (FSH), oestradiol and testosterone. To date, 41 patients and 30 controls have been recruited in this ongoing study.

Results: There were no significant between‐group differences in age, gender, body mass index, and usage of bone mineral medications. We found no significant between‐group differences in BMD of the 3 regions assessed, or in the risk of major osteoporotic and hip fracture. When considering the lowest T‐score of the three regions, 56.1% of PD patients had osteopenia and 17.1% had osteoporosis, with no significant differences compared to controls. 41.5% of patients were vitamin D deficient. In the patient group, the risk of major osteoporotic fracture correlated significantly with age (R=0.556, p=<0.001), gender (R=0.400, p=0.012), FSH (R=0.434, p=0.007), and BMD of femoral neck (R=‐0.756, p<0.001) and radius (R=‐0.519, p=0.005).

Conclusions: Preliminary data of this study found no significant between‐group differences in BMD, prevalence of osteopenia and osteoporosis, or risk of major osteoporotic and hip fracture. BMD of the femoral neck and radius (but not the spine) and FSH were significantly associated with risk of major osteoporotic fracture in PD, highlighting the importance of evaluating these parameters in PD. Recruitment is ongoing to achieve a larger sample size to explore the predictors of osteoporosis and fracture risk in PD.

References: Allen NE, Schwarzel AK, Canning CG. Recurrent Falls in Parkinson's Disease: A Systematic Review. Parkinsons Disease. 2013:1‐16. Zhao Y, Shen L, Ji H. Osteoporosis risk and bone mineral density levels in patients with Parkinsons disease: A meta‐analysis. Bone. 2013; 52 (1), 498‐505. Kanis JA, on behalf of the World Health Organisation Scientific Group. Assessment of osteoporosis at the primary health care level. WHO Collaborating Centre for Metabolic Bone Diseases, University of Sheffield 2007.

Table 1.

Demographics and Clinical Characteristics

	PD patients (n=40)	Controls (n=29)	P values
Age	69.24 = 9.18	66.73 = $.11	0.236
Gender (% male)	53.7	46.7	0.732
Ethnicity			0.930
% Chinese	68.3	70
% Indian	22.0	16.7
% Malay	7.3	10.0
% Others	2.4	3.3
Highest level of education			0.455
% Tertiary	43.9	33.3
% Secondary	46.3	50.0
% Primary	7.3	16.7
% None	2.4	0
Body mass index (kg nr)	23.4 = 3.6	24.6 = 3.9	0.157
PD history & disease severity
Disease duration (years)	12.66 = 5.81
Age at onset (years)	57.41 = 10.41
Hoehn & Yahr stage
% Stage I	2.4
% Stage II	56.1
% Stage IE	29.3
% Stage IV	9.8
% Stage V	2.4
MDS‐UPDRS part 1 (0‐52)	11.66 = 5.17
MDS‐UPDRS part 2 (0‐52)	18.95 = 9.84
MDS‐UPDRS part 3 (0‐132)	38.76=14.88
MDS‐UPDRS part 4 (0‐24)	4.12 = 3.78
PD subtype
% Tremor‐dominant	4.9
% Postural instability, gait difficulty'	82.9
% Mixed	12.2
% With motor response complications	61.0
Levodopa equivalent daily dosage (mg day)	665.83 = 428.04
% Bisphosphonate intake	4.9	0.0	0.505
% Supplemental vitamin D intake	26.8	23.3	0.953
% Supplemental calcium intake	36.6	23.3	0.351

Table 2.

Bone mineral density, osteopenia and osteoporosis

	PD patients (n=40)	Control (n=29)	P value
Whole‐body bone mineral density (g/cm2)	1.02 ±0.13	1.03 = 0.15	0.885
Bone mineral density
Lumbar spine (gcm2)	1.05 ±0.19	1.04 = 0.24	0.834
Femur neck (gcm2)	0.82 ±0.13	0.81 ±0.13	0.627
Forearm radius (gcm2)	0.76 ±0.15	0.70 = 0.33	0.344
T‐score
Lumbar spine	‐1.32 ±1.45	‐1.38=1.92	0.888
Femur neck	‐1.75 ±0.90	‐1.82 ±0.90	0.737
Forearm radius	‐1.93 = 1.29	‐1.74 = 0.98	0.511
BMD category for femoral neck
% Normal	20.5	13.3	0.6S6
% Osteopenia	61.5	63.3
% Osteoporosis	17.9	23.3
BMD category for lumbar spine
% Normal	35.0	33.3	0.271
% Osteopenia	47.5	33.3
% Osteoporosis	17.5	33.3
BMD category for forearm radius
% Normal	14.6	23.3	0.430
% Osteopenia	68.3	53.3
% Osteoporosis	17.1	23.3
% Prevalence of osteopenia and osteoporosis based on the lowest T‐score of the lumbar spine, femoral neck, and forearm radius
% Normal	26.8	30.0	0.503
% Osteopenia	56.1	43.3
% Osteoporosis	17.1	26.7

156

The clinical research of Parkinson's disease with rapid eye movement sleep behavior disorder

Ying Wang, Yaping Hu, Yun Zhang, Zhanhua Liang, Shuzhao Ge, Wendi Zhang (Dalian, People's Republic of China)

Objective: To compare the differences of clinical characteristics between PD patients with rapid eye movement sleep behavior disorder (RBD) (RBD+ group) and those without RBD (RBD‐ group). To explore new ideas for the study of pathogenesis, early diagnosis and treatment of PD.

Background: The clinical features of PD patients with RBD were different from those without RBD, suggesting that PD may have different clinical subtypes.

Methods: In this cohort study, 53 patients with primary PD were enrolled. The PD patients with RBD were further divided into ERBD group and LRBD group according to the medical history. The statistical methods were used to compare the motor symptoms, cognitive function, anxiety and depression, the prevalence rate of obstructive sleep apnea symptom (OSAS), sleep parameters and sleep structure among groups.

Results: 1.The motor symptoms, cognitive function, depression and anxiety of PD patients with RBD were more serious than those without RBD. 2. The REM sleep time of PD patients with RBD was longer than that in PD patients without RBD, while the prevalence rate of OSAS of PD patients with RBD was lower than that in PD patients without RBD. 3. Compared with the patients whose RBD symptoms prior to PD, those RBD symptoms' occuring at the same time as PD or secondary to PD showed more serious motor symptoms, shorter sleep time of REM and more resistance to anti‐PD drugs. 4.The patients whose RBD symptoms' occuring at the same time as PD or secondary to PD were younger than those RBD symptoms prior to PD. The sleep time of REM for the patients with RBD symptoms prior to PD was longer than that of PD patients without RBD.

Conclusions: 1. Cognitive protection and psychological intervention should be taken early for PD patients with RBD. 2. RBD might be a protective factor for OSAS. Continuous positive airway pressure should be applied early for the PD patients without RBD who were combined with OSAS to improve the chronic hypoxia in patients. 3. The prognosis of patients with RBD symptoms prior to PD is better. 4. PD might have different clinical subtypes in terms of pathogenesis.

References: Albers J A, Chand P, Anch A M. Multifactorial sleep disturbance in Parkinson's disease[J]. Sleep Med, 2017,35:41‐48. Jankovic M, Svetel M, Kostic V. Frequency of REM sleep behavior disorders in patients with Parkinson's disease[J]. Vojnosanit Pregl, 2015,72 (5):442‐446. Fantini M L, Macedo L, Zibetti M, et al. Increased risk of impulse control symptoms in Parkinson's disease with REM sleep behaviour disorder[J]. J Neurol Neurosurg Psychiatry, 2015,86 (2):174‐179.

157

Evaluation of olfactory function and related factors in patients with Parkinson's disease

Liu Xiangdan, Yuling Tian (Taiyuan City, People's Republic of China)

Objective: To investigate the incidence of olfactory disturbance and its possible related factors in patients with Parkinson's disease.

Background: Olfactory dysfunction is one of the first non‐motor symptoms of Parkinson's disease (PD). About 90% of patients with early PD have olfactory dysfunction and can appear several years before exercise symptoms. However, in reality, the subjective symptoms of individuals are not always consistent with the actual degree of olfactory dysfunction, so the degree of olfactory disorder in Parkinson's disease is difficult to quantify. Although there are many methods for olfactory examination, the nationalities, cultures, and customs of different countries are different, and the familiar tastes are different. Therefore, we used the Jinmomer‐Parkinson's disease olfactory impairment aided diagnostic card designed specifically for Chinese to perform olfactory testing.

Methods: A total of 126 patients with Parkinson's disease and 120 normal volunteers were selected to evaluate olfactory function using the Olfactory Test Card of Parkinson's disease (Kin Pamor). Olfactory assessment was performed on the two groups, and the incidence of olfactory disorders was compared between the two groups.Analysis the relation between the age, gender, age of onset, duration of disease, Hohn‐Yahr stage, UPDRS‐III score, RBD, constipation, education, substantia nigra, residual urine and olfactory function.

Results: The olfactory score of the Parkinson's disease group (5.69±2.58) was significantly lower than that of the control group (9.31±2.07), and the difference was statistically significant (P=0.000). According to the clinical trial results of the Olfactory Test Card of Parkinson's disease (Kin Pamor), the boundary value was selected as 8 points, and the incidence of olfactory disturbance in the Parkinson's disease group was 75.39%.The correlation analysis showed that the sex, age, and onset a age, education, constipation, substantia nigra were associated with olfactory dysfunction; duration, Hohn‐Yahr staging, UPDRS‐III score, RBD, residual urine were not associated with olfactory dysfunction (P>0.05).

Conclusions: The incidence of olfactory disturbance in patients with Parkinson's disease is high. The olfactory function of patients with Parkinson's disease was related to age, gender, education level, age of onset, constipation and substantia nigra ultrasound; it was not associated with disease course, Hohn‐Yahr stage, UPDRS‐III score, RBD, and residual urine.

References: [1]Doty R L. Olfactory dysfunction in Parkinson disease[J]. Nature Reviews Neurology, 2012, 8 (6):329. [2]Park J W, Kwon D Y, Choi J H, et al. Olfactory dysfunctions in drug‐naïve Parkinson's disease with mild cognitive impairment. [J]. Parkinsonism & Related Disorders, 2017, 46. [3]Postuma R B, Berg D, Stern M, et al. MDS clinical diagnostic criteria for Parkinson's disease[J]. Mov Disord, 2015, 30 (12):1591‐1601. [4]Braak Heiko,Del Tredici Kelly,Rüb Udo et al. Staging of brain pathology related to sporadic Parkinson's disease. [J] .Neurobiol. Aging, 2003, 24 (2): 197‐211. [5]A. Haehner,S. Boesveldt,H.W. Berendse,A. Mackay‐Sim,J. Fleischmann,P.A. Silburn,A.N. Johnston,G.D. Mellick,B. Herting,H. Reichmann,T. Hummel. Prevalence of smell loss in Parkinson's disease – A multicenter study[J]. Parkinsonism and Related Disorders,2008,15 (7). [6]Haugen Jacob,Müller Martijn L T M,Kotagal Vikas et al. Prevalence of impaired odor identification in Parkinson disease

with imaging evidence of nigrostriatal denervation. [J] .J Neural Transm (Vienna), 2016, 123 (4): 421‐4. [7]Brämerson Annika,Johansson Leif,Ek Lars et al. Prevalence of olfactory dysfunction: the skövde population‐based study. [J] .Laryngoscope, 2004, 114 (4): 733‐7. [8]Noel Julia,Habib Al‐Rahim R,Thamboo Andrew et al. Variables associated with olfactory disorders in adults: A U.S. population‐based analysis. [J] .World J Otorhinolaryngol Head Neck Surg, 2017, 3 (1): 9‐16. [9]Karpa Michael J,Gopinath Bamini,Rochtchina Elena et al. Prevalence and neurodegenerative or other associations with olfactory impairment in an older community. [J] .J Aging Health, 2010, 22 (2): 154‐68. [10]Hummel T, Konnerth C G, Rosenheim K, et al. Screening of olfactory function with a four‐minute odor identification test: reliability, normative data, and investigations in patients with olfactory loss[J]. Ann Otol Rhinol Laryngol, 2001, 110 (10):976‐981. [11]Doty R L,Deems D A,Stellar S. Olfactory dysfunction in parkinsonism: a general deficit unrelated to neurologic signs, disease stage, or disease duration. [J] .Neurology, 1988, 38 (8): 1237‐44. [12]Hawkes C H, Shephard B C, Daniel S E. Olfactory dysfunction in Parkinson's disease. [J]. Journal of Neurology, 2007, 254 (4):IV2‐IV7. [13]BERARDELLI A, WENNING GK, ANTONINI A, et al. EFNS/MDS‐ES recommendations for the diagnosis of Parkinson's disease [J]. European Journal of Neurology,2013,20 (1):16‐34. [14]Passali G C, Bove F,Vargiu L et al. New olfactometric findings in Parkinson's disease. [J] .Clin Otolaryngol, 2017, 42 (4): 837‐843. [15]Wu L,Mu N,Yang F et al. A study of the non‐motor symptoms in early Parkinson's disease with olfactory deficits. [J] .Eur Rev Med Pharmacol Sci, 2016, 20 (18): 3857‐3862. [16]Hawkes C H, Del T K, Braak H. Parkinson's disease: a dual‐hit hypothesis. [J]. Neuropathology & Applied Neurobiology, 2010, 33 (6):599‐614. [17]Huang S F, Chen K, Wu J J, et al. Odor Identification Test in Idiopathic REM‐Behavior Disorder and Parkinson's Disease in China:[J]. Plos One, 2016, 11 (8):e0160199. [18]Mazza S,Soucy J P,Gravel P et al. Assessing whole brain perfusion changes in patients with REM sleep behavior disorder. [J] .Neurology, 2006, 67 (9): 1618‐22. [19]Vengalil Seena,Agadi J B,Raghavendra K. University of Pennsylvania Smell Identification Test Abnormalities in Parkinson's Disease. [J] .J Assoc Physicians India, 2016, 64 (4): 32‐36. [20]Busse K, Heilmann R, Kleinschmidt S, et al. Value of combined midbrain sonography, olfactory and motor function assessment in the differential diagnosis of early Parkinson's disease. [J]. J Neurol Neurosurg Psychiatry, 2012, 83 (4):441. [21]Cavaco Sara,Gonçalves Alexandra,Mendes Alexandre et al. Abnormal Olfaction in Parkinson's Disease Is Related to Faster Disease Progression. [J] .Behav Neurol, 2015, 2015: 976589. [23]Fujita H, Suzuki K, Numao A, et al. Usefulness of Cardiac MIBG Scintigraphy, Olfactory Testing and Substantia Nigra Hyperechogenicity as Additional Diagnostic Markers for Distinguishing between Parkinson's Disease and Atypical Parkinsonian Syndromes[J]. Plos One, 2016, 11 (11):e0165869. [24]Zhang L M, Zhang X P. Investigation of Urination Disorder in Parkinson's Disease[J]. 2015, 128 (21):2906‐2912.

158

Body fat, sarcopenia and frailty in Parkinson's Disease

Yong Wei, Yan Jing Tan, Yi‐De Ng, Xing Yan Choo, Kavita Sugumaran, Mohammad Nazri Md Shah, Raja Rizal Azman Raja Aman, Norlisah Mohd Ramli, Mathis Grossmann, Shen‐Yang Lim, Ai Huey Tan (Kepong, Malaysia)

Objective: To evaluate body fat, sarcopenia and frailty in Parkinson's disease (PD).

Background: Frailty and sarcopenia are two overlapping geriatric conditions that may aggravate the functional impairment in patients with PD and increase the risk of adverse outcomes. Studies assessing these conditions, and changes in body fat, in PD are limited.

Methods: Consecutive PD patients and spousal/sibling controls underwent comprehensive assessment of disease severity, and body composition using dual‐energy X‐ray absorptiometry (DEXA). The combination of low muscle mass with low handgrip strength and/or impaired gait speed was classified as sarcopenia, using the Asian Working Group for Sarcopenia (AWGS) algorithm and cut‐offs. To date, 33 patients and 27 controls have been recruited in this ongoing study. Two models were used to define frailty. The Fried phenotype model encompasses five variables (weight loss, exhaustion, physical activity, walk time, and grip strength), while the cumulative deficit model encompasses 40 items in five domains (physical, cognitive‐psychological, visual/hearing, comorbidities, and physiological parameters).

Results: There were no significant between‐group differences in age, gender and education level. Mean PD disease duration was 13.5±6.1 years and 87.8% of the patients were Hoehn and Yahr stage 2 or 3. Self‐reported weight loss was higher in PD patients compared to controls (33.3% vs. 7.4%, P=0.025). Patients had lower whole‐body fat percentage (29.8%±8.7 vs. 34.3%±6.8; p=0.033) and reduced android: gynoid ratio (1.0±0.2 vs. 1.2±0.3; p=0.008). There were no significant between‐group differences in body mass index, fat mass index and skeletal muscle mass index. Patients had a higher prevalence of sarcopenia (30.3% vs. 7.4%; P=0.049) and frailty using both phenotype (63.6% vs. 11.1%; P<0.001) and cumulative models (78.8% vs. 18.5%; P<0.001).

Conclusions: Consistent with previous studies, preliminary data of this study showed that PD patients had a significant reduction in whole‐body fat, suggesting that fat loss is an important contributor to weight loss in PD. We found high prevalences of sarcopenia and frailty in a cohort comprising primarily physically independent patients with moderate‐stage PD. A larger sample size is needed to explore the predictors and the impact of sarcopenia and frailty in PD.

References: 1. LK Chen, L‐K Liu, J Woo, P Assantachai, TW Auyeung, KS Bahyah et al. Sarcopenia in Asia: consensus report of the Asian working group for sarcopenia. J Am Med Dir Assoc. 2014;15:95–101. 2. A Clegg, J Young, S Iliffe, MO Rikkert, K Rockwood, Frailty in elderly people. Lancet. 2013;381:752–762.3. AH Tan, YC Hew, S‐Y Lim, NM Ramli, SB Kamaruzzaman, MP Tan et al. Altered body composition, sarcopenia, frailty and their clinico‐biological correlates, in Parkinson's disease. Park Rel Disord. 2018; https://doi.org/10.1016/j.parkreldis.2018.06.020.

Table 1.

Demographic; and clinical characteristics.

	PD patients (n=33)	Controls (n=27)	P values
Age	68.9 ± 9.4	67.2 ± 8.2	0.425
Gender (% male)	51.5	44.4	0.614
Ethnicity			0.984
% Chinese	75.8	74.1
% Indian	12.1	14.8
% Malay	9.1	7.4
% Others	3.0	3.7
Highest level of education			0.382
% Tertiary	45.5	29.6
% Secondary	42.4	51.9
% Primary	9.1	18.5
% None	3.0	0.0
PD history' & disease severity
Disease duration (years)	13.5 ±6.1
Age at onset (years)	56.5 ±10.6
Hoehn & Yahr stage
% Stage I	0
% Stage II	54.5
% Stage III	33.3
% Stage IV	9.1
% Stage V	3.0
MDS‐UPDRS part 1 (0‐52)	10.9 ±5.1
MDS‐UPDRS part 2 (0‐52)	18.8 ± 10.2
MDS‐UPDRS part 3 (0‐132)	40.6 ±15.4
MDS‐UPDRS part 4 (0‐24)	3.9 = 3.6
PD subtype
% Tremor‐dominant	6.1
% Postural instability gait difficulty	78.8
% Mixed	15.2
% With motor response complications	57.6
Levodopa equivalent daily dosage	639.9 ±411.7

Table 2.

Anthropometric data, body composition, sarcoenia and family.

	PD patients (n=33)	Control (n=27)	P value
% Self‐reported weight loss > 5kg in the past	33.3	7.4	0.025*
Body mass index (kg m1)	23.2 ± 3.7	24.1 ±3.3	0.308
Body mass index classification			0.560
% Underweight (<8.5 kg/m2)	12.1	3.7
% Normal (18.5‐22.9 kg/m2)	36.4	44.4
% Pre‐obese (23.0‐27.4 kg/m2)	39.4	33.3
% Obese I (27.5‐34.9 kg/m2)	12.1	18.5
% Obese II (35.0‐39.9 kg/m2)	0.0	0.0
Whole‐body fat percentage (%)	29.8 ±8.7	34.3 ± 6.8	0.033*
Fat mass index (kg/m2)	6.9 ±2.7	8.0 ± 2.2	0.086
Body fat distribution
Android fat mass (kg)	1.4 ±0.7	l.8 ± 0.7	0.019*
Gynoid fat mass (kg)	2.5 ±0.9	3.1 ±1.1	0.033*
Trunk fat mass (kg)	9.0 ±3.9	11.3 ±3.4	0.018*
Limb fat mass (kg)	5.0 ±2.0	5.9 = 2.2	0.133
Andioid: gynoid fat mass ratio	1.0 ±0.2	1.2 ±0.3	0.008*
Skeletal muscle mass index (kg/m2)	6.9 ±1.2	6.8 ±1.1	0.975
% Reduced skeletal muscle mass index	30.3	18.5	0.375
% Sarcopenia	30.3	7.4	0.049*
Frailty [Phenotype model]
Mean number of deficits (0‐5)	2.7 ±1.3	1.0 ±1.1	<0.001*
% Non‐frail (no deficits)	3.0	44.4	<0.001*
% Pre‐frail (1‐2 deficits)	33.3	44.4
% Frail (≥ 3 deficits)	63.6	11.1
Frailty [Cumulative deficit model]
Cumulative frailty index (range 0‐1)	0.3 ±0.1	0.2 ±0.1	<0.001*
% Frail (frailty index score >0.2)	78.8	18.5	<0.001*

* denotes P<0.05

159

Clinical study of twenty‐four hour non‐invasive ambulatory blood pressure and heart rate monitoring in hospitalized patients with Parkinson's disease

Wan Liu, Weiguo Liu (Nanjing, People's Republic of China)

Objective: To investigate the characteristics of 24‐hour non‐invasive ambulatory blood pressure, heart rate, postprandial blood pressure and its possible influencing factors in hospitalized patients with Parkinson's disease.

Background: Parkinson's disease (PD) is a common neurodegenerative disorder whose clinical manifestations include motor symptoms and non‐motor symptoms.At present, there are few studies on non‐exercise symptoms. This paper mainly studies the 24‐hour blood pressure and heart rate changes of patients with Parkinson's disease.

Methods: A 24‐hour ambulatory blood pressure and heart rate monitoring was performed using a non‐invasive ambulatory blood pressure monitor to assess the subject's ambulatory rhythm and postprandial blood pressure changes. At the same time, hospitalized PD patient related scales were used to evaluate the related factors of pathological blood pressure rhythm and postprandial hypotension.

Results: 24‐hour non‐invasive ambulatory blood pressure monitoring showed a high prevalence of inverted dippers in PD patients and non‐dippers in control (P<0.01). The nocturnal blood pressure dip of PD patients was positively correlated with the age (r=‐0.454,P=0.005), which was not associated with disease duration, UPDRS III rating, HohenYahr staging and L‐dopa equivalent daily dose. Compared with the control, systolic blood pressure drop and incidence of hypotension after breakfast and after dinner were higher in PD patients (P<0.05). The decline in systolic blood pressure after breakfast was positively correlated with age in PD patients (r=0.361,P=0.028), which was not associated with disease duration, UPDRS III rating, HohenYahr staging and L‐dopa equivalent daily dose.

Conclusions: There are extensive nocturnal hypertension and postprandial hypotension in hospitalized PD patients. These abnormal blood pressure changes are related to age.

Table 1.

 

Figure 1.

 

Figure 2.

 

160

A clinical analysis of the pain associated with Parkinson Disease in 120 patients

Jie Zu, Hafiz Khuram Raza, Chuan‐Ying Xu, Chenchen Cui, Qihua Xiao, Guiyun Cui (Xuzhou, People's Republic of China)

Objective: To explore the characteristics of the pain associated with Parkinson's disease (PD) and its related factors.

Background:‐

Methods: The pain was evaluated in 120 patient with PD by the simple pain questionnaire and visual analogue scale (VAS). The third part of the unified PD rating scale (UPDRS) was used to evaluate the motor function, Hoehn‐Yahr grading scale was used to classify the disease, the Hamilton rating scale for depression (HAMD) scale was used to assess the depression, and the montreal cognitive assessment scale was employed to assess the cognitive function.

Results: Out of 120 patients, 84 patients (52.2%) reported having pain, and their average VAS score was 3.92 + 2.82. The most common pain sites were lower limbs (29.2%), back (27.1%), and shoulders (20.8%) while 15 patients (12.5%) had multiple pain sites. The most common types of pain were skeletal muscle pain (37.5%) and dyskinesia pain (20.8%). Eighteen patients (14.6%) had more than two types of pain. The UPDRS and HAMD scores of PD patients with pain were significantly higher than PD patients without pain (P < 0.05). Multivariate Logistic stepwise regression analysis showed that the pain associated with PD was correlated with UPDRS‐lll scores and HAMD scores (OR = 1.422, 95% C /: 0.245‐0, 768, P < 0.01; OR = 0, 975, 95% 6'/: 0.426‐0, 860, P < 0.05).

Conclusions: There is a high incidence of pain in patients with PD and the pain is, perhaps, related to the motor dysfunction and depression.

References: 1. Silverdale M A, Kobylecki C, Kass‐Iliyya L, et al. A detailed clinical study of pain in 1957 participants with early/moderate Parkinson's disease[J]. Parkinsonism & Related Disorders, 2018.2. Lin X J, Yu N, Lin X G, et al. A clinical survey of pain in Parkinson's disease in Eastern China. [J]. International Psychogeriatrics, 2016, 28 (2):283‐289.3. Rana A, Saeed U, Masroor M S, et al. A cross‐sectional study investigating clinical predictors and physical experiences of pain in Parkinson's disease. [J]. Functional Neurology, 2013, 28 (4):297‐304.4. Valkovic P, Minar M, Singliarova H, et al. Pain in Parkinson's Disease: A Cross‐Sectional Study of Its Prevalence, Types, and Relationship to Depression and Quality of Life[J]. Plos One, 2015, 10 (8).

161

The risk factor and correlation analysis of Fatigue and apathy in Parkinson's disease

Yuling Tian, Tihong Liu (Taiyuan, People's Republic of China)

Objective: To understand the occurrence of fatigue and apathy in patients with Parkinson's disease (PD) and to study the influence factors of the symptoms and their correlation between the two.

Background: Fatigue and apathy are the most common and most disabling non‐motor symptoms of PD, which are difficult to identify and distinguish clinically. Some studies have confirmed that its impact on patients' quality of life may be more severe than motor symptoms. Risk factors affecting fatigue and apathy in patients with Parkinson's disease are still unclear; in pathophysiology, studies suggest that PD fatigue and apathy are multifactorial, but anatomical basis suggests PD fatigue and prefrontal and posterior cortex. The relationship between the increase is related to the occurrence of apathy and the anterior frontal cortex basal ganglion axis. There may be correlation between the two, and there may even be a common cause; pathological staging indicates that fatigue occurs in Break II, and emotional apathy occurs in Break III and IV, and it is unclear whether the conjecture is the development of different stages of the same symptom. There are no clear and effective drugs for treatment. That is to say, the etiology and pathogenesis of PD combined fatigue and apathy are not very clear. The two are independent or mutually influential, and there is controversy. The purpose of this study is to determine the occurrence of PD fatigue and apathy, risk factors and the two. The correlation is to improve the clinician's recognition rate of symptoms, to improve the treatment rate of patients, thereby improving the daily living ability of patients and improving the quality of life.

Methods: We recruited the 66 idiopathic PD patients who visited our department of neurology, from November 2016 to November 2017 and prospectively assessed Fatigue Severity Scale (FSS) score, Modified Apathy Evaluation Scale (MAES) score. Other clinical measures including: severity of Motor symptoms, severity of PD, depression, anxiety and ability of daily living. Logistic regression analysis was used to analyze factors related to fatigue and apathy in PD, Spearman correlation analysis was used to analyze the correlation between the two.

Results: 1. Of the total sample, 63.6% of patients with PD had fatigue, and 57.6% experienced apathy. Among them, 27 cases (40.9%) fatigued PD subjects were apathetic, 15 cases (22.8%) were fatigued only, and 11 cases (16.7%) were only apathetic. 2. In contract, Hoehn&Yahr score, the UPDRS Part 3 score, Hamilton Depression Rating Scale (HAMD), and LDE were all significantly difference in the fatigue group (high fatigue /low apathy) than in the control group (low fatigue /low apathy) ( P<0.05); Similarly, The UPDRS part 3, HAMD was statistically significant (P<0.05) between apathy group (high apathy /low fatigue) and control group ( low fatigue /low apathy). 3. Analyses showed that the risk factors for predicting the occurrence of fatigue and apathy were UPDRS part 3 (OR=2.860,95%CI 0.005~0.026)and (OR=1.064,95%CI 0.060~0.473),the severity of motor symptoms is a risk factor for both.4.Correlation analysis found that there was a significant correlation between FSS average scores and AS total scores in PD (r=0.381,P<0.05).

Conclusions: Fatigue and apathy are the common non‐motor symptoms in Parkinson's disease (PD),the severity of motor symptom is a common predictive factor and the two symptoms are correlation.

References: [1]Li k, Morris HR. Parkinson's disease: chameleons and mimics [J]. Practical Neurology, 2015, 15 (1):14‐25. [2]Kalia LV, Lang A E. Parkinson's disease [J]. Lancet, 2015, 386 (9996): 896‐912. [3]Chaudhuri KR1, Odin P, Antonini A, Martinez‐Martin P. Parkinson's disease: The non‐motor issues [J]. Parkinson & Related Disorders, 2011, 17 (10): 717‐723. [4]Tessitore A, Giordano A, De Micco R, Caiazzo G, Russo A, Cirillo M, Esposito F, Tedeschi G. Functional connectivity underpinnings of fatigue in “Drug‐Naive” patients with Parkinson's disease [J]. Movement Disorder, 2016, 31 (10):1497‐1505. [5]Postuma RB, Berg D, Stern M, Poewe W, Olanow CW, Oertel W, Obeso J, Marek K, Litvan I, Lang AE, Halliday G, Goetz CG, Gasser T,Dubois B, Chan P, Bloem BR, Adler CH, Deuschl G.MDS clinical diagnostic criteria for Parkinson's disease [J]. Movement Disorders Official Journal of the Movement Disorder Society, 2015, 30 (12):1591‐1601. [6]Krupp LB, LaRocca NG, Muir‐Nash J, Steinberg AD. The fatigue severity scale. Application to patients with multiple sclerosis and systemic lupus erythematosus [J] . Arch Neurology, 1989, 46 (10): 1121‐1123. [7]Kluger BM, Herlofson K, Chou KL, Lou JS, Goetz CG, Lang AE, Weintraub D8, Friedman J. Parkinson's Disease‐related Fatigue: A Case Definition and Recommendations for Clinical Research [J]. Movement Disorders, 2016, 31 (5):625‐631. [8]Starkstein SE, Mayberg HS, Preziosi TJ, Andrezejewski P, Leiguarda R, Robinson RG. Reliability, validity, and clinical correlates of apathy in Parkinson's disease [J]. Journal of Neuropsychiatry & Clinical Neurosciences, 1992, 4 (2): 134‐139. [9]Friedman JH, Beck JC, Chou KL, Clark G, Fagundes CP,Goetz CG, Herlofson K, Kluger B, Krupp LB,Lang AE, Lou JS, Marsh L, Newbould A, and Weintraub D.Fatigue in Parkinson's disease: report from a multidisciplinary symposium [J]. NPJ.Parkinson's Disorder, 2016, 2:15025[10]Zwarts MJ, Bleijenberg G, van Engelen BG. Clinical neurophysiology of fatigue [J]. Clinical Neurophysiology Official Journal of the International Federation of Clinical Neurophysiology, 2008, 119 (1): 2‐10. [11]Kostic VS, Tomic A, Jecmenica‐Lukic M. The Pathophysiology of Fatigue in Parkinson's Disease and its Pragmatic Management [J]. Movement Disorders Clinical Practice, 2016, 3 (4):323‐330. [12]Pagonabarraga J, Kulisevsky J, Strafella AP, Krack P. Apathy in Parkinson's disease: clinical features, neural substrates, diagnosis, and treatment [J]. Lancet Neurology, 2015, 14 (5):518‐531. [13]Lou JS, Kearns G, Benice T, Oken B, Sexton G, Nutt J. Levodopa improves physical fatigue in Parkinson's disease: a double‐blind, placebo‐controlled, crossover study [J]. Movement Disorders Official Journal of the Movement Disorder Society, 2003, 18 (10):1108–1114[14]Szatmari S, Illigens BM, Siepmann T, Pinter A, Takats A, Bereczki D. Neuropsychiatric symptoms in untreated Parkinson's disease. Neuropsychiatric Disease & Treatment, 2017, 13:815‐826. [15]Elbers R, Van Wegen E H, Rochester L. Is impact of fatigue an independent factor associated with physical activity in patients with idiopathic Parkinson's disease [J]. Movement Disorders, 2010, 24 (10): 1512‐1518. [16]van Dijk JP, Havlikova E, Rosenberger J, Nagyova I, Skorvanek M, Gdovinova Z, Lok W, Groothoff JW, Middel B. Influence of disease severity on fatigue in patients with Parkinson's disease is mainly mediated by symptoms of depression [J]. European Neurology, 2013, 70 (3‐4): 201‐209. [17]Zuo LJ, Yu SY, Wang F, Hu Y, Piao YS, Du Y, Lian TH, Wang RD, Yu QJ, Wang YJ, Wang XM4, Chan P, Chen SD, Wang Y, Zhang W. Parkinson's Disease with Fatigue: Clinical Characteristics and Potential Mechanisms Relevant to a‐Synuclein Oligomer [J]. Journal of Clinical Neurology, 2016, 12 (2):172‐180. [18]Kluger BM, Pedersen KF, Tysnes OB, Ongre SO, Øygarden B, Herlofson K. Is fatigue associated with cognitive dysfunction in early Parkinson's disease [J]. Parkinson & Related Disorders, 2017, 37:87‐91. [19]Reijnders JS, Scholtissen B, Weber WE, Aalten P, Verhey FR, Leentjens AF. Neuroanatomical correlates of apathy in Parkinson's disease: A magnetic resonance imaging study using voxel‐based morphometry [J]. Mov Disord, 2010, 25 (14): 2318–2325. [20]Cubo E, Benito‐León J, Coronell C, Armesto D; ANIMO Study Group.Clinical correlates of apathy in patients recently diagnosed with Parkinson's disease: the Animo study [J]. Neurology epidemiology, 2012, 38 (1): 48‐55. [21]den Brok MG, van Dalen JW, van Gool WA, Moll van Charante EP, de Bie RM, Richard E.Apathy in Parkinson's disease: A systematic review and meta‐analysis [J] . Movement Disorders Official Journal of the Movement Disorder Society, 2015, 30 (6):759‐769. [22]Kirsch‐Darrow L, Marsiske M, Okun MS, Bauer R, Bowers D. Apathy and Depression: Separate Factors in Parkinson's Disease [J]. Journal of the International Neuropsychological Society Jins, 2011, 17 (6): 1058‐1066. [23]Santangelo G1, Vitale C, Trojano L, Longo K, Cozzolino A, Grossi D, Barone P. Relationship between depression and cognitive dysfunctions in Parkinson's disease without dementia. [J] Neurology. 2009; 256 (4): 632‐638. [24]Elbers RG, Verhoef J,van Wegen EE, Berendse HW, Kwakkel G. Interventions for fatigue in Parkinson's disease. The Cochrane Database of Systematic Reviews, 2014, 1:CD 010925. [25]Ongre SO, Larsen JP, Tysnes OB, Herlofson K. Fatigue in early Parkinson's disease: the Norwegian ParkWest study [J]. European Journal of Neurology, 2016, 24 (1):105‐111. [26]Elbers R G, Berendse H W, Kwakkel G. Treatment of Fatigue in Parkinson Disease [J]. JAMA, 2016, 315 (21):23402341. [27]Pagonabarraga J, Kulisevsky J, Strafella AP, Krack P. Apathy in Parkinson's disease: clinical features, neural substrates, diagnosis, and treatment. [J]. Lancet Neurology, 2015, 14 (5):518‐531. [28]Devos D, Moreau C, Maltête D, Lefaucheur R, Kreisler A, Eusebio A, Defer G, Ouk T, Azulay JP, Krystkowiak P, Witjas T, Delliaux M, Destée A, Duhamel A, Bordet R, Defebvre L, Dujardin K. Rivastigmine in apathetic but dementia and depression‐free patients with Parkinson's disease: a double‐blind, placebo‐controlled, random clinical trial[J]. J Neurology Neurosurg Psychiatry, 2014, 85 (6):668‐674. [29]Czernecki V, Schüpbach M, Yaici S, Lévy R, Bardinet E, Yelnik J, Dubois B, Agid Y.Apathy following subthalamic stimulation in Parkinson disease: a dopamine responsive symptom. [J]. Movement Disorders, 2008, 23 (7):964–969. [30]Pfeiffer R F. Non‐motor symptoms in Parkinson's disease [J]. Parkinson & Related Disorders, 2016, 22 Suppl 1 (3):119‐122.Cochrane GD, Rizvi S, Abrantes AM, Crabtree B, Cahill J, Friedman JH. The association between fatigue and apathy in patients with either Parkinson's disease or multiple sclerosis [J]. Parkinson & Related Disorders, 2015, 21 (9):1093‐1095. [31]Dujardin K, Langlois C, Plomhause L, Carette AS, Delliaux M, Duhamel A, Defebvre L. Apathy in untreated early‐stage Parkinson disease: relationship with other non‐motor symptoms [J]. Movement Disorders Official Journal of the Movement Disorder Society, 2015, 29 (14):1796‐1801. [32]Hagell P, Brundin L. Towards an understanding of fatigue in Parkinson disease [J]. Neurology Neurosurg Psychiatry, 2009, 809 (5): 489‐492. [33]Sáez‐Francàs N, Hernández‐Vara J, Corominas Roso M, Alegre Martín J, Casas Brugué M. The Association of Apathy With Central Fatigue Perception in Patients With Parkinson's Disease [J]. Behavioral Neuroscience, 2013, 127 (2): 237‐244. [34]Martinez‐Martin P, Falup Pecurariu C, Odin P, van Hilten JJ, Antonini A, Rojo‐Abuin JM, Borges V, Trenkwalder C, Aarsland D, Brooks DJ, Ray Chaudhuri K.Gender‐related differences in the burden of non‐motor symptoms in Parkinson's disease [J] . Journal of Neurology, 2012, 259 (8): 1639‐1647. [35]Skorvanek M1, Gdovinova Z, Rosenberger J, Saeedian RG, Nagyova I, Groothoff JW, van Dijk JP. The associations between fatigue, apathy, and depression in Parkinson's disease [J]. Acta Neurol Scand. 2015, 131 (2): 80–87.

