Abstract
7α‐Hydroxysteroid dehydrogenase (7α‐HSDH) is an NAD(P)H‐dependent oxidoreductase belonging to the short‐chain dehydrogenases/reductases. In vitro, 7α‐HSDH is involved in the efficient biotransformation of taurochenodeoxycholic acid (TCDCA) to tauroursodeoxycholic acid (TUDCA). In this study, a gene encoding novel 7α‐HSDH (named as St‐2‐1) from fecal samples of black bear was cloned and heterologously expressed in Escherichia coli. The protein has subunits of 28.3 kDa and a native size of 56.6 kDa, which suggested a homodimer. We studied the relevant properties of the enzyme, including the optimum pH, optimum temperature, thermal stability, activators, and inhibitors. Interestingly, the data showed that St‐2‐1 differs from the 7α‐HSDHs reported in the literature, as it functions under acidic conditions. The enzyme displayed its optimal activity at pH 5.5 (TCDCA). The acidophilic nature of 7α‐HSDH expands its application environment and the natural enzyme bank of HSDHs, providing a promising candidate enzyme for the biosynthesis of TUDCA or other related chemical entities.
Keywords: acidophilic, 7α‐hydroxysteroid dehydrogenase, short‐chain dehydrogenases/reductases, bile acids
Introduction
Ursodeoxycholic acid (UDCA) is an endogenous bile acid with a variety of drug applications due to its beneficial effects on primary biliary cirrhosis, drug‐induced hepatitis, and other diseases.1, 2, 3 UDCA combines with taurine to form tauroursodeoxycholic acid (TUDCA), which is beneficial for treating hepatobiliary diseases, Alzheimer's disease, and Parkinson's disease,4 and it appears to be a promising therapeutic agent for inflammatory bowel disease.5 In the past, TUDCA preparations have always been considered from the perspective of chemical synthesis;6, 7, 8 however, the production of TUDCA is limited due to the complex reaction process and poor selectivity.9 Compared to chemical synthesis, the biosynthesis of TUDCA from taurochenodeoxycholic acid (TCDCA) is mild and environmentally friendly. TCDCA is converted to TUDCA in vivo in several steps via intestinal microorganisms.10, 11 In vitro, however, TUDCA can be directly biosynthesized from TCDCA by 7α‐ and 7β‐HSDH in two steps.12 Therefore, 7α‐HSDHs play a key role in the biosynthesis of TUDCA. In addition, a series of aromatic or bulky aliphatic α‐ketoesters13 and benzaldehyde analogues14 undergo biotransformation by asymmetric reduction of 7α‐HSDHs.
To the best of our knowledge, five genes encoding 7α‐HSDHs have been cloned and functionally verified from Clostridium absonum PDB code: 5PEO (Clo.sa‐a, Genebank No. AET80685),15 Clostridium sordellii (Clo.so‐a, Genebank No. AAA53556),16 Clostridium scindens (Clo.sc‐a, Genebank No. AAB61151),17 Bacteroides fragilis (Bac‐fr‐a, Genebank No. AAD49430),18 and Escherichia coli (Esc.co‐a, Genebank No. P0AET8).19 Previously, we cloned five 7α‐HSDHs (S1‐a‐1, S1‐a‐2, H1‐a‐1, H1‐a‐2, and Y1‐a‐1) and one 7β‐HSDH from the genomes of gut microbiota via a metagenomic approach.20 According to the literature, 7α‐HSDHs have been reported to have their optimal enzyme activity in the pH range of 7.5–11.15, 18, 19 Nevertheless, because some biocatalysts perform under acidic conditions during biosynthesis, the biotransformation environment of the basophilic 7α‐HSDHs has been reported in the literature to have limitations. Interestingly, we cloned a new 7α‐HSDH (St‐2‐1, Genebank No. MH743112), which is relatively stable in the pH range 4.5–6, and when using TCDCA as the substrate, its optimum pH was 5.5. Thus, St‐2‐1 is the first acidophilic 7α‐HSDH reported in the literature. The discovery of this acidophilic enzyme expands the biotransformation environment of 7α‐HSDHs and is of great significance for extending the scope of application of 7α‐HSDHs.
Results and Discussion
Purification and physical properties of enzyme
After searching the database for predicted open reading frames using known 7α‐HSDHs as a template, we successfully cloned and purified a full‐length 7α‐HSDH encoding gene (named St‐2‐1 gene) from a sample of Sichuan bear stool. The St‐2‐1 gene contains 789 bp for a novel protein of 262 amino acids [Fig. 1(a,b)].