162

The Characteristics of Autonomic Dysfunction in Parkinson's Disease Patients with Different Motor Subtypes

Meng‐Yan Wang, Jian‐Yong Wang, Rong‐Pei Liu, Lan‐Bing Zhu, Ming Zou, Xiong Zhang (Wenzhou, People's Republic of China)

Objective: In this study, we showed the characteristics of autonomic dysfunction in PD Patients with different motor subtypes.

Background: Increasingly studies have found that patients with Parkinson's disease (PD) have different degree of non‐motor symptoms throughout the course of the disease. Among them, autonomic dysfunction is the main factor, which lead patients to a lower quality of the life. Autonomic components include cardiovascular, digestive, urinary, thermoregulatory, and sexual function. Symptoms such as salivation, constipation, orthostatic hypotension, frequent urination, and increased sweating are common in patients, and these symptoms are heterogeneous in patients.

Methods: Twenty‐eight PD patients were recruited in this case‐control study. All these patients were diagnosed with primary PD in Geriatrics & Neurology Department of the Second Affiliated Hospital and Yuying Children's Hospital, Wenzhou Medical University. Patients were defined as PIGD/TD/MIX subtype according to the Stebbins' method. Clinical data including Basic Information Scale (BIS), Unified Parkinson's Disease Rating Scale (UPDRS), Mini‐Mental State Examination (MMSE), Non‐Motor Symptom Scale (NMSS) and Scales for Outcomes in Parkinson's Disease‐Autonomic Symptoms (SCOPA‐AUT) were collected by neurologists during face to face interviews. In addition, all the patients underwent a neurophysiologic assessment, including Sympathetic Skin Response (SSR), Heart Rate Variability (HRV) and Orthostatic Hypotension (OH).

Results: The total scores of UPDRS (P = 0.005), NMSS (P = 0.039) and SCOPS‐AUT (P = 0,005) in PIGD patients were higher than these in TD patients, and PIGD patients had more severe in salivation (P = 0.002), urinary urgency (P = 0.011) and sweating (P = 0.025) when compared to TD patients. Comparing the Sympathetic Skin Response characteristics of the two groups, we found that the SSR latency was longer in the PIGD patients.

Conclusions: PIGD PD patients had more sever non‐motor symptoms, especially in autonomic dysfunction, compared to TD subtype, implying that Stebbins' method is also suitable for the description of non‐motor symptoms.

163

Neuroinflammation induces olfactory deficits in Thy1‐aSyn transgenic mice

Ruolin Li (Beijing, People's Republic of China)

Objective: To explore the effect of neuroinflammation in olfactory deficits of Thy1‐aSyn transgenic mice, and contribute to our understanding of PD pathogenesis.

Background: Parkinson's disease (PD) is a central nervous system degenerative disease characterizedby motor deficits that are often accompanied by a series of non‐motor symptoms suchas olfactory deficits, constipation, depression, and cognitive disorders. Olfactorydeficits is an early symptoms that can precede motor symptoms by 10‐20 years in up to 95% of PD patients, which is accompanied by abnormal a‐synuclein (a‐syn) deposition in olfactory bulb. However, the relevant mechanism is still unclear. A large number of studies have confirmed that the increase of a‐syn can cause excessiveactivation of microglia, thereby inducing the production of neuroinflammation. Andwith the deepening of research in PD patients and animal models, neuroinflammationhas been found to play a pivotal role in the degeneration of dopamine neurons. Thissuggests that neuroinflammation may be associated with olfactory deficits. In the caseof nerve damage caused by neurodegenerative diseases, microglia are rapidly activatedand release a large number of inflammatory factors, leading to neuroinflammation.Various inflammatory mediators can accelerate the death of nerve cells, and the deathof neurons further activates microglia, which forms a vicious circle. If this cycle causesdisturbance in the olfactory system, it may be the reason of olfactory deficits. Thisprovides a new clue of olfactory deficits of PD.

Methods: Buried pellet test and open field test were used to detect the olfactory function of each group mice. Rotarod test, traction test and pole test were used to detect the motor behavior of each group. Immunofluorescence (IF) was used to detect Iba‐1 levels in mouse OB, to assess microglial activation. qPCR was used to detect the transcription levels of inflammatory factors (IL‐1ß, TNF‐a, IL‐6, Arg1), to assess inflammation.

Results: 1. Thy1‐aSyn transgenic mice as an ideal model for research. Western Blot and IFresults showed that the olfactory bulb (OB) of TG mice was overexpressed human a‐syn compared to WT (wildtype) mice. 2. Thy1‐aSyn transgenic mice have olfactory deficits earlier than motor deficits. Buried pellet test and open field test results showed that compared with WT mice, the 6‐month‐old TG mice have olfactory deficits. The results of motor behavior test showed that there is no significantly difference of motor function of WT and TG mice at 6‐month‐old, and the motor function of 12‐month‐old TG mice was impaired. Immunohistochemical staining of TH in the midbrain showed that there was no loss of dopaminergic neurons in TG mice at 6‐month‐old, dopaminergic neurons were absent in TG mice at 12‐month‐old. In summary, TG mice have olfactory deficits at 6‐month‐old, and there is no midbrain dopaminergic neuron loss and motor deficits at this time. 3. More microglia are activated in the OB of Thy1‐aSyn transgenic mice at 6‐month‐old. IF results showed that the number of activated microglia in the olfactory bulb of 6‐month‐old TG mice was increased, when compared with WT mice (P<0.01). 4. Increased transcription levels of inflammatory factors in the OB of Thy1‐aSyntransgenic mice at 6‐month‐old. qPCR results showed that the transcription levels of inflammatory factors (IL‐1ß, TNF‐a, IL‐6, Arg1) in the OB of 6‐month‐old TG mice were significantly increased, when compared with WT mice (P <0.05).

Conclusions: 1. Thy1‐aSyn transgenic mice have olfactory deficits in 6‐month‐old. 2. Thy1‐aSyn transgenic mice have motor deficits and dopamine neurons loss at 12‐month‐old. 3. Thy1‐aSyn transgenic mice have increase activated microglia in the OB at 6‐month‐old. 4. Thy1‐aSyn transgenic mice have increased inflammatory factors in the OB at 6‐month‐old. 5. The olfactory deficits of 6‐month‐old Thy1‐aSyn mice may be related to the neuroinflammation.

References: 1. Liu J, Liu W, Lu Y, et al. Piperlongumine restores the balance of autophagy and apoptosis by increasing BCL2 phosphorylation in rotenone‐induced Parkinson disease models. Autophagy. 2018;8627:1‐17. doi:10.1080/15548627.2017.1390636.2. Doty RL. Olfactory dysfunction in Parkinson disease. Nat Rev Neurol. 2012;8 (6):329‐339. doi:10.1038/nrneurol.2012.80.3. Braak H, Ghebremedhin E, Rüb U, Bratzke H, Del Tredici K. Stages in the development of Parkinson's disease‐related pathology. Cell Tissue Res. 2004;318 (1):121‐134. doi:10.1007/s00441‐004‐0956‐9.4. Ransohoff RM. How neuroinflammation contributes to neurodegeneration. Science (80‐ ). 2016;353 (6301):777‐783. doi:10.1126/science.aag2590.5. Lee JK, Tran T, Tansey MG. Neuroinflammation in Parkinson's disease. J Neuroimmune Pharmacol. 2009;4 (4):419‐429. doi:10.1007/s11481‐009‐9176‐0.

164

This abstract has been withdrawn.

Parkinson's Disease: Pathophysiology

165

Rifampicin inhibits the toxicity of rotenone‐induced PC12 cells by sumoylation modification of a‐synuclein

Danyu Lin, Enxiang Tao, Yingyu Xie (Guangzhou, People's Republic of China)

Objective: Rifampicin could stabilize a‐synuclein and prevent rotenone‐induced PC12 cells from apoptosis by enhancing sumoylation of a‐synuclein.

Background: Our previous researches had revealed that rifampicin could protect PC12 cells from rotenone‐induced cytotoxicity by reversing the aggregation of a‐synuclein. Further research pointed out that the misfolded a‐synuclein with SUMOylation, an important proteic posttranslational modification, was easier to solubilize and get rid of toxicity.

Methods: The expression of SUMO1 and SUMO2/3, two main formation of sumoylation modification in PC12 cells, were detected by western blotting. Co‐immunoprecipitation was performed to compare qualitatively the sumoylation modification of a‐synuclein. The cell viability and apoptosis rate were measured by CCK‐8 assay kit and flow cytometry. We targeted Ubc9 as a key enzyme in sumoylation modication and knocked down the gene of Ubc9 by effecient siRNA.

Results: With the treatment of 150μmol/L rifampicin, the expression of SUMO1 and SUMO2/3 in cells was 1.5 times higher than control group, meanwhile, the cell viability of rotenone‐induced cells was increased from 20% to 80% (P<0.05). Besides, the increase of sumoylation activity in the cells stimulated by rifampicin was observed 18 hours earlier than which were treated by rotenone alone. a‐synuclein's sumoylation was more significant in rifampicin‐treated cells and Ubc9 up‐regulared cells, however, the same phenomenon and the protective effect of rifampicin was reversed with Ubc9 inhibition.

Conclusions: Rifampicin may reduce the cytotoxicity of rotenone‐induced PC12 cells by promoting a‐synuclein's sumoylation.

References: Alderson, T. R., Bax, A., 2016. Parkinson's disease: Disorder in the court. Nature 530, 38‐39.Benskey, M. J., Perez, R. G., Manfredsson, F. P., 2016. The contribution of alpha synuclein to neuronal survival and function ‐ Implications for Parkinson's disease. Journal of Neurochemistry 137, 331‐359.Bi, W., Zhu, L., Jing, X., Liang, Y., Tao, E., 2013. Rifampicin and Parkinson's disease. Neurological Sciences 34, 137‐141.Chakradhar, S., 2016. The road less traveled: Start‐ups invest in novel approaches against neurodegeneration. Nature Medicine 22, 11‐13.Chio, A., Defazio, G., 2016. A new scale for prognostication in Parkinson disease: Of animals and men. Neurology 86, 982‐983.Connor‐Robson, N., Peters, O. M., Millership, S., Ninkina, N., Buchman, V. L., 2016. Combinational losses of synucleins reveal their differential requirements for compensating age‐dependent alterations in motor behavior and dopamine metabolism. Neurobiology of Aging 46, 107‐112.Dearborn, A. D., Wall, J. S., Cheng, N., Heymann, J. B., Kajava, A. V., Varkey, J., Langen, R., Steven, A. C., 2015. alpha‐Synuclein Amyloid Fibrils with Two Entwined, Asymmetrically Associated, Protofibrils. Journal of Biological Chemistry 291, 2310‐2318.Drobecq, H., Boll, E., Senechal, M., Desmet, R., Saliou, J. M., Lacapere, J. J., Mougel, A., Vicogne, J., Melnyk, O., 2016. A Central Cysteine Residue Is Essential for the Thermal Stability and Function of SUMO‐1 Protein and SUMO‐1 Peptide‐Protein Conjugates. Bioconjug Chem 27, 1540‐1546.Eckermann, K., 2013. SUMO and Parkinson's disease. Neuromolecular Med 15, 737‐759.Gallea, J. I., Sarroukh, R., Yunes‐Quartino, P., Ruysschaert, J. M., Raussens, V., Celej, M. S., 2016. Structural remodeling during amyloidogenesis of physiological Nalpha‐acetylated alpha‐synuclein. Biochim Biophys Acta 1864, 501‐510.Guerra, D. S. A., Prediger, R. D., Cimarosti, H., 2016. SUMO‐regulated mitochondrial function in Parkinson's disease. Journal of Neurochemistry 137, 673‐686.Hewitt, W. M., Lountos, G. T., Zlotkowski, K., Dahlhauser, S. D., Saunders, L. B., Needle, D., Tropea, J. E., Zhan, C., Wei, G., Ma, B., Nussinov, R., Waugh, D. S., Schneekloth, J. J., 2016. Insights Into the Allosteric Inhibition of the SUMO E2 Enzyme Ubc9. Angew Chem Int Ed Engl 55, 5703‐5707.Jing, X., Shi, Q., Bi, W., Zeng, Z., Liang, Y., Wu, X., Xiao, S., Liu, J., Yang, L., Tao, E., 2014. Rifampicin protects PC12 cells from rotenone‐induced cytotoxicity by activating GRP78 via PERK‐eIF2alpha‐ATF4 pathway. PLoS One 9, e92110.Ketharanathan, T., Hanwella, R., Weerasundera, R., de Silva, V. A., 2014. Major depressive disorder in Parkinson's disease: a cross‐sectional study from Sri Lanka. BMC Psychiatry 14, 278.Krumova, P., Meulmeester, E., Garrido, M., Tirard, M., Hsiao, H. H., Bossis, G., Urlaub, H., Zweckstetter, M., Kugler, S., Melchior, F., Bahr, M., Weishaupt, J. H., 2011. Sumoylation inhibits alpha‐synuclein aggregation and toxicity. Journal of Cell Biology 194, 49‐60.Krumova, P., Weishaupt, J. H., 2013. Sumoylation in neurodegenerative diseases. Cellular and Molecular Life Sciences 70, 2123‐2138.Mazzulli, J. R., Zunke, F., Isacson, O., Studer, L., Krainc, D., 2016. alpha‐Synuclein‐induced lysosomal dysfunction occurs through disruptions in protein trafficking in human midbrain synucleinopathy models. Proc Natl Acad Sci U S A 113, 1931‐1936.Oida, Y., Kitaichi, K., Nakayama, H., Ito, Y., Fujimoto, Y., Shimazawa, M., Nagai, H., Hara, H., 2006. Rifampicin attenuates the MPTP‐induced neurotoxicity in mouse brain. Brain Research 1082, 196‐204.Pavlou, M. A., Pinho, R., Paiva, I., Outeiro, T. F., 2016. The yin and yang of alpha‐synuclein‐associated epigenetics in Parkinson's disease. Brain.Plotegher, N., Bubacco, L., 2016. Lysines, Achilles' heel in alpha‐synuclein conversion to a deadly neuronal endotoxin. Ageing Research Reviews 26, 62‐71. Popova, B., Kleinknecht, A., Braus, G. H., 2015. Posttranslational Modifications and Clearing of alpha‐Synuclein Aggregates in Yeast. Biomolecules 5, 617‐634.Reiter, K. H., Ramachandran, A., Xia, X., Boucher, L. E., Bosch, J., Matunis, M. J., 2016. Characterization and Structural Insights into Selective E1‐E2 Interactions in the Human and Plasmodium falciparum SUMO Conjugation Systems. Journal of Biological Chemistry 291, 3860‐3870.Rodriguez‐Nogales, C., Garbayo, E., Carmona‐Abellan, M. M., Luquin, M. R., Blanco‐Prieto, M. J., 2016. Brain aging and Parkinson's disease: New therapeutic approaches using drug delivery systems.Sarge, K. D., 2016. Analysis of Protein Sumoylation. Curr Protoc Protein Sci 83, 14‐18.Smirnova, L., Harris, G., Delp, J., Valadares, M., Pamies, D., Hogberg, H. T., Waldmann, T., Leist, M., Hartung, T., 2015. A LUHMES 3D dopaminergic neuronal model for neurotoxicity testing allowing long‐term exposure and cellular resilience analysis. Archives of Toxicology.Soldner, F., Stelzer, Y., Shivalila, C. S., Abraham, B. J., Latourelle, J. C., Barrasa, M. I., Goldmann, J., Myers, R. H., Young, R. A., Jaenisch, R., 2016. Parkinson‐associated risk variant in distal enhancer of alpha‐synuclein modulates target gene expression. Nature 533, 95‐99.Tomanov, K., Ziba, I., Bachmair, A., 2016. SUMO Chain Formation by Plant Enzymes. Methods Mol Biol 1450, 97‐105.Xu, J., Wei, C., Xu, C., Bennett, M. C., Zhang, G., Li, F., Tao, E., 2007. Rifampicin protects PC12 cells against MPP+‐induced apoptosis and inhibits the expression of an alpha‐Synuclein multimer. Brain Research 1139, 220‐225.

166

Analysis of stn dbs in PD – a study with microelectrode recording

Venkateshwarla Rama Raju, Rupam Borgohain, Rukmini Kandadai (Hyderabad, India)

Objective: To study the effectiveness of lead‐point with microelectrode recording (MER) of STN DBS in Parkinson's disease and correlation of MER in determining with final tract chosen for placing DBS electrode during bilateral STN DBS performed in a tertiary care NIMS hospital, south India.

Background: In a US based study, average cost for STNDBS with MER was $33,481.43 for real‐time bilateral, $53,529.58 for staged bilateral. 270 patients have undergone DBS at NIMS. Medtronic lead point 5 channel MER is done in all. MER data of 46 patients who underwent DBS from Aug 2008 to Feb 2012 were analyzed.

Methods: 46 subjects with PD were included in the study. Subjects with advanced PD of > 6 years with good response to L‐Dopa, H & Y score of < 4 with normal cognition eligible for surgery. Surgery was planned using CRW frame with MRI protocol using 5 channel Framelink software. MER was done in all subjects extending from ±10 mm (above target to below STN). Final target selection was based on the effects and side effects of macrostimulation confirmed by post operative MRI. STN can be visualized on MRI but other methods such as Lozano's technique where a position 3 mm lateral to the superolateral border of the red nucleus is targeted have been studied and found to be effective areas for stimulation. As MRI techniques are not very ideal, use of electrophysiological techniques‐microelectrode recording from STN as well as intra‐operative stimulation have helped in clearly distinguishing STN (Fig 1).

Results: 46patients included in this study. Mean age (58.1+9.1yrs, disease duration8.8+3.64yrs), UPDRS score in off/on state (52.7+10.6/13.4+5). Mean # of channels in which STNMER was detected out of 5multiple channels on rightside=3.5+1.1, left=3.6+1.04. 92sides computed. Fig 2 shows % of people with # of channels showing MER. Concordance rate with finer signal utmost width of recording was inferred. Final channel selected (central in 39/92 42.3%, anterior31/92 ‐33.7%, medial 15/92 ‐16.3%,posterior 4/92 ‐4.3%,lateral 3/92 ‐3.2%). Concordance with top recording with chosen track was seen in 58.7%. Maximum length of (recording mean5.3+1.3mm, STN 48%), concordance with either highest recording or top length was noted in64%. In 28patients, final tract did not match either to tract with top recording or most width of MER. 93.48% of patients showed STN recording in final channel.

Conclusions: In our study, we find that MER gives proof of correct‐positioning of electrode, ensures accurate detection of STN precincts and determines its exact coordinates in a more objective way. MER enhances safety, accuracy and efficacy of DBS electrode implementation. Thus, MER confirms presence of abnormal STN neurons. Unperturbed MER definitely can confirm clear position of electrodes and bolsters the confidence of the neurosurgeons that they are in the target. Availability of MER results in a vast data regarding functioning on neurons situated deep in the brain may further help in unraveling mysteries of brain.Absence of any recording from STN in the final tract selected was noted in 6/92 ‐6.52%. Out of 6 patients, 1 had no MER recording in any of the 5 channels and lead was placed in central channel. 2 had medial, 2 anterior and 2 had central channels as their final tract. This was selected based on macrostimulation.

References: 1. Amirnovin R, Williams ZM, Cosgrove GR, Eskandar EN. Experience with microelectrode guided subthalamic nucleus deep brain stimulation. Neurosurgery. 2006 Feb;58 (1 Suppl):ONS96‐102.2. Bour LJ, Contarino MF, Foncke EM, de Bie RM, van den Munckhof P, Speelman JD, Schuurman PR. Long term experience with intraoperative microrecording during DBS neurosurgery in STN and Gpi . Acta Neurochir (Wien). 2010 Dec;152 (12):2069‐77. Epub 2010 Oct 15.

Figure 1.

 

Table 1.

 

167

Neuroprotection effects of probiotics strains on a chronic MPTP‐induced mouse model of Parkinson's disease

Yiwei Qian, Xiaodong Yang, Shaoqing Xu, Qin Xiao (Shanghai, People's Republic of China)

Objective: To explore the effects of probiotics strains on the neuroinflammation and degeneration of dopaminergic neurons in chronic Parkinson's disease (PD) mice model.

Background: Microglia‐mediated neuroinflammation has been implicated in the pathogenesis of PD. A growing body of evidences from both the clinical and animals' experiments suggested that gut microbiota dysbiosis play a key role in influencing the progress of PD. However, the potential role of the therapeutic options probiotics, which pointed at modification the gut microbiota composition in the progress of PD is unknown.

Methods: Four‐week‐old C57BL/6N male mice were oral‐administered the probiotics strains Lactobacillus acidophilus NCFM and Bifidobacterium lactis HN019 (109 CFU/day) or saline for 4 weeks prior to testing. 1‐methyl‐4‐phenyl‐1,2,3,6‐tetrahydropyridine (MPTP) (25 mg/kg) or saline were injected twice a week for 5 weeks. Mice were also oral‐administered the probiotics or saline each day during the 5 weeks of MPTP injection. At the end of MPTP injection, gastrointestinal (fecal pellet output) and motor symptoms (open‐field and pole tests) was assessed. Pathology of a‐synuclein, tyrosine hydroxylase (TH) neuron loss, inflammation and hallmarks of microglial phenotype from the middle brain were also analyzed. Fecal samples were collected and the DNA were extracted and performed 16S rRNA sequencing targeting V3‐V4 region.

Results: The supplementary of probiotics could adjusted the changed‐community of gut microbiota induced by MPTP, especially with decrease of genus prevotella, which was linked with chronic inflammatory conditions. Probiotics also significantly attenuated gastrointestinal and motor symptoms, along with the decrease of pro‐inflammatory cytokines mRNA expression, TH‐positive neuronal loss, TLR‐2 expression and typical hallmarks of the pro‐inflammatory (M1) activation of microglia. Additionally, probiotics upregulated the anti‐inflammatory cytokines mRNA expression as well as increasing the expression of typical hallmarks of anti‐inflammatory (M2) phenotype.

Conclusions: Overall, the supplementary of probiotics strains was essential for M2 microglia polarization by modifying gut microbiota, and therefore it has a potential role in the switch of microglia phenotypes to show neuroprotective effects in the pathogenesis of PD.

168

Neuroprotective propensity of FUPB, a dual inhibitor of sEH and COX‐2 against rotenone induced neurotoxicity in cell line and Drosophila model of Parkinson disease

Navya Lakkappa, Pandareesh Mirazkar Dasharatharao, Praveen T.K (Bangalore, India)

Objective: In the present study, FUPB was evaluated for its anti‐Parkinson activity against rotenone induced mitochondrial dysfunction, oxidative stress and neuroinflammation in N27 dopaminergic cell lines and Drosophila melanogaster model of Parkinson disease (PD).

Background: Epoxyeicosatrienoic acids (EETs), are the metabolites of arachidonic acid cascade, plays a crucial role in cytoprotection by attenuating oxidative stress, in?ammation and apoptosis. EETs are rapidly metabolised in vivo by soluble epoxide hydrolase (sEH). Elevating the half life of EETs by inhibiting sEH is a novel strategy for neuroprotection and the simultaneous inhibition of COX‐2 will have an added advantage in neuroprotection.

Methods: The in vitro neuroprotective efficiency was evaluated by measuring cell survival (MTT and LDH release assays), oxidative stress parameters (Total intracellular ROS, protein oxidation, lipid peroxidation, and mitochondrial membrane potential), inflammatory markers (IL‐6, COX‐1 and COX‐2), and apoptotic markers (c‐jun, P‐c‐jun, JNK, P‐JNK, pro and active caspase‐3). Further, in vivo neuroprotective efficiency was confirmed by measuring Survival rate, negative geotaxis, dopamine and its metabolites (LCMS) and oxidative stress parameters.

Results: FUPB pre‐treatment significantly improved cell viability, through amelioration of ROS production, proteins oxidation and lipids peroxidation. It also attenuated the mitochondrial damage by improving mitochondrial membrane potential and FUPB also decreased the phosphorylation of apoptotic markers like JNK and c‐jun leading to alleviated levels of cleaved caspase‐3. These results were in corroboration with in vivo results with improved survival rate, negative geotaxis, dopamine levels, antioxidants and anti‐inflammatory status in Drosophila model of PD.

Conclusions: These results substantiate the neuroprotective efficiency of FUPB indicating its potential therapeutic benefits in the treatment of PD.

References: 1. Navya Lakkappa, Praveen T. Krishnamurthy, Bruce D. Hammock, D. Velmurugan, M.M. Srinivas Bharath. Possible role of Epoxyeicosatrienoic acid in prevention of oxidative stress mediated neuroinflammation in Parkinson disorders. Medical hypothesis journal. DOI:10.1016/j.mehy.2016.06.0032. Allen RG, Tresini M. 2000. Oxidative stress and gene regulation.Free Radic Biol Med 28: 463–499

169

Modulating effects of MDMA on spontaneous firing of the subthalamic nucleus neurons: a quantitative study

Chitaranjan Mahapatra (Powai, India)

Objective: The subthalamic nucleus (STN) plays the dominant role in several functions of basal ganglia and its activity is regulated by 5‐HT. This study presents a quantitative study of the modulating effects of the MDMA on the firing pattern of the STN neuron via 5‐HT receptors.

Background: MDMA has diverse psychological and physiological effects, particularly rewarding and addicting influences in both humans and animals. MDMA is considered as a substrate of various neurotransmitter transporters to stimulate the efflux of neurotransmitter from vesicles into the cytosol.

Methods: Here the interpretation of MDMA and 5‐ HT are based on differential equations, where all parameters are borrowed from published data. Then, this neurotransmitter mechanism is incorporated into a published STN electrophysiological model.

Results: A brief square pulse of varied duration and magnitude is applied as an external stimulus current (Istim) to trigger action potential (AP) in the whole cell model. Then MDMA concentration is varied to investigate the modulated response in AP and resting membrane potential. The single STN neuron model mimicked vigorous spontaneous action potential activity and the tonic firing pattern with regular inter‐spike intervals similar to those found in the experiment. The MDMA is simulated from 2 to 20 μM. We found that the mean and median firing rates in the simulation increased moderately and in a concentration‐dependent manner with the application of MDMA.

Conclusions: This finding from the simulation of the STN neuron by MDMA agrees with the notion found in experimental studies, which mention that the effects of the drug to its motor effects. The future extension of this preliminary study will reveal the heterogenic modulatory effects of MDMA in STN cell.

170

Neuron‐specific protein S100B as a differentiated marker of Parkinson's disease and an essential tremor.

Rustambek Matmurodov, Rustambek Matmurodov (Tashkent City, Uzbekistan)

Objective: To study the level of neuron‐specific protein S100B in blood plasma in patients with PD and ET.

Background: The neuron‐specific protein S100B is a major factor in the development of a neurodegenerative disease, such as Parkinson's (PD) and essential tremor (ET).

Methods: Twenty‐four patients with PD, 22 patients aged 33 to 65 years (mean age 46.7±8.1 years), 24 men and 23 women were examined. The control group consisted of 12 patients without BP and ET, which coincided in age and sex. All patients underwent clinico‐neurological, neurophysiological studies and differentiated from patients with secondary brain diseases. The level of S100B of neuron‐specific protein was determined by the method of enzyme immunoassay.

Results: The results obtained showed that in the serum of patients in the main group the amount of neurospecific S100B protein was 144.6±7.5 ng / l, in the control group 72.6 ± 4.8 ng / l (p <0.05). In the main group, the S100B protein content was twice as high as in the control group. In patients with PD, the amount of S100B protein in the blood serum was 165.4 ± 9.7 ng / L, with ET 103.4 ± 6.1 ng / L (p <0.05), indicating an increased serum levels of serum S100B protein in the disturbances of the pallidar system, which have astrocytic cells and produce more protein S100B.

Conclusions: Thus, based on the data obtained, it can be concluded that the S100B protein can be considered as a differentiated marker of Parkinson's disease and an essential tremor.

171

Evaluation of the OX40L serum levels in the patients with the Parkinson compared with the controls

Sepideh Allahdadian, Nahid Eskandari (Isfahan, Iran)

Objective: The present study was designed to investigate the serum level of the OX40L in the patient with the Parkinson as a diagnostic test.

Background: Parkinson disease is the second chronic neurodegenerative disorder after the Alzheimer disease that its prevalence is rising recently. It's a common problem in the elderly as it affect their quality of life by its motor symptoms such as the bradykinesia, rigidity, and rest tremor. OX40L is the member of the TNF (Tumor Necrosis Factor) family that express from the activated T‐ cells. Lots of studies demonstrated the OX40L role in the autoimmune disease such as the Multiple Sclerosis and Lupus. Therefore, as such study has not been done, we propose to do it, and check it as a diagnostic test.

Methods: This cross‐sectional analytic study was carried out on 20 patients with the Parkinson disease and 20 controls at Isfahan Kashani Hospital in the years 1395‐1396. Data were collected using questionnaire of demographic information and also their serum were collected. Measurement of the OX40L serum levels was done by the ELISA (Enzyme ImmunoSorbent Assay). After defect detection, they were entered by computer and analyzed by SPSS version 24 software.

Results: The mean serum concentration of OX40L was increased in the cases compared with the controls but the differences wasn't significant (p value > 0.05).

Conclusions: Finally, in this study, we investigated that OX40L cannot be used as a diagnostic biomarker in the Parkinson disease.

172

Construction of SHSY‐5Y cell lines stably overexpressing a‐synuclein mediated by lentivirus

Yingyu Xie, Danyu Lin (Guangzhou, People's Republic of China)

Objective: To established two stable SHSY‐5Y cell lines overexpressing wild‐type and mutant (A53T) a‐synuclein respectively.

Background: Parkinson disease,as the second most common neurodegenerative disease in humans,is characterized by the loss of dopaminergic neurons and the presence of Lewy bodies (LBs) in surviving neurons. One of the major component of Lewy bodies is a protein called a‐synuclein, a 140‐amino acid protein that is soluble and unstructured under physiological conditions.In pathological condition,a‐synuclein misfolds, aggregates, and finally form different types of insoluble polymeric structures, including oligomers, protofibrils and amyloid fibrils that are believed to be responsible for the protein induced toxicity.This forming of toxic conformations can be affected by many factors. Mutations of the gene that codes for a‐synuclein (SNCA), such as the A53T mutation, and duplications of the gene generate cases of PD with autosomal dominant inheritance.Here,we construct cell models overexpressing wild‐type (WT) and A53T mutant a‐synuclein with lentivirus respectively.

Methods: Lentiviral vectors encoding wild‐type (WT) or mutant (A53T) human a‐synuclein for the overexpression of a‐synuclein were constructed respectively. Human neuroblastoma SHSY‐5Y cell line was cultured with complete medium (CM) containing DMEM high glucose, 10% fetal bovine serum (FBS), 10?U/ml penicillin–10?mg/ml streptomycin and 200?mM l‐glutamine. Cells were incubated at 37?°C in a humidified chamber in 5% CO2 atmosphere. For transduction experiments,cells were plated on 24‐well plates at a density of 5?×?10^4 cells/mL. After 24 h, when cells came to 70% confluence, the culture medium was changed with 250ul of fresh CM and 5ul of the respective viral preparation was added. The polybrene was added to each flask to reach a final concentration of 1%. After 24h, medium was changed with CM.Following culturing in CM at 37°C in a 5% CO2 incubator for 24 h, transfected SHSY‐5Y cells were examined for GFP expression under an inverted fluorescence microscope. The number of GFP‐positive cells was used to calculate the transfection efficiency. Successfully transfected SHSY‐5Y cells were selected using puromycin (40μg/ml). The expression of a‐synuclein was confirmed by reverse transcription‐quantitative polymerase chain reaction (RT‐qPCR) and western blot analysis.

Results: Experimental observations indicate that the lentiviral vector carrying GFP was successfully transfected into SHSY‐5Y cells. RT‐qPCR and western blotting showed the increased expression level of a‐synuclein compared with the controls.

Conclusions: The experiment successfully established two stable SHSY‐5Y cell lines overexpressing wild‐type and mutant (A53T) a‐synuclein respectively.This can be used as the model for the investigation of Parkinson's disease and provides an experimental basis for the establishment of model in vivo.

References: [1]Lauwers Erwin,Debyser Zeger,Van Dorpe Jo et al. Neuropathology and neurodegeneration in rodent brain induced by lentiviral vector‐mediated overexpression of alpha‐synuclein. [J] .Brain Pathol., 2003, 13 (3): 364‐72. [2]Wong Yvette C,Krainc Dimitri. a‐synuclein toxicity in neurodegeneration: mechanism and therapeutic strategies. [J] .Nat. Med., 2017, 23 (2): 1‐13.

173

This abstract has been withdrawn.

174

A critical role of autophagy in regulating microglia polarization in neurodegeneration

Fen Wang, Mengmeng Jin, Wenwen Liu, Chao Gu, Lifang Hu, Chunfeng Liu (Suzhou, People's Republic of China)

Objective: To explore the role of autophagy in microglia polarization and neuroinflammation.

Background: Neuroinflammation and autophagy dysfunction are closely related to the development of neurodegeneration such as Parkinson's disease (PD).

Methods: Primary microglia and midbrain neuron culture, Quantitative PCR, Western blot analysis, Immunocytochemistry, Cell viability assay, Nitrite Quantification, Cytokine assay.

Results: TNF‐a treatment led to an autophagic flux impair in microglia. Concomitantly, an increase of M1 marker (iNOS, IL‐1ß, NO, IL‐6) expression and reduction of M2 marker (Arginase1, Ym1/2, IL‐10) was observed in TNF‐a challenged microglia. Upregulation of autophagy via serum deprivation or with pharmacologic activators (rapamycin and resveratrol) promoted microglia polarization toward M2 phenotype, as evidenced by suppressed M1 and elevated M2 gene expression, while inhibition of autophagy with 3‐MA or Atg5 siRNA consistently aggravated the M1 polarization induced by TNF‐a. Activation of AKT and mTOR may be involved in the changes of autophagy and inflammation as the AKT specific inhibitor perifosine prevented the increase of LC3II (an autophagic marker) in TNF‐a stimulated microglia. In addition, the microglia‐neuron coculture assay revealed that the inhibition of autophagy in microglia resulted in the further decreases of neuron survival, increasing PI‐positive cells and caspase 3 expression, and aggravated the neurite shortening when the midbrain neurons or MES23.5 were exposed to TNF‐a microglia conditioned medium.

Conclusions: Our results demonstrate that TNF‐a inhibits autophagy in microglia through AKT/mTOR signaling pathway, and autophagy enhancement can promote the microglia polarization toward M2 phenotype and inflammation resolution.

175

A cross sectional study of optical coherence tomography in parkinson's disease: newer insights

Bharat Vishnu Reddy B, Sreekanta Swamy, Boraiah Nataraju, Srinivas Raju (Proddatur, India)

Objective: To assess the Retinal Nerve Fibre Layer Thickness (RNFL), Central Macular Thickness (CMT) & Total Macular Volume (TMV) of both eyes with Spectral Domain Optical Coherence Tomography (SD – OCT) in patients with PD and hence exploring the utility of OCT.

Background: Parkinson's disease (PD) is second most common neurodegenerative movement disorders worldwide and its incidence is increasing along with aging population[2]. Several clinical and histologic studies suggest that the neurodegenerative process, affecting the brain may also affect the other parts which includes retina of PD patients. Dopamine dysfunction in PD is seen not only in the basal ganglia but also in the retina especially in the horizontal, amacrine, bipolar and ganglion cells [2].

Methods: Source of Data: This is a hospital based, cross sectional study done at the department of Neurology, Vydehi Institute of Medical Sciences & Research Centre, Bengaluru, from January 2016 to November 2017 in the patients with clinical features of PD after fulfilling the inclusion and exclusion criteria.Sample Size: 70 patients with PD were enrolled into the study. Out of them 55 patients fulfilled the inclusion and exclusion criteria. 30 age and sex matched controls were included into the study.Neurological & Ophthalmological evaluation:Detailed clinical history and examination with UK Parkinson's Disease Society Brain Bank Clinical Diagnostic criteria, Hoehn and Yahr (H & Y) stage assessment and motor assessment using part III of the Unified Parkinson's Disease Rating Scale (UPDRS). After complete ophthalmological examination patients were subjected to SD‐OCT (Cirrus OCT, Carl Zeiss Meditec, India) to measure the RNFL thickness, CMT and TMV.

Results: RNFL: A significant negative correlation was found between the RNFL thickness and the UPDRS motor score in both the eyes (P value< 0.05). In the right eye, the significance is seen in the order of inferior> temporal> superior quadrants (r value= ‐0.812, ‐0.695, ‐0.693 respectively) with moderate correlation between RNFL nasal quadrant and UPDRS motor score (r value= ‐0.39). In the left eye the significance is in the order of inferior>nasal>temporal quadrants (r value= ‐0.749, ‐0.451, ‐0.440 respectively) with moderate correlation between RNFL superior quadrant and UPDRS motor score (r value= ‐0.34). TMV: A significant negative correlation was found between the TMV and the UPDRS motor score in both the eyes (P value< 0.001). In the right eye, the r value is ‐0.738; P<0.001 and on the left r= ‐0.717; P<0.001.CMT: A significant negative correlation was found between the CMT and the UPDRS motor score in both the eyes (P value< 0.001). In the right eye, the r value is ‐0.798; P<0.001 and on the left r= ‐0.807; P<0.001.

Conclusions: To our knowledge, this is one of the first studies which have included a large group of PD cohorts in Indian population. We have analysed the changes in the retina using the SD‐OCT and compared it with the severity of PD. Our study demonstrated a statistically significant difference in the OCT values. There was a significant negative correlation between the severity and stage of the PD illness with the OCT variables studied. These findings suggest the possibility of dopaminergic depletion in the retina. A further long term follow up study may be useful in assessing and demonstrating the progressive decrease in TMV over time. Contradictory findings between the different studies warrant studies with larger sample sizes and long term follow up. Longitudinal studies may also help establish whether specific measurements on the optical coherence tomography will be useful as a diagnostic marker for PD management and prognostication.

References: 1. De Lau LML, Breteler MMB 2006. Epidemiology of Parkinson's disease. Lancet Neurol 5: 525–5352. 6. M.B. Djamgoz, M.W. Hankins, J. Hirano, S.N. Archer, Neurobiology of retinal dopamine in relation to degenerative states of the tissue, Vis. Res. 37 (24) (1997) 3509‐3529.

Table 3.

Age distribution of study population

Age in years	Cases	Controls	Total
41‐50	5(9.1%)	10(33.3%)	15(17.6%)
51‐60	28(50.9%)	10(33.3%)	38(44.7%)
61‐70	17(30.9%)	8(26.7%)	25(29.4%)
71‐80	5(9.1%)	2(6.7%)	7(8.2%)
Total	55(100%)	30(100%)	85(100%)
Mean = SD	59.45=7.22	55.80=8.47	58.16=7.84

P=0.039*_: significant, Student t test

Graph 1.

Age distribution of study population

Table 4.

Gender distribution of study population

Gender	Cases	Controls	Total
Female	24(43.6%)	11(36.7%)	35(41.2%)
Male	31(56.4%)	19(63.3%)	50(58.8%)
Total	55(100%)	30(100%)	85(100%)

P=0.533, not significant, Chi‐Square test

Graph 2.

Gender distribution of study population

Table 5.

Duration of illness distribution

Duration of illness (years)	No. of patients	%
<6	43	79.6
6‐10	10	18.5
>10	1	1.9
Total	54	100.0

Mean ± SD: 3.43±2.96 years

Graph 3.

Duration of illness distribution

Table 6.

Comorbidity distribution

Any Comorbidity	No. of patients(n=55)	%
Nil	39	70.9
Yes	16	29.1
• HTN	12	18.2
• DM	3	5.5
• CAD	1	1.8
• Hypothyroidism	1	1.8
• EteoaeUs	1	1.8

Figure 6.

A pie diagram showing comorbidity distribution of patients studies.

Graph 4.

Comorbidity distribution

Table 7.

Mini Metal State Examination distribution

Mini Mental State Examination	No. of patients	%
25‐30	53	96.4
20‐25	1	1.8
10‐20	1	1.8
<10	0	0.0
Total	55	100.0

Mean ± SD: 27.53= 1.61

Graph 5.

Mini Mental State Examination distribution

Table 8.

Unified Parkinson's disease rating score (motor score) distribution of patients studied

Unified Parkinson's disease rating score (motor score)	No. of patients	%
<10	7	12.7
10‐30	42	76.4
>30	6	10.9
Total	55	100.0

Mean ± SD: 17.89±9.57

Graph 6.

Unified Parkinson's diseases rating score (motor score) distribution of patients studied

Table 9.

Hoehn and Yahr| Score distribution of patients studied

Hoehn and Yahr Score	No. of patients	%
1	9	16.4
1.5	2	3.6
2	30	54.5
2.5	8	14.5
3	6	10.9
Total	55	100.0

Graph 7.

Hoehn and Yahr Score distribution of patients studies

Table 10.

OCT variables studied in the Right eye

OCT variables	Cases	Controls	Total	P value
RNFL Average	76.63=8.98	94.55±4.55	82.96±11.54	<0.001**
RNFL Inferior Quadrant	90.76±17.39	119.10±8.70	100.76=20.15	<0.001**
RNFL Superior Quadrant	100.90=11.57	118.53±6.26	107.12=13.09	<0.001**
RNFL Nasal Quadrant	65.42=9.24	70.53±4.49	67.23=8.24	<0.001**
RNFL Temporal Quadrant	49.19=7.03	69.60=3.38	56.39±11.49	<0.001**
Total Macular Volume	9.20±1.13	7.28±0.30	8.52±1.31	<0.001**
Central Macular Thickness	221.25±9.50	242.47±5.59	228.74=13.14	<0.001**

Student t test

Graph 8.

OCT variables studied in the Right eye

Table 11.

OCT variables studied in the Left eye.

Retinal nerve fiber layer: Left	Cases	Controls	Total	P value
RNFL Average	78.00=7.52	95.59=4.62	84.21±10.73	<0.001**
RNFL Inferior Quadrant	93.01±13.25	120.4=7.41	102.68=17.47	<0.001**
RNFL Superior Quadrant	102.77=10.91	119.87±7.04	108.8±12.70	<0.001**
RNFL Nasal Quadrant	65.02=8.29	71.07=4.85	67.15=7.80	<0.001**
RNFL Temporal Quadrant	51.17=7.82	71.03=3.88	58.18±11.65	<0.001**
Total Macular Volume	9.13±1.10	7.32±0.31	8.49±1.26	<0.001**
Central Macular Thickness	222.09±8.71	243.13±5.69	229.52=12.74	<0.001**

Student t test

Graph 9.

Oct variables studied in the Left eye

Table 12.

Pearson Correlation of UPDRS 3 with OCT variables in the Right eye

UPDRS 3 vs OCT variables: Right	r value	P value
UPDRS3 vs RNFL Average	‐0.866	<0.001**
UPDRS3 vs RNFL Inferior Quadrant	‐0.812	<0.001**
UPDRS3 vs RNFL Superior Quadrant	‐0.693	<0.001**
UPDRS3 vs RNFL Nasal Quadrant	‐0.392	0.003**
UPDRS3 vs RNFL Temporal Quadrant	‐0.695	<0.001**
UPDRS3 vs Total Macular Volume	‐0.738	<0.001**
UPDRS3 vs Central Macular Thickness	‐0.798	<0.001**

Pearson correlation

Graph 10.

Scatter plot graph correlating UPDRS 3 score with OCT variables of the Right eye

Table 13.

Pearson Correlation of UPDRS 3 with OCT variables in the Left eye

UPDRS 3 vs OCT variables: Left	r value	P value
UPDRS 3 vs RNFL Average	‐0.693	<0.001**
UPDRS 3 vs RNFL Inferior Quadrant	‐0.749	<0.001**
UPDRS 3 vs RNFL Superior Quadrant	‐0.343	0.010**
UPDRS3 vs RNFL Nasal Quadrant	‐0.451	0.001**
UPDRS 3 vs RNFL Temporal Quadrant	‐0.440	0.001**
UPDRS3 vs Total Macular Volume	‐0.717	<0.001**
UPDRS3 vs Central Macular Thickness	‐0.807	<0.001**

Figure 11.

Scatter plot graph correlating UPDRS 3 score with OCT variables of the left eye

Table 14.

Pearson Correlation of Duration of illness with OCT variables in the Right eye

Duration of illness vs OCT variables: Right	r value	P value
Duration of illness vs RNFL Average	‐0.210	0.127
Duration of illness vs RNFL Inferior Quadrant	‐0.217	0.115
Duration of illness vs RNFL Superior Quadrant	‐0.096	0.489
Duration of illness vs RNFL Nasal Quadrant	‐0.167	0.226
Duration of illness vs RNFL Temporal Quadrant	‐0.165	0.232
Duration of illness vs Total Macular Volume	‐0.131	0.346
Duration of illness vs Central Macular Thickness	‐0.123	0.375

Graph 12.

Scatter plot graph correlating Duration of illness with OCT variables of the right

Table 15.

Pearson Correlation of Duration of illness with OCT variables in the Left eye

Duration of illness vs OCT variables: Left	r value	P value
Duration of illness vs RNFL Average	‐0.174	0.208
Duration of illness vs RNFL Inferior Quadrant	‐0.274	0.045*
Duration of illness vs RNFL Superior Quadrant	‐0.074	0.595
Duration of illness vs RNFL Nasal Quadrant	‐0.062	0.656
Duration of illness vs RNFL Temporal Quadrant	‐0.099	0.478
Duration of illness vs Total Macular Volume	‐0.051	0.712
Duration of illness vs Central Macular Thickness	‐0.108	0.438

Graph 13.

Scatter plot graph correlating Duration of illness with OCT variables of the left eye

Table 16.

Pearson Correlation of H & Y score with OCT variable in the Right eye

H & Y SCORE vs OCT variables: Right	r value	P value
H & Y score vs RNFL Average	‐0.S18	<0.001**
H & Y score vs RNFL Inferior Quadrant	‐0.625	<0.001**
H & Y score vs RNFL Superior Quadrant	‐0.654	<0.001**
H & Y score vs RNFL Nasal Quadrant	‐0.553	<0.001**
H & Y score vs RNFL Temporal Quadrant	‐0.696	<0.001**
H & Y score vs Total Macular Volume	‐0.483	<0.001**
H & Y score vs Central Macular Thickness	‐0.714	<0.001**

Graph 14.

Scatter plot graph correlating H & Y score with OCT variables of the right eye

Table 17.

Pearson Correlation of H & Y score with OCT variable in the Left eye

H & Y SCORE vs OCT variables: Left	r value	P value
H & Y score vs RNFL Average	‐0.695	<0.001**
H & Y score vs RNFL Inferior Quadrant	‐0.630	<0.001**
H & Y score vs RNFL Superior Quadrant	‐0.424	<0.001**
H & Y score vs RNFL Nasal Quadrant	‐0.539	<0.001**
H & Y score vs RNFL Temporal Quadrant	‐0.452	0.001**
H & Y score vs Total Macular Volume	‐0.521	<0.001**
H & Y score vs Central Macular Thickness	‐0.650	<0.001**

Graph 15.

Scatter plot graph correlating H & Y score with OCT variables of the left eye

176

GO‐SHA‐JINKI‐GAN (GJG) prevent inflammation in MPTP induced Parkinson's disease model mice

Shiying Jiang, Kousuke Baba, Hideki Hayakawa, Keisuke Hagihara, Hideki Mochizuki (Osaka, Japan)

Objective: To investigate whether GO‐SHA‐JINKI‐GAN (GJG) plays a protective role in MPTP induced Parkinson's disease model mice.

Background: GJG is a Japanese traditional herbal medicine and we have found that GJG has anti‐inflammation and PGC1‐a upregulation effect. Here we discussed the protective potential of GJG to neurons in brain.

Methods: C57BL/6J male mice were divided into Control, MPTP and MPTP‐GJG groups. Since we considered span of GJG treatment might have influence on the effective concentration of GJG, the pretreatment time of GJG was divided into three groups as 1 week, 1 month and 3 months. Intraperitoneal injection of MPTP 15mg/kg was performed 4 times/2h within a day respectively after each pretreatment was completed. Brains were then collected 1 week after the injection. Immunostaining and Western Blotting analysis were performed.

Results: MPTP induced inflammation in substantia nigra and increase of microglia activated marker, Iba1 positive cell. For 1 week and 1 month pretreatment, reduction of Iba1 positive cell had no significant difference. While GJG 3 months pretreatment significantly ameliorated inflammation characterized by reduction of Iba1. Both of 1 week and 1 month did not have substantial reduction of Iba1 positive cell compared with 3 month group. However, though the inflammation was palliated, reduction of dopaminergic neurons (TH positive cells) caused by MPTP in substantia nigra was slightly prevented not as effective as we expected.

Conclusions: GJG plays a protective role against inflammation in brain whose effectiveness is related to the duration of pretreatment. We speculated that pretreatment span is concerned with effectiveness of GJG. However, in protection of dopaminergic neurons (DA), GJG did not show much effectiveness as expected.

References: Go‐sha‐jinki‐Gan (GJG), a traditional Japanese herbal medicine, protects against sarcopenia in senescence‐accelerated mice. (Kishida et.al., 2014) Go‐sha‐jinki‐Gan (GJG) ameliorates allodynia in chronic constriction injury‐model mice via suppression of TNF‐a expression in the spinal cord. (Nakanishi et.al., 2016)

177

The research of inhibiting Glucocerebrosidase leads to Parkinson's disease in mice via decreasing cathepsin D

Zheng Sun, Cheng Chang, Jian‐Jun Ma, Si‐yuan Chen, Wei‐Wei Yan, Qi Gu, Lin‐yi Li, Zhenxiang Zhao (Henan, People's Republic of China)

Objective: The purpose of this study is to elucidate whether the inhibition of glucocerebrosidase (GCase,GBA) leading Parkinson's disease (PD) and accumulation of serine129 (S129) phosphorylated alpha‐syncline (a‐syn) in mice by decreasing Cathepsin D (CTSD).

Background: Studies have showed GCase deficiency is one of the risk factors for developing PD. Animal models have exhibited inhibiting the expression of GCase leads to accumulation of a‐syn in substantia nigra (SN). And CTSD plays an important role in degration of a‐syn. Studies also showed the specificity of S129 phosphorylated a‐syn is higher than a‐syn in pathological process of PD.

Methods: 8 weeks old male C57BL/6 mice were used in this study. These mice were divided into 3 groups: Control group, MPTP group and conduritol‐ß‐epoxide (CBE) group. The mice in MPTP group were injected with MPTP to induce subacute PD model mice. The mice in CBE group received injections of CBE. Changes of behavior of the mice were studied through pole test. To explore the change of dopaminergic (DA) neurons in SN, immunohistochemistry was used to observe the number of Tyrosine Hydroxylase (TH)‐positive cells. Western blotting was used to evaluate the expressions of S129phosphorylated a‐syn, CTSD and GBA in SN.

Results: Compared with the Control group, MPTP and CBE groups showed motor deficiency. Pole test results showed significantly increased time to turn and descend in these two groups (P<0.001,figure1). Immunohistochemistry results showed the numbers of TH‐positive cells in the bilateral SN of MPTP and CBE groups were significantly decreased compared with Control group (P<0.001,figure2). The result of Western blotting showed in comparison to Control group, the level of S129 phosphorylated a‐syn were increased (P<0.01,P<0.05,figure3), but the expressions of CTSD and GBA were decreased in MPTP and CBE groups (P<0.001).

Conclusions: The findings indicate inhibition of GCase leads to the accumulation of S129phosphorylated a‐syn and loss of DA neurons in SN via decreasing CTSD, which result in the occurrence of PD in mice.

References: Taguchi YV, Liu J, Ruan J, et al. Glucosylsphingosine Promotes alpha‐Synuclein Pathology in Mutant GBA‐Associated Parkinson's Disease[J]. J Neurosci, 2017, 37 (40): 9617‐9631

Figure 1.

 

Figure 2.

 

Figure 3.

 

Figure 4.

 

178

Elevated serum pesticide levels and risk for Parkinson's disease

Shaoqing Xu, Xiaodong Yang, Yiwei Qian, Qin Xiao (Shanghai, People's Republic of China)

Objective: To evaluate the association between serum levels of pesticides and Parkinson's disease (PD).

Background: The etiological factors of PD are not yet completely understood. Exposure to pesticides has been reported to increase the risk of PD. However, the identification of the specific pesticides is lacking.

Methods: A total of 90 PD patients and their healthy spouses who were living in the same household for at least 20 years were included in this case‐control study. Clinical features were recorded including disease duration, the Hoehn and Yahr stage (H&Y stage), levodopa equivalent dose (LED), Unified Parkinson's Disease Rating Scale (UPDRS) scores, Non‐Motor Symptoms questionnaire for Parkinson's disease (NMS), Hamilton Anxiety Scale (HAMA), Hamilton Depression Scale (HAMD), Mini‐Mental State Examination (MMSE) and Montreal Cognitive Assessment (MoCA). Serum sample was also collected. The level of serum pesticides was investigated by Gas Chromatography‐Mass Spectrometer (GC‐MS) method in PD patients and controls.

Results: We detected 19 pesticides in the serum of PD patients and controls. We found that a‐HCH, ß‐HCH, Aldrin and pp'‐DDE were more often detectable in patients with PD than controls. The median level of a‐HCH, a‐HCH, d‐HCH, Propanil, Heptachlor, Dieldrin and pp'‐DDE were higher in patients with PD compared with controls. After controlling the age and gender, d‐HCH significantly increased the risk of PD. Moreover, serum level of a‐HCH was positively correlated with UPDRS part I, UPDRS part II, UPDRS total scores, NMS scores and negatively correlated with MMSE scores. Dieldrin was positively correlated with HAMD scores. pp'‐DDE was positively correlated with UPDRS part III, UPDRS total scores, NMS scores, and negatively correlated with MoCA scores.

Conclusions: These data suggest that d‐HCH is associated with increased the risk of PD. Further research is needed regarding the potential role of d‐HCH as a etiologic agent for some cases of PD.

179

Study on Serum differential proteomics in Parkinson's disease

Yunfei Long, Fei Xiao, Yanyan Jiang, Xin Xin Ma, Huijing Liu, Haibo Chen, Wen Su (Beijing, People's Republic of China)

Objective: LC‐MS/MS was used to search for differential proteins in the serum of PD patients and normal controls, in order to find the biomarker of PD Serum proteins.

Background: Parkinson's disease (PD) is a kind of common neurodegenerative disease. The mechanism of PD associated mental disorders is still unclear, and few studies on the relationship between PD mental disorders and genetic factors are available. In addition, the clinical diagnosis of PD is often limited by the experience of the clinician, and there is no biomarkers that can diagnose PD accurately. The pathogenesis of PD, still unclear, may be related to genetic, environment, age, abnormal protein deposition, oxidative stress, mitochondrial dysfunction, etc. And proteins are the direct substances to reflect the various biological processes. With the development of proteomics, label‐free quantitative proteomics technology (LC‐MS/MS) is widely used in disease research, and the research of serum differential proteins is of great significance in the study of biomarkers.

Methods: A total of 24 PD patients were enrolled, of which 12 had only PD, 12 had PD only complicated with hypertension and/or diabetes mellitus. 24 age‐ and sex‐matched controls included 12 healthy individuals and 12 controls hypertension and/or diabetes without other diseases. Serum samples were collected, LC‐MS/MS was used to detect the serum protein expression in each group. After screening out the difference between the expression of each group of proteins, select the expression of the same changes in each group of proteins, which are differential proteins.

Results: 1. With the mass spectrometry analysis and identification of samples, a number of 144 proteins were identified and the differential proteins were PRG4, CFHR‐3, ACTG1 and HIST2H2BF. In the serum of patients with PD, the expression of PRG4 and CFHR‐3 was incereased, ACTG1 and HIST2H2BF was decreased. 2. Bioinformatics analysis revealed that 4 differential proteins were mainly distributed in the extracellular region and blood microparticle, but no significant enrichment in molecular function, biological process and KEGG pathway.

Conclusions: LC‐MS/MS may be an effective method to study proteomics of Parkinson's disease. PRG4, CFHR‐3, ACTG1 and HIST2H2BF were differential proteins in the serum of patients with PD, which may have a certain significance in the diagnosis of PD.

Table 1.

The sex and age of 24 PD patients, of which 12 had only PD (group PI), 12 had PD only complicated with hypertension and/or diabetes mellitus (group P2), with 24 age‐ and sex‐matched controls included 12 healthy individuals (group N1) and 12 controls hypertension and/or diabetes without other diseases(group N2).

Groups	PI	P2	N1	N2	Total
Male	6	6	6	6	24
Female	6	6	6	6	24
Age range	56‐83	59‐78	59‐80	58‐78	56‐83
Average age	67.8=9.3	69.8=5.9	70.6=7.1	70.0=6.6	69.6=7.2

Table 2.

Serum protein expression in each group detect by LC‐MS/MS. The value of detection is relative, not absolute.

UniProtKB	Protein	Description	PI	P2	N1	N2
Q92954	PRG4	proteoglycan 4	4.90*106	3.53*107	0	0
Q02985	CFHR‐3	complement factor H‐related protein 3	5.30*106	3.64*107	0	0
P63261	ACTG1	actin, cytoplasmic 2	0	0	1.87*107	1.95*107
Q5QNW6	HIST2H2BF	histone H2B type 2‐F isoform b	S.00*106	5.00*106	3.47*107	3.50*107

180

Auricular vagus nerve stimulation exerts antiinflammatory effects and immune regulatory function in a 6‐OHDA model of Parkinson's disease

Ying Jiang, Tao Feng (Beijing, People's Republic of China)

Objective: The aim of this study was to evaluate the effects of auricular vagus nerve stimulation (aVNS) on substantia nigra (SN) dopaminergic neurodegeneration and the associated neuroinflammation and immune responses in a rat PD model.

Background: According to epidemiologic studies, smoking appears to downregulate the prevalence of Parkinson's disease (PD), possibly due to antiinflammatory mechanisms via activation of a7 nicotinic acetylcholine receptors (a7 nAChRs). This receptor also appears to play a role in T‐cell differentiation. Recently, it has become apparent that the innate immune system participates in PD pathogenesis.

Methods: Adult male Wistar rats were unilaterally administered 6‐hydroxydopamine (6‐OHDA) to the medial forebrain bundle, followed by aVNS treatment after surgery. Following motor behavioral tests, the expression of tyrosine hydroxylase (TH) in the SN and the levels of inflammatory cytokines in the ventral midbrain were evaluated. In addition, changes in the trends of subsets of CD4+ T lymphocytes in the SN were measured by immunofluorescence staining. Western blotting was used to evaluate the a7 nAChR protein level.

Results: Compared with 6‐OHDA treats rats, aVNS treatment significantly improved motor deficits, increased TH and a7 nAChR expression, and reduced the levels of inflammatory cytokines (tumor necrosis factor‐a (TNF‐a) and interleukin‐1ß (IL‐1ß)) (p<0.05). Additionally, aVNS increased the numbers of regulatory T (Treg) cells while decreasing T helper (Th)17 cells.

Conclusions: aVNS exerted neuroprotective effects against dopaminergic damage, possibly by suppressing the evolution of inflammation and modulating innate immune responses. Thus, aVNS may be a potential promising therapy in the future.

References: 1.Ay I, Napadow V, Ay H. (2015) Electrical stimulation of the vagus nerve dermatome in the external ear is protective in rat cerebral ischemia. Brain Stimul. 8 (1):7‐12. 2.Bordia T, McGregor M, Papke RL, Decker MW, McIntosh JM, Quik M (2015) The a7 nicotinic receptor agonist ABT‐107 protects against nigrostriatal damage in rats with unilateral 6‐hydroxydopamine lesions. Exp Neurol. 263:277‐84. 3.Galitovskiy V, Qian J, Chernyavsky AI, Marchenko S, Gindi V, Edwards RA, Grando SA (2011) Cytokine‐induced alterations of a7 nicotinic receptor in colonic CD4 T cells mediate dichotomous response to nicotine in murine models of Th1/Th17‐ versus Th2‐mediated colitis. J Immunol. 187 (5):2677‐87.4.Farrand AQ, Helke KL, Gregory RA, Gooz M, Hinson VK, Boger HA (2017) Vagus nerve stimulation improves locomotion and neuronal populations in a model of Parkinson's disease. Brain Stimul.10 (6):1045‐1054.

181

SNX16 regulates intracellular a‐synuclein trafficking in microgliaSNX16 regulates intracellular a‐synuclein trafficking in microglia

Yuan Li, Wenyan Kang, Yiwen Wu, Qiong Yang, Jun Liu (Shanghai, People's Republic of China)

Objective: Growing evidence has demonstrated that intracellular a‐synuclein mediates a proinflammatory response in microglia, which, in turn, may have a role in the pathogenesis of Parkinson's disease (PD). We aim to explore the mechanism of the intracellular trafficking of a‐synuclein in microglia.

Background: Accumulating evidence suggests that a–synuclein may be involved in the initiation and disease progression of PD. Microglia are activated by aggregated or nitrated forms of a‐synuclein and could mediate the neurotoxic effects induced by the a‐synuclein protein by changing morphology or secreting cytokines.

Methods: A proteomic technique was performed to screen associated proteins involved in the intracellular trafficking of a‐synuclein. A single protein was identified. Subsequently, confocal microscopy, immunoprecipitation experiments and pull‐down assays were performed to validate the interaction between the targeted protein and a‐synuclein. Lastly, an siRNA technique was used to evaluate the alteration of a‐synuclein traffic in microglia after targeted protein knockdown. Contemporaneously, an assessment of whether the protein then affected the process of a‐synuclein‐induced microglial activation was also measured.

Results: Our results identified SNX16 involvement in the intracellular transport of a‐synuclein, and its interaction with a‐synuclein in microglia was validated. Further research determined that SNX16 silencing could not only decrease intracellular expression of a‐synuclein but also influence the process of a‐synuclein‐induced microglial activation.

Conclusions: We demonstrated that SNX16 is involved with a‐synuclein trafficking in microglia cells. Considering the role of a‐synuclein in microglia, our results might provide new clues for preventing a‐synuclein‐induced microglial activation in PD.

References: 1. Bliederhaeuser C, Grozdanov V, Speidel A, Zondler L, Ruf WP, Bayer H, et al. Age‐dependent defects of alpha‐synuclein oligomer uptake in microglia and monocytes. Acta Neuropathol. 2016;131 (3):379‐91.2. Yoshida S, Hasegawa T, Suzuki M, Sugeno N, Kobayashi J, Ueyama M, et al. Parkinson's disease‐linked DNAJC13 mutation aggravates alpha‐synuclein‐induced neurotoxicity through perturbation of endosomal trafficking. Hum Mol Genet. 2018;27 (5):823‐36.

Figure 1.

 

Figure 2.

 

Figure 3.

 

182

Freezing of gait in Parkinson's Disease: a deterministic model classification objective method for tracking and predicting preventing FoG episodes in PDs (prognostic diagnosis)

Venkateshwarla Rama Raju, Borgohain Rupam, Rukmini Kandadai (Hyderabad, India)

Objective: There is a growing need to develop automated methods for detecting FoG, with ultimate‐goal of being able not only to determine but also to predict and prevent episodes of FoG. In this, we developed a new‐method which automatically detects the onset‐and‐duration of FoG in PDs in real‐time, employing inertial‐sensors.

Background: Parkinson's disease (PD) is the second most common neurodegenerative disease which is characterized by the convolution of four classes of cardinal motoric symptoms: tremor, rigidity, Bradykinesia and postural instability. The search for optimal cure is on for the past 2 centuries since the time it was first described by James Parkinson [1] in 1817. The main‐cause of PD is a loss‐of‐ dopaminergic, sub‐cortical‐neurons, which leads to motor‐impairments [1]. To validate the severity‐of frequency of gait (FoG) presently, clinicians use patient‐questionnaires such as the new‐FoG‐Questionnaire (NFoG‐Q) [2] that rely‐on‐patient self‐report.

Methods: In this study, we develop‐new‐methods to automatically‐detect the onset/duration of FoG in PD‐patients in real‐time, employing inertial‐sensors. We first‐build a physical‐model that describes trembling‐motion during the FoG‐events. We then design a generalized likelihood‐ratio‐test framework‐to‐develop a two‐stage detector‐for‐determining zero‐velocity and trembling‐events during‐gait. Thereafter, to filter‐out‐falsely detected‐FoG‐events, we develop a point‐process‐filter that combines the output‐of‐the‐detectors with information about the speed‐of‐the‐foot, provided by a foot mounted inertial‐navigation‐system. We computed the probability of FoG by using the point‐process filter to determine the onset/duration‐of‐FoG event. Finally, we validate the performance‐of‐proposed system‐design using real‐data gathered from PD cases (while on gait tasks). We compare our results with an existing method that uses accelerometer‐data.

Results: The results indicate that our method yields 81.03% accuracy in detecting FoG events and a threefold decrease in the false alarm rate relative to the existing method.

Conclusions: We introduced a new system‐design to address the problem‐of‐finding of FoG using inertial‐sensors. Future‐plan is to develop an adaptive‐design‐framework which learns the system‐parameters based on Fog‐events and dynamically adjusts the model‐parameters. Development of a valid, reliable, and dynamic‐method of real‐time identification‐of‐FoG is critical to better‐understand patterns and frequency of FOG in daily life. Significance: An enhanced‐understanding of FoG may lead to development of novel‐treatment‐approaches to address FoG‐events in real‐time.

References: [1] H. Braak et al., “Stages in the development of Parkinson's disease related pathology,” Cell Tissue Res., Vol.318, No.1,Pp.121‐134,2014. [2] A. Nieuwboer et al., “Reliability of the new freezing of gait questionnaire: Agreement between patients with Parkinson's disease and their carers,” Gait Posture,Vol. 30, No.4,Pp.459–463,2009.

183

Prion‐like mechanisms in Parkinson's disease

Jiangnan Ma, Xie Anmu (Qingdao, People's Republic of China)

Objective: To summarize the mechanisms that involved in the aggregation of abnormal intracellular a‐syn and its subsequent transmission cell‐to‐cell. According to these findings, we expect for the effective therapeutic perspective that can block the disease progression.

Background: Formation and aggregation of misfolded protein in central nervous system (CNS) are a central hallmark of several age‐related neurodegenerative diseases,including Alzheimer's disease (AD),Parkinson's disease (PD) and amyotrophic lateral sclerosis (ALS). These diseases share key biophysical and biochemical characteristics with prion disease.

Methods: Summarize the research progress in recent years.

Results: The misfolded aggregation escape from the clearance and release to the extracellular space via synapse, exosome, exocytosis, cell death or tunneling nanotubes. Afterwards, the a‐syn aggregations are internalized by the recipient cell and induce the endogenous a‐syn to misfold and assemble with some unclear manner.

Conclusions: Abnormal a‐syn can spread to neighboring brain regions and cause aggregation of endogenous a‐syn as seeds in a “prion‐like manner”.

References: M. Hasegawa, T. Nonaka, M. Masuda‐Suzukake, Prion‐like mechanisms and potential therapeutic targets in neurodegenerative disorders, Pharmacol Ther, 172 (2017) 22‐33.

184

Dopaminergic neuron injury in Parkinson disease is mitigated by interfering lncRNA SNHG14 expression through miR‐133b/a‐Synuclein pathway

Hong Lu, Limin Zhang (Zhengzhou, People's Republic of China)

Objective: This study was undertaken to explore the etiology and pathogenesis of PD and provide scientific evidence for the prevention and treatment of this neurodegenerative disorder.

Background: Abundant a‐synuclein (a‐syn) protein accumulation is the pathological hallmark of Parkinson disease (PD) and it induces dopaminergic (DA) neuron apoptosis. This study explored the regulatory effect of long non‐coding RNA (lncRNA) SNHG14 on a‐syn in DA neurons, aiming to elucidate the role of SNHG14 in PD pathogenesis.

Methods: PD model was established in mouse with a stereotaxic surgery, and the motor function of mice was assessed. In the brain tissue of PD mice, the expression levels of SNHG14, miR‐133b, a‐syn and SP‐1 protein were determined. Chromatin immunoprecipitation (ChIP) assay was performed to validate the binding between SP‐1 and SNHG14 promoter. DA neuron viability was analyzed with CCk‐8 assay. Interplay between SNHG14 and miR‐133b was examined with RNA immunoprecipitation (RIP) and RNA pull‐down assay. Regulatory relationship between miR‐133b and a‐syn was verified through dual luciferase reporter assay. Interference of SNHG14 in PD mice was achieved by lentiviral injection.

Results: Compared with the sham group (n=7), the expression of SNHG14, a‐syn and SP‐1 protein was increased in PD mice model (n=7), while miR‐133b was down‐regulated. Binding between SP‐1 and SNHG14 promoter was enhanced by rotenone, and rotenone promoted SNHG14 expression through SP‐1. Interference of SNHG14 ameliorated DA neuron injury induced by rotenone. Interaction between SNHG14 and miR‐133b was identified in clonal mesencephalic dopaminergic cell line MN9D cells. MiR‐133b negatively regulated a‐syn by targeting its 3'‐UTR of mRNA. SNHG14 regulated a‐syn expression via miR‐133b. Interference of SNHG14 improved DA neuron activity that affected by rotenone through miR‐133b. Down‐regulated SNHG14 mitigated neuron injury in PD mouse model.

Conclusions: Interference of lncRNA SNHG14 expression mitigates dopaminergic neuron injury by down‐regulating a‐syn via miR‐133b, which contributes to improving PD pathological state.

185

This abstract has been withdrawn.

186

Idebenone alleviates neuroinflammation and modulates microglial polarization in LPS‐stimulated BV2 cells and MPTP‐induced Parkinson's disease mice

Aijuan Yan, Song Lu, Zhenguo Liu (Shanghai, People's Republic of China)

Objective: Idebenone may have an inhibitory effect on neuro‐inflammatory processes and microglial activation in PD. To test this hypothesis, we will investigate the antineuroinflammation and microglia modulating effects of idebenone in the BV2 microglial cell line and examine idebenone's efficacy on 1‐methyl‐4‐phenyl‐1,2,3,6‐tetrahydropyridine (MPTP)‐induced neurodegeneration and neuroinflammatory response in PD mice.

Background: Idebenone is an antioxidant and a coenzyme Q10 analog that has been used to treat neurodegeneration disease. Some studies show idebenone exerts anti‐inflammatory effects. However, whether idebenone can be used to reduce the neuroinflammation in Parkinson's disease (PD) has been little studied.

Methods: The study investigated potential anti‐inflammatory effects of idebenone in vitro and in vivo, using cell models of Lipopolysaccharide (LPS)‐simulated BV2 cells and animal models of 1‐methyl‐4‐phenyl‐1,2,3,6‐tetrahydropyridine (MPTP)‐induced PD with or without idebenone. To verify how idebenone exerts its effects on the BV2 cell activation and PD model, we performed the mechanistic studies in vitro and in vivo.

Results: in vitro study showed that pretreatment with idebenone could attenuate the production of pro‐inflammatory factors in LPS‐stimulated BV2 cells and promoted a phenotypic switch from the M1 state to the M2 state. Mechanistically, idebenone reduced the activation of the MAPK and NF‐B signaling pathway upon LPS stimulation. Furthermore, in vivo experiments confirmed that pretreatment with idebenone could ameliorate MPTP‐induced neurodegeneration and modulate microglia phenotypes through inhibition of the MAPK and NF‐B signaling pathway in the SN.

Conclusions: These results suggest that idebenone ameliorates the neurological deficits related to PD and that this effect is partly mediated by inhibiting the neuroinflammation and modulating microglia phenotypes.

References: Jaber, S., and Polster, B.M. (2015). Idebenone and neuroprotection: antioxidant, pro‐oxidant, or electron carrier? J Bioenerg Biomembr 47 (1‐2), 111‐118. doi: 10.1007/s10863‐014‐9571‐y.Lauro, F., Ilari, S., Giancotti, L.A., Ventura, C.A., Morabito, C., Gliozzi, M., et al. (2016). Pharmacological effect of a new idebenone formulation in a model of carrageenan‐induced inflammatory pain. Pharmacol Res 111, 767‐773. doi: 10.1016/j.phrs.2016.07.043.Liu, C., Li, Y., Yu, J., Feng, L., Hou, S., Liu, Y., et al. (2013). Targeting the shift from M1 to M2 macrophages in experimental autoimmune encephalomyelitis mice treated with fasudil. PLoS One 8 (2), e54841. doi: 10.1371/journal.pone.0054841.Min, S., More, S.V., Park, J.Y., Jeon, S.B., Park, S.Y., Park, E.J., et al. (2014). EOP, a newly synthesized ethyl pyruvate derivative, attenuates the production of inflammatory mediators via p38, ERK and NF‐kappaB pathways in lipopolysaccharide‐activated BV‐2 microglial cells. Molecules 19 (12), 19361‐19375. doi: 10.3390/molecules191219361.

Figure 1.

 

Figure 2.

 

Figure 3.

 

187

Effect of 5‐BDBD on expression of NLRP3 and caspase‐1 in Parkinson's disease rat model

XiaoNa Zhang, Xie Anmu (Qingdao, People's Republic of China)

Objective: To investigate the effect of P2X4 receptor antagonist 5‐BDBD on the expression of P2X4R, NLRP3 and caspase‐1 in Parkinson's disease (PD) rat model induced by 6‐OHDA.

Background: ATP can be released as an extracellular stimulator when DA neurons were damaged, and bind to P2X4R on microglia. Then the inflammation corpuscles of NLRP3 in microglia can be activated, and secrete a variety of inflammatory cytokines, which caused the degeneration and death of DA neurons.

Methods: Wistar male rats were divided into 4 groups (n=30): control group: one week after normal saline pretreatment, 0.02% ascorbic acid was stereotactic injected into the left substantia nigra; 6‐OHDA group: one week after normal saline pretreatment, 6‐OHDA was stereotactic injected into the left substantia nigra; 5‐BDBD group: one week after 5‐BDBD pretreatment, 0.02% ascorbic acid was stereotactic injected into the left substantia nigra; 5‐BDBD+6‐OHDA group: one week after 5‐BDBD pretreatment, 6‐OHDA was stereotactic injected into the left substantia nigra. TH‐positive neurons in PD rats substantia nigra were detected by immunohistofluorescence stain. The relative mRNA level of P2X4R, NLRP3 and caspase‐1 was measured by RT‐PCR. The relative protein level of P2X4R, NLRP3 and caspase‐1 was measured by Western‐blot.

Results: Compared with the control group and 5‐BDBD group, the TH‐positive neurons were decreased in 6‐OHDA group and 5‐BDBD+6‐OHDA group (F=162.7, P<0.01); the mRNA level of P2X4R, NLRP3 and caspase‐1were increased in 6‐OHDA group and 5‐BDBD+6‐OHDA group (F=59.13,F=635.9,F=538.0; P<0.01); the protein level of P2X4R, NLRP3 and caspase‐1were increased in 6‐OHDA group and 5‐BDBD+6‐OHDA group (F=269.3,F=120.3,F=141.1; P<0.01). Compared with 6‐OHDA group, the TH‐positive neurons were increased in 5‐BDBD+6‐OHDA group (F=162.7, P<0.01); the mRNA level of P2X4R, NLRP3 and caspase‐1 were decreased in5‐BDBD+6‐OHDA group (F=59.13,F=635.9,F=538.0; P<0.01); the protein level of P2X4R, NLRP3 and caspase‐1 were decreased in 5‐BDBD+6‐OHDA group (F=269.3,F=120.3,F=141.1; P<0.01).