Figure 1.
(a) PCR amplification of the full length of gene St‐2‐1. (b) Verification of recombinant plasmid pGEX‐6p‐St‐2‐1. (c) SDS‐PAGE analysis of the purified enzymes St‐2‐1, before and after PreScission protease cutting.
The novel 7α‐HSDH gene found above was expressed as a glutathione S‐transferase (GST) fusion recombinant protein, and PreScission Protease was used to excise the GST tag from the recombinant protein. The quality of the purified enzyme was verified by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS‐PAGE). Gel filtration was carried out with an AKTA prime plus protein purifier system to determine the molecular mass of St‐2‐1.18, 21 The SDS‐PAGE [Fig. 1(c)] and gel filtration analyses [Fig. 2(a)] indicate a subunit size of 28.3 kDa and a native size of 56.6 kDa. Mass spectrometry detected the substance separated by gel chromatography [Fig. 2(b)], and the molecular weight was found to be consistent with the molecular weight obtained by gel chromatography. Thus, St‐2‐1 was concluded to be a homodimer in the solution. Many members of the SDR group are in the form of dimers or tetramers in solution,22 as, for example, RDH13 (SDR7C3) which exists as a dimer.23
Figure 2.
(a) Standard protein and St‐2‐1 7α‐HSDH elution curve; standard protein standard curve (b) MS analysis.
Sequence alignment and phylogenetic analysis
The amino acid sequences of the 7α‐HSDHs (S1‐a‐1, S1‐a‐2, H1‐a‐1, H1‐a‐2, Y1‐a‐1) were derived from our previous studies.20 In addition, the amino acid sequences of the 7α‐HSDHs from C. sardiniense (Clo.sa‐a, Genebank No. AET80685),14 C. sordellii (Clo.so‐a, Genebank No. AAA53556),15 C. scindens (Clo.sc‐a, Genebank No. AAB61151),16 B. fragilis (Bac‐fr‐a, Genebank No. AAD49430),17 and E. coli (Esc.co‐a, Genebank No. P0AET8)18 were used for alignment with the discovered St‐2‐1. Figure 3(a) shows the alignment of the present 7α‐HSDH (St‐2‐1) with 10 reported 7α‐HSDHs, revealing a high percentage identity (62.97%) of these 7α‐HSDHs. In particular, St‐2‐1 has a higher percentage homology with H1‐a‐1 and H1‐a‐2 (69.8%, 68.3%). The amino acid sequence similarities of the 7α‐HSDHs also suggest that St‐2‐1 belongs to the short‐chain dehydrogenase/reductase (SDR) family, with a sequence alignment that clearly shows conserved domains in the SDR primary structure, including the NADP+/NADPH cofactor‐binding motif (around position Gly‐17, Ile‐18, and Gly‐19 in 7α‐HSDH). Active site residues Ser‐145, Lys‐162, and Tyr‐158 are also present.12
Figure 3.
(a) Amino acid sequence alignment of 7α‐HSDH(St‐2‐1) from this study with other selected 7α‐HSDHs. (b) Phylogenetic tree based on alignment of 7α‐HSDH protein sequences.
The evolutionary tree, based on the alignment, is represented in Figure 3(b). According to the phylogenetic analysis, St‐2‐1 has the closest genetic relationship with proteins H1‐a‐1 and H1‐a‐2 and has a relatively low homology with Esc.co‐a and Bac‐fr‐a from our previous work.20 Based on these results, St‐2‐1 could be classified as a typical member of the SDR superfamily.
Substrate dependence of 7α‐HSDH activity and kinetic analysis
Glycochenodeoxycholic acid (GCDCA), taurochenodeoxycholic acid (TCDCA), sodium taurocholate hydrate (TCA), and sodium glycocholate hydrate (GCA) were evaluated as substrates with NADP+ as the coenzyme. Absorbance values were recorded for 30 seconds (Fig. 4). The catalytic activity of St‐2‐1 on CDCA including TCDCA and GCDCA was higher than on CA including GCA and TCA. Ji et al.24 proposed the bioconversion of TCDCA to TUDCA using a double enzyme coupling method. Therefore, St‐2‐1 is of great significance for the synthesis of TUDCA.
Figure 4.
Catalytic activity of 7α‐HSDH (St‐2‐1) on substrates.
The kinetic parameters for St‐2‐1 in the presence of NADP+ were measured, and the estimated apparent Michaelis constant (K m) and turnover frequency (k cat) are shown in Table 1. In general, when comparing the results of St‐2‐1 to the other 7α‐HSDHs in our previous work,20 St‐2‐1 has a relatively higher V max and better catalytic efficiencies than H1‐a‐2.