Conclusions: The results suggested that inhibiting the P2X4R could inhibit the inflammatory reaction and the degeneration of dopaminergic neurons of PD rat model, and inhibit the expression of NLRP3 and caspase‐1 induced by 6‐OHDA, which had a potential neuroprotective effect.

References: [1] Tolleson CM, Fang JY. Advances in the mechanisms of Parkinson's disease[J]. Discov Med, 2013, 15 (80): 61‐66. [2] Moon HE, Paek SH. Mitochondrial Dysfunction in Parkinson's Disease[J]. Annals of Neurology, 2015, 24 (1): 103‐116. [3] Jiang T, Sun Q, Chen S, et al. Oxidative stress: A major pathogenesis and potential therapeutic target of antioxidative agents in Parkinson's disease and Alzheimer's disease[J]. Prog Neurobiol, 2016, 147: 1‐19. [4] Hirsch EC, Vyas S, Hunot S. Neuroinflammunation in Parkinson's Disease[J]. Parkinsonism Relate Disord, 2011, 18 (4): 210‐212. [5] Gonza1ez H,Elgueta D,Montoya A,et a1. Neuroimmune regulation of mieroglial activity involved in neuroinflammation and neurodegenerative diseases[J]. Neuroimmune, 2014, 274 (1‐2): 1‐13. [6] WU T. DAI, M. SHI, X. R. Et. Functional expression of P2X4 receptor in capillary endothelial cells of the cochlear spiral ligament and its role in regulating the capillary diameter. Am J Physiol Heart Circ Physiol, 2017, 301 (1): H69‐78. [7] MJ BOURS, PC DAGNELIE, AL GIULIANI, A WESSELIUS, VF DI. P2 receptors and extracellular ATP: a novel homeostatic pathway in inflammation[J]. Frontiers in Bioscience, 2011, 3 (4):1443. [8] Z Mao, et al. The NLRP3 Inflammasome is Involved in the Pathogenesis of Parkinson's Disease in Rats[J]. Neurochemical Research, 2017, 42 (4): 1104‐1115. [9] T Chen, et al. Homerl knockdown protects dopamine neurons through regulating calcium homeostasis in an in vitro model of Parkinson's disease[J]. Cellular Signalling, 2013, 25 (12): 2863. [10] R Cabezas, et al. Astrocytic modulation of blood brain barrier: perspectives on Parkinson's disease[J]. Frontiers in Cellular Neuroscience, 2014, 8 (9‐10): 211. [11] MÈ Tremblay, et al. The role of microglia in the healthy brain. [J]. Journal of Neuroscience, 2011, 31 (45): 16064‐16069. [12] S Hunot, et al. Neuroinflanunation in Parkinson's Disease[J]. Parkinsonism & Related Disorders, 2003, 53 (3): 49‐60. [13] H González, et al. Neuroimmune regulation of microglial activity involved in neuroinflammation and neurodegenerative diseases[J]. Journal of Neuroimmunology, 2014, 274 (1‐2): 1‐13. [14] D Koziorowski, et al. Inflammatory cytokines and NT‐proCNP in Parkinson's disease patients[J]. Cytokine, 2012, 60 (3): 762‐6. [15] G Burnstock, et al. Physiopathological Roles of p2x Receptors in the Central Nervous System[J]. Current Medicinal Chemistry, 2015, 22 (7). [16] JQD Rodrigues, et al. Differential regulation of atrial contraction by P1 and P2 purinoceptors in normotensive and spontaneously hypertensive rats[J]. Hypertension Research, 2014, 37 (3): 210‐219. [17] PF Durrenberger, et al. Inflammatory Pathways in Parkinson's Disease; A BNE Microarray Study[J]. Parkinsons Dis, 2012, 2012, 214714. [18] Z Hracskó, et al. Lack of neuroprotection in the absence of P2X7 receptors in toxin‐induced animal models of Parkinson's disease[J]. BioMed Central. 2011, 102 (11): 1604‐1610. [19] Inou M, et al. NLRP3 inflammasome and MS/EAE[J]. Autoimmune Dis, 2013, 2013: 859145. [20] Willingham SB, et al. NLRP3 (NALP3,Cryopyrin) facilitates in vivo caspase‐1 activation, necrosis, and HMGB1 release via inflammasome‐dependent and –independent pathways[J]. J Immunol, 2009, 183 (3): 2008‐2015. [21] Juliana C, et al. Nontranscriptional priming and deubiquitination regulate NLRP3 inflammasome activation [J]. J Bio Chem, 2012, 287: 36617‐36622. [22] L Franchi, et al. The inflammasome: a caspase‐1‐activation platform that regulates immune responses and disease pathogenesis[J]. Nature Immunology, 2009, 10 (3): 241‐247. [23] K CHEN, et al. ATP‐P2X4 signaling mediates NLRP3 inflammasome activation: A novel pathway of diabetic nephropathy[J]. International Journal of Biochemistry & Cell Biology, 2013, 45 (5):932‐943.

188

Hydralazine protects nigrostriatal dopaminergic neurons from MPP+ and MPTP induced neurotoxicity: Roles of NRF2‐ARE signaling pathway

Xingfang Guo, Chao Han, Kai Ma, Yun Xia, Fang Wan, Si Jia Yin, Liang Kou, Yadi Sun, Jiawei Wu, Junjie Hu, Jinsha Huang, Nian Xiong, Tao Wang (Wuhan, People's Republic of China)

Objective: In this study, we tested whether the hypothesis of activation of NRF2 and its downstream network of antioxidative genes with hydralazine attenuated 1‐Methyl‐4‐phenylpyridinium (MPP+) and 1‐methyl‐4‐phenyl‐1,2,3,6‐tetrahydropyridine (MPTP)‐ induced neurotoxicity in vitro and in vivo.

Background: Although the pathogenic mechanisms that underlie Parkinson's disease (PD)remain unclear, ample empirical evidence suggests that oxidative stress is pivot player in disease pathogenesis. The nuclear factor E2‐related factor 2 (NRF2) is known to induce a battery of antioxidant response element (ARE)‐driven antioxidative genes expression that protect from oxidative stress in vitro and in vivo. Meanwhile, it was documented that hydralazine was a potent NRF2 activator.

Methods: Mice were administered hydralazine (Hyd) 51.7 mg/kg per day by oral gavage for 3 weeks before, during, and after MPTP 30 mg/kg ( i.p.) for 7 days. Human neuroblastoma cell line (SH‐SY5Y) were treated with hydralazine when exposed to MPP+ or not. Moreover, in the absence or presence of NRF2 SiRNA, SH‐SY5Y cells were subjected to MPP+ with hydralazine treatment or MPP+ alone.

Results: We showed that hydralazine was a potent activator of the NRF2‐ARE signaling pathway with upregulating antioxidative genes expression in an NRF2‐dependent manner, oral administration of hydralazine can ameliorates MPTP‐induced behavioral disorder, oxidative stress and dopaminergic neurons loss in the substantia nigra (SN) and striatum, associated with the activation of NRF2‐ARE signaling pathway, further confirmed in MPP+ induced in vitro model.

Conclusions: Our results indicate that hydralazine is a potential candidate for treating Parkinson's disease by activating NRF2‐ARE signaling pathway.

189

VPS35 interacts with DAT and disrupts DAT recycling pathway

Huang Yi, Zhou Leping1, Li Jiawei, Chen Xiang, Joseph Thomas, He Xiaofei1, Guo Wenyuan, Zeng Yixuan, Low Boon Chuan, Zeng Jinsheng, Tan Eng King, Wanli Smith, Zhong Pei, Christopher A. Ross (Zhuhai, People's Republic of China)

Objective: Recently, it has been shown that mutation of vacuolar protein sorting 35 homolog (VPS35) gene causes a rare, autosomal dominant form of Parkinson's disease (PD). The exact pathophysiologic role of VPS35 in PD is unknown.

Background: We aimed to determine whether pathogenic VPS35 mutation impacts the endosomal trafficking of DA transporter (DAT) and its underlying mechanism.

Methods: SWIP assay, co‐immunoprecipitation assays, western blot and immunofluorescent assay were used to investigate the effect of VPS35 expression on DAT recycling pathway in C.elegans model, Hela cells and mice.

Results: We reported several major findings: (i) VPS35 D620N expression caused decreased surface DAT; (ii) VPS35‐induced DAT dysfunction mediates VPS35‐induced disorder of DA signaling and neuronal toxicity; (iii) VPS35 directly interacted with DAT and (iv) VPS35‐induced surface DAT reduction was related with endosomal pathway.

Conclusions: Our results suggest that VPS35 regulates DAT function through the recycling pathway in neurons and support the notion that defects in the regulation of endosomal pathway probably contribute to the pathogenesis of PD, which could potentially unravel new therapeutic targets.

190

LRRK2 interacts with AQP4 and regulates the glymphatic pathway

Zhou Leping, Feng Yukun, Zhong Pei (Zhuhai, People's Republic of China)

Objective: Parkinson's disease (PD) is characterized by abundant α‐synuclein (α‐syn) deposition. The glymphatic pathway is important for the clearance of interstitial solutes. And aquaporin‐4 (AQP4) channels, were found to participate in this pathway. However, the underlying pathophysiology of Leucine‐rich repeat kinase 2 (LRRK2) and AQP4 in PD is scarce.

Background: The objective of this study was to determine whether LRRK2 regulates the glymphatic pathway by interaction with AQP4, which results in facilitating clearance of α‐syn.

Methods: In our study, we used the BAC LRRK2R1441G and FVBN mice. To assess glymphatic pathway function, we injected FITC(4KD) into the fourth ventricle and α‐synuclein labeled fluorescent dye into striatum, which were measured by 2‐photon laser scanning microscopy and multiscan spectrum, respectively. Immunofluorescent assay was used to evaluate AQP4 Polarity. To explore AQP4 phosphorylation level and whether if LRRK2 interacts with AQP4, western blot and immunofluorescent assay were employed.

Results: Compared to FVBN mice, we found LRRK2R1141G mice have significantly deficit in glymphatic pathway (Figure 1). Besides, AQP4 depolarization and upregulation of AQP4 phosphorylation level were found in LRRK2R1141G mice, compared to FVBN mice (Figure 2). In 293 cells, we further determined that LRRK2 interacts and co‐localizes AQP4 (Figure 3).

Conclusions: Our results suggest that LRRK2 can up‐regulate AQP4 phosphorylation level by interacting with AQP4, which disrupts the function of glymphatic pathway and further decreases clearance of α‐syn. Our study has may provide notion that the defects in the glymphatic pathway contribute to the pathogenesis in LRRK2R144G PD and underlying intervention in the future.

Figure 1.

 

Figure 2.

 

Figure 3.

 

191

Oral P. gingivalis activate microglia and upregulate LRRK2 of the DA neuron and PBMC in LRRK2R1441G mice.

Feng Yukun, Wu Qiongli, Chi Li, Peng Yanwen, Zhong Pei (Zhuhai, People's Republic of China)

Objective: Mutations that activate leucine‐rich repeat kinase 2 (LRRK2) kinase activity are associated with Parkinson's disease (PD), which have toxic effect on DA neuron. Peripheral influences have been implicated in the progression of PD, such as gut and oral cavity. However, relationship chronic periodontal disease and LRRK2R114G PD is scarce.

Background: The objective of this study was to determine whether oral P. gingivalis (Pg) have deleterious effect on substantia nigra (SN) by oral‐gut‐brain axis, which results in the progression PD.

Methods: In our study, BAC LRRK2R1441G and FVBN mice were given Pg by gavage. Immunofluorescent assay was used to evaluate number of DA neuron, activated microglia and LRRK2 location in the SN. To explore LRRK2 and pro‐inflammation expression level in the SN, western blot was employed. Peripheral blood mononuclear cells (PBMC) were isolated using Ficoll. And then LRRK2 and IL‐17A expression were measured by western blot. Besides, in vitro, we assess phenotype of lymphocyte from BAC LRRK2R1441G and FVBN mice without oral Pg using Flow cytometry. To assess perivascular function, we injected FITC (70KD) into the fourth ventricle, which were measured by 2‐photon laser scanning microscopy.

Results: There was no difference in DA neuron. However, Compared to FVBN mice, we found LRRK2R1141G mice have significantly increase in activated microglia (Figure 2) and upregulation of LRRK2 in DA neuron (Figure 1). Besides, activated microglia were belong to pro‐inflammatory phenotype (Figure 2). In the periphery, upregulation of LRRK2 expression and IL‐17A were found in LRRK2R1141G mice with Pg, compared to FVBN mice (Figure 3). In vitro, we further determined that there was a significant increase in plasma and lymphocyte cells for Th17 cells (Figure 4). Furthermore, deficit in perivascular pathway was observed in LRRK2R1141G mice with Pg.

Conclusions: Our results suggest that oral Pg are digested by gut and provokes production of IL‐17A by up‐regulating LRRK2 expression level. Transport of IL‐17A into brain may induce an increase of pro‐inflammatory microglia, which could have toxic effect on DA neuron by up‐regulation LRRK2 expression. Furthermore, inflammation response possibly disrupts perivascular pathway. Our study has may provide notion that peripheral inflammation response has a deleterious effect on neuron in the SN by mutant LRRK2 and targeting LRRK2 would be underlying intervention in the future.

Figure 1.

 

Figure 2.

 

Figure 3.

 

Figure 4.

 

192

The Parkinson's Disease associated protein DJ‐1 is critical for the integrity and function of ER and mitochondria tethering

Yi Liu, Xiongwei Zhu, Shengdi Chen (Shanghai, People's Republic of China)

Objective: To discover a new role and function of Parkinson's Disease associated protein DJ‐1 in ER and mitochondria contact sites.

Background: Prior studies suggest perturbation in endoplasmic reticulum (ER)‐mitochondria tethering (a.k.a. mitochondria‐associated ER membranes, MAMs) is involved in mitochondrial dysfunction and neurodegeneration in various neurodegenerative diseases including Alzheimer disease, Parkinson disease and Amyotrophic Lateral Sclerosis[1]. DJ‐1 is a protein with wide subcellular distribution and pleiotropic functions. The loss‐of‐function mutations of DJ‐1 are associated with autosomal recessive early‐onset Parkinson's disease yet the underlying pathogenic mechanism remains elusive.

Methods: Subcellular fractionation assays were used to purify the ER‐mitochondria contacts on both cultured human neuroblastoma cells, mouse brain tissues and human brain samples. A series of protein‐protein interactome (PPI)analyzing techniques including Co‐immunoprecipitation, 2D‐PAGE, Proximity Ligation Assay (PLA) were utilized to determine the interactions of DJ‐1 in ER‐mitochondria contact sites. The defective ER‐mitochondria crosslink in DJ‐1 defective models were analyzed in detail in biochemistry, ultrastruacture, interorganellar function and etc. to study the mechanism of action of DJ‐1 in ER‐mitochondria contacts.

Results: Our data suggest that DJ‐1 is an endogenous component of the ER‐mitochondria calcium transfer complex (i.e., IP3R‐grp75‐VDAC1 complex in the MAMs, Figure 1. DJ‐1 deficiency triggers the disassembly of this complex and caused the disassociation of ER and mitochondria tethering (Figure 2, 3).

Conclusions: Our study unveiled a novel role of DJ‐1 to facilitate the inter‐organelle calcium signaling via stabilizing the IP3R‐grp75‐VDAC1 complex in the ER‐mitochondria contact sites and suggest that impaired ER‐mitochondria tethering could contribute to the pathogenic effects of DJ‐1 mutations.

References: Liu, Yi, and Xiongwei Zhu. "Endoplasmic reticulum‐mitochondria tethering in neurodegenerative diseases." Translational neurodegeneration 6.1 (2017): 21.

Figure 1.

DJ‐1 is an endogenous MAMs resident protein and a component of ER‐mitochondria calcium transfer complex

A,B; Human M17 cells(A) and C57BL6 mouse brain(B) subcellular fractionation assays revealed DJ‐1 is an endougenous MAMs protein.

C: DJ‐1 is in close proximity with IP3R, grp75 and VDAC1 endogenously and simultaneously.

D: DJ‐1 interacts with IP3R‐grp75 complex in MAMs.

E,F: Blue native and 2D PAGE revealed that DJ‐1 is component of ER‐miltochondria

Calcium transfer complex.

Figure 2.

DJ‐1 Knockout caused the disassembly of ER‐mitochondria contacts.

A,B. DJ‐1 KO caused the disassembly of IP3R‐grp75‐VDAC1 macrocomplex.

C: Ultrastructural analysis indicated the ER‐mitochondria contacts were destroyed in DJ‐1 KO cells

D: The ER calcium relese capscity via IP3R was inhibites in DJ‐1 KO cells.

E: The m tochondrial calcium uptake was impaired in DJ‐1 KO cells.

Figure 3.

Graphical illustration of the role and function of Parkinson's Disease associated proteint DJ‐1 in ER‐mitochondra contact sites

193

Source identification of abnormally increased hsa‐miR‐4639‐5p in plasma of PD patients and preliminary exploration on its transcriptional regulation

Yimeng Chen, He Lu, Jianqing Ding, Shengdi Chen (Shanghai, People's Republic of China)

Objective: To identify the source of abnormally increased hsa‐miR‐4639‐5p in plasma of PD patients, and to explore the transcriptional regulation of hsa‐miR‐4639‐5p.

Background: Decreased level of normal DJ‐1 protein is associated with the occurrence of PD due to the impaired anti‐oxidative activity. In our previous study, hsa‐miR‐4639‐5p was identified as the post‐transcriptional regulator of DJ‐1 expression, which leads to decreased DJ‐1 protein level, severe oxidative stress and neuronal death. Plasma hsa‐miR‐4639‐5p level was significantly up‐regulated in PD patients, with the potential to be an early diagnostic marker for PD. However, whether the elevated plasma hsa‐miR‐4639‐5p level in PD patients reflects its abnormal change in CNS, and the molecular mechanism of the abnormal up‐regulation of hsa‐miR‐4639 in PD is still unknown.

Methods: Exosomes and further CNS‐derived exosomes were isolated from plasma to analyze the source of plasma hsa‐miR‐4639‐5p. Bioinformatics prediction, dual‐luciferase assay, CRISPR‐Cas9 genome editing system and real‐time qPCR were applied to analyze the transcription profile of hsa‐miR‐4639‐5p and its host gene MYLIP. DJ‐1 protein level, ROS, O2‐ production and cell viability were measured in hsa‐miR‐4639‐promoter knockout cells.

Results: Plasma hsa‐miR‐4639‐5p mainly comes from CNS‐derived exosomes (L1CAM+ exosomes), indicating the increased plasma hsa‐miR‐4639‐5p in PD patients reflected its up‐regulation in the CNS. To explore the underlying mechanism of increased hsa‐miR‐4639‐5p, we focused on its transcriptional regulation. The primary hsa‐miR‐4639 coordinately translates with its host gene MYLIP, sharing the same promoter region located upstream the transcriptional starting site (TSS) of MYLIP. Dual‐luciferase assay and CRISPR‐Cas9 genome editing results indicated that the 286bp fragment from ‐560 to ‐275 was the core promoter region of both hsa‐miR‐4639 and MYLIP. Core promoter region knockout cells displayed increased DJ‐1 protein level, decreased ROS or O2‐ production and enhanced resistance to MPP+ induced cell death.

Conclusions: To conclude, this study identified the source of plasma hsa‐miR‐4639‐5p by the first time, enhanced the value of plasma hsa‐miR‐4639‐5p as an early diagnostic biomarker of PD and yielded new insights into blood biomarker studies. In addition, it was the first time to define the promoter region of hsa‐miR‐4639‐5p and MYLIP, which laid the foundation for further transcriptional regulation studies.

194

Exosomes from patients with Parkinson's disease are pathological in mice

Chao Han, Xingfang Guo, Tao Wang, Nian Xiong, Jinsha Huang (Wuhan, People's Republic of China)

Objective: Our study explored the correlation between serum exosomes and PD pathogenesis.

Background: Cell‐to‐cell transport of risk molecules becomes a highly anticipated pathogenic mechanism in initiation and progression of various neurodegenerative diseases, in which extracellular exosome‐mediated neuron to neuron transport of a‐synuclein (a‐syn) is increasingly recognized as a potentially new etiologic mechanism in Parkinson's disease (PD). However, this mechanism has not been verified systematically, especially in vivo. It has been reported that exosomes from cerebrospinal fluid might cause a‐syn oligomerization in target cells. Serum contains more exosomes compared to the cerebrospinal fluid, but the correlation between serum exosomes and PD pathogenesis remains unknown.

Methods: intravenous or intrastriatal treatments of mice with PD patients' serum‐derived exosomes.

Results: Here we show that PD patients' serum‐derived exosomes caused a‐syn, ubiquitin and P62 aggregation in recipient cells. More importantly, intravenous or intrastriatal treatments of mice with PD patients' serum‐derived exosomes could also evoke protein aggregation, trigger dopamine neuron degeneration, induce microglial activation, and even cause apomorphine‐coaxed rotation and movement defects.

Conclusions: All these recapitulate proteinous, cellular and behavioral phenotypes of PD, clarifying the exosome pathway as a new pathogenesis mechanism.

195

Role of microglia in the transmission of a‐syn‐containing exosomes

Yun Xia, Tao Wang (Wuhan, People's Republic of China)

Objective: We investigated the role of microglia in the transmission of a‐syn‐containing exosomes.

Background: Current understanding of the pathophysiology of Parkinson's disease (PD) suggests a keyplayer of “prion like” propagation of alpha‐synuclein (a‐syn) in the pathogenesis. The idea that exosomes may be involved in the spreading of a‐syn has recently gained considerable attention. Besides, exosomes‐associated a‐synhas recently been detected in the biological fluids. Previous studies have shown that the activation of microglia is associated with the aggregation ofa‐syn in PD, suggesting an important role of microglia in clearing a‐syn.

Methods: The exosomes‐rich fraction was purified from the plasma of PD patients and healthy controls using a standard protocol of differential ultracentrifugation. Twenty sporadic mild‐late stage PD patients were rolled. The concentrations of a‐syn in the plasma‐derived exosomes were determined by enzyme‐linked immunosorbent assay (ELISA), thioflavin T‐assay and western blot analysis. PKH26‐labeled exosomes werestereotaxicallyinjected into the unilateral striatum of 8‐month‐old mice.After 1 week of exposure, brain sections were double stained with the cell marker antibodies of brain cells and DAPI. Plasma exosomes derived from PD patients was added to the microglial cell lineBV2; then expression levels of a‐syn, IBA1, LC3, P62 and Beclin1 were analyzed by western blotting. Detection of TNF‐a and IL‐6 by ELISA were performed. Besides, measurement of nitric oxide was also done. Exosomes of treated BV2 cells were isolated from the conditioned supernatant by ultracentrifugation; then protein level of a‐syn was evaluated by western blotting.

Results: The concentrations of total, oligomeric and monomeric a‐syn in the plasma‐derived exosomes were significantly higher in patients with PD versus healthy controls. However, there was no significant difference in the plasma exosomalfibrillara‐syn concentrations in PD vesus controls. Intrastriatally infused exogenous exosomes are taken up by microglia and transported to substantianigra and cortex. Plasma exosomes derived from PD patients preferentially target microglia in vivo, rather than neuron or astrocyte. Efficient uptake of exosomes was also detected when BV2 cells were used. Plasma exosomes derived from PD patients caused increased IBA1 expression revealed by immunofluorescent staining and western blotting. Moreover, plasma exosomes derived from PD patients significantly elevated the NO production, proliferation and cytokine (TNF‐aand IL‐6) secretion. A significant decrease in the ratio of the LC3 II/I proteins and the levels of Beclin1 proteins was observed 12 hours after plasma exosomes derived from PD patients administration compares with the control. Consistently, western blot analysis revealed that levels of P62 protein were increased by exosomes. A significant elevation of oligomeric and monomeric a‐syn protein level in exosomes‐treated cells as compared to non‐treated BV2 cells was observed. Moreover, Plasma exosomes derived from PD patients promote the secretion of a‐syn via exosomes in BV2 cells.

Conclusions: Plasma exosomesderived from PD patients were highly selectively uptake by microglia (rather than neurons or astrocytes) in vivo and vitro.Moreover, exosomes with toxic a‐syn can activate microglia cells, thereby inhibiting autophagy activity, reducing the scavenging activity of microglia cells, and further promoting the transmission of a‐syn.

196

Reduced VMAT2 expression aggravate the hyposmia and depression in the MPTP model of Parkinson's disease

Kai Ma, Tao Wang (Wuhan, People's Republic of China)

Objective: We investigated the mechanisms of non‐motor symptoms in PD

Background: Non‐motor symptoms occur during the prodromal phase of Parkinson's disease (PD), while the underlying mechanisms remain unclear. It has been suggested that altered dopamine content of olfactory bulbs (OB), Locus Coeruleus (LC) may be linked to depression and hyposmia. Meanwhile, OB are the regions where adult neurogenesis occurs, dysfunction of neurogenesis was also involved in non‐motor symptoms in the context of PD. Considering mouse with reduced VMAT2 expression is now deemed as a relatively new model of PD simulating motor and nonmotor symptoms, as well as the pathological nigral and extranigral change. Hence, it may provide a new insight into investigating the mechanisms of non‐motor symptoms in PD.

Methods: we examined the effect of subacute administration of MPTP on mice with reduced expression of VMAT2, focusing on the histopathological alterations in OB and LC.

Results: mice with a reduced VMAT2 expression showed markedly decreased dopaminergic interneurons in OB as wells as TH‐immunoreactive cell in the LC in response to MPTP administration. Furthermore, neurogenesis in OB was also impaired after MPTP administration.

Conclusions: We therefore demonstrated that reduced expression of VMAT2 contributed to the impairment of non‐motor symptoms such as depression and hyposmia, pathologically, the degeneration of extranigral systems and reduced MPTP‐induced neurogenesis might be the underlying mechanisms.

197

Analysis of gut microbiota in patients of Parkinson's disease with or without constipation

Min Ye, An Bi (Nanjing, People's Republic of China)

Objective: To analyze the gut microbiota of Parkinson disease (PD) patients with or without constipation and normal population.

Background: PD is a progressively debilitating neurodegenerative disease characterized by a‐synucleinopathy, which involves all districts of the brain‐gut axis, including the central, autonomic and enteric nervous systems. The highly bidirectional communication between the brain and the gut is markedly infuenced by the microbiome through integrated immunological, neuroendocrine and neurological processes.

Methods: Methods A total of 15 patients of primary PD with constipation, 14 patients of PD without constipation and 15 patients only with constipation and 15 control group were collected. Specimen bacterial DNA was extracted, the 16srRNA gene amplification and high‐throughput sequencing were done. Spectral annotation, diversity analysis, and species difference analysis were performed on the sequencing results. The correlation between gut microbiota and clinical features of PD was analyzed.

Results: Compared with the control group, the PD group (including PD constipation group and PD non‐constipation group) had different gut microbiota types in the classification level of phylum, class, order, family, genus, species and OTU (operational taxonomic unit).But there is a certain degree of overlap. There was no significant difference in the diversity index between the PD group and the control group (P>0.05). The abundances of Coriobacteriia, Collinsella and Actinomyces in the PD group were higher than those in the control group (P<0.05), while the abundance of Lachnospira and Trisposonobacter were lower than those in the control group (P<0.05). But there was no significant difference between the PD constipation group and the PD non‐constipation group (P>0.05). There was a negative correlation between the abundance of Coriobacteriia and antiplatelet drugs in patients with PD (spearman correlation coefficient ‐0.38), and there was no significant correlation between the abundance of residual bacteria and clinical features (P>0.05). In addition, the abundances of Hungatella, Anaerrotruncus_colihominis and Lactobacillus_fermentum in the PD group were also higher than those in the control group (P<0.05), and were positively correlated with the wexner score (correlation coefficients were 0.48, 0.45, 0.65 respectively). During the three groups the abundance of the three gut microbiota in the PD constipation group was significantly higher than that in the PD non‐constipation group and the control group (P<0.05). There was no significant difference between the PD non‐constipation group and the control group (P>0.05).

Conclusions: Constipation had great influence on the gut microbiota of PD. The abundance changes of Hungatella, Anaerrotruncus_colihominis and Lactobacillus_fermentum were related to constipation, and had nothing to do with the onset of Parkinson's disease. The abundance changes of Rhizopus, Collins, Actinomycetes, Trichophyton and Terrisporobacter may be related to the onset of Parkinson's disease, and some gut microbiota changes were related to the clinical features of patients with Parkinson's disease.

References: [1]Zhang;ZX;Roman;GC;Hong;Z;Wu;CB;Qu;QM; Huang; JB; Zhou; B; Geng; ZP; Wu; JX; Wen; HB; Zhao;H; Zahner;GE. Parkinson's disease in China: prevalence in Beijing, Xian, and Shanghai. [J]. Dkgest of the World Latest Medical Information, 2005, 365 (9459):595. 2. Hansen C, Li JY. Beyond alpha‐synuclein transfer: pathology propagation in Parkinson's disease. Trends Mol Med 2012, 18:248‐255.3.Wang T, Hay JC. Alpha‐synuclein Toxicity in the Early Secretory Pathway: How It Drives Neurodegeneration in Parkinsons Disease. Front Neurosci 2015, 9:433.4.Shannon KM, Keshavarzian A, Mutlu E, Dodiya HB, Daian D, Jaglin JA, Kordower JH.Alpha‐synuclein in colonic submucosa in early untreated Parkinson's disease. [J]Movement Disorders, 2012, 27 (6):709–715.5.Olanow C W, Brundin P. Parkinson's disease and alpha synuclein: is Parkinson's disease a prion‐like disorder?[J]. Movement Disorders, 2013, 28 (1):31–40.6.Holmqvist S, Chutna O, Bousset L, et al. Direct evidence of Parkinson pathology spread from the gastrointestinal tract to the brain in rats[J]. Acta Neuropathologica, 2014, 128 (6):805‐820.7.vensson E, Horváth‐Puhó E, Thomsen RW, Djurhuus JC, Pedersen L, Borghammer P, Sørensen HT. Vagotomy and subsequent risk of Parkinson's disease[J]. Annals of Neurology, 2015, 78 (4):522‐529. [8]Unger MM, Spiegel J, Dillmann KU, Grundmann D, Philippeit H, Bürmann J, Faßbender K, Schwiertz A, Schäfer KH. Short chain fatty acids and gut microbiota differ between patients with Parkinson's disease and age‐matched controls. [J]. Parkinsonism & Related Disorders, 2016, 32:66‐72. [9]Keshavarzian A, Green SJ, Engen PA, Voigt RM, Naqib A, Forsyth CB, Mutlu E, Shannon KM. Colonic bacterial composition in Parkinson's disease. [J]. Movement Disorders, 2015, 30 (10):1351‐1360. [10]Bäckhed F, Ley RE, Sonnenburg JL, Peterson DA, Gordon JI. Host‐bacterial mutualism in the human intestine. [J]. Science, 2005, 307 (5717):1915. [11]Qin J, Li R, Raes J, Arumugam M, Burgdorf KS, Manichanh C, Nielsen T, Pons N, Levenez F, Yamada T, Mende DR, Li J, Xu J, Li S, Li D, Cao J, Wang B, Liang H, Zheng H, Xie Y, Tap J, Lepage P, Bertalan M, Batto JM, Hansen T, Le Paslier D, Linneberg A, Nielsen HB, Pelletier E, Renault P, Sicheritz‐Ponten T, Turner K, Zhu H, Yu C, Li S, Jian M, Zhou Y, Li Y, Zhang X, Li S, Qin N, Yang H, Wang J, Brunak S, Doré J, Guarner F, Kristiansen K, Pedersen O, Parkhill J, Weissenbach J; MetaHIT Consortium, Bork P, Ehrlich SD, Wang J. A human gut microbial gene catalog established by metagenomic sequencing[J]. Nature, 2010, 464 (7285):59‐65. [12]Parashar A, Udayabanu M. Gut microbiota: Implications in Parkinson's disease. [J]. Parkinsonism & Related Disorders, 2017, 38:1. [13]Gaboriau‐Routhiau V, Cerf‐Bensussan N. [Gut microbiota and development of the immune system][J]. Medecine Sciences M/s, 2016, 32 (11):961. [14]Chen S G, Stribinskis V, Rane M J, et al. Exposure to the Functional Bacterial Amyloid Protein Curli Enhances Alpha‐Synuclein Aggregation in Aged Fischer 344 Rats and Caenorhabditis elegans[J]. Sci Rep, 2016, 6:34477. [15]Scheperjans F, Aho V, Pereira PA, Koskinen K, Paulin L, Pekkonen E, Haapaniemi E, Kaakkola S, Eerola‐Rautio J, Pohja M, Kinnunen E, Murros K, Auvinen P. Gut microbiota are related to Parkinson's disease and clinical phenotype[J]. Movement Disorders, 2015, 30 (3):350‐358. [16]Heintz‐Buschart A, Pandey U, Wicke T, Sixel‐Döring F, Janzen A, Sittig‐Wiegand E, Trenkwalder C, Oertel WH, Mollenhauer B, Wilmes P. The nasal and gut microbiome in Parkinson's disease and idiopathic rapid eye movement sleep behavior disorder[J]. Movement Disorders Official Journal of the Movement Disorder Society, 2018, 33 (1):88. [17]Qian Y, Yang X, Xu S, Wu C2, Song Y, Qin N, Chen SD, Xiao Q. Alteration of the fecal microbiota in Chinese patients with Parkinson's disease[J]. Brain Behavior & Immunity, 2018. [18][D]. 2017. [19]Postuma RB, Berg D, Stern M, Poewe W, Olanow CW, Oertel W, Obeso J, Marek K, Litvan I, Lang AE, Halliday G, Goetz CG, Gasser T, Dubois B, Chan P, Bloem BR, Adler CH, Deuschl G. MDS clinical diagnostic criteria for Parkinson's disease. Mov Disord,2015,30 (12):1591‐1601. [20]ZL 2016 2 1208783.3,2017‐05‐03. [21][J] 49 (4):282‐287. [22]Dai Y, Mao C, Ding M, Ma L, Fu Y, Zhang H, Li J, Liu C. [Correlations between constipation and the axial symptoms, related motor symptoms in Parkinson's disease][J]. Zhonghua Yi Xue Za Zhi, 2016, 96 (5):324. [23]Zhu L, Liu W, Alkhouri R, Baker RD, Bard JE, Quigley EM, Baker SS. Structural changes in the gut microbiome of constipated patients[J]. Physiological Genomics, 2014, 46 (18):679. [24] Dusková D, Marounek M. Marounek. Fermentation of pectin and glucose, and activity of pectin‐degrading enzymes in the rumen bacterium Lachnospira multiparus[J]. Letters in Applied Microbiology, 2001, 33 (2):159–163. [25]Qi CJ, Zhang Q, Yu M, Xu JP, Zheng J, Wang T, Xiao XH. Imbalance of Fecal Microbiota at Newly Diagnosed Type 1 Diabetes in Chinese Children[J]. Chinese Medical Journal, 2016, 129 (11):1298‐1304. [26]Stiemsma LT, Arrieta MC, Dimitriu PA, Cheng J, Thorson L, Lefebvre DL, Azad MB, Subbarao P Mandhane P, Becker A, Sears MR, Kollmann TR, Canadian Healthy Infant Longitudinal Development (CHILD) Study Investigators, Mohn WW, Finlay BB, Turvey SE. Shifts in Lachnospira and Clostridium sp. in the 3‐month stool microbiome are associated with preschool‐age asthma[J]. Clinical Science, 2016, 130 (23):2199. [27]Wu T, Zhang Z, Liu B, Hou D, Liang Y, Zhang J, Shi P. Gut microbiota dysbiosis and bacterial community assembly associated with cholesterol gallstones in large‐scale study[J]. Bmc Genomics, 2013, 14 (1):669. [28]JR Christiansen,MN Olesen,DE Otzen,M Romeroramos,V Sanchezguajardo.a‐Synuclein vaccination modulates regulatory T cell activation and microglia in the absence of brain pathology[J]. Journal of Neuroinflammation, 2016, 13 (1):1‐19. [29]Erny D, Hrabe de Angelis AL, Jaitin D, Wieghofer P, Staszewski O, David E, Keren‐Shaul H, Mahlakoiv T, Jakobshagen K, Buch T, Schwierzeck V, Utermöhlen O, Chun E, Garrett WS, McCoy KD, Diefenbach A, Staeheli P, Stecher B, Amit I, Prinz M. Host microbiota constantly control maturation and function of microglia in the CNS. [J]. Nature Neuroscience, 2015, 18 (7):965‐977. [30]Erin M. Hill‐Burns, PhD, Justine W. Debelius, PhD, James T. Morton, BS, William T. Wissemann, BA, Matthew R. Lewis, MS, Zachary D. Wallen, MS, Shyamal D. Peddada, PhD, Stewart A. Factor, DO, Eric Molho, MD, Cyrus P. Zabetian, MD, MS, Rob Knight, PhD, and Haydeh Payami, PhD. Parkinson's disease and Parkinson's disease medications have distinct signatures of the gut microbiome[J]. Movement Disorders, 2017, 32 (5):739. [31][M], 2014. [32]Takahashi K, Nishida A, Fujimoto T, Fujii M, Shioya M, Imaeda H, Inatomi O, Bamba S, Sugimoto M, Andoh A. Reduced Abundance of Butyrate‐Producing Bacteria Species in the Fecal Microbial Community in Crohn's Disease[J]. Digestion, 2016, 93 (1):59. [33]Strati F, Cavalieri D, Albanese D, De Felice C, Donati C, Hayek J, Jousson O, Leoncini S, Pindo M, Renzi D, Rizzetto L, Stefanini I, Calabrò A, De Filippo C. Altered gut microbiota in Rett syndrome[J]. Microbiome, 2016, 4 (1):41. [34]Peters BA, Dominianni C, Shapiro JA, Church TR, Wu J, Miller G, Yuen E, Freiman H, Lustbader I, Salik J, Friedlander C, Hayes RB, Ahn J. The gut microbiota in conventional and serrated precursors of colorectal cancer[J]. Microbiome, 2016, 4 (1):69. [35]Ketil Berstad, Johanna E.R. Berstad. Parkinson's disease; the hibernating spore hypothesis[J]. Medical Hypotheses, 2017, 104:48‐53. [36]Lambeth SM, Carson T, Lowe J, Ramaraj T, Leff JW, Luo L, Bell CJ, Shah VO. Composition, Diversity and Abundance of Gut Microbiome in Prediabetes and Type 2 Diabetes[J]. Journal of Diabetes & Obesity, 2015, 2 (3):1‐7. [37]Chen J, Wright K, Davis JM, Jeraldo P, Marietta EV, Murray J, Nelson H, Matteson EL, Taneja V. An expansion of rare lineage intestinal microbes characterizes rheumatoid arthritis[J]. Genome Medicine, 2016, 8 (1):43. [38]Karlsson FH, Fåk F, Nookaew I, Tremaroli V, Fagerberg B, Petranovic D, Bäckhed F, Nielsen J. Symptomatic atherosclerosis is associated with an altered gut metagenome. [J]. Nature Communications, 2012, 3 (4):1245. [39]Cheng MP, Domingo MC, Lévesque S, Yansouni CP. A case report of a deep surgical site infection with Terrisporobacter glycolicus/T. Mayombei and review of the literature[J]. Bmc Infectious Diseases, 2016, 16 (1):529. [40][J], 2017, 6 (2):121‐126. [41]Holmqvist S, Chutna O, Bousset L, Aldrin‐Kirk P, Li W, Björklund T, Wang ZY, Roybon L, Melki R, Li JY. Direct evidence of Parkinson pathology spread from the gastrointestinal tract to the brain in rats[J]. Acta Neuropathologica, 2014, 128 (6):805‐820. [42]Nair AT, Ramachandran V, Joghee NM, Antony S, Ramalingam G. Gut Microbiota Dysfunction as Reliable Non‐invasive Early Diagnostic Biomarkers in the Pathophysiology of Parkinson's Disease: A Critical Review[J]. J Neurogastroenterol Motil, 2018, 24 (1):30‐42. [43]Sampson TR, Debelius JW, Thron T, Janssen S, Shastri GG, Ilhan ZE, Challis C, Schretter CE, Rocha S, Gradinaru V, Chesselet MF, Keshavarzian A, Shannon KM, Krajmalnik‐Brown R, Wittung‐Stafshede P, Knight R, Mazmanian SK.Gut Microbiota Regulate Motor Deficits and Neuroinflammation in a Model of Parkinson's Disease[J].Cell,2016,167 (6):1469‐1480.

198

Hitting the brakes: freezing of gait in Parkinson's disease derives from pathological activity in the subthalamic nucleus

Matthew Georgiades, James Shine, Moran Gilat, Jacqueline McMaster, Brian Owler, Neil Mahant, Simon Lewis (Sydney, Australia)

Objective: We sought to obtain intraoperative microelectrode recordings (MER) of subthalamic nucleus (STN) multiunit activity (MUA) and analyze the signals during lower limb freezing elicited by a validated virtual reality (VR) gait task performed by patients with Parkinson's disease (PD) during deep brain stimulation (DBS) surgery.

Background: Freezing of gait is a poorly understood, complex symptom of PD manifesting as sudden, transient motor arrest. Traditional models of PD implicating dopaminergic denervation inadequately explain the pathophysiological mechanism of freezing, which occurs paroxysmally and in a variety of cognitive contexts. As such, current therapies are partially effective at best.

Methods: We collected intraoperative MER of STN activity from 8 individuals with idiopathic PD while they performed the VR gait task during awake neurosurgical implantation of DBS electrodes. The intraoperative VR task consisted of a virtual corridor which subjects navigated using a set of foot pedals (Figure 1). We examined STN spiking MUA while people suffered freezing events elicited by the VR task and compared these to periods of normal walking and volitional stopping. In addition, we analyzed beta and theta frequency modulation of the STN signal and used Granger Causality Analysis to investigate whether pathological rhythms in the STN during freezing could be causative of concurrent pathological lower limb muscle firing recorded by electromyography.

Results: We present evidence to support our original prediction that freezing episodes are associated with transient increases in STN MUA (freeze = 12.6 ? 6.8; Walk = 6.5 ? 3.5; p = 2.0x10‐5; Figure 2). We further refine the pathophysiological mechanism underlying freezing by characterizing the oscillatory dynamics of STN activity coincident with freezing. We found an increase in beta activity that peaked with freezing onset, and increased theta oscillations during freezing episodes and demonstrate a temporal chain of pathological activity from the STN to abnormal lower limb muscle firing characteristic of freezing (Figure 3). Finally, we interrogated the potential clinical utility of STN spiking activity by contrasting the pathological freezing signature with purposeful stopping.

Conclusions: Together, these results advance our understanding of the neurobiological basis of gait freezing in PD, highlighting the role of emergent STN activity and bringing us closer to more effective therapeutic interventions.

Figure 1.

 

Figure 2.

 

Figure 3.

 

199

Effect of oxidative stress on autophagy‐related protein expression in the substantia nigra in rat models of Parkinson's disease

Liu Bin, Xu Li, Hu Kun, Wu Kun, Zhang Xia (Tangshan, People's Republic of China)

Objective: In this study, we investigated the effects of oxidative stress on autophagy‐related protein expression in rat models of PD.

Background: Parkinson's disease (PD) is a chronic progressive neurodegenerative disorder of the central nervous system, characterized by degeneration of dopaminergic neurons in the substantia nigra, which can cause a significant decrease in dopamine levels, lead to a series of clinical symptoms, including motor symptoms (tremor, muscle rigidity, bradykinesia) and non‐motor symptoms (cognitive impairment, depression, constipation). To date, the pathogenesis of PD has not yet been fully elucidated. Studies have shown that oxidative stress plays a key role in the pathogenesis of PD, autophagy is also closely related to the pathogenesis of PD. However, the relationship between oxidative stress and autophagy in the occurrence and development of PD is still unclear.

Methods: Rat models of PD were established by subcutaneous injection of rotenone through back of the neck, antioxidant N‐acetylcysteine (NAC) and oxidative stress inducer amyloid ß‐peptide (Aß) were injected into the lateral ventricle of brain in rats, changes in oxidative stress indicators glutathione (GSH), glutathione peroxidase (GSH‐Px), superoxide dismutase (SOD), malondialdehyde (MDA) contents and expression of autophagy‐related proteis Beclin1, LC3 were detected. GSH content and GSH‐Px activity,SOD activity and MDA content were detected by Micro‐enzyme assay. Expression of Beclin1, LC3II/LC3‐I in the rat substantia nigra of each group by Western blot analysis.

Results: The results showed that GSH, GSH‐Px, SOD contents were decreased, MDA content was increased in the rat substantia nigra of that PD group than that in the control group (all P<0.05), GSH, GSH‐Px, SOD contents were decreased, MDA content was increased at 8 days than that at 4 days (all P<0.05); Compared with the PD group, GSH, GSH‐Px, SOD contents were increased in the NAC group, and decreased in the Aß group, MDA content was decreased in the NAC group, and increased in the Aß group (all P<0.05). GSH, GSH‐Px, SOD contents were increased, MDA content was decreased at 8 days than that at 4 days in the NAC group (all P<0.05), and GSH, GSH‐Px, SOD contents were decreased, MDA content was increased at 8 days than that at 4 days in the Aß group (all P<0.05). (Table 1, Table 2) Beclin1 and LC3 protein expression and LC3II/LC3‐I ratio were increased in the PD group than that in the control group (all P<0.05), with an increase for 8 days compared with 4 days (all P<0.05). Compared with the PD group, Beclin1 and LC3 protein expression and LC3II/LC3‐I ratio were decreased in the NAC group (all P<0.05) with a decrease for 8 days compared with 4 days (all P<0.05), and increased in the Aß group (all P<0.05), with a increase for 8 days compared with 4 days (all P<0.05). (Table 3, Table 4, Figure 1, Figure 2)

Conclusions: The results indicated that oxidative stress and autophagy are involved in the pathogenesis of PD. Oxidative stress can promote the autophagy‐related protein expression in the substantia nigra of the rats with PD. Anti‐oxidative stress can inhibit the autophagy‐associated protein expression, which has neuroprotective effects. The findings may provide a new drug target for treating PD.

References: 1. Shiner T, Seymour B, Wunderlich K, Hill C, Bhatia KP, Dayan P, Dolan RJ. Dopamine and performance in a reinforcement learning task: evidence from Parkinson's disease. Brain. 2012;135 (Pt 6):1871‐83.2. Dexter DT, Jenner P. Parkinson disease: from pathology to molecular disease mechanisms. Free Radic Biol Med. 2013;62:132‐44. 3. Liu B, Lv C, Zhang J, Liu Y, Sun J, Cheng X, Mao W, Ma Y, Li S. Effects of eldepryl on glial cell proliferation and activation in the substantia nigra and striatum in a rat model of Parkinson's disease. Neurol Res. 2017;39 (5):459‐467.4. Ali SF, Binienda ZK, Imam SZ. Molecular aspects of dopaminergic neurodegeneration: gene‐environment interaction in parkin dysfunction. Int J Environ Res Public Health. 2011;8 (12):4702‐13.5. Sleeman IJ, Boshoff EL, Duty S. Fibroblast growth factor‐20 protects against dopamine neuron loss in vitro and provides functional protection in the 6‐hydroxydopamine‐lesioned rat model of Parkinson's disease. Neuropharmacology. 2012;63 (7):1268‐77. 6. Pan‐Montojo F, Anichtchik O, Dening Y, Knels L, Pursche S, Jung R, Jackson S, Gille G, Spillantini MG, Reichmann H, Funk RH. Progression of Parkinson's disease pathology is reproduced by intragastric administration of rotenone in mice. PLoS One. 2010;5 (1):e8762. 7. Voshavar C, Shah M, Xu L, Dutta AK. Assessment of Protective Role of Multifunctional Dopamine Agonist D‐512 Against Oxidative Stress Produced by Depletion of Glutathione in PC12 Cells: Implication in Neuroprotective Therapy for Parkinson's Disease. Neurotox Res. 2015;28 (4):302‐18.8. Lu C, Wei Y, Hu R, Wang Y, Li K, Li X. Transcranial Direct Current Stimulation Ameliorates Behavioral Deficits and Reduces Oxidative Stress in 1‐Methyl‐4‐Phenyl‐1,2,3,6‐Tetrahydropyridine‐Induced Mouse Model of Parkinson's Disease. Neuromodulation. 2015;18 (6):442‐6.9. Janda E, Isidoro C, Carresi C, Mollace V. Defective autophagy in Parkinson's disease: role of oxidative stress. Mol Neurobiol. 2012;46 (3):639‐61. 10. Lee HJ, Han J, Jang Y, Kim SJ, Park JH, Seo KS, Jeong S, Shin S, Lim K, Heo JY, Kweon GR. Docosahexaenoic acid prevents paraquat‐induced reactive oxygen species production in dopaminergic neurons via enhancement of glutathione homeostasis. Biochem Biophys Res Commun. 2015;457 (1):95‐100.11. Wang B, Abraham N, Gao G, Yang Q. Dysregulation of autophagy and mitochondrial function in Parkinson's disease. Transl Neurodegener. 2016;5:19. 12. Liu B, Sun J, Zhang J, Mao W, Ma Y, Li S, Cheng X, Lv C. Autophagy‐related protein expression in the substantia nigra and eldepryl intervention in rat models of Parkinson's disease. Brain Res. 2015;1625:180‐8.13. Zhang ZN, Zhang JS, Xiang J, Yu ZH, Zhang W, Cai M, Li XT, Wu T, Li WW, Cai DF. Subcutaneous rotenone rat model of Parkinson's disease: Dose exploration study. Brain Res. 2017;1655:104‐113.14. Feng J. Microtubule: a common target for parkin and Parkinson's disease toxins. Neuroscientist. 2006;12 (6):469‐76.15. Sherer TB, Betarbet R, Kim JH, Greenamyre JT. Selective microglial activation in the rat rotenone model of Parkinson's disease. Neurosci Lett. 2003;341 (2):87‐90.16. Grieb B, von Nicolai C, Engler G, Sharott A, Papageorgiou I, Hamel W, Engel AK, Moll CK. Decomposition of abnormal free locomotor behavior in a rat model of Parkinson's disease. Front Syst Neurosci. 2013;7:95.17. Bartolomei F, Massacrier A, Rey M, Viale M, Régis J, Gastaldi M, Cau P. Effect of gamma knife radiosurgery on rat brain sodium channel subunit mRNA expression. Stereotact Funct Neurosurg. 1998;70:237‐42.18. Betarbet R, Greenamyre JT. Parkinson's disease: animal models.Handb Clin Neurol. 2007;83:265‐87. 19. Carriere CH, Kang NH, Niles LP. Neuroprotection by valproic acid in an intrastriatal rotenone model of Parkinson's disease. Neuroscience. 2014;267:114‐21. 20. Li C, Chen X, Zhang N, Song Y, Mu Y. Gastrodin inhibits neuroinflammation in rotenone‐induced Parkinson's disease model rats. Neural Regen Res. 2012;7 (5):325‐31. 21. Ock CY, Kim EH, Choi DJ, Lee HJ, Hahm KB, Chung MH. 8‐Hydroxydeoxyguanosine: not mere biomarker for oxidative stress, but remedy for oxidative stress‐implicated gastrointestinal diseases. World J Gastroenterol. 2012;18 (4):302‐8. 22. Hwang O. Role of oxidative stress in Parkinson's disease. Exp Neurobiol. 2013;22 (1):11‐7. 23. Navarro‐Yepes J, Zavala‐Flores L, Anandhan A, Wang F, Skotak M, Chandra N, Li M, Pappa A, Martinez‐Fong D, Del Razo LM, Quintanilla‐Vega B, Franco R. Antioxidant gene therapy against neuronal cell death. Pharmacol Ther. 2014;142 (2):206‐30. 24. Wang SG, Xu Y, Xie H, Wang W, Chen XH. Astragaloside IV prevents lipopolysaccharide‐induced injury in H9C2 cardiomyocytes. Chin J Nat Med. 2015;13 (2):127‐32. 25. Sharma T, Airao V, Panara N, Vaishnav D, Ranpariya V, Sheth N, Parmar S. Solasodine protects rat brain against ischemia/reperfusion injury through its antioxidant activity. Eur J Pharmacol. 2014;725:40‐6. 26. De Araújo DP, Lobato Rde F, Cavalcanti JR, Sampaio LR, Araújo PV, Silva MC, Neves KR, Fonteles MM, Sousa FC, Vasconcelos SM. The contributions of antioxidant activity of lipoic acid in reducing neurogenerative progression of Parkinson's disease: a review. Int J Neurosci. 2011;121 (2):51‐7. 27. Romuk EB, Szczurek W, Nowak PG, Hudziec E, Chwalinska E, Birkner E. Effects of Propofol on the Liver Oxidative‐Antioxidant Balance in a Rat Model of Parkinson's Disease. Adv Clin Exp Med. 2016;25 (5):815‐820. 28. Jiang T, Sun Q, Chen S. Oxidative stress: A major pathogenesis and potential therapeutic target of antioxidative agents in Parkinson's disease and Alzheimer's disease. Prog Neurobiol. 2016;147:1‐19.29. Venkateshappa C, Harish G, Mythri RB, Mahadevan A, Bharath MM, Shankar SK. Increased oxidative damage and decreased antioxidant function in aging human substantia nigra compared to striatum: implications for Parkinson's disease. Neurochem Res. 2012;37 (2):358‐69. 30. Lin TK, Chen SD, Chuang YC, Lin HY, Huang CR, Chuang JH, Wang PW, Huang ST, Tiao MM, Chen JB, Liou CW. Resveratrol partially prevents rotenone‐induced neurotoxicity in dopaminergic SH‐SY5Y cells through induction of heme oxygenase‐1 dependent autophagy. Int J Mol Sci. 2014;15 (1):1625‐46.31. Bharadwaj PR, Verdile G, Barr RK, Gupta V, Steele JW, Lachenmayer ML, Yue Z, Ehrlich ME, Petsko G, Ju S, Ringe D, Sankovich SE, Caine JM, Macreadie IG, Gandy S, Martins RN. Latrepirdine (dimebon) enhances autophagy and reduces intracellular GFP‐Aß42 levels in yeast. J Alzheimers Dis. 2012;32 (4):949‐67.32. Towers CG, Thorburn A. Therapeutic Targeting of Autophagy. EBioMedicine. 2016;14:15‐23.33. He C, Klionsky DJ. Regulation mechanisms and signaling pathways of autophagy. Annu Rev Genet. 2009;43:67‐93. 34. Liu B, Tang J, Zhang J, Li S, Yuan M, Wang R. Autophagy activation aggravates neuronal injury in the hippocampus of vascular dementia rats. Neural Regen Res. 2014;9 (13):1288‐96. 35. Chen Y, Azad MB, Gibson SB. Methods for detecting autophagy and determining autophagy‐induced cell death. Can J Physiol Pharmacol. 2010;88 (3):285‐95. 36. Sun Q, Fan W, Zhong Q. Regulation of Beclin 1 in autophagy. Autophagy. 2009;5 (5):713‐6. 37. Glick D, Barth S, Macleod KF. Autophagy: cellular and molecular mechanisms. J Pathol. 2010;221 (1):3‐12. 38. Nah J, Pyo JO, Jung S, Yoo SM, Kam TI, Chang J, Han J, Soo A An S, Onodera T, Jung YK. BECN1/Beclin 1 is recruited into lipid rafts by prion to activate autophagy in response to amyloid ß 42. Autophagy. 2013;9 (12):2009‐21.39. He H, Dang Y, Dai F, Guo Z, Wu J, She X, Pei Y, Chen Y, Ling W, Wu C, Zhao S, Liu JO, Yu L. Post‐translational modifications of three members of the human MAP1LC3 family and detection of a novel type of modification for MAP1LC3B. J Biol Chem. 2003;278 (31):29278‐87.40. Klionsky DJ, Abeliovich H, Agostinis P, Agrawal DK, Aliev G, Askew DS, Baba M, Baehrecke EH, Bahr BA, Ballabio A, et al. Guidelines for the use and interpretation of assays for monitoring autophagy in higher eukaryotes. Autophagy. 2008;4 (2):151‐75.41. Cherra SJ 3rd, Kulich SM, Uechi G, Balasubramani M, Mountzouris J, Day BW, Chu CT. Regulation of the autophagy protein LC3 by phosphorylation. J Cell Biol. 2010;190 (4):533‐9. 42. Wu G, Wang X, Feng X, Zhang A, Li J, Gu K, Huang J, Pang S, Dong H, Gao H, Yan B. Altered expression of autophagic genes in the peripheral leukocytes of patients with sporadic Parkinson's disease. Brain Res. 2011;1394:105‐11. 43. Yang Q, Mao Z. Parkinson disease: a role for autophagy? Neuroscientist. 2010;16 (4):335‐41. 44. Murphy KE, Halliday GM. Glucocerebrosidase deficits in sporadic Parkinson disease. Autophagy. 2014;10 (7):1350‐1. 45. Yang Q, Mao Z. Parkinson disease: a role for autophagy? Neuroscientist. 2010;16 (4):335‐41. 46. Elbini Dhouib I, Jallouli M, Annabi A, Gharbi N, Elfazaa S, Lasram MM. A minireview on N‐acetylcysteine: An old drug with new approaches. Life Sci. 2016;151:359‐363.47. Reddy PH, Beal MF. Are mitochondria critical in the pathogenesis of Alzheimer's disease? Brain Res Brain Res Rev. 2005;49 (3):618‐32.48. Chauhan V, Chauhan A. Oxidative stress in Alzheimer's disease. Pathophysiology. 2006;13 (3):195‐208.49. Resende R, Moreira PI, Proença T, Deshpande A, Busciglio J, Pereira C, Oliveira CR. Brain oxidative stress in a triple‐transgenic mouse model of Alzheimer disease. Free Radic Biol Med. 2008;44 (12):2051‐7.

Table 1.

GSH content and GSH‐Px activity in the substantia nigra of the rats in each group (Mean ± SD, n = 6)

Group	GSH (μmo/gprot)		GSH‐Px (U/ mgprot)
	4d	8d	4d	8d
Control	13.72±1.92	13.47±1.33	373.24±26.73	383.17±16.38
PD	8.40±1.23*	6.53±1.14*⋆	292.96±17.41*	244.52±22.57*⋆
NAC	10.93±1.59Δ	11.70±1.61Δ⋆	295.01±17.52Δ	333.98±21.01Δ⋆
AP	5.02±0.89Δ	2.83±1.38Δ⋆	128.22±22.54Δ	99.84±21.87Δ⋆
F value	38.62	75.05	124.22	249.55
P value	0.000	0.000	0.000	0.000

*P<0.05, vs control group: ΔP<0.05, vs PD group; ⋆P<0.05. vs 4‐day subgroup

Table 2.

SOD activity and MDA content in the substantia nigra of the rats in each group (Mean ± SD, n =6)

Goup	SOD( U /mgprot)		MDA (nmolmgprot)
	4d	8d	4d	8d
Control	402.77±34.73	376.20±31.25	4.56±0.79	4.96±0.75
PD	259.28 ±26.97*	247.92±15.26*⋆	8.50±1.24*	9.91±0.66*⋆
NAC	282.91±21.41Δ	305.79±18.82Δ⋆	6.51±0.64Δ	6.23±1.05Δ⋆
Aβ	156.07±26.74Δ	104.19±10.93Δ⋆	10.70±1.14Δ	12.90±1.07Δ⋆
F value	84.00	171.16	37.65	118.94
P value	0.000	0.000	0.000	0.000

*P<0.05, vs control group; ΔP<0.05, vs PD group; ⋆P<0.05. vs 4‐day subgroup

Table 3.

Immunohistochemical results of Beclinl and LC3 in the rat substantia nigra of each group (Mean ± SD, n =6)

Group	Beclinl		LC3
	4d	8d	4d	8d
Control	7.15±1.S2	S.97±1.33	6.72±1.41	S.17±1.47
PD	26.75±2.3*	30.27±2.55*⋆	21.71±1.64	25.20±1.82*⋆
NAC	22.29±2.0Δ	21.49±1.58Δ⋆	19.75±1.59	17.94±1.22Δ⋆
Aβ	32.31±2.40Δ	34.61±1.00Δ	26.16±2.52Δ	28.73±1.53Δ⋆
F value	153.55	260.91	122.76	210.30
P value	0.000	0.000	0.000	0.000

*P<0.01, vs control group; ΔP <0.01, vs PD group; ⋆P<0.01, vs 4‐day subgroup

Table 4.

Western blot analysis results of Beclinl, LC3II/LC3‐I in the rat substantia nigra of each group (Mean ± SD, n =6)

Group	Beclinl		LC3IIT‐C3‐I
	4d	8d	4d	8d
Control	12600.77±1993.89	13706.69±1S82.32	0.31±0.01	0.31±0.01
PD	19195.90±2018.91*	25196.96±2193.19*⋆	0.35±0.12*	0.38±0.15*⋆
NAC	17906.69±3322.16Δ	16473.15±2950.75Δ⋆	0.35±0.02Δ	0.33±0.01Δ⋆
Aβ	27466.04±2309.08Δ	32426.58±2937.49Δ⋆	0.42±0.14Δ	0.46±0.02Δ⋆
F value	44.64	58.27	87.42	86.66
P value	0.000	0.000	0.000	0.000

*P<0.01, vs control group; ΔP<0.01, vs PD group; ⋆P<0.01, vs 4‐day subgro

Figure 1.

Western blot analysis results of Beclin1 in the rat substantia nigra of each group.

A control group at 4 days; B: Control group at 8 days; C: PD group at 4 days; D: PD group at 8 days; E: NAC group at 4 days; F: NAC group at 8 days; G: Aβ group at 4 days; H: Aβ group at 8 days

Figure 2.

Western blot analysis results of LC3 in the rat substantia nigra of each group.

A control group at 4 days; B: Control group at 8 days; C: PD group at 4 days; D: PD group at 8 days; E: NAC group at 4 days; F: NAC group at 8 days; G: Aβ group at 4 days; H: Aβ group at 8 days

200

MPTP‐driven miRNA‐425 deficiency promotes necroptosis and dopaminergic neurodegeneration

Yong‐bo Hu, Gang Wang (Shanghai, People's Republic of China)

Objective: To investigate the role of miRNA‐425 in MPTP‐induced mouse model of Parkinson's disease (PD).

Background: Degeneration of the dopaminergic neurons of the substantia nigra is a major hallmark of Parkinson's disease (PD) and the causative mechanisms are thought to be the activation of the programmed neuron death. Necroptosis is a regulated process of cell death triggered by RIPK1. Although the pathogenesis of PD has been studied extensively, the mechanism underlying dopaminergic neuron death is still unclear.

Methods: Immune gene profiles and miRNA‐seq analyses were measured in MPTP‐treated mice. Regulation of RIPK1 by miR‐425 was validated by in silico prediction and target gene luciferase assay. miR‐425 was targeted by genetic ablation or centrally administered Agomir‐425 in MPTP‐treated mice.

Results: In MPTP‐induced mice, we found both necroptosis activation and deficiency of miR‐425 in the substantia nigra, which is correlated with dopaminergic neuron loss. This miRNA targeted RIPK1 transcripts and promoted activation of RIPK1, RIPK3, and MLKL. Furthermore, we found that genetic knockdown of miR‐425 aggravated MPTP‐induced motor deficit and dopaminergic neurodegeneration with early upregulation of necroptotic genes. Intracerebral Agomir‐425 treatment depressed necroptosis activation, dopaminergic neuron loss and improved locomotor behaviors.

Conclusions: We found that deficiency of miR‐425in MPTP‐treated mouse triggering necroptosis of dopaminergic neurons. Targeting miR‐425 in MPTP‐treated mice could restore dysfunctional dopaminergic neurodegeneration and ameliorates disease. These findings identify the brain delivery of miR‐425 as a potential therapeutic approach for the treatment of PD.

201

Novel antibody for detecting Ser129 phosphorylated a‐synuclein in Thy1 h‐a‐syn transgenic mice

Weijin Liu (Beijing, People's Republic of China)

Objective: To figure out the roles of a‐synuclein (a‐syn) and a‐syn phosphorylated at serine129 site (pSer129 a‐syn, p‐a‐syn) in Parkinson's disease (PD) pathogenesis. We firstly prepared a serial of p‐a‐syn monoclonal antibodies and screened out one C140S who obtained the highest specificity towards different forms of p‐a‐syn. Using C140S, together with another a‐syn N‐terminal (N‐a‐syn) polyclonal antibody who had strong capture ability towards total a‐syn (t‐a‐syn), we tried to establish novel sandwich‐ELISA methods which had high specificity in detection of different forms of p‐a‐syn and a‐syn, including monomeric and aggregated forms. The final aim of our study is to develop a relatively simple test for detection abnormal p‐a‐syn/a‐syn in plasma and provide surrogate markers for PD dignosis in the early stage of the disease.

Background: PD is one of the most common neurodegener¬ative disorders worldwide. Owing to the complexity of pathogenesis, it is still in lack of effective treatment and diagnosis criteria for PD. 1 The defining neuropathological features of PD are the loss of dopaminergic neurons in substantia nigra pars compacta (SNpc) and the presence of Lewy bodies (LBs) in relevant brain regions. 2 a‐syn is the main component of LBs. 3 Previous experiments have revealed that approximately 90% of a‐syn deposited in LBs is p‐a‐syn compared with only 4% is modificated at this residue in the soluble component of normal brain, 4, 5 this abnormally elevated p‐a‐syn are closely related to PD pathogenesis. Increasing evidence supports that p‐a‐syn plays important role in inducing a‐syn aggregation, spreading between cells6 and exerting cytotoxicity. 7 Therefore, monitoring the level changes of p‐a‐syn in relevant brain regions of PD patients and animal models may reflect PD progression. Given the complexity of structure, morphology heterogeneity and the reversible nature of p‐a‐syn, it is difficult to find proper antibodies to detect different forms of p‐a‐syn and a‐syn in our basic research. Besides, many commercially available p‐a‐syn antibodies are low specificity. All those lead to the difficulty in studying p‐a‐syn in PD pathogenesis.

Methods: We firstly designed p‐a‐syn immunopeptides and generated hybridoma cells, among which we selected one strain with the highest specificity by dot blots and indirect enzyme‐linked immunosorbent assay (Indirect‐ELISA). The screened‐out strain was intraperitoneally injected into female BALB/c‐nu mice for antibody amplification. We collected and purified this C140S antibody and tested its specificity by dot blots, indirect‐ELISA, western blot (WB) and immunofluorescence (IF). p‐a‐syn protein was prepared for antibody detection by phosphorylation of a‐syn in virto. We also prepared aggregated antigens including prefabricated fibrils (PFF), phosphorylated PFFs (pPFFs), a‐syn aggregates (OW) and p‐a‐syn aggregate (OP) induced by one reactive aldehyde, named 4‐oxo‐2‐nonenal (ONE)8 and examined them with transmission electron microscopy (TEM). The PD mice model we used was Thy1 h‐a‐syn transgenic mice (Tg). After a series of biochemical detection of C140S, we used C140S to detect p‐a‐syn level in brain of 12‐month (m) Tg and wild‐type brood mice (Wt). We also produced an a‐syn polyclonal antibody SN16 who had strong capture ability towards t‐a‐syn. Using SN16 and C140S, we established a sandwich‐ELISA method and tested its specificity with the antigens we prepared above.

Results: I. We have successfully preparated highly specific p‐a‐syn monoclonal antibody C140S, C140S could be used in the detection of both monomeric and aggregated p‐a‐syn in vivo/in virto. II. 12 m Tg mice brain had higher p‐a‐syn level in midbrain and striatum compared with Wt mice. III. The sandwich‐ELISA (SN16‐C140S) obtained high specificity in recognizing different forms of p‐a‐syn, especially those aggregated p‐a‐syn. IV. Although OW and OP appeared smaller in volume, their connection was much tighter and more stable than PFF and pPFF.

Conclusions: Our results demonstrate that I. C140S antibody obtains high specificity towards p‐a‐syn and can be used to detect p‐a‐syn in mice brain. II. Using C140S and SN16, we established a new sandwich‐ELISA method who can detect different forms of p‐a‐syn. III. Different forms of p‐a‐syn/a‐syn antigens had distinct structure and stability properties.

References: 1. Kalia, L. V. & Lang, A. E. Parkinson's disease. Lancet 386, 896‐912, doi:10.1016/S0140‐6736 (14)61393‐3 (2015).2. Goedert, M., Spillantini, M. G., Del Tredici, K. & Braak, H. 100 years of Lewy pathology. Nature reviews. Neurology 9, 13‐24, doi:10.1038/nrneurol.2012.242 (2013).3. Spillantini, M. G. et al. Alpha‐synuclein in Lewy bodies. Nature 388, 839‐840, doi:10.1038/42166 (1997).4. Fujiwara, H. et al. alpha‐Synuclein is phosphorylated in synucleinopathy lesions. Nature cell biology 4, 160‐164, doi:10.1038/ncb748 (2002).5. Anderson, J. P. et al. Phosphorylation of Ser‐129 is the dominant pathological modification of alpha‐synuclein in familial and sporadic Lewy body disease. The Journal of biological chemistry 281, 29739‐29752, doi:10.1074/jbc.M600933200 (2006).6. Samuel, F. et al. Effects of Serine 129 Phosphorylation on alpha‐Synuclein Aggregation, Membrane Association, and Internalization. The Journal of biological chemistry 291, 4374‐

4385, doi:10.1074/jbc.M115.705095 (2016).7. Sato, H., Kato, T. & Arawaka, S. The role of Ser129 phosphorylation of alpha‐synuclein in neurodegeneration of Parkinson's disease: a review of in vivo models. Reviews in the neurosciences 24, 115‐123, doi:10.1515/revneuro‐2012‐0071 (2013).8. Nasstrom, T. et al. The lipid peroxidation products 4‐oxo‐2‐nonenal and 4‐hydroxy‐2‐nonenal promote the formation of alpha‐synuclein oligomers with distinct biochemical, morphological, and functional properties. Free radical biology & medicine 50, 428‐437, doi:10.1016/j.freeradbiomed.2010.11.027 (2011).

Parkinson's Disease: Psychiatric Manifestations

202

Behavioral profile of an early post‐natal stressed parkinsonian rat model on a 29 day treatment regimen with fluvoxamine maleate

Ernest Dalle, William Daniels, Musa Mabandla (Pietermaritzburg, South Africa)

Objective: In this study, we investigated the behavioral efficacy of Fluvoxamine maleate (FM) in alleviating the effects of early stress (maternal separation) in a parkinsonian rat model.

Background: Exposure to early life stress can result in behavioral symptoms such as anxiety, depression and/or cognitive deficits later on in life. Fluvoxamine maleate (FM) is a common antidepressant used as first‐line treatment for these behavioral symptoms.

Methods: Early maternal separation was used to create a rat model that depicts anxiety/depressive‐like symptoms and cognitive deficits. Maternally separated Sprague‐Dawley rats were treated with FM once a day for 29 days. The body weight was daily assessed. The elevated plus‐maze (EPM) test, the open field test (OFT), the sucrose preference test (SPT) and the Morris Water Maze (MWM) test were conducted to evaluate the effects of FM on anxiety/depressive‐like symptoms and cognitive deficits.

Results: Our results show that animals exposed to early life stress displayed increased anxiety/ depressive‐like behavior and cognitive deficits symptoms in the EPM, the OFT, the SPT and, in the MWM test. All these symptoms were attenuated by the treatment with Fluvoxamine maleate (FM).

Conclusions: This study suggests that 29 days of early treatment with FM is enough to attenuate anxiety, depression and cognitive deficits in early onset of Parkinson's disease.

References: DALLE, E., DANIELS, W. M. U. & MABANDLA, M. V. 2016. Anti‐parkinsonian effects of fluvoxamine maleate in maternally separated rats. International Journal of Developmental neuroscience, 53, 26‐34.DALLE, E., DANIELS, W. M. U. & MABANDLA, M. V. 2017. Fluvoxamine maleate effects on dopamine signaling in the prefrontal cortex of stressed parkinsonian rats: Implications for learning and memory. Brain Research Bulletin, 132, 75‐81.

203

Study of prevalence of Axis‐1 DSM‐4 psychiatric disorders in patients with parkinsonism in a rural movement disorder clinic in Western India

Soaham Desai, Devangi Desai, Sidharth Singh (Anand, India)

Objective: To assess the prevalence of Axis‐1 DSM‐4 [The Diagnostic and Statistical Manual of Mental disorders] psychiatric disorders in patients with Parkinson's disease [PD], atypical parkinsonism [P+] and vascular parkinsonism [VascP] in a rural movement disorders clinic using a short structured questionnaire [Mini International Neuropsychiatric Interview (MINI)].

Background: Prevalence of psychiatric co‐morbidity in patients with parkinsonism in rural India is not known.

Methods: A cross sectional survey of patients attending movement disorders clinic of Shree Krishna Hospital, a rural medical teaching hospital in Karamsad, Gujarat, in Western India was done between Sept 2016 to Feb 2017. 130 consecutive consenting adults with parkinsonism [PD/ P+/ VascP] were assessed using MINI for prevalence of Axis‐1 DSM‐4 disorders.

Results: Out of 70 patients with PD [ mean age 69,40 males] 42 (60%) had depression/dysthymia as compared to 16 out of 34 (47%) patients with P+[mean age 71, 20 males] and 10 out of 26 ( 38%) of patients with VascP[mean age 73,18 males]. Anxiety was seen in 26 (37%) of PD patients, 10 patients (29%)with P+ and 5 (19%) patients with VascP. 12 (20%) patients with PD had psychosis and 7 (10%) had Obsessive compulsive disorder (OCD). 3 (10%) patient with P+ had psychosis and 1 had OCD. No VascP patient had psychosis or OCD. Of 130 patients 81 (62%) had co‐existent psychiatric co‐morbidity [70% in PD, 55% in P+ and 46% in VascP].

Conclusions: Using MINI in clinics can help identify psychiatric comorbidity in patients with parkinsonism. More than half of patients with parkinsonism have comorbid psychiatric disorder.

204

Psychiatric symptoms in association with Orthostatic Hypotension in Parkinson's disease and the change of them after one year

Yanlei Mu, Haibo Chen, Wen Su, Li Shuhua, Huijing Liu, Liying Jin (Beijing, People's Republic of China)

Objective: In this study, the psychiatric symptoms was compared between PD patients with and without OH with the goal of identifying the relationship of psychiatric symptoms and OH. A further longitudinal study one year later was done to compare the changes of psychiatric symptoms of PD patients with and without OH to reveal the time role on psychiatric symptoms between the two groups.

Background: Orthostatic hypotension (OH) and psychiatric symptoms are very common in patients with Parkinson disease (PD) even in the early stage of the disease. It has been reported that OH is associated with higher prevalence of cognition impairments and depression, both of which were risk factors of psychiatric problems in PD.

Methods: Blood pressure was measured by supine and upright (active standing), OH was identified by a diagnostic criteria of the 20/10 mmHg (systolic/diastolic) in 222 PD patients. All PD participants were divided into two groups by the presence or absence of OH. PD patients underwent a battery of scales: the psychiatric symptoms by Brief Psychiatric Rating Scale (BPRS), affects: depression by Hamilton depression scale (HAMD), anxiety by Hamilton Anxiety Scale (HAMA), motor symptoms by Movement Disorders Society‐Unified Parkinson Disease Rating Scale (MDS‐UPDRS I‐IV), global cognitive function by Mini Mental State Examination (MMSE), sleep disorders by Parkinson's Disease Sleep Scale (PDSS) and ability to perform basic life activities: by Activities of Daily Living (ADL) scale and Parkinson's Disease Questionnaire (PDQ)‐39. Seventy‐six PD patients among them were followed and evaluated again one year later. The scores of the scales and the change of them one year later were compared between the OH+ and OH‐ groups.