Table 1.
The kinetic parameters of the purified St‐2‐1
| Enzyme | Substrate | Km (mM) | Vmax (U/mg) | Kcat (S−1) | Kcat/Km |
|---|---|---|---|---|---|
| St‐2‐1 | TCDCA | 0.578 | 35.312 | 9.263 | 16.023 |
| H1‐a‐2 | TCDCA | 0.695 | 32.627 | 2.280 | 3.280 |
Effect of pH on 7α‐HSDH activity
Selecting TCDCA as the substrate and NADP+ as the coenzyme, we determined the initial reaction rates of the enzymatic reaction under different pH conditions. The optimal pH value of St‐2‐1 was selected, and intervals of 0.5 pH units were used for the tests [Fig. 5(a)]. Under the above conditions, pH 5.5 was found to be the optimum value. Yoshimoto et al.19 evaluated the optimum pH of 7α‐hydroxysteroid dehydrogenase (Esc.co‐a) from E. coli HB101 and found that the enzyme was most active at pH 8.5 and stable at pH 8 to 9. Bennett et al.18 assessed the activity of 7α‐HSDH (Bac. fr‐a) from B. fragilis in the pH range from 5.5 to 10.5. Bac.fr‐a was found to have the highest enzymatic activity at pH between pH 7.5 and 8.0 in the oxidation reaction. Moreover, Ferrandi et al.15 evaluated Ca 7α‐HSDH (Clo.sa‐a) activity from C. absonum in the pH range between 6.0 and 9.5 and found that its highest activity was between pH 7.5 and 8.0 in the bile acid oxidation reaction. We also measured the optimal pH values for the five 7α‐HSDHs published in the previous work20 under the same conditions (Coenzyme: 50 mM NADP+; Substrate: 50 mM TCDCA; pH range: 4.5–12), which were S1‐a‐1 (pH 9.0)，S1‐a‐2 (pH 7.5)，H1‐a‐1 (pH 8.5), H1‐a‐2 (pH 8.5), and Y1‐a‐1 (pH 7.5), respectively (Supporting Information Fig. S1). The 7α‐HSDH St‐2‐1 exhibited its highest enzymatic activity in acidic conditions (pH 5.5) in contrast to what was found for the eight 7α‐HSDHs. To date, St‐2‐1 is the only acidophilic member of the 7α‐HSDH enzyme family reported in the literature. The discovery of this acidophilic 7α‐HSDH expands the biotransformation environment of the 7α‐HSDHs and may extend the scope of application of the 7α‐HSDHs.
Figure 5.
(a) Optimum pH for activity of St‐2‐1 toward TCDCA; (b) secondary structure of St‐2‐1 at different pH values.
Effect of pH on the secondary structure of St‐2‐1
Changes in the secondary structure of St‐2‐1 proteins were determined at different pH values by circular dichroism spectroscopy. The results showed that the double negative peak at 208–222 nm reflected the α‐helix structure in the protein; and the negative peak at 217–218 nm was characteristic of the β‐sheet conformation [Fig. 5(b)]. The results were calculated using the CONTIN.EXE, SELCON.EXE, and CDSSTR.EXE programs of the CDpro software (Table 2). The comprehensive analysis of the data from the circular dichroism spectroscopy indicated that the α‐helix, β‐sheet, β‐turn, and random coil of St‐2‐1 fluctuated greatly under different pH buffer conditions.
Table 2.
Effect of pH on the content of secondary structure of St‐2‐1
| Enzyme | α‐helix (%) | β‐sheet (%) | β‐turn (%) | Random coil (%) |
|---|---|---|---|---|
| pH 3.5 (St‐2‐1) | 31.70 | 20.26 | 21.20 | 28.13 |
| pH 5.5 (St‐2‐1) | 30.76 | 23.23 | 22.13 | 25.07 |
| pH 6.0 (St‐2‐1) | 42.47 | 14.37 | 19.50 | 23.87 |
| pH 7.5 (St‐2‐1) | 55.50 | 17.20 | 14.60 | 12.26 |
The secondary structure of the protein has an effect on the flexibility of the protein.25, 26, 27 The results show that when St‐2‐1 is in an environment with an optimum pH of 5.5, the α‐helix, β‐sheet, β‐turn, and random coil comprise 30.76%, 23.23%, 22.13%, and 25.07% of the protein, respectively. From the composition of the secondary structure of St‐2‐1, we can see that its α‐helix, β‐sheet, β‐turn