Results: Fifty –four (24.3%) patients met the OH diagnostic criteria, one hundred and sixty‐eight (75.7%) patients were without OH. OH+ patients and OH‐ patients had similar impairments in total score of BPRS (OH‐ PD=30.37 ± 1.01, OH+ PD=32.59 ±1.67, P>0.05), significant difference in grandiosity (OH‐ PD=1.21±0.70, OH+ PD=1.00±0.00, P<0.05) and hallucinatory behavior (OH‐PD=1.23± 0.74, OH+PD=1.68±1.18, P<0.05) and a trend of difference in orientation (OH‐PD=1.15 ± 0.71, OH+PD=1.40 ± 1.32, P=0.073) and insight impairments (OH‐PD=1.07± 0.35, OH+PD=1.24± 0.72, P=0.074) of BPRS. OH+ patients showed significant impairments in UPDRS section and MMSE, HAMD, HAMA and PDQ‐39 than OH‐ patients. One year later, the changes of BPRS scores (OH‐ PD=‐ 0.74 ± 13.90, OH+ PD=‐ 0.06 ± 12.13, P>0.05) showed no difference in twenty OH+ patients and fifty‐six OH‐ patients followed up. Each sub‐item score change of BPRS was further compared and no difference was found, either (P>0.05). Neither did the motor nor the other non‐motor scores changes was revealed significant difference between the two groups.

Conclusions: The OH+ patients had significant difference in psychiatric symptoms of grandiosity and hallucinatory behavior than OH‐patients, and had similar changes of psychiatric impairments one year later with OH‐patients. PD patients with hallucination symptom may be benefit from treatment of OH.

References: Papapetropoulos S, Mash DC Psychotic symptoms in Parkinson's disease. From description to etiology [J]. Journal of neurology, 2005,252: 753‐764.DOI:10.1007/s00415‐005‐0918‐5Hohler AD, Zuzuarregui JR, Katz DI, Depiero TJ, Hehl CL, Leonard A, Allen V, Dentino J, Gardner M, Phenix H, Saint‐Hilaire M, Ellis T Differences in motor and cognitive function in patients with Parkinson's disease with and without orthostatic hypotension [J]. The International journal of neuroscience, 2012,122: 233‐236.DOI:10.1080/00207454.2012.642038

Table 1.

motor and non‐motor data of patients

	OH (‐) (n=168)	OH (+) (n=54)	P value
Motor symptom MDS‐UPDRS	45.40 ± 18.51	47.73 ± 21.26	0.099
Section I	3.11 ±2.12	3.84 ± 2.25	0.033*
Section II	12.02 ± 5.69	12.66 ± 6.08	0.485
Section III	26.45 ± 12.87	27.05 ± 14.05	0.764
Section IV	3.10 ±3.03	4.25 ± 3.20	0.019*
Non‐motor symptoms
MMSE	27.15± 0.48	26.58 ±0.89	0.020*
BPRS	30.37 ± 1.01	32.59 ±1.67	0.245
PDSS	118.17 ±22.87	111.91 ±24.33	0.119
HAMD	8.40 ± 5.97	11.34 ±5.78	0.002*
HAMA	9.60 ± 5.98	13.34 ±7.17	0.000*
PDQ‐39	26.46 ± 18.16	35.65 ± 18.80	0.003*
ADL	28.22 ± 11.92	31.32 ± 11.35	0.101

Table 2.

scores of sub‐item of BPRS of patients

	OH (–) (n=168)	OH (+) (n=54)	P value
BPRS‐1	2.66 ± 1.54	2.72 ±1.31	0.708
BPRS‐2	2.20 ± 1.32	2.28 ± 1.10	0.790
BPRS‐3	1.15 ±0.53	1.12 ±0.44	0.692
BPRS‐4	1.24 ±0.77	1.32 ± 0.90	0.844
BPRS‐5	1.18 ±0.54	1.32 ±0.75	0.451
BPRS‐6	1.72 ± 1.53	1.68 ± 1.15	0.805
BPRS‐7	1.17 ± 0.4S9	1.12 ±0.60	0.754
BPRS‐8	1.21 ±0.70	1.00 ±0.00	0.035*
BPRS‐9	2.06 ± 1.26	2.76 ± 1.54	0.107
BPRS‐10	1.39± 1.35	1.24 ±0.66	0.502
BPRS‐11	1.30 ±0.90	1.48 ±0.92	0.716
BPRS‐12	1.23± 0.74	1.68 ± 1.18	0.018*
BPRS‐13	3.03 ± 1.54	3.32 ± 1.11	0.962
BPRS‐14	1.07 ±0.35	1.00 ±0.00	0.321
BPRS‐15	1.18 ±0.72	1.20 ±0.58	0.990
BPRS‐16	1.42 ±0.91	1.32* 0.85	0.295
BPRS‐17	1.04± 0.26	1.20± 0.71	0.146
BPRS‐IS	1.15 ±0.71	1.40 ± 1.32	0.073
BPRS‐19	1.07± 0.35	1.24± 0.72	0.074
BPRS‐20	1.80 ± 1.34	2.32 ± 1.25	0.296

Table 3.

changes of BPRS sub‐item scores of patients

	OH (+) (n=20)	OH (–) (n=56)	P value
BPRS‐1	‐0.35 ± 1.93	‐0.07 ± 2.80	0.683
BPRS‐2	‐0.30 ± 1.38	‐0.52 ± 1.73	0.613
BPRS‐3	0.20 ± 1.32	‐0.02 ± 1.05	0.461
BPRS‐4	‐0.05 ± 0.61	‐0.20 ± 0.70	0.408
BPRS‐5	‐0.05 ± 1.36	‐0.14 ±0.52	0.665
BPRS‐6	‐0.35 ± 1.50	‐0.32 ± 2.08	0.955
BPRS‐7	0.25 ± 0.79	0.11 ±0.93	0.541
BPRS‐8	0.15 ±0.49	0.05 ± 0.44	0.420
BPRS‐9	‐0.15 ±2.16	‐0.32 ± 1.82	0.732
BPRS‐10	0.00 ±1.08	‐0.05 ± 0.84	0.821
BPRS‐11	‐0.25 ± 0.91	‐0.11 ±0.97	0.566
BPRS‐12	0.40 ± 1.60	0.14 ± 1.68	0.554
BPRS‐13	‐0.05 ± 1.36	‐0.27 ± 1.88	0.637
BPRS‐14	0.10 ±0.45	‐0.27 ± 1.88	0.572
BPRS‐15	0.10 ±0.79	‐0.25 ± 1.03	0.172
BPRS‐16	0.15 ±2.00	‐0.16± 1.50	0.471
BPRS‐17	0.00± 0.000	‐0.02± 0.73	0.913
BPRS‐18	0.10 ±0.45	‐0.05 ± 0.644	0.329
BPRS‐19	‐0.05 ± 0.686	0.04 ±0.571	0.587
BPRS‐2 0	0.20 ±1.77	0.07 ± 1.54	0.758

205

Follow‐up study of relationship between depression and quality of life in middle aged and elderly patients with Parkinson's disease

Jiang Yanyan, Wen Su, Haibo Chen (Beijing, People's Republic of China)

Objective: The aim of this follow‐up study was to analyze the long‐term effects of depressive symptoms on quality of life in Parkinson's disease (PD) patients and to explore predictors of changes in quality of life in PD patients.

Background: Multiple cross‐sectional studies have shown that depressive symptoms significantly affect the quality of life of PD patients. However, Longitudinal studies of quality of life, particularly those following patients with PD four long time, are few.

Methods: We had searched 80 PD patients from our research center,Who had complete general information, UPDRS, H‐Y stage, MMSE, HAMD, HAMA, PDQ‐39, etc. A follow‐up visit was conducted after four years. PD patients were divided into two groups according to the baseline HAMD scores. Compare the differences in disease progression and decline in quality of life between the two groups. According to PDQ‐39 change value, cluster analysis was used to reclassify patients into fast‐ decline group and slow‐ decline group. To find the factors related to the rapid decline in quality of life though comparison between groups. A binary logistic regression analysis was used to investigate independent predictors of the decline in quality of life in PD patients.

Results: The quality of life decreased more significantly and the disease progressed faster in the patients of PD with depressive symptoms. The disease course, UPDRS total score, HY stage,and HAMD score were significantly different between the fast‐ decline group and slow‐ decline group (P=0.001, 0.039, 0.003, <0.001, <0.001). Binary Logistic regression analysis showed that disease course (OR=1.254,P=0.020), baseline HAMD score (OR=1.450,P=0.003) has a certain predictive effect on the decline in the quality of life.

Conclusions: The quality of the PD patients with depressive symptoms were worse than the others. PD patients with depressive symptoms progressed faster and the quality of life decreased more significantly. The disease course and high depression score were independent predictors of the decline in quality of life.

References: Müller B, Assmus J, Herlofson K, et al. Importance of motor vs. non‐motor symptoms for health‐related quality of life in early Parkinson's disease. Parkinsonism Relat Disord,2013, 19:1027‐103.Qin Z, Zhang L, Sun F, et al. Chinese Parkinson Study G: Depressive symptoms impacting on health‐related quality of life in early Parkinson's disease: results from Chinese L‐dopa exposed cohort. Clin Neurol Neurosur, 2009, 111:733‐737.Forsaa EB, Larsen JP, Wentzel‐Larsen T, et al. Predictors and course of health‐related quality of life in Parkinson's disease. Mov Disord,2008, 23:1420‐1427.Pontone GM, Bakker CC, Chen S, et al. The longitudinal impact of depression on disability in Parkinson disease. Int J Geriatr Psychiatry, 2016,31:458‐465.

Quality of Life/Caregiver Burden in Movement Disorders

206

This abstract has been withdrawn.

207

Caregiver and the person with Parkinson's: maintaining mental and physical health.

Nabanita Mandal (East Medinipur, India)

Objective: In a southern district of West Bengal, India most of the Parkinson's patient faced neglect due to lack of awareness about the disease and low economic level.

Background: To identify and try to solve to the extent possible the main difficulties in giving care to these patients of the area.

Methods: Home visit by volunteers and enumeration of the problems as discussed by the patient and their families.

Results: Analysis the following data and identify these main problems. Patient problems: Trimmer, dizziness, movement disorder, trouble sleeping, etc. Our volunteers visited homes and their families in our areas. Family problems: Inability to match work life with the care of the patients. Adverse attitude of neighbors and local peoples. Social problems: Lack of awareness of the neighbor of local people about the disease resulting patient and family members faced loneness.

Conclusions: We believe that if we are able to continue our program for a long enough period the suffering of the Parkinson's patient and their families might be resolved to a large extent over time. Probably one of the most important, and sometimes difficult, things caregivers can do is to take care of themselves.

208

Health‐related quality of life and strain among caregivers of Chinese patients with Parkinson's disease

Ying Chen, Yanran Liang, Jing Xiuna, Sudan Peng, Enxiang Tao (Guangzhou, People's Republic of China)

Objective: To investigate the health‐related quality of life and burden among caregivers of Chinese Parkinson's disease patients, and to illustrate the connection between caregiver burden and the feature of both PD patients and their caregivers.

Background: Influence factors of caregiver burden vary in different country and society. The burden among caregivers of PD patients in China is little understood and any effects on caregiver strain remain unclear.

Methods: Caregivers complete Hospital Anxiety and Depression Scale (HADS), Zarit caregiver burden interview (ZCBI) and EQ‐5D, a generic measure of HRQoL. Patients were assessed with Hoehn and Yahr (H&Y) staging, UPDRS, Freezing of Gait questionnaire (FOGQ), PDSS and ESS, HADS, PDQ‐39. Multivariate regression analyses were used to explore the relationship between variables and caregiver burden.

Results: 86 pairs of PD patient and caregiver were interviewed. The basic demographic characteristics and the clinical features of the patients and caregivers are shown in [table 1]. Spouse caregivers accounted for 55.8%. Sixty percent of the caregivers have other family caregivers to take care of the patients. Caregivers need to aid of both IADL and ADL items to the PD patients, and the average care time was 13.79 hours per week. Increased caregivers age, higher HY stage of patients and increased patients age will cause decline of health‐related quality of life in PD caregivers. Subjective Caregiver burden scored an average of 33.50 points assessing through ZBI. Caregivers who bear little subjective burden accounted for 16.3%, the rest feel mild to severe subjective burden. Five factors (caregivers depression, PDQ ‐ 39, PDSS, caregivers' anxiety, whether to hire nanny) influence subjective care burden of PD caregivers [table 2].

Conclusions: Patients' sleep disorders and caregiver's mood significantly influenced burden of PD caregivers. Poor HRQoL in PD patient is associated with higher strain in caregivers. Hiring nursing staff can reduce the caregiver burden.

Table 1.

Clinical and Demographic characteristics of the patients and caregivers.

	Patient	Caregiver
	Mean (SD) or n (%)	Mean (SD) or n (%)	t(p)
Demographic characteristics
Age (years)	65.08(9.14)	49.51(16.54)
Disease duration(years)	7.22(3.50)
Gender
Male	46(53.5)	32(37.2)
Female	40(46.5)	54(62.8)
Marital status
Married	67(77.9)	78(90.7)
Others	19(22.1)	8 (9.3)
Work status
At work		39(45.4)
No work		47(55.6)
Clinical characteristics
UPDRS I	1.98(2.12)
UPDRS III	21.37(6.17)
UPDRS IV	5.78(3.23)
FOGQ	7.98(6.16)
PDQ‐39	34.54(12.34)
PDSS	108.13(22.07)
ESS	7.09(2.96)
HADS‐anxiety	6.67(2.66)	5.33(1.98)	3.230(0.002)
HADS‐depression	7.59(2.89)	5.61(2.79)	4.611(0.000)
SSRE		39.09(5.16)
Objectives		9.04(1.66)
Subjective		22.17(3.61)
Support utilize		7.87±1.76
EQ‐5D index		0.82(0.14)
EQ‐vas		79.35(10.31)
ZBI		33.50(13.45)

Table 2.

Determinants of PD caregiver burden through stepwise multiple Linear regression

Predictors	Standardized Coefficient	Standard Error	t‐Value	P	F	Adjusted R1
				<0.001	57.635	0.863
(constant)	17.331	7.072	2.451	0.019
Caregiver depression	1.198	0.481	2.491	0.017
PDQ‐39	0.374	0.061	6.110	0.000
PDSS	‐0.161	0.047	‐3.459	0.001
Caregiver anxiety	1.435	0.465	3.085	0.004
Employed nurse	‐7.015	3.013	‐2.328	0.025

209

This abstract has been withdrawn.

210

Perceptions of care and access to services in the western Pacific region

Christine Wools, Jian Wang, Shen‐Yang Lim, Shahrul Azmin, Andrew Evans, Xiaoniu Liang, Ai Huey Tan (Brighton, Australia)

Objective: Exploring patient and carer perspectives from patients in Australia, China and Malaysia on care delivery for PD, we aim to understand the preferred care model in our region and current limitations to delivering this.

Background: Given service provision challenges for equitable delivery of care in the Western Pacific Region, not all patients with PD receive care from a movement disorders specialist. Dorsey et al (1) surveyed American patients with PD; those seeing specialist neurologists were more satisfied.

Methods: A self‐administered questionnaire was promoted via web‐link from PD support associations in Australia and Malaysia and in paper format in China. Patients or their carer were questioned regarding their demographics with particular interest in factors anticipated to impact on access to health care. Disease and treatment data in addition to impressions of symptom burden were also collected. Participant level of satisfaction with current care provision was assessed on a 5‐point Likert scale, with these questions replicated from the survey by Dorsey et al (1). Patient current engagement with and interest in additional service providers including nursing and allied health, and other platforms of service delivery such as Telehealth were also addressed.

Results: 450 participants competed the survey, 65% patients. The majority resided in metropolitan areas; 25% of Australians were located regionally. The majority identified a doctor caring for their PD. 85% of Chinese patients and 60% of Australian/Malaysians with a movement disorder specialist in this role. In those not seeing a specialist, access difficulties were cited. Whilst half would participate in a telehealth consultation, 70% prefer to visit the doctor in person. Respondents were generally satisfied with their medical care. The area of most dissatisfaction was delivery of information regarding non‐drug therapies. The most troublesome symptom overall was bradykinesia, with tremor more problematic for the online respondents. A minority had seen nursing and allied health professionals, and endorsed finding it useful. Half of the Australian but only 10% of the Chinese respondents had engaged support groups and were at least moderately satisfied with their experience.

Conclusions: Respondents under specialist care are generally satisfied with medical care for PD. Access to specialty services continue to be an area requiring further development. Patients still prefer a personal attendance to a doctor, but would engage with technology such as telehealth to overcome some of these barriers. An area of dissatisfaction is with delivery of non‐pharmacological management strategies, with many patients not accessing nursing and allied health staff trained in Parkinson's care and delivery of these therapies. In the Western Pacific Region, much could be done to improve the landscape with patient preferences to guide us to focus the initial steps.

References: Dorsey.E.R et al. A U.S survey of patients with parkinson's disease: Satisfaction with Medical care and support groups. Movement Disorders. 2010 (25.3) 2128‐2135

211

Caregiver burden and quality of life among carers of patients with Parkinson disease

Chee Chan (Kuala Lumpur, Malaysia)

Objective: To determine the caregiver burden among carers of Parkinson disease patients using Zarith Burden Interview.

Background: Parkinson disease (PD) is a chronic neurodegenerative disease associated with motor and non‐motor symptoms. With progressive disability, patients require caregivers help to maintain daily functioning. This study was conducted to determine the caregiver burden in PD and its associated factors.

Methods: This cross sectional study was conducted among primary caregivers of patients with idiopathic PD attending the outpatient clinic in UKM Medical Centre or Malaysian Parkinson Disease Association (MPDA) community centre. Caregiver burden was determined using the Zarith Burden Interview and caregivers' quality of life was assessed using the Adult Carer Quality of Life Questionnaire (AC‐QoL). The staging of PD was determined using the modified Hoehn and Yahr scale.

Results: A total of fifty‐one caregiver‐patient pairs completed the study. Of these, 13 were recruited from the outpatient clinic, while 38 were recruited from MPDA community centre. There were 9 Malays, 37 Chinese, 4 Indians and 1 from other ethnic. The mean age of caregivers and patients were 57.04 (SD=12.794) years and 71.12 (SD=7.030) years respectively. The mean PD duration was 10.76 (SD=8.127) years. Mean PD stage was 3.62 (SD=1.232). The mean Zarith caregiver burden score was 27.39 (SD=14.069), corresponds to mild burden. 40 (78.4%) patients had mild burden, 11 (21.6%) had moderate burden while none had severe burden. The mean quality of life score was 76.71 (SD=19.161), corresponds to moderate reported quality of life. Most (n=48, 98%) caregivers had moderate to high quality of life scores. High caregiver burden correlated significantly with poorer quality of life (p=0.003, r=0.591). Comparison between high and low burden showed that three non‐motor symptoms contributed significantly to higher caregiver burden; personality changes (p=0.039), psychosis (p=0.037) and sexual concern (p=0.003). Patients with age 70 years and above contributed significantly to higher caregiver burden (p=0.041). Age of caregivers (p=0.519), duration of disease (p=0.543), stage of disease (p=0.262) were not significantly associated with high burden.

Conclusions: The caregivers in this study reported low to moderate burden with good quality of life scores. Factors associated with high burden were the presence of psychosis, personality changes, sexual concern and higher patient age (=70). The low caregiver burden in this study is possibly due to relatively short disease duration and active involvement in the Parkinson community centre.

References: 1. Bente Thommessen et al. (2002). The psychosocial burden on spouses of the elderly with stroke, dementia and PD. 2. Rozina Bhimani et al. Understanding the Burden in Caregivers of People with Parkinson.

212

Retrospective analysis of inpatients Parkinson 's disease patients from 2002 to 2014

Cheng Jie Mao, Jing Chen, Jie Li, Juanying Huang, Kangping Xiong, Yun Shen, Wei‐feng Luo, Chunfeng Liu (Jinchang, People's Republic of China)

Objective: To analyzed the reasons of admission, comorbidities, use of drugs, and the causes of death of Parkinson's disease (PD) patients during admission by collecting data of PD patients admitted to our hospital in the past 12 years.

Background: Parkinson's disease (PD), closely related to aging, is a well‐known neurodegenerative disease, of which the attack rate in China is ascending with the passage of the time. According to relevant epidemiological statistics, the morbidity of Parkinson's Disease is estimated to reach 5 million by 2030, whose management go up a higher impact to the patients and their family, also to the society.

Methods: We retrospectively analyzed 1589 cases of PD patients admitted to the Second Affiliated Hospital of Soochow University between Jan 2002 and Aug 2014 and analyzed the data of patients admitted in the past 12 years, including the reasons for admission, concomitant diseases and medication, and the causes of death during admission.

Results: During the past 12 years, the number of PD patients admitted to our hospital annually has been increasing year by year. The number of PD patients began to increase sharply in 2009. 30% ‐60% of PD patients were combined with hypertension. Antihypertensive drugs are the most common combination of drugs in patients with PD, followed by antiplatelet drugs and statins. The most commonly used antihypertensive drugs are calcium channel blockers (CCB). The proportion of initial treatment with levodopa of PD patients admitted to the department of neurology showed an upward trend since 6 years before and after. There was no significant difference in the proportion of initial treatment with other kinds of medications in PD patients hospitalized in neurology between 6 years ago and later. Pulmonary infection was the major cause of death during PD admission.

Conclusions: Our study showed that from 2002 to 2014, hospitalized patients with PD showed a trend of increasing year by year. The proportion of PD patients using madopar and dopamine agonists showed also an increasing trend. Hypertension was the most common comorbidities of PD. CCB and antiplatelet drugs were the most common concomitant medications. Pulmonary infection is the major cause of death during PD admission.

213

Reason of hospitalization of Parkinson's disease patients in a tertiary hospital of Nepal

Rajeev Ojha (Maharajgunj, Nepal)

Objective: This study aims to evaluate hospitalized PD patients and look for its etiology for hospitalization to minimize the complications in future.

Background: Global burden of Parkinson's Disease (PD) is increasing worldwide. Although most of the patients are usually managed in outpatient department, some patients need hospitalization for controlling motor symptoms or associated co‐morbid conditions.

Methods: Patient admitted in inpatient ward from 2016 September to 2018 August in Neurology department of Tribhuvan University of Teaching Hospital, Kathmandu, Nepal with diagnosis of PD were evaluated.

Results: Out of 30 patients of Parkinsonism admitted, patients of PD were 16 (53.3%). Male patients were 12 (75%) and female were 4 (25%); mean age was 69.3±4.5 years; and mean admission days was 5.8±2.0 days . Difficulty walking ( 9 patients; 56.6%) was the main reason for hospital admission, out of them 3 patients were already bedbound. Other causes of hospitalization were chest infections, tingling sensation and pain of whole body, urinary tract infection, seizure, stroke and gastrointestinal obstruction. All of the patients were discharged with improvement and no mortality was seen in our study. Delay in outpatient follow‐up (8 patients; 50%) and drug compliance (7 patients; 43.7%) were found to be the two common reasons for the complications that caused these patients to get hospitalized.

Conclusions: Regular follow‐up of PD patients and home monitoring of drug intake are important factors to maintain their motor activity so to reduce the complications, and family members or caregivers should also be well trained to care PD patients.

214

Variability of gait parameters in Parkinson's disease population – a comparative study

Sai Sri Lakshmi Meka, Tazeem Syed, Rukmini Kandadai, Rupam Borgohain (Hyderabad, India)

Objective: To study the improvement in different gait parameters with medication and neurostimulation.

Background: Parkinson's Gait or festinating gait is one of the most common symptoms seen in patients with Parkinson's Disease which is characterized by short shuffling steps often accompanied by hypokinesia and even akinesia in few extreme cases. This is often characterized by a reduction in stride length, loss of bilateral symmetry, reduced speed accompanied by an increase in cadence rate and double support time mostly attributable to altered muscle tonicity.

Methods: A total of 30 PD patients, 15 post Deep Brain Stimulation and 15 on anti‐Parkinson's medication attending Department of Neurology, NIMS, Hyderabad, and 30 age and ethnicity matched controls were included in the study after obtaining the consent. Gait in the study population was recorded using tri‐axial accelerometer and the parameters were analyzed using MATlab program.

Results: All measures of gait variability were significantly varying in PD patient population when compared to the control group. The degree of variability varied with disease duration and improved when the patient was on medication (on state) or when the pulse generator was on. The p values obtained for various parameters studied were significant. Variation was seen even when the left and right side gait parameters were compared.

Conclusions: Results from the current study indicate, there is a significant variation in the parameters studied both during the off and on stage in patients and also when compared to the control group. A well designed clinical approach leading to an individually tailored treatment, may at least offer a partial relief for patients suffering from gait disorders.

Rare Genetic and Metabolic Diseases

215

A case of cerebrotendinous xanthomatosis with movement disorders

Jun Li, Xu Erhe, Shanshan Mei, Piu Chan (Beijing, People's Republic of China)

Objective: Cerebrontendinous xanthomatosis (CTX) is a recessive inherited multi‐systemic disorder of lipodystrophy. The causative gene is located on the autosome 2q33‐qter. CTX lack of sterol 27‐hydroxylase that hinders cholesterol synthesis of bile acids, and results in cholesterol metabolism disorders in tissues. This disease is often onset in adulthood, manifested as progressive neurological dysfunction (such as ataxia, dystonia, dementia, epilepsy, mental disorders, peripheral neuropathy and myopathy) and early non‐neurological manifestations (such as tendon xanthoma, childhood cataract, seizures Sexual diarrhea, early onset atherosclerosis, osteoporosis and respiratory function all). It aims to refresh and improve the Parkinson's specialists' understanding of the disease.

Background: Movement disorders have rarely been reported in CTX.

Methods: we collected a clinical data of a case of Cerebrontendinous xanthomatosis comprehensively. The patient, male, 40 years old, showed the first difficulty in walking difficulties. In the past 2 years, the right achilles tendon was slightly swollen. At the same time, pyramidal damage, extrapyramidal, cortical damage, peripheral nerve damage and spinal cord cerebellar damage were found. More Damaged by the system, accompanied by adolescent cataract, gallstones with multiple stones. We comprehensively collected the blood biochemistry, immunity, infection, tumor, metabolism and other blood indicators, cerebrospinal fluid examination, steroid spectrum, abdominal ultrasound, EEG, EMG, CT, MRI, SWI, Achilles tendon pathology, gene sequencing, FDG‐PET, AV133‐PET. Follow‐up was performed after treatment.

Results: AV133 radiological distribution of the petal basal ganglia is basically normal. Brain MRI shows white matter degeneration, and the symmetry abnormal signal of the cerebellar dentate nucleus is accompanied by calcification. The sterol profile suggests a significant increase in cholesterol. Abdominal ultrasound suggests mild fatty liver and multiple gallstones in the gallbladder. Achilles tendon block pathology suggests multifocal xanthoma cells and multiple cholesterol crystals to make. Gene sequencing indicated that there were two heterozygous mutations in cyp27a1, which were from both parents. Clinical, laboratory examination, imaging, pathology, and multiple angles of the gene were confirmed as Cerebrontendinous xanthomatosis. Symptoms improved after treatment.

Conclusions: CTX is an under‐recognized disease. Parkinson's symptoms can occur in patients with CTX. When diagnosed with Parkinson's disease, most patients have manifestations of systemic or other neurological diseases, which are regarded as advanced disease manifestations and are often overlooked. And underestimate, and cause the mechanism of Parkinson's symptoms in CTX Less, SWI in this paper suggests iron deposition, which may be related to the mechanism of Parkinsonism symptoms. Should pay attention to the differential diagnosis of CTX in Parkinson's syndrome, early diagnosis and improve prognosis.

References: Movement disorders in cerebrotendinous xanthomatosis. Parkinsonism Relat Disord. 2018 Jul 19. pii: S1353‐8020 (18)30310‐9. doi:10.1016/j.parkreldis.2018.07.006. [Epub ahead of print]

Restless Legs Syndrome and Other Sleep Disorders

216

Abnormal resting‐state metrics in REM sleep behavior disorder

Zhichun Chen, Yuan Li, Liche Zhou, Mengsha Yao, Niu Mengyue, Xufeng Jiang, Haiyan Zhou, Shengdi Chen, Jun Liu (Shanghai, People's Republic of China)

Objective: How resting‐state metrics change in idiopathic REM sleep behavior disorder (iRBD) has not been extensively investigated to date. In this study, we used fMRI to study the alterations of the resting‐state metrics in iRBD subjects.

Background: iRBD has been intimately related to midbrain dopaminergic neurodegeneration and is considered a prodrome of neurodegenerative synucleinopathies, implying its value in neuroprotective therapy.

Methods: In this cross‐sectional study, data were collected from October 1, 2016, through May 31, 2018, from 21 subjects with polysomnography‐confirmed iRBD, 34 subjects with Parkinson's disease (PD), and 25 matched control subjects at the Department of Neurology at Ruijin Hospital, Shanghai, China. The resting‐state metrics were derived from fMRI results. Dopamine transporter (DAT) functioning were measured by DAT single‐photon emission computed tomography imaging. Correlations between resting‐state metrics and DAT uptake ratio and other clinical features of iRBD subjects were performed.

Results: We identified changes in four resting‐state metrics, including amplitude of low‐frequency fluctuations (ALFF), fraction of ALFF, regional homogeneity, and functional connectivity in iRBD, which are substantially more prominent in subjects with PD. These resting‐state metric changes were correlated with clinical characteristics, such as the Nonmotor Symptom Questionnaire scores and RBD Screening Questionnaire scores. In addition, we further identified diverse patterns of intranetwork connectivity and internetwork connectivity in the three groups of subjects. Finally, these resting‐state metrics were correlated with reduced DAT functioning of the striatum.

Conclusions: In this cohort, both regional brain activity measured by ALFF, fALFF, and ReHo, and integrative network functional connectivity were abnormally changed and associated with clinical characteristics and disease severity in iRBD. These findings advance the understanding of regional and network dysfunction in iRBD and provide insight into the prediction of future conversion to synuleinopathies.

References: 1. Berg D, Postuma RB, Adler CH, Bloem BR, Chan P, Dubois B, Gasser T, Goetz CG, Halliday G, Joseph L, Lang AE, Liepelt‐Scarfone I, Litvan I, Marek K, Obeso J, Oertel W, Olanow CW, Poewe W, Stern M, Deuschl G. 2015. MDS research criteria for prodromal Parkinson's disease. Movement disorders : official journal of the Movement Disorder Society 30:1600‐1611.2. Ehrminger M, Latimier A, Pyatigorskaya N, Garcia‐Lorenzo D, Leu‐Semenescu S, Vidailhet M, Lehericy S, Arnulf I. 2016. The coeruleus/subcoeruleus complex in idiopathic rapid eye movement sleep behaviour disorder. Brain: a journal of neurology 139:1180‐1188.

Figure 1.

Altered segregational resting‐state metrics in iRBD and PD subjects.

(A) ALFF were significantly altered in the three groups of subjects by using ANCOVA analysis, and six significantly different clusters were identified. (B) fALFF were significantly altered in the three groups of subjects by using ANCOVA analysis, and four significantly different clusters in the fALFF map were identified. (C) ReHo was significantly altered in the three groups of subjects by using ANCOVA analysis, and seven clusters were significantly different among the three groups. (D) ReHo in cluster 5 was negatively correlated with the NMSQ, RBDSQ, and SCOPA‐AUT scores in PD subjects (n=34). (E) ReHo in cluster 4 was negatively correlated with the SCOPA‐AUT score in PD (n=34). (F) ALFF in cluster 5 was negatively correlated with the MMSE score in PD (n=34).

Figure 2.

Impaired FC of left caudate, left putamen, and left thalamus in iRBD and PD.

(A) FC of left caudate was significantly different among three groups. We identified reduced altered FC between left caudate and six clusters in the FC map of the three groups. (B) FC of left putamen was significantly different among the three groups. We identified altered FC between left putamen and three clusters in the FC map of the three groups. (C) FC of left thalamus was significantly different among the three groups. We identified altered FC between left thalamus and four clusters in the FC map of the three groups. (D) LTHFC in cluster 2 was positively correlated with SS‐16 score and negatively correlated with NMSQ score (n=23). (E) LTHFC in cluster 3 was negatively correlated with NMSQ score in iRBD subjects (n=23). (F) LPFC in cluster 3 was negatively correlated with the UPDRS‐III score (n=34).

Figure 3.

Impaired FC of right caudate, right putamen, and right thalamus in iRBD and PD subjects.

(A) FC of right caudate was significantly different among the three groups. FC between right caudate and three clusters was significantly different among the three groups. (B) FC of right putamen was significantly changed among the three groups. FC between right putamen and three clusters was significantly different among the three groups. (C) FC of right thalamus was significantly changed among the three groups. FC between right thalamus and four clusters was significantly different among the three groups. (D) RPFC in cluster 3 was negatively correlated with the NMSQ and RBDSQ scores (n=23). (E) RPFC in cluster 3 was negatively correlated with the UPDRS‐III score (n=34). (F) RCFC in cluster 3 was negatively correlated with the Stroop C score (n=20).

Figure 4.

Divergent intranetwork and internetwork connectivity in iRBD and PD.

(A) The intranetwork FC matrix of ASN in the three groups and the F matrix based on NBS analysis are shown. (B) The intranetwork FC matrix of VSN in the three groups and the F matrix based on NBS analysis are shown. (C) The internetwork FC matrix of 9 networks in the three groups and the F matrix based on NBS analysis are shown.

Figure 5.

Altered resting‐state metrics in iRBD subjects with SS‐16<8 versus SS‐16≥8.

(A) Altered ALFF in iRBD subjects with SS‐16<8 versus SS‐16≥8 (P<0.05, AlphaSim correction). (B) Altered fALFF in iRBD subjects with SS‐16<8 versus SS‐16≥8 (P<0.05, AlphaSim correction). (C) Altered ReHo in iRBD subjects with SS‐16<8 versus SS‐16≥8 (P<0.05, AlphaSim correction). (D) Increased LCFC in iRBD subjects with SS‐16<8 versus SS‐16≥8 (P<0.05, AlphaSim correction). (E) Reduced LPFC in iRBD subjects with SS‐16<8 versus SS‐16≥8 (P<0.05, AlphaSim correction). (F) Reduced RPFC in iRBD subjects with SS‐16<8 versus SS‐16≥8 (P<0.05, AlphaSim correction). (G) Reduced RTHFC in iRBD subjects with SS‐16<8 versus SS‐16≥8 (P<0.05, AlphaSim correction).

Figure 6.

Associations between resting‐state metrics and DAT uptake ratios

(A) ALFF in cluster 3 was significantly correlated with DAT uptake ratios in LC and LAP in iRBD group (n=16). (B) fALFF in cluster 4 was negatively correlated with DAT uptake ratios in RPP in iRBD group (n=16). (C) ReHo in cluster 6 was negatively correlated with DAT uptake ratios in LAP in iRBD group (n=16). (D) FC between right putamen and cluster 1 (bilateral precuneus, right middle/superior occipital gyrus) was negatively correlated with DAT uptake ratios in LC and LAP in iRBD group (n=16). (E) In PD group, ALFF in cluster 3 was positively correlated with DAT uptake ratios in LAP (n=10). (F) ReHo in cluster 1 was negatively correlated with DAT uptake ratios in RAP in PD group (n=10). (G) ReHo in cluster 6 was negatively correlated with DAT uptake ratios in RAP in PD group (n=10). (H) RCFC in cluster 3 was positively correlated with DAT uptake ratios in LC in PD group (n=10). (I) RPFC in cluster 1 was positively correlated with DAT uptake ratios in RPP in PD group (n=10).

217

Studies of polysomnography in patients with Parkinson's disease depression

Hengfeng Qiu (Guangzhou, People's Republic of China)

Objective: Use the whole night Polysomnography (PSG) to study the charateristics of PDD patients's sleep disorder about clinical and electrophysiological features; and futher to compare with PDND patients's sleep disorder.

Background: Nonmotor symptoms of Parkinson disease.

Methods: 28 Patients up to the standard were included. To assess the PD Patients using UPDRS – II H&Y stage MMSE, HAMD, PSQI, ESS. PD Patients will be divided into two groups according to HAMD scores,17 PD Patients in PDD group and 11 PD Patients without depression in PDND group, which were matched with gender, age and duration of disease. PDD group was divided into PDD anti‐depression group (9 Patients) and PDD non‐anti‐depression group (8 Patients). Two‐time monitoring of the whole night PSG were performed respectively in the foregoing groups. The PSG results of the 2nd night were compared. The characteristics of all PD patients including sleep architecture, Process Parameter and abnormal behaviors of sleep were analyzed, and made comparisons and analysis of these index between PDD and PDND groups.

Results: PD Patients who always complain of bad sleep . PDD patients had PSG characteristics of long sleep latency (34.4min‐29.8min), short total sleep time (267.7min‐89.4min), low sleep efficiency (57.3%‐20.5%), somnolence increased (N1 16.4%‐17.9% /N2 66.2%‐17.5%), less N3 sleep (12.5%‐9.4%), short R sleep or long R sleep latency (R 13.7%‐6.3%/R‐SL 169.9min‐69.2min), long arousal time (148.8min‐86.7min). Compared with PDND group, the non‐anti‐depression group had PSG characteristics of longer sleep latency (41.0min‐39.2min vs 20.1 min‐40.7min,P=0.139), shorter N3 sleep (10.4%‐11.0% vs 14.1%‐9.3%,P=0.219), longer arousal time (185.3min‐89.2min vs 132.5 min‐99.1min,P=0.124), low sleep efficiency (50.6%‐20.0% vs 51.7%‐30.1%,P=0.465), short N1 sleep (18.2%‐24.7% vs 20.3%‐13.3%, P=0.407) and short N2 sleep (57.3%‐17.3% vs 63.7%‐20.2%,P=0.240). Compared with PDND group, the anti‐depression group had PSG characteristics of long total sleep time (286.8 min‐92.8 min vs 230.4 min‐113.1 min,P=0.123), high sleep efficiency (63.2%‐20.1% vs 51.7%‐30.1%, P=0.170), long N2 sleep (74.2%‐14.1% vs 63.7%‐20.2%, P=0.102), short N3 sleep (10.2%‐9.3% vs 14.1%‐9.3%,P=0.216), less stage shifts (70.2‐35.8 vs 74.7‐46.1,P=0.407), short arousal sleep time (116.3 min‐74.5 min vs 132.5 min‐99.1 min,P=0.345), R sleep obviously decreased (0.9%?‐2.1% vs 11.2%‐8.1%,P=0.001). There was significant statistical difference between the PDD group and the PDND group in R sleep decrease (P<0.05), but not in other foregoing index (P>0.05).

Conclusions: PDD Patients had PSG characteristics of long sleep latency, short total sleep time, low sleep efficiency, somnolence increased, less N3 sleep, short R sleep or long R sleep latency, long arousal time; compared with PDND group, the anti‐depression group had PSG characteristics of long total sleep time, high sleep efficiency, long N2 sleep, short N3 sleep, less stage shifts, short total sleep time, R sleep obviously decreased.

References: [1] Zesiewicz TA, Sullivan KL, Arnulf I,et al. Practice Parameter: treatment of nonmotor symptoms of Parkinson disease: report of the Quality Standards Subcommittee of the American Academy of Neurology. Neurology. 2010 Mar 16;74 (11):924‐31. [2] Lauterbach, E.C. The neuropsychiatry of Parkinson's disease[J].Minerva Med,2005,96 (3):155‐73. [3] Martinez‐Martin,P,et al. Parkinson's Disease Sleep Scale: validation study of a Spanish version[J]. Mov Disord,2004.19 (10):1226‐1232[4] Rouillon F. Epidemiology of mood disorders. Rev Prat,2008,58:361

Spasticity

218

This abstract has been withdrawn.

Surgical Therapy: Other Movement Disorders Technology

219

Globus pallidus internus versus subthalamic nucleus deep brain stimulation in isolated dystonia

Lin Zhen, Li Xia, Li You, Wu Wen (Shanghai, People's Republic of China)

Objective: Our objective was to compare the efficacy of DBS of the GPi and STN in patients with isolated dystonia.

Background: Deep brain stimulation (DBS) of the globus pallidus internus (GPi) and subthalamic nucleus (STN) is a well‐established procedure for isolated dystonia. However, selection of the best stimulation target remains a matter for debate.

Methods: This was a matched retrospective cohort study that recruited 30 patients with isolated dystonia receiving bilateral GPi (n = 14) or STN (n = 16) stimulation from January 30, 2014 to June 30, 2017. Standardized assessments of dystonia and quality of life were evaluated before and 1, 6, and 12 months after surgery, using the Burke‐Fahn‐Marsden Dystonia Rating Scale (BFMDRS) and Medical Outcomes Study 36‐item Short‐Form General Health Survey (SF‐36).

Results: Thirty and 25 patients completed the 6‐ and 12‐month follow‐ups, respectively. Both GPi and STN stimulation produced a significant clinical effect. There was a significant difference in the percentage improvement in BFMDRS movement score after 1 month between groups (GPi, 48%; STN, 64%; p = 0.01) (Table 1). A significant difference in percentage improvement after 12 months was found in the axis between groups (GPi, 93% vs STN, 83%; p = 0.03) (Table 1). We found lower total electrical energy scores delivered to the STN when compared with GPi (GPi, 192 ± 65.3; STN, 123.9 ± 52.2 ; p = 0.008). (Table 2)

Conclusions: Targeting the GPi or STN was effective in dystonia patients. GPi stimulation may be better for patients with axial symptoms. STN stimulation has a potential economic advantage relative to battery consumption and usually works more quickly.

References: Schjerling L, Hjermind LE, Jespersen B, Madsen FF, Brennum J, Jensen SR, et al: A randomized double‐blind crossover trial comparing subthalamic and pallidal deep brain stimulation for dystonia. J Neurosurg 119:1537‐1545, 2013

Table 1.

Effect of bilateral GPi and STN deep brain stimulation on BFMDR sub‐scores of each site at 1.6 and 12 months after surgery^a

Variable	DBS		BFMDRS score (mean ± SD)				P‐value (mean improvement %)a			P valuec
	Site	N	Pie	lm	6m	ly	1m vs pre	6m vs 1m	1y vs 6m	lm	6m	1y
Total scale [0‐120]	GPi	14	33 82±28 71	15 50±15.95	993±1394	10 82±15.15	0 00(51)	0 00(71)	010(73)
Movement Scale	STN	16	41.53±18.37	1631±845	12.03±830	9.18±7 29	000(60)	0 00(73)	000(80)	0.09	0.89	1
Total [0‐90]	GPi	14	27.32±22.37	13.21±12.96	8.29±11.47	8.91±12.35	0.00(48)	0. 00(70)	0.13(72)
	STN	16	31.78±15.41	11.69±7. 44	8.84±7.31	6.46±6.46	0.00(64)	0.01(75)	0.00(84)	0.01	0.47	0.34
Eyes [0‐8]	GPi	7	1.71±2. 56	1.36±2.01	0. 79±1.30	0.73±1.25	0.18(31)	0. 15(54)	1. 00(65)
	STN	2	0.09±0.27	0.00±0.00	0.03±0.13	0.00±0 00	N.a	N.a	N.a	0.22	0.67	N.a
Mouth [0‐8]	GPi	9	2.86±3. 06	1.11±1.62	0.71±1.68	0.91±1.87	0. 00(51)	0.05(82)	1.00(74)
	STN	4	0.53±1. 09	0.19±0. 40	0. 13±0.34	0.14±0. 36	0. 51(33)	0. 39(83)	1.00(67)	0.83	0.94	0.86
Face [0‐16]	GPi	10	4.57±4.72	2.46±2.61	1.50±2.13	1.64±2. 28	0.00(40)	0.01(73)	1.00(70)
	STN	4	0.63±1.20	0.19±0.40	0.16±0.35	0.14±0.36	0.07(58)	0.49(79)	1.00(67)	0.54	0.84	0.53
Speech[0‐16]	GPi	9	3.86±5. 14	2.00±2.22	1.54±2. 18	1.27±1. 85	0.00(40)	0. 10(61)	0. 35(60)
	STN	7	2.13±3. 20	0.56±1. 09	0.50±1.10	0.36±0.63	0.00(77)	0.58(81)	1. 00(81)	0.04	0.35	0.57
Neck [0‐8]	GPi	10	3.39±3.00	1.07±1.55	0.43±0.73	0.18±0.34	0.00(74)	0.01(91)	0.18(96)
	STN	15	4. 16±2.17	1.44±1.20	1.19±1.14	0.82±0. 85	0.00(68)	0.08(75)	001(81)	0.53	0.02	0.02
Tntnk [0‐16]	GPi	6	4.64±6.30	1.21±2. 78	0.36±0. 84	0.45±0.93	0.00(74)	0. 17(92)	1. 00(92)
	STN	13	5.38±3.88	2.31±2.15	1.63±1.50	1.14±1.35	0. 00(61)	0.02(70)	0.02(86)	0.47	0.03	0.58
Axis [0‐24]	GPi	11	8.04±8.15	2.29±3.32	0.79±1.17	0.64±1.10	0.00(73)	0.01(91)	0.19(93)
	STN	16	9.53±4. 60	3.75±2.93	2.75±2.34	1.96±1. 99	0.00(66)	0. 00(75)	0.00(83)	0.39	0.02	0.03
Anns [0‐32]	GPi	6	6.29±9.21	3.71±6.73	2.83±6.79	2.73±7.10	0.02(44)	0. 10(69)	0.23(69)
	STN	13	11.50±7.61	4.19±3.23	3. 38±3.48	2.57±3.55	0. 01(50)	0.24(73)	0.02(83)	0.37	0. 58	0.72
Legs [0‐32]	GPi	4	4.57±9. 39	2.64±6. 54	2.42±6.10	2.63±6. 34	0.06(46)	0. 09(70)	1. 00(70)
	STN	9	8.00±8.10	3.00±3.27	2.13±2.58	1.43±2.14	0.00(64)	0.09(74)	0.09(83)	0.41	0.83	0.71
Limbs [0‐64]	GPi	7	10. 86±17.66	6.36±12. 64	5.73±13.26	5.36±13.36	0.00(45)	0.07(70)	0.24(74)
	STN	13	19.50±14.23	7.19±5. 53	5.73±5.50	4.00±5. 14	0.01(49)	0.20(74)	0.02(82)	0.31	0.69	1
Disability scale Total [0‐30]	GPi	12	6.50±6.62	2.29±3. 17	1.64±2.56	2.00±2.79	0.00(63)	0. 39(67)	0.34(72)
	STN	15	9.75±4.54	4.63±2.47	3. 19±1.87	2.71±1.54	0.00(49)	0. 00(66)	0.01(74)	0.52	0.35	0.72
Speech [0‐4]	GPi	9	1.00±1.04	0.71±0.83	0.67±0.65	0.64±0.67	0.32(22)	0.18(41)	1.00(41)
	STN	7	0.81±1. 11	0.38±0.72	0. 31*0.60	0.21±0.43	0.00(64)	0.36(69)	0.36(78)	0.17	0.35	0.22
Writing [o‐4]	GPi	4	0.79±1. 31	0.29±0.83	0.25±0.87	0.27±0.90	0. 06(67)	0. 39(75)	1. 00(75)
	STN	12	1.81±1.28	0.88±0. 89	0.56±0.73	0.57±0.76	0.00(58)	0.02(74)	0.34(76)	0.59	0.59	0.77
Feeding [0‐4]	GPi	4	0.64±1.22	0.07±0.27	0.00±0.00	0.00±0.00	0.00(88)	0.39(100)	1. 00(100)
	STN	13	1.50±1. 15	0.63±0.89	0.25±0.58	0.21±0.43	0. 00(71)	0.01(90)	0.34(92)	0.41	0.55	0.55
Eating and swallowing [0‐4]	GPi	6	0.86±1. 17	0.21±0.43	0.25±0.62	0.27±0.65	0.00(78)	0. 81(75)	1.00(75)
Hygiene [0‐ 4]	STN	6	0.56±0.89	0.25±0.58	0.19±0.40	0.14±0.36	0.15(64)	0.36(63)	0.37(83)	0.59	0.82	1
	GPi	5	0.86±1.35	0.14±0.53	0. 17±0.58	0.18±0. 60	0.00(87)	1(87)	1. 00(87)
Dressing [0‐4]	STN	14	1.63±1.15	0.69±0.79	0.56±0.63	0.43±0.65	0.00(62)	0.16(67)	0.10(82)	0.26	0.29	0.69
	GPi	6	0.93±1. 21	0.14±0.53	0. 17±0.58	0.18±0. 60	0.00(83)	1(83)	1. 00(83)
	STN	14	1.50±1.03	0.69±0.87	0.56±0.73	0.50±0.65	0.00(61)	0. 19(67)	0.24(76)	0. 27	0.35	0.49
Walking [0‐ 6)	GPi	7	1.36±1.65	0.71±1.14	0.42±0.90	0.45±0.93	0.02(55)	0.16(77)	1.00(77)
	STN	10	1.94±1.73	1.13±1.02	0.88±0.81	0.64±0. 84	0.00(48)	0. 02(63)	0.08(71)	0.74	0. 13	0.54

^aGPi, globus pallidus internus: STN, subthalamic nucleus: DBS, deep brain stimulation: BFMDRS, Burke‐Fahn‐Marsden Dystonia Rating Scale: n, number of patients in relevant position: Pre, preparation: 1m, 1 month after operation: 12m, 12 months after operation plus‐minus values are means ± standard deviation; improvement %=BFMDRS score (pre‐1m or 1y)/pre; face= eye + month; axis=neck +trunk; limbs=arms + legs;

^bp‐value for improvement comparisons between 1 mo and baseline. 6 mos and 1 mo 1 yr and 6 mos in each group; two‐tailed Wilcoxon signed rank (Mann‐Whitney) test

^cp‐value for improvement comparisons between GPi and STN groups at each follow‐up time; two‐tailed Wilcoxon signed rank (Mann‐Whitney) test

Table 2.

Stimulation parameters and TEED^a

	Variable	GPi (n=11)	STN (n=14)	p value
Left	Voltage	2.85=0.25	2.44+0.48
	Frequency	158.2±11.5	146.4±17.3
	Pulse width	74.5±16.3	80±19.2
	Resistance	1079.8±109.6	1134.7±1.23
	TEED	92±31.6	63±27.1	0.022
Right	Voltage	2.97±0.35	2.28±0.53
	Frequency	157.3±10.8	147.1±18.4
	Pulse width	77.3±16.2	77.9±19.7
	Resistance	1134.3±248.9	1040.4±192.6
	TEED	100±41.1	61±31	0.012
Total	TEED	192±65.3	123.9±52.2	0.003

^aGPi, globus pallidus intemus: STN, subthalamic nucleus; TEED, total electrical energy delivered plus‐minus values are means ± standard deviation n. number; total TEED=left TeED+right TEED.

^b p‐value for TEED companions between GPi and STN group by Student's T test

220

Deep brain stimulation in central post‐traumatic dystonia

Li Xia, He Lu, Wu Wen, Li You (Shanghai, People's Republic of China)

Objective: This study was designed to evaluate the efficacy and safety of deep brain stimulation (DBS) in patients with Central post‐traumatic dystonia (CPD).

Background: CPD, a complication of brain trauma, is often difficult to manage with medications. Since DBS has been proposed as an effective treatment for drug‐intolerant primary dystonia, whether it is also efficacious in CPD worth further exploration.

Methods: Seven patients with disabling CPD underwent DBS therapy (STN in 3 cases, GPi in 3 cases and thalamic Vim nucleus in 1case). The clinical outcomes were assessed by the Burke‐Fahn‐Marsden dystonia rating scale (BFMDRS) movement and disabling score. Quality of life assessment was based on the Short Form 36) Health Survey (SF‐36). Mini‐mental State Examination (MMSE) was also assessed to evaluate the cognitive function. All assessment were conducted at baseline and the last follow‐up visit.

Results: The mean age of brain injury and surgery was individually 21.0 ± 6.4 years (range, 4‐46 years) and 32.3 ± 5.1 years (range, 16‐54 months). (Table 1) Patient 7 was excluded for the efficacy assessment due to his complicated DBS treatment history. The total BFMDRS score of the patients were improved favorably at the last follow‐up (64 %, range 52%‐78%, p < 0.01) except patient 4. (Table 2) The BFMDRS movement score of the 5 patients had improved by 65% (range 52%‐79%) and the disability score had improved by 64% (range 33%‐76%). (Table 2) The Quality of life was improved significantly at the long‐term follow‐up. (Table 3) MMSE scores displayed no difference between baseline and the long‐term follow‐up. There was no side effect observed during the programming session.

Conclusions: DBS would be a potential treatment for a medically refractory CPD.

References: K. Frei, Posttraumatic dystonia, J Neurol Sci 379 (2017) 183‐191.

Table 1.

Summary of patient demographic data and clinical characteristics^a

No	Sex	Age (years)	Onset age of trauma (years)	Loss of consciousness (Y,N/duration)	MRI lesions	age of surgery (years)	target	History of dystonia	Latency of dystonia onset (months)	Dystonia type	Affected region	Persistence during sleep	Accompanying symptom (pair)	Failed treatment of medicine	Respose to Botulinum toxin
1	M	20	7	Y/4m	right temporal lobe	19	R‐GPi	N	4	multifocal dystonia	L‐upper limb and R‐lower limb extremity	N	Y	Mecobalamin, Levodopa, Clonazepam and Benzoresin hydrochloride	Unknown
2	M	25	17	Y/6d	left global pallidus	24	L‐STN	N	6	herai‐ dystonia	R‐upper limb and R‐lower limb extremity	N	Y	Baclofen and Benzoresin hydrochloride	N
3	F	41	28	Y/2d	bilateral outer capsule	38	R‐GPi	N	12	hemi‐ dystonia	L‐upper limb, mouth neck and L‐lower limb extremity	N	Y	traditional Chinese medicine, Levodopa, Clonazepam and Benzoresin hydrochloride	unknown
4	M	24	4	N	left global pallidus and left thalamus	16	B‐STN	N	0.5	multifocal dystonia	L and R‐upper limb and L‐ lower limb extremity	N	N	Levodopa, Clonazepam and Benzoresin hydrochloride	N
5	M	37	6	Y/2h	bilateral basal ganglia	34	B‐STN	N	6	multifocal dystonia	L and R‐Upper extremity and trunk	N	N	Clonazepam and Baclofen	unknown
6	M	46	39	Y/lm	right midbrain	41	R‐VIM	N	18	focal dystonia	L‐upper limb	N	N	Levodopa, Pirbeidil and Benzoresin hydrochloride	unknown
7	M	64	46	Y/lm	/	54	B‐GPi	N	0	segmental dystonia	L‐upper limb and neck	N	N	Paraxetine, Estazolam, fluoxetine and Benzoresin hydrochloride	unknown

^a No, patients number; sex: M, male; F, female; target: L, left; R, right;B bilateral: m, months; d, days; h, hours; GPi, globus pallidus internus; STN. subthalamic nucleus.VIM, Ventra Intermediate Thalamic Nucleus; Y. yes; N, no; /. there was no MRI image of patient.

Table 2.

clinical outcomes of DBS ondystonia and stimulation paremeters^a

number	follow‐up (months)	BFMDRS before DBS (movement/disability)	BFMDRS at last evaluation (movement/disability)	BFMDRS Improvement % (movement/disability/total)	Stimulation parameters of the last follow‐up visit [Amplitude(V)/ Frequency (Hz)/pulse width (ms)]
1	14	15/6	6/4	60/33/52	Right:2.65/175/90 Case(+) 1 (‐) 2(‐)
2	12	28/17	6/4	79/76/78	Left:3.3/169/70 Case(+) 2 (‐) 3 (‐)
3	30	11.5/4	4/1	65/75/78	Right:3.15/145/90 Case(+) 3 (‐) 4(‐)
4*	0	47/24	47/24	0/0/0	NA Left:2.15/125/60 Case(+) 10 (‐)
5	24	21/9	10/3	52/67/57	3.15/125/90Case(+) 11 (‐)Right:2.15/125/60 Case(+) 2 (‐)
6	49	12/3	4/1	67/67/67	Right:2.5/185/90 Case(+) 1 (‐)2 (‐) 3.75/ 160/60Case(+) 0 (‐) 1 (‐)

^aDBS. deep brain stimulation; BFMDRS. Burke‐Fahn‐Marsden Dystotiia Rating Scale; *, The IPG was not implanted in the patient 4 after the electrode implantation, due to poor test results;

Table 3.

Health‐related quality‐of‐life sub‐scores on the Medical Outcomes Study 36‐item Short‐Form General Health Survey and Mini‐mental State Examination at baseline and the last follow‐up visit^a

	baseline scores (mean±SD)	the last follow‐up scores (mean±SD)	P valueb
SF‐36 subscale
General Health	38.00 ±1.225	65.00 ±3.391	0.0079c
Bodily Pain	73.40 ± 12.93	86.40 ±5.845	0.5397c
Physical Functioning	61.00 ±9.138	95.00 ±1.581	0.0079c
Role‐Physical	20.00 ±5.000	55.00 ±9.354	0.0397c
Vitality	45.00 ±4.183	67.00 ±3.742	0.0238c
Social Functioning	47.50 ±4.677	75.00 ±5.590	0.0238c
Role‐Emotional	40.00 ±12.47	100.0 ±0.0	0.0079c
Mental Health	41.60±4.118	58.40 ± 1.600	0.0317c
MMSE	25.67 ±0.9545	26.33 ± 1.022	0.6438c

^aSF‐36,Health‐related quality of life sub‐score; MMSE Mini ‐mental State Examination; mean±SD, means ± standard deviation; score 0‐100;

^bP values for comparisons between baseline and the last follow‐up

^cP value based on two‐tailed Mann‐Whitney test

221

The safety and efficacy of PSA deep brain stimulation in essential tremor: a pilot study

Wu Wen, Huang Ke, Pan Xin, Sun Ming, Zhang Cheng, Wang Tao, Li You (Shanghai, People's Republic of China)

Objective: To investigate the efficacy and safety of posterior subthalamic area (PSA) deep brain stimulation (DBS) in medication refractory essential tremor (ET).

Background: ET is one of the most common movement disorders and affects approximately 1% of the population worldwide. DBS targeting the thalamic nucleus ventralis intermedius (VIM) is an effective treatment for ET, particularly for medication‐resistant disabling cases. However, there may be loss of benefit over a long period of time in a subset of patients. Thus, alternative targets like PSA are worth considering.

Methods: Seven ET patients with 14 PSA deep brain stimulation electrodes were recruited in this pilot, single‐center, prospective study. All the patients have completed at least 6 months. The effect of stimulation was evaluated with standardized settings for each contact using items from the Essential tremor rating scale (ETRS).

Results: PSA‐DBS significantly reduced tremor severity and improved quality of life. Postoperative. Stimulation of the PSA improved the baseline ETRS motor score by 89.06% (p = 0.00002). In addition, Item 4 (tremor of head) was improved from 1.86±0.90 to 0.00±0.00 (100%, p=0.00015), and items 5 to 6 (tremor of upper‐limb) from 13.64±2.58 to 2.00±1.41 (85.34%, p=0.00001). Activities of daily living were improved by 78.33% (p=0.00001). No severe complication occurred.

Conclusions: Our prospective data suggest that PSA DBS resulted in a marked reduction of tremor.

References: Ludy C. Shih, Kathrin LaFaver, Chen Lim,et al.Loss of benefit in VIM thalamic deep brain stimulation (DBS) for essential tremor (ET): How prevalent is it?Parkinsonism and Related Disorders 19 (2013) 676 67Kitagawa M, Murata J, Kikuchi S, Sawamura Y, Saito H, Sasaki H, Tashiro K:Deep brain stimulation of subthalamic area for severe proximal tremor.Neurology 2000, 55:114–116

222

Bilateral nucleus basalis of meynert deep brain stimulation for dementia with lewy bodies a randomized clinical trial

James Gratwicke, Ludvic Zrinzo, Joshua Kahan, Tarek Yousry, Harith Akram, Jonathan Hyam, Ashwini Oswal, Brian Day, Sebastian Crutch, Thornton John, Jonathan Schott, Patricia Limousin, Martin Rossor, David Burn, Marwan Hariz, John‐Paul Taylor, Ian McKeith, Lynn Rochester, Marjan Jahanshahi, Thomas Foltynie (London, United Kingdom)

Objective: To evaluate the safety and potential symptomatic effects of deep brain stimulation of Nucleus Basalis of Meynert (NBM DBS) for Dementia of Lewy Bodies (DLB).

Background: DLB is the second most common neurodegenerative dementia (McKeith et al., 1996), associated with increased morbidity and caregiver burden (Boström et al., 2007; Price et al., 2017; Ricci et al., 2009). DLB is characterised by prominent deficits in attention, executive functions and visuoperceptual abilities, while mnemonic abilities are less impaired (Ferman et al., 2006; McKeith et al., 2004, 2017). These cognitive impairments are accompanied by fluctuating cognition, visual hallucinations, REM sleep behaviour disorder and parkinsonism (McKeith et al., 2005, 2017). Current treatment is limited to symptomatic therapies and there is an unmet need for more effective treatments. We reported that low frequency NBM DBS in patients with Parkinson's disease dementia (PDD) was safe and well‐tolerated and reduced visual hallucinations in some patients (Gratwicke et al., 2018). Since DLB and PDD share common pathophysiological features including NBM degeneration associated with cognitive decline (Grothe et al., 2014; Perry et al., 1985; Ray et al., 2018), we considered whether NBM DBS might impact upon symptoms in DLB in a similar manner to PDD.

Methods: We completed a randomised, double‐blind, crossover clinical trial evaluating the results in six patients with DLB treated with NBM DBS and evaluated at two centres in the UK. Patients met the following eligibility criteria: diagnostic criteria for probable DLB; appropriate surgical candidates aside from the existence of dementia; aged 50‐80 years; able to give informed consent; Clinician Assessment of Fluctuations Scale score of 2‐12; Mini‐Mental State Examination score 21‐27; minimal atrophy on MRI brain imaging; living at home with a carer‐informant. Fifteen patients were assessed; six eligible patients were enrolled, underwent NBM DBS surgery and completed the trial. Following surgery, patients were assigned to receive either active (bilateral, 20 Hz NBM DBS) or sham stimulation for six weeks, followed by the opposite condition for six weeks. The primary outcome was the difference in scores on each item of an abbreviated cognitive battery (Hopkins Verbal Learning Test ‐ Revised, digit span, verbal fluency, Posner's covert attention test, simple and choice reaction times, Clinician Assessment of Fluctuation Scale) between the two conditions. Secondary outcomes were exploratory and included differences in scores on standardised measurements of cognitive, psychiatric and motor symptoms, and resting state fMRI.

Results: Surgery and stimulation were well tolerated by all six patients (five male, mean age 71.33 years [SD 3.67]). One serious adverse event occurred: one patient developed antibiotic‐associated colitis, prolonging his hospital stay by two weeks. No consistent improvements were observed in primary outcome measures, but there was a trend for improvement in neuropsychiatric symptoms with NBM DBS. Resting state fMRI indicated potential changes in functional connectivity in both the default mode and frontoparietal networks associated with active NBM DBS in the study cohort.

Conclusions: Low frequency NBM DBS was safely conducted in DLB patients. Further studies may be warranted to explore other stimulation paradigms and potential symptomatic effects.

References: Boström F, Jönsson L, Minthon L, Londos E. Patients with dementia with lewy bodies have more impaired quality of life than patients with Alzheimer disease. Alzheimer Dis. Assoc. Disord. 2007; 21: 150–4.Ferman TJ, Smith GE, Boeve BF, Graff‐Radford NR, Lucas J a, Knopman DS, et al. Neuropsychological differentiation of dementia with Lewy bodies from normal aging and Alzheimer's disease. Clin. Neuropsychol. 2006; 20: 623–636.Gratwicke J, Zrinzo L, Kahan J, Peters A, Beigi M, Akram H, et al. Bilateral Deep Brain Stimulation of the Nucleus Basalis of Meynert for Parkinson Disease Dementia: A Randomized Clinical Trial. JAMA Neurol. 2018; 75: 169–178.Grothe MJ, Schuster C, Bauer F, Heinsen H, Prudlo J, Teipel SJ. Atrophy of the cholinergic basal forebrain in dementia with Lewy bodies and Alzheimer's disease dementia. J. Neurol. 2014: 1939–1948.McKeith I, Mintzer J, Aarsland D, Burn D, Chiu H, Cohen‐Mansfield J, et al. Dementia with Lewy bodies. Lancet Neurol. 2004; 3: 19–28.McKeith IG, Boeve BF, Dickson DW, Halliday G, Taylor J‐P, Weintraub D, et al. Diagnosis and management of dementia with Lewy bodies: Fourth consensus report of the DLB Consortium. Neurology 2017; 89: 88–100.McKeith IG, Dickson DW, Lowe J, Emre M, O'Brien JT, Feldman H, et al. Diagnosis and management of dementia with Lewy bodies: third report of the DLB Consortium. Neurology 2005; 65: 1863–72.McKeith IG, Galasko D, Kosaka K, Perry EK, Dickson DW, Hansen L a., et al. Consensus guidelines for the clinical and pathologic diagnosis of dementia with Lewy bodies (DLB): Report of the consortium on DLB international workshop. Neurology 1996; 47: 1113–1124.Price A, Farooq R, Yuan J‐M, Menon VB, Cardinal RN, O'Brien JT. Mortality in dementia with Lewy bodies compared with Alzheimer's dementia: a retrospective naturalistic cohort study. BMJ Open 2017; 7: e017504.Ray NJ, Bradburn S, Murgatroyd C, Toseeb U, Mir P, Kountouriotis GK, et al. in vivo cholinergic basal forebrain atrophy predicts cognitive decline in de novo Parkinson's disease. Brain 2018; 141: 165–176.Ricci M, Guidoni SV, Sepe‐Monti M, Bomboi G, Antonini G, Blundo C, et al. Clinical findings, functional abilities and caregiver distress in the early stage of dementia with Lewy bodies (DLB) and Alzheimer's disease (AD). Arch. Gerontol. Geriatr. 2009; 49: 10–13.

Surgical Therapy: Parkinson's Disease

223

A study of bilateral stn dbs in Parkinson disease on motor and non‐motoric axial symptoms using levodopa and with microelectrode recording

Venkateshwarla Rama Raju, Rupam Borgohain, Rukmini Kandadai (Hyderabad, India)

Objective: To evaluate the effects and efficacy of high frequency stimulation of bilateral STNDBS on motor, non‐motoric axial symptoms' rousing in idiopathic advanced Parkinson's disease. Mostly reduce in the use of L‐dopa during course of the disease has been ascribed to appearance of axial features.

Background: STN‐DBS is an effective therapy for PDs. Patients tend to respond less with L‐dopa long term treatment after many years of the assessment of the disease. Though, motoric features clearly enhanced by L‐Dopa, albeit in the late stages of disease. 5 channel lead‐point MER done in all PDs.

Methods: The effectiveness of subthalamic stimulation score (UPDRS III) on motoric axial symptoms were assessed in 46 advanced idiopathic PD subjects. Sub score were also studied for bradykinesia slowness of movement, rigidity, postural instability, tremor, stiffness, walking that are known to respond to L‐dopa. Axial features includes slurred speech, posture, reaching for a cup, rising from chair, neck‐rigidity, postural‐instability, ballistic movements, and walk that are identified to retort to L‐dopa. Patients were diagnosed in ‘on’ and ‘off’ state in L‐dopa challenge test done prior implantation of deep brain stimulating electrodes. Resumed after 6 months post surgery under constant STN stimulation. A complimentary score for axial signs from the daily living activities, i.e. swallowing, falling, speech, freezing gait was obtained from patient's questionnaire.

Results: There were improvements in motoric disability score (68%), limbic‐signs (68%), non‐motoric‐axial signs (74%) with STN‐DBS were statistically comparable with those gained from L‐dopa in pre op challenge (74%, 75% and 64%). On combined STNDBS, there was more development in motoric‐disability score (86%) when compared with pre op dopamine precursor. Hence, consisted this largely for further progress in non‐motoric axial signs (88%) especially postural‐stability and position. On STNDBS levodopa combination, there was similar progress portrayed in non motoric axial features from their daily living activities.

Conclusions: Our findings imply that bilateral STNDBS enhances most of the non‐motoric axial symptoms of Parkinson disease. Also, a synergistic effect can be obtained when DBS therapy is employed in conjunction with L‐dopa therapy. With varied degree of stimulation frequencies (<130 Hz) and the effect of varying frequency parameters, axial symptoms can be effectively improved. A huge amount of work done in exploring effects of frequency modulation, which may help patients with freezing of gait and other axial symptoms. However, there is a dearth of data on the use of tiny pulse‐width settings that are possible with advanced technologies now.

References: 1. Momin S, Philipp M, Dejan G, Thomas F, Ludvic Z, Marwan H, Andre Z, Patricia L, Impact of subthalamic deep brain stimulation frequency on upper limb motor function in Parkinson's disease. Journal of Parkinson's disease 8 (2018) 267‐271.2. Viswas D, Patricia L, Thomas F, Subthalamic nucleus deep brain stimulation in Parkinson's disease: the effect of varying stimulation parameters. Journal of Parkinson's disease 7 (2017) 235‐245.

224

Deep brain stimulation of the subthalamic nucleus and globus pallidus for apathy in PD patients

Xue Zhang, Xie Anmu (Qingdao, People's Republic of China)

Objective: In this meta‐analysis we aim to evaluate the impact of bilateral DBS of the STN and GPi on apathy in PD patients.

Background: Most studies have researched that rapid and aggressive post‐operative DBS‐related mood changes such as cognition following bilateral STN DBS [15‐18]. However, to date there is neither a systematic review of the apathy of DBS in the GPi region (GPi‐DBS), nor a review that compares the apathy of both STN‐DBS and GPi‐DBS targets.

Methods: We searched the PubMed, ScienceDirect, and Embase databases published between 1990 and 2018. The articles included were those contained both pre‐ and postsurgery apathy data acquired using the Starkstein Apathy Scale, Apathy Evaluation Scale, and Lille Apathy Scale and the ‘Apathy’ item of MDS‐UPDRS with patient follow up of at least three months.

Results: A total of 25 out of 102 articles were incorporated into the present meta‐analysis. Standardized mean difference (SMD), that is, Cohen's d, with a 95% confidence interval (CI) was calculated to show the change. We found a significant difference between the presurgery stage and the postsurgery stage scores (SMD = 0.28, 95% CI: 0.17~0.40, P = 0.000). Further subgroup analysis showed that bilateral STN‐DBS seemed to worsen the PD patients' apathetic condition (SMD = 0.29, 95% CI: 0.17~0.41, P =0.000), while bilateral GPi‐DBS had no adverse effects on apathy in PD patients (SMD = 0.02, 95% CI: ‐0.38~0.43, P =0.905). Meta‐regression found that disease duration, age, follow up and LEDD had on effect on apathy.

Conclusions: STN‐DBS and GPi‐DBS seem to relatively worsen the condition of apathy, while bilateral GPi‐DBS may be safe for PD patients. Further studies should focus on the exact mechanisms of possible postoperative apathy in the future.

References: 1. de Lau LM, Breteler MM. Epidemiology of Parkinson's disease. Lancet Neurol. 2006; 5:525–35. 2. Jankovic J, Poewe W. Therapies in Parkinson's disease. Curr Opin Neurol. 2012; 25:433–47.3. Pahwa R, Lyons KE. Treatment of early Parkinson's disease. Curr Opin Neurol. 2014; 27:442–9.

Table 1.

Characteristics of the eligible studies.

Author	N	Age	Disease duration	DBS programming	Scale	Follow‐up	Preoperative score	Preoperative LEDD	Postoperative score	Postoperative LEDD	MINO score
Haidar S. Dafsari1 [22]	39	62.8± 9.1	9.6 ± 5.3	Bilateral STN‐DBS	AES	5 months	28.9±7.1	973.2±484.8	29.8±6.7	456.1±303.5	11
Drapier et al. [7]	15	59.7 ± 7.6	12.2 ± 2.8	Bilateral STN‐DBS	SAS	6 months	13±6.5	1448 ± 400	18.8±9.7	1127 ±482	10
Castelli et al. [8]	19	62.1 ± 4.2	14.7 ± 5.0	Bilateral STN‐DBS	SAS	17 months	11.6±4.1	1192.5 ±415.7	12.6±5.3	571.6 ± 274.8	12
Drapier et al. [9]	17	56.9 ± 8.7	11.8 ± 2.6	Bilateral STN‐DBS	AES	3 months	37.2±5.5	NS	42.5 ±8.9	NS	11
Lhommee et al. [10]	67	57.8 ± 7.2	10.5 ± 3.1	Bilateral STN‐DBS	SAS	1 year	6.2±3.5	1026 ±459	9.4±4.5	284 ±312	11
Lewis et al. [11]	27	61.1 ± 9.1	12.7 ± 6.7	Bilateral STN‐DBS	AES	1 year	34.04±9.58	831.5 ±425.91	37.44±8.71	359.23 ± 264.46	10
Isabel.Fisher [12]	22	63.2±1.7	14.1	STN‐DBS	LARS	6 months	‐20.1±6.1	NS	‐22.8±1.9	NS	11
Lewis et al. [15]	28	61.1 ± 8.9	12.43 ± 6.74	Bilateral STN‐DBS	AES	1 year	33.85±9.71	832 ±426	37±8.91	359.3 ± 264.5	10
Chou et al. [16]	10	62.1 ± 6.5	9.1 ± 5.8	Bilateral STN‐DBS	SAS	6 months	13.2±8.6	1164.9 ±752.9	13.6±7.4	567.9 ± 512.4	11
Robert etal. [17]	44	56.3± 7.5	11.4 ±4.1	Bilateral STN‐DBS	AES	3 months	31.4±6.4	1280.8 ± 632.4	31.6±7.1	889.9 ± 209.3	13
Houvenaghel et al. [18]	26	56.6 ± 7.4	11.47 ±4.54	Bilateral STN‐DBS	AES	3 months	31.8±7	1271.2 ±555.6	31.2±7.7	758.0 ± 407.79	11
Franziska Maier[30]	7	63.71 ± 4.07	13.67 ± 6.60	Bilateral STN‐DBS	AES	12 months	45 ±13.78	759.71 ± 578.70	46.71 ±6.08	578.57 ± 227.04	11
Franziska Maier[30]	9	57.11 ± 9.36	12.7 ± 6.7	Bilateral STN‐DBS	AES	12 months	36.33 ±8.35	968.11 ± 348.84	42.22 ± 7.46	408.33 =276.92	11
Franziska Maier[30]	12	62.58 ± 10.11	11.17 ± 7.00	Bilateral STN‐DBS	AES	12 months	28.58 ±6.49	699.00 ± 372.92	30.08± 5.52	209.58 ± 153.76	11
Franziska Maier[31]	8	60.5 ± 7.19	11.00 ± 4.78	Bilateral STN‐DBS	AES	3 months	42.25 ±11.52	900.75 ± 576.63	44.5 ± 7.15	479.58 ± 299.94	11
Franziska Maier[31]	8	58.88 ± 9.33	14.38 ± 8.14	Bilateral STN‐DBS	AES	3 months	29.88 ±8.59	806.25 ± 371.63	27 ±6.63	250.42 =243.01	11
Franziska Maier[31]	14	62.93 ±9.24	11.14 ± 7.07	Bilateral STN‐DBS	AES	3 months	31.64 ± 7.85	709.86 ± 340.6	33.31 ±6.85	326.36 ± 116.41	11
F. Le Jeune[35]	12	57.4 ±8.00	11.2 ± 2.4	Bilateral STN‐DBS	AES	3 months	30.91 ±4.07	1200 ±426.5	39.16± 6.05	796.66 ± 620	13
L. Castelli[23]	65	60.5 ±6.5	15.1 ± 5.1	Bilateral STN‐DBS	item 4, UPDRS part 1	15 months	0.35 ±0.68	1010.5 ± 419.9	0.35 ±0.72	447.1 ± 284.8	10
A Funkiewviez,[24]	77	55 ± 8	15 ± 5	Bilateral STN‐DBS	item 4, UPDRS part 1	3 year	0.5 ±0.8	NS	0.9± 1.1	NS	11
Lilleeng B[25]	16	60 ± 8.1	12.9 ±5.7	Bilateral STN‐DBS	item 4, UPDRS part 1	6‐9 year	0.9 ± 1.3	960 ±220	1.5± 1.2	910±320	10
C. Lozachmeur[33]	20	60.1 ± 9.1	13.3 ± 5.4	Bilateral Gpi‐DBS	AES	6 months	37.2 ±6.2	1348.7 ±510.2	37.2 ±5	1341.3 ± 367.4	10
Maijan Jahanshahi[27]	14	41.9 ± 18.5	24.1 ± 16.7	Bilateral GPi‐DBS	AES	1 year	26.89 ±3.79	NS	27.78± 4.09	NS	11
Michael S. Okunl[26]	14	60.1 ±5.5	11.5 ± 3.3	Bilateral Gpi‐DBS	SAS	1 year	6.67 ±4.16	622 ±69.4	6 ±5.29	467±47.1	12

AES: Apathy Evaluation Scale; SAS: Starkstein Apathy Scale; item 4, UPDRS part 1: 'Apathy' item of MDS‐UPDRS; LARS: the Lille Apathy Scale

Figure 1.

 

225

Psychiatric and cognitive effects of STN‐DBS in PD

Rukmini Kandadai, Maruthi Kesani, Rajesh Alugolu, Tazeem Syed, Sai Sri Lakshmi Meka, Swetha Tandra, Suryaprabha Turaga, Rupam Borgohain (Hyderabad, India)

Objective: To evaluate the effects of STN DBS on psychiatric, cognition and quality of life in patients with advanced Parkinson's disease.

Background: DBS of STN in Parkinson's disease is well established therapeutic option with wide range of complications.

Methods: Study design: Prospective, single‐centre, observational study using a direct, structured interview of PD patients. Materials and methods: All patients undergoing bilateral STN‐DBS were evaluated with MINI neuropsychiatric interview, ACE and PDQ‐39 before surgery, 6 weeks with MINI and at 6 months with MINI, ACE and PDQ‐39. Post op MRI correlation of the lead position with psychiatric disorder was done. Statistical analysis: Paired t test and Wilcoxon sign rank test were used to study the difference between means.

Results: Out of 36 patients depression was noted in 19.4%, psychosis in 13.8%, anxiety in 27.7% and suicidal ideation in 5.5%. Postoperatively one patient developed new onset depression and one patient developed visual hallucination, two patients had acute deterioration in the immediate post op period. Patient who developed depression had their leads medially located, however the patient who developed hallucinations had normal lead locations. Depression, psychosis and anxiety improved in majority of patients. Mild cognitive decline was noted and there was significant improvement in quality of life.

Conclusions: Bilateral STN‐DBS is a safe and effective therapeutic option and improves psychiatric disorders if the leads are appropriately placed. Mild cognitive decline may occur and significant improvement in quality of life is observed.

226

2 cases of fatal PHS in PD patients while actively treated with deep brain stimulation

Tao Li, Ziyi Huang, Shuzhao Ge, Shanshan Fu, Zhanhua Liang (Dalian, People's Republic of China)

Objective: Here we report 2 cases of fatal PHS in PD patients while actively treated with deep brain stimulation.

Background: Parkinsonism‐hyperthermia syndrome (PHS) is an emergency of movement disorders happening when dopaminergic drugs decrement, withdrawal, or during the period of transformation. This dopaminergic deficiency crisis may appear in a few hours to several days. Core symptoms include high fever, muscle stiffness (may not be associated with tremors), autonomic nervous system dysfunction (including tachycardia, blood pressure fluctuations, sweat, etc.), disturbance of consciousness, etc. Mortality rate can reach 4%.

Methods: Case 1: 71 year old male suffering from PD for 18 years and received bilateral STN‐DBS implantation for 3 years. Other comorbidities include hypertension, diabetes, coronary heart disease. A history of precursor infection was detected 3 days prior to admission. The highest temperature is 41°. Antipyretic, anti‐inflammatory therapy is of poor effect. Loss of appetite and gradually appear disturbance of consciousness. Antiparkinsonian agents failed to taken timely and adequately. Disturbance of consciousness after admission deepened and unstable autonomic nervous function appeared (fast shallow breathing, tachycardia, and hypotension), limb muscle tone increased as lead tube. After then acute myocardial infarction complicated with stress ulcer. Time duration from admission to death was 8 hours. Case 2: 63 year old male suffering from PD for 11 years and received bilateral STN‐DBS implantation for 4 years. Pulse generator power is 2.79v half year before admission and we advised patients to replace the pulse generator as soon as possible. Other comorbidities include diabetes and hepatocellular carcinoma. A history of precursor infection was detected 1 days prior to admission. The highest temperature is 42°. Antipyretic, anti‐inflammatory therapy is of poor effect. Disturbance of consciousness after admission progressive deepening and also appeared unstable autonomic nervous function (fast shallow breathing, tachycardia, and hypotension), but muscle tension of limbs remained normal. Creatine kinase, super‐sensitive troponin I and D‐dimer were significantly increased. Pulse generator power decreased to 2.65v. Time duration from admission to death was 12 hours because of multiple organ failure.

Results: The 2 patients had long history of PD. They both have comorbidities and received DBS therapy. History of precursor infection and ultrahyperpyrexia before admission were detected. Oral medicine can't be taken duo to progressive disturbance of consciousness. In consideration of the history and the symptoms and signs and laboratory examination we diagnosed them as PHS.

Conclusions: PHS usually appear in dopaminergic drug fast reduction or withdrawal after 18h to within 1 week. Risk factors include long‐term acceptance of DBS stimulation (> 8 years) and a longer history of PD (> 18 years). Iinfections, dehydration, stabilizer usage, poor compliance, levodopa malabsorption, spontaneous fluctuations may induce PHS. DBS surgery itself as a stress may induce PHS. When fever, myotonia, disturbance of consciousness happened after the discontinuation of Antiparkinsonian agents before DBS surgery, or DBS therapy interruption, one should consider PHS. Early recognition and diagnosis is of crucial to reduce morbidity and mortality. To guarantee system stability, patients need to keep a close watch on rechargeable DBS system after charging the batter, avoid missing recharge leading to the suspension of stimulation. For not recharging system of DBS, doctors should prompt patients regularly detection, when electricity shortage should shorten the follow‐up time interval, in order to timely replace the pulse generator to avoid DBS withdrawal syndrome. In addition, for long history of PD patients, when the symptoms of fever or infection were suspected, be sure to specialized hospital to make a diagnosis and give therapy, avoid the disturbance of consciousness then oral medicine can't be taken and eventually leading to irreversible withdrawal cascade prognosis. Maybe Transdermal patch are ideal choice for them.

References: [1] Factor SA. Fatal Parkinsonism‐hyperpyrexia syndrome in a Parkinson's disease patient while actively treated with deep brain stimulation. Mov Disord. 2007 Jan;22 (1):148‐9. [2] Linazasoro G, Van Blercom N, Castro A, et al. Subthalamic deep brain stimulation masking possible malignant syndrome in Parkinson disease. Neurology. 2004 Aug 10;63 (3):589‐90. [3] Kim JH, Kwon TH, Koh SB, et al. Parkinsonism‐hyperpyrexia syndrome after deep brain stimulation surgery: case report. Neurosurgery. 2010 May;66 (5):E1029. [4] Kadowaki T, Hashimoto K, Suzuki K, et al. Case report: recurrent parkinsonism‐hyperpyrexia syndrome following discontinuation of subthalamic deep brain stimulation. Mov Disord. 2011 Jul;26 (8):1561‐2. [5] Reuter S, Deuschl G, Deuschl G, et al. Uncoupling of dopaminergic and subthalamic stimulation: Life‐threatening DBS withdrawal syndrome. Mov Disord. 2015 Sep;30 (10):1407‐13.

Therapy in Movement Disorders: Gene and Cell‐Based Therapies

227

Astrocyte‐like cells differentiated from dental pulp stem cells protect dopaminergic neurons against 6‐hydroxydopamine toxicity

Indrani Datta, Kavina Ganapathy (Bengaluru, India)

Objective: the aim of our present study was to evaluate the differentiation potential of dental pulp stem cells (DPSCs) to astrocytes and validate their neuroprotective role towards dopaminergic neurons under 6‐OHDA toxicity in comparison with naïve DPSCs. We also studied the nitric oxide (NO) and BDNF crosstalk in mediating the survival, yield and function of these DA neurons.This will clearly indicate whether naïve DPSCs or astrocyte‐like differentiated DPSCs are the better cell of choice as exogenous supportive cells in neurodegenerative diseases.

Background: Astrocytes are the most abundant glial cell type in the central nervous system and are critical for the protection of neurons in the adult brain. Among its numerous functions, the astrocyte is known to maintain an optimal milieu for the survival and functioning of neuronal cells through antioxidant protection, glutamate clearance, release of neurotrophic factors and cytokines, and maintenance of ionic balance. Studies have suggested that the transient or permanent impairment of these astroglial cells during brain damage leads to neuronal death (Rappold et al., 2010; Hamby and Sofroniewl, 2010). SOD1 mutation in astrocytes has been reported in familial amyotrophic lateral sclerosis (fALS) contributing to the selective death of motor neurons (Nagai et al., 2007; Pehar et al., 2014); similarly, studies have shown that genes (DJ1, PINK1, iPLA2, Parkin, LRRK2) known to have a contributory role in the development of PD have key roles in astrocyte function (Booth et al., 2017; Lev et al., 2013; Choi et al., 2016; Kim et al., 2013; Yun et al., 2015; Ledesma et al., 2002; Henry et al., 2015; Miklossy et al., 2006). These reports highlight the impairment of niche cells of specialized neurons in the disease state. Whether this endogenous niche cell function can be mimicked by tissue derived stem cells is therefore the next question. To understand if tissue derived stem cells could be a potential way to mimic the endogenous niche cell function, we carried out our study with dental pulp stem cells (DPSCs). Among the adult tissue derived stem cells, DPSCs are of prime interest for use in nervous system diseases because of their part cranial neural crest origin (Janebodin et al., 2011: Janebodin et al., 2012). Our earlier study has shown the capability of DPSCs to respond to developmental midbrain cues for differentiation to dopaminergic neurons (Majumdar et al., 2016) in vitro. Their capability for differentiation to neuronal cells in vivo following transplantation in rodent brain in instances of brain injury and neurodegenerative diseases has also been reported (Jung et al., 2016; Leong et al., 2012; Young et al., 2016). However, their plasticity towards non neuronal supportive cells of the CNS is yet to be reported. Given the crucial importance of replacing impaired endogenous niche cells of the CNS in neurodegenerative diseases with healthy exogenous supportive cells, it is essential to evaluate the capability of DPSCs to differentiate to functional astrocyte cells.

Methods: DPSCs were isolated from human molar teeth and subjected to ontogenic cues for astrocyte differentiation. Primary midbrain culture were established through sequential culture technique reported in our earlier publication (Ganapathy et al., 2016). Immunofluorescence and Fluorescence activated cell sorting was used for qualitative and quantitative detection of markers during differentiation. Gene expression was detected by quantitative RT‐PCR. Fluorescence based assays was were used for detecting apoptosis, immunopositive population of cells.

Results: Induction of DPSCs to astrocytes with differentiation‐factors showed definitive increase in astrocyte‐specific markers glial‐fibrillary acidic‐protein (GFAP), S100 and excitatory amino‐acid transporter2 through FACs and immunofluorescence assays. RT‐PCR and ELISA showed significant increase in BDNF & GDNF expression and secretion in astrocyte‐differentiated‐DPSCs over naïve‐DPSCs. Neuroprotective‐role of these cells on DA‐neurons under 6‐OHDA stress was evaluated by both contact and non‐contact methods. FACS‐analysis of PKH26 stained SH‐SY5Y homogenous‐cells in contact method, and of TH‐immunopositive cells in primary‐midbrain‐culture in non‐contact method, both indicated higher survival of DA‐neurons in astrocyte‐differentiated‐DPSCs over naïve‐DPSCs. Recovery of tubulin‐III and TH‐immunopositive cells was reduced in presence of TrkB‐inhibitor, suggesting a key neuroprotective‐role of BDNF secretion by DPSCs. When nitric‐oxide (NO) release was inhibited by L‐NAME in primary midbrain‐culture, BDNF release in co‐culture under 6‐OHDA stress reduced further in naïve‐DPSCs than in astrocyte‐differentiated DPSCs, suggesting that BDNF release in naïve‐DPSCs is primarily regulated by paracrine‐signaling while for differentiated‐DPSCs, it is equally through autocrine and paracrine‐signaling with NO being the mediator.

Conclusions: In sum, our data demonstrate that DPSCs exposed to glial commitment cues show a substantial differentiation towards astrocyte‐like cells and that these cells attain functional maturity with respect to their interaction with midbrain neuronal cells to bring about neuroprotection. The data further suggest that astrocyte‐differentiated DPSCs may be appropriate candidates for further evaluation as stem cell therapy‐based treatments in animal models of neurological diseases and injury involving modification of midbrain microenvironment. In conclusion, based on the evidence of the study, DPSCs may be evaluated as a preferred option for mimicking the role and function of endogenous astrocytes in neurodegenerative disease.

References: Ganapathy K, Sowmithra S, Bhonde R, Datta I. By Changing Dimensionality, Sequential Culturing of Midbrain Cells, rather than Two‐Dimensional Culture, Generates a Neuron‐Glia Ratio Closer to in vivo Adult Midbrain. Cells Tissues Organs. 2016 Jul 16;201 (6):445‐463.Majumdar D, Kanafi M, Bhonde R, Gupta P, Datta I. Differential Neuronal Plasticity of Dental Pulp Stem Cells From Exfoliated Deciduous and Permanent Teeth Towards Dopaminergic Neurons. J Cell Physiol. 2016 Sep;231 (9):2048‐63.

Figure 1.

 

Figure 2.

 

Figure 3.

 

228

The neuroprotection of AAV8‐MANF on 6‐OHDA‐induced PD model

Jingxing Zhang, Ming Jiang, Liting Jiang, Jia Guo, Yanxin Yin, Jianmin Fang, Lingjing Jin (Shanghai, People's Republic of China)

Objective: To explore the neuroprotective effect of AAV8‐MANF on PD rat model and investigate its potential mechanism.

Background: Mesencephalic astrocyte‐derived neurotrophic factor (MANF) has been reported to have neuroprotective effects through anti‐apoptosis, anti‐oxidative, and anti‐inflammatory mechanisms in PD. However, MANF cannot reach the specific brain regions to exert therapeutic effects by conventional administration because it cannot across the blood‐brain barrier. Stereotactic injection of the brain cannot be repeatedly performed because of surgical‐related injuries. Realizing the continuous and stable expression of MANF in specific brain regions has important clinical significance for the treatment of PD.

Methods: 3 μl of AAV serotype 8 (AAV8) vector carrying the MANF gene (AAV8‐MANF,1×1013 vg/ml) was injected into the right substantia nigra (AP, ‐5.5 mm; ML, ‐2.2 mm; DV, ‐8.2 mm) 2 weeks before 2 μl of 6‐OHDA (10 μg/μl) was injected into the right striatum (AP, 0 mm; ML, +3.5 mm; DV, ‐5.5 mm). 3 weeks after 6‐OHDA injection, the rat's motor ability was detected by rotarod test. Survival of dopaminergic neurons was detected by immunofluorescence staining. The gene expression and distribution of AAV8‐MANF were detected using qRT‐PCR, Western blot or immunofluorescence staining. The expression of cleaved caspase‐3, Bax and Bcl‐2 were detected by western blot. Gene expression in the injection tissue was analyzed using RNA‐seq sequencing and expression profile analysis.

Results: Rotarod analysis showed that substantia nigra injection of AAV8‐MANF significantly improved the motor function of PD rat model. Meanwhile, Immunofluorescence staining revealed that AAV8‐MANF could promote the survival of dopaminergic neurons. To clarify the potential mechanisms under MANF‐mediated neuroprotection, the gene expression of AAV8‐MANF and its anti‐apoptotic effect were detected. qRT‐PCR, western blot and immunofluorescence staining showed that AAV8‐MANF could express MANF protein under in vitro infection and brain injection condition. More importantly, the expression of AAV8‐MANF was limited to the substantia nigra region on the injection side, no abnormal distribution of non‐target regions was detected. Moreover, the expression of the AAV8‐MANF was detected in the dopaminergic neurons rather than astrocytes, oligodendrocytes, and microglia. Then, western blot revealed that AAV8‐MANF could inhibit the expression of Cleaved caspase‐3 and reduced the ratio of Bax/Bcl‐2, indicating that anti‐apoptotic effect may be involved in MANF‐mediated protection. GO analysis showed that after AAV8‐MANF treatment, the gene expression related to ATP synthesis, energy coupled proton transport and metabolic process were significantly up‐regulated. KEGG analysis revealed that after AAV8‐MANF treatment, the gene expression associated with oxidative phosphorylation pathway and metabolic pathway were significantly up‐regulated.

Conclusions: AAV8‐MANF can improve the motor function of PD rats, promote the survival of dopaminergic neurons. The protective mechanism of MANF may be closely related to maintaining mitochondrial function and improving energy metabolism.

References: 1. Petrova, P.; Raibekas, A.; Pevsner, J.; Vigo, N.; Anafi, M.; Moore, M.K.; Peaire, A.E.; Shridhar, V.; Smith, D.I.; Kelly, J., et al. Manf: A new mesencephalic, astrocyte‐derived neurotrophic factor with selectivity for dopaminergic neurons. Journal of molecular neuroscience : MN 2003, 20, 173‐188.2. Lindholm, P.; Peranen, J.; Andressoo, J.O.; Kalkkinen, N.; Kokaia, Z.; Lindvall, O.; Timmusk, T.; Saarma, M. Manf is widely expressed in mammalian tissues and differently regulated after ischemic and epileptic insults in rodent brain. Molecular and cellular neurosciences 2008, 39, 356‐371.3. Chen, Y.C.; Sundvik, M.; Rozov, S.; Priyadarshini, M.; Panula, P. Manf regulates dopaminergic neuron development in larval zebrafish. Developmental biology 2012, 370, 237‐249.4. Voutilainen, M.H.; Back, S.; Porsti, E.; Toppinen, L.; Lindgren, L.; Lindholm, P.; Peranen, J.; Saarma, M.; Tuominen, R.K. Mesencephalic astrocyte‐derived neurotrophic factor is neurorestorative in rat model of parkinson's disease. The Journal of neuroscience : the official journal of the Society for Neuroscience 2009, 29, 9651‐9659.5. McFarland, N.R.; Lee, J.S.; Hyman, B.T.; McLean, P.J. Comparison of transduction efficiency of recombinant aav serotypes 1, 2, 5, and 8 in the rat nigrostriatal system. Journal of neurochemistry 2009, 109, 838‐845.6. Zhang, J.; Cai, Q.; Jiang, M.; Liu, Y.; Gu, H.; Guo, J.; Sun, H.; Fang, J.; Jin, L. Mesencephalic astrocyte‐derived neurotrophic factor alleviated 6‐ohda‐induced cell damage via ros‐ampk/mtor mediated autophagic inhibition. Experimental gerontology 2017, 89, 45‐56.7. Cordero‐Llana, O.; Houghton, B.C.; Rinaldi, F.; Taylor, H.; Yanez‐Munoz, R.J.; Uney, J.B.; Wong, L.F.; Caldwell, M.A. Enhanced efficacy of the cdnf/manf family by combined intranigral overexpression in the 6‐ohda rat model of parkinson's disease. Molecular therapy : the journal of the American Society of Gene Therapy 2015, 23, 244‐254.8. Herzog, C.D.; Brown, L.; Kruegel, B.R.; Wilson, A.; Tansey, M.G.; Gage, F.H.; Johnson, E.M., Jr.; Bartus, R.T. Enhanced neurotrophic distribution, cell signaling and neuroprotection following substantia nigral versus striatal delivery of aav2‐nrtn (cere‐120). Neurobiology of disease 2013, 58, 38‐48.9. Yuan, H.; Zhang, Z.W.; Liang, L.W.; Shen, Q.; Wang, X.D.; Ren, S.M.; Ma, H.J.; Jiao, S.J.; Liu, P. Treatment strategies for parkinson's disease. Neuroscience bulletin 2010, 26, 66‐76.10. Bezdjian, A.; Kraaijenga, V.J.; Ramekers, D.; Versnel, H.; Thomeer, H.G.; Klis, S.F.; Grolman, W. Towards clinical application of neurotrophic factors to the auditory nerve; assessment of safety and efficacy by a systematic review of neurotrophic treatments in humans. International journal of molecular sciences 2016, 17.11. Nasrolahi, A.; Mahmoudi, J.; Akbarzadeh, A.; Karimipour, M.; Sadigh‐Eteghad, S.; Salehi, R.; Farhoudi, M. Neurotrophic factors hold promise for the future of parkinson's disease treatment: Is there a light at the end of the tunnel? Reviews in the neurosciences 2018.12. Twiss, J.L.; Chang, J.H.; Schanen, N.C. Pathophysiological mechanisms for actions of the neurotrophins. Brain pathology (Zurich, Switzerland) 2006, 16, 320‐332.13. Mickiewicz, A.L.; Kordower, J.H. Gdnf family ligands: A potential future for parkinson's disease therapy. CNS & neurological disorders drug targets 2011, 10, 703‐711.14. Kordower, J.H.; Emborg, M.E.; Bloch, J.; Ma, S.Y.; Chu, Y.; Leventhal, L.; McBride, J.; Chen, E.Y.; Palfi, S.; Roitberg, B.Z., et al. Neurodegeneration prevented by lentiviral vector delivery of gdnf in primate models of parkinson's disease. Science (New York, N.Y.) 2000, 290, 767‐773.15. Lang, A.E.; Gill, S.; Patel, N.K.; Lozano, A.; Nutt, J.G.; Penn, R.; Brooks, D.J.; Hotton, G.; Moro, E.; Heywood, P., et al. Randomized controlled trial of intraputamenal glial cell line‐derived neurotrophic factor infusion in parkinson disease. Annals of neurology 2006, 59, 459‐466.16. Kordower, J.H.; Herzog, C.D.; Dass, B.; Bakay, R.A.; Stansell, J., 3rd; Gasmi, M.; Bartus, R.T. Delivery of neurturin by aav2 (cere‐120)‐mediated gene transfer provides structural and functional neuroprotection and neurorestoration in mptp‐treated monkeys. Annals of neurology 2006, 60, 706‐715.17. Gasmi, M.; Brandon, E.P.; Herzog, C.D.; Wilson, A.; Bishop, K.M.; Hofer, E.K.; Cunningham, J.J.; Printz, M.A.; Kordower, J.H.; Bartus, R.T. Aav2‐mediated delivery of human neurturin to the rat nigrostriatal system: Long‐term efficacy and tolerability of cere‐120 for parkinson's disease. Neurobiology of disease 2007, 27, 67‐76.18. Bartus, R.T.; Baumann, T.L.; Siffert, J.; Herzog, C.D.; Alterman, R.; Boulis, N.; Turner, D.A.; Stacy, M.; Lang, A.E.; Lozano, A.M., et al. Safety/feasibility of targeting the substantia nigra with aav2‐neurturin in parkinson patients. Neurology 2013, 80, 1698‐1701.19. Warren Olanow, C.; Bartus, R.T.; Baumann, T.L.; Factor, S.; Boulis, N.; Stacy, M.; Turner, D.A.; Marks, W.; Larson, P.; Starr, P.A., et al. Gene delivery of neurturin to putamen and substantia nigra in parkinson disease: A double‐blind, randomized, controlled trial. Annals of neurology 2015, 78, 248‐257.20. Kordower, J.H. Aav2‐neurturin for parkinson's disease: What lessons have we learned? Methods in molecular biology (Clifton, N.J.) 2016, 1382, 485‐490.21. Huang, Y.; Yun, W.; Zhang, M.; Luo, W.; Zhou, X. Serum concentration and clinical significance of brain‐derived neurotrophic factor in patients with parkinson's disease or essential tremor. The Journal of international medical research 2018.22. Zhang, X.; Zhou, Y.; Li, H.; Wang, R.; Yang, D.; Li, B.; Fu, J. Intravenous administration of dpscs and bdnf improves neurological performance in rats with focal cerebral ischemia. International journal of molecular medicine 2018.

229

The generation and characterization of Dopaminergic Precursor‐like Cells from mouse and cynomolgus monkeys fibroblasts

Huili Chen, Hongfang Lu, Yizhao Ma, Xiaohuan Xia, Xinrui Qi, Jialin Zheng (Shanghai, People's Republic of China)

Objective: The study is to determine how much degree dopaminergic precursor (DP)‐like cells reprogrammed from mouse fibroblasts exhibit endogenous neural progenitor cells (NPCs) phenotypes and if DPs can be induced from monkey fibroblasts similarly.

Background: Cell replacement therapy using DP‐like cells is considered as a promising therapeutic strategy in treating Parkinson's disease (PD) which is characterized by specific loss of dopaminergic neurons in the substantia nigra par compacta.

Methods: Firstly, high‐throughput RNA‐sequencing was performed between DP‐like cells and NPCs to identify key gene clusters and pathways involved in dopaminergic neuron development by Gene Ontology (GO) and KEGG pathway analyses. Furthermore, the differentiation potential of DP‐like cells in the aspect of axonal and dentritic formation and guidance was examined. Finally, reprogramming of monkey fibroblast into DPs by the overexpression of the same three transcription factors through lentivirus delivery system was carried out.

Results: We found that the DP‐like cells derived from mouse fibroblasts and NPCs were different in the transcript levels of genes involved in the maturation of dopaminergic neurons, indicating that they have more potential to differentiate into dopaminergic neurons than NPCs. The transcript levels of genes involved in axon guidance pathway was lower in DP‐like cells compared to that of NPCs. We have established a methodological model for the analysis of the neuronal axon and dendritic development. Fibroblasts from cynomolgus monkeys can be induced to form a single clone and proliferate in vitro culture, representing one of the major characteristics of DPs. Further identification of their phenotypes as DPs will be done in the future.

Conclusions: Mouse fibroblasts transduced into DP‐like cells are different to endogenous NPCs. They are more likely to differentiate into dopaminergic neurons even though lacking axon guidance ability, which could be further improved by modifying specific pathways. The three transcription factors have expectedly changed cynomolgus monkeys fibroblasts into single clones. The results were preliminary but still give some evident for the translation from preclinical to clinical studies of cell transplantation based‐therapeutic strategies.

References: Tian, C., et al., Selective Generation of Dopaminergic Precursors from Mouse Fibroblasts by Direct Lineage Conversion. Sci Rep, 2015. 5: p. 12622.Shimozawa, N., et al., Cynomolgus monkey induced pluripotent stem cells established by using exogenous genes derived from the same monkey species. Differentiation, 2013. 85 (4‐5): p. 131‐9.

Tremor

230

Volumetric abnormalities of hippocampal subfields in essential tremor

Shweta Prasad, Apurva Shah, Ketaki Bhalsing, Keshav Kumar, Jitender Saini, Madhura Ingalhalikar, Pramod Pal (Bangalore, India)

Objective: This study aims to characterize cognitive dysfunction in essential tremor (ET), explore hippocampal subfield volumes in ET, and ascertain correlations between abnormal subfields, if any, and scores of neuropsychological tests.

Background: ET is a highly prevalent movement disorder classically considered to be a benign monosymptomatic tremor disorder. However, multi‐domain cognitive impairment has been frequently described in patients with ET, and the exact neuroanatomical basis for this impairment is uncertain (1).

Methods: 40 patients with ET and 40 age, gender and education matched healthy controls (HC) were enrolled in this study. Cognitive domains of executive function, attention, visuo‐spatial abilities, and memory‐working, verbal and visual were assessed using a structured neuropsychological battery. Automatic segmentation of hippocampal subfields was performed using FreeSurfer 6.0 (2) [Figure‐1]. Volumes of which were correlated with scores of neuropsychological tests.

Results: Abnormalities in executive function, attention, visuo‐spatial abilities and memory‐ working, verbal and visual were observed in patients with ET. Atrophy of bilateral subiculum (right=0.06), left CA4, granule‐cell layer of dentate gyrus, right molecular layer, and hypertrophy of bilateral parasubiculum, right hippocampus‐amygdala‐transition‐area, bilateral hippocampal fissure (HF) (left=0.06), and bilateral hippocampal tail (HT) was observed in ET [Table‐1]. Significant correlations were observed between the volumes of HT, HF, fimbria and scores of tests for executive function, working and verbal memory.

Conclusions: Patients with essential tremor have significant volumetric abnormalities of several hippocampal subfields and these may form the core neuroanatomical basis for the cognitive impairment observed in essential tremor. These observations provide novel insights into the expanding concept of pathogenesis of cognitive dysfunction in essential tremor and lend support to the possibility of essential tremor being a neurodegenerative disorder.

References: 1. Bermejo‐Pareja F. Essential tremor‐‐a neurodegenerative disorder associated with cognitive defects? Nat Rev Neurol. 2011;7 (5):273‐2822. 2. Iglesias JE, Augustinack JC, Nguyen K, Player CM, Player A, Wright M, Roy N, Frosch MP, McKee AC, Wald LL, Fischl B, Van Leemput K, Alzheimer's Disease Neuroimaging I. A computational atlas of the hippocampal formation using ex vivo, ultra‐high resolution MRI: Application to adaptive segmentation of in vivo MRI. Neuroimage. 2015;115:117‐137.

Figure 1.

 

Table 1.

Volumes (mm³ x 10^‐4) of hippocampal subfields in patients of essential tremor and healthy controls

Hippocampal subfields	HC (n=40)	ET (n=40)	HC vs ET
Left
Parasubiculum	0.41 ± 0.08	0.50 ± 0.07	0.000*
Presubiculum	2.26 ± 0.33	2.32 ± 0.29	0.508
Subiculum	3.15 ± 0.47	2.99 ± 0.39	0.066#
CA1	4.56 ± 0.67	4.59 ± 0.51	0.915
CA2‐3	1.58 ± 0.30	1.49 ± 0.19	0.128
CA4	1.92 ± 0.33	1.77 ± 0.18	0.012*
GC‐DG	2.25 ± 0.38	2.08 ± 0.22	0.017*
HATA	0.46 ± 0.08	0.48 ± 0.06	0.509
Fimbria	0.56 ± 0.12	0.56 ± 0.15	0.938
Molecular layer	4.18 ± 0.62	4.04 ± 0.44	0.196
HP fissure	1.20 ± 0.25	1.29 ± 0.21	0.066#
HP tail	3.87 ± 0.67	4.22 ± 0.65	0.023*
Whole HP	25.21 ± 3.65	25.04 ± 2.60	0.729
Right
Parasubiculum	0.41 ± 0.07	0.50 ± 0.08	0.000*
Presubiculum	2.23 ± 0.23	2.18 ± 0.26	0.361
Subiculum	3.23 ± 0.31	3.02 ± 0.33	0.005*
CA1	4.90 ± 0.41	4.84 ± 0.46	0.522
CA2‐3	1.7 ± 0.18	1.72 ± 0.21	0.727
CA4	2.01 ± 0.17	1.95 ± 0.22	0.164
GC‐DG	2.34 ± 0.19	2.3 ± 0.26	0.479
HATA	0.45 ± 0.05	0.48 ± 0.62	0.034*
Fimbria	0.53 ± 0.09	0.53 ± 0.13	0.796
Molecular layer	4.41 ± 0.31	4.26 ± 0.41	0.058#
HP fissure	1.23 ± 0.23	1.38 ± 0.21	0.002*
HP tail	4.06 ± 0.48	4.45 ± 0.66	0.003*
Whole HP	26.28 ± 1.71	26.24 ± 2.51	0.919

*: Significant; #: Trend toward significance

CA: Cornu Ammonis; CI: Cognitive impairment; DG: Dentate gyrus; ET: Essential tremor; ETCI: ET with cognitive impairment; ETNCI: ET without cognitive impairment; GC: Granular layer; HATA: Hippocampus amygdala transition area; HC: Healthy control; HP: Hippocampal/ Hippocampus; ML: Molecular layer

231

Early‐onset Holmes' tremor with bilateral hypertrophic olivary degeneration after midbrain infarction: a case report

Ye Li, Yiming Liu (Qingdao, People's Republic of China)

Objective: Report a rare case of early‐onset Holme's Tremor with peculiar bilateral hypertropic olivary degeneration.

Background: Holmes' tremor is rare to see in clinical practice and the latency from lesion to tremor onset is around 2 months. Bilateral Hypertrophic Olivary Degeneration (HOD) is a very unusual condition.

Methods: We report a 54‐year‐old female who had tremor in head and upper limbs only 5 days after midbrain infarction which was extremely in the central part. She presented rest tremor in 3‐4Hz and severe intention tremor as well as mild posture tremor which worsened gradually. 49 days after the infarction, MRI revealed enlargement of bilateral inferior olive nucleus which had not shown in the earlier MRI.

Results: After the treatment with clonazepam, benzhexol, idebenone, tremor was markedly improved.

Conclusions: We believed the bilateral HOD was secondary to the only one lesion in the central midbrain which damaged the cross part of the bilateral Guillain‐Mollaret triangles.

References: [1] Raina GB, Cersosimo MG, Folgar SS, et al. Holmes tremor: Clinical description, lesion localization, and treatment in a series of 29 cases. Neurology, 2016, 86 (10): 931‐938. [2] Kwon DY. Movement Disorders Following Cerebrovascular Lesions: Etiology, Treatment Options and Prognosis. J Mov Disord, 2016, 9 (2): 63‐70. [3] Bocci T, Ardolino G, Parenti L, et al. Holmes' or functional tremor? Clin Neurophysiol Pract, 2018, 3: 104‐106. [4] Konno T, Broderick DF, Tacik P, et al. Hypertrophic olivary degeneration: A clinico‐radiologic study. Parkinsonism Relat Disord, 2016, 28: 36‐40. [5] Alarcon F, Zijlmans JC, Duenas G, et al. Post‐stroke movement disorders: report of 56 patients. J Neurol Neurosurg Psychiatry, 2004, 75 (11): 1568‐1574. [6] Kim JS. Delayed onset mixed involuntary movements after thalamic stroke: clinical, radiological and pathophysiological findings. Brain, 2001, 124 (Pt 2): 299‐309. [7] Martins WA, Marrone LC, Soder RB, et al. Hypertrophic olivary degeneration: unveiling the triangle of Guillain‐Mollaret. Arq Neuropsiquiatr, 2016, 74 (5): 426‐427.

Figure 1.

 

Figure 2.

 

Figure 3.

 

232

Inter‐rater and intra‐rater agreement on the 2018 consensus statement on classification of tremors

Roopa Rajan, Sanjay Pandey, R. Anandapadmanabhan, Achal Srivastava (Kerala, India)

Objective: To assess the inter‐rater and intra‐rater agreement on the 2018 consensus statement on classification of tremors.

Background: Well defined criteria are essential to the diagnosis and classification of tremors as they are predominantly diagnosed clinically. Whether the criteria set forth in the new 2018 consensus statement on the classification of tremors achieves reliable and consistent differentiation of tremor syndromes is unknown.

Methods: Two independent movement disorder specialist raters reviewed videotaped recordings of tremor patients and applied the 2018 consensus classification criteria to classify the tremors into Axis 1 syndromes. Intraclass Correlation Coefficient (ICC) and Cohen's were calculated for inter‐rater and intra‐rater agreement.

Results: 49 structured videotaped neurological examinations were reviewed. For inter‐rater agreement ICC =0.468 [95%CI 0.223‐0.658], p<0.001 and Cohen's =0.388 [95% CI 0.192‐0.584], p<0.001. For intra‐rater agreement ICC=0.689 [95% CI 0.510‐0.812], p<0.001 and Cohen's = 0.670 [95% CI 0.494‐0.846], p< 0.001. Majority of the inter‐rater discordant pairs (19/49) involved a classification of dystonic tremor syndrome (13/19) or essential tremor plus (11/19).

Conclusions: The current consensus classification achieves modest inter‐rater agreement and better intra‐rater agreement. Majority of the discordant classifications involved a judgement on the presence or absence of dystonia.

References: Bhatia KP, Bain P, Bajaj N, Elble RJ, Hallett M, Louis ED, et al. Consensus Statement on the classification of tremors. from the task force on tremor of the International Parkinson and Movement Disorder Society. Mov Disord Off J Mov Disord Soc. 2018 Jan;33 (1):75–87. Landis J, Koch G. The measurment of observer agreement for categorical data. Biometrics. 33 (1):159–74.

Table 1.

Axis 1 classification classifications of patients with concordant and discordant classifications by the two raters. 1Dystonic tremors include both dystonic tremor and tremor associated with dystonia.

Axis 1 Classification		Number of pairs
Concordant classification between raters (n=30)
Dystonic tremors1		21
Essential tremor plus		4
Task and position specific tremor		2
Holmes tremor		2
Focal tremor		1
Discordant classification between raters (n=19)
Dystonic tremors1	Essential tremor plus	6
	Task and position specific tremor	3
	Essential tremor	2
	Intention tremor	1
	Focal tremor	1
Essential tremor plus	Task and position specific tremor	3
	Essential tremor	2
Task and position specific tremor	Isolated segmental action tremor	1

Table 1: Axis 1 classifications of patients with concordant and discordant classifications by the two raters. ¹Dystonic tremors include both dystonic tremor and tremor associated with dystonia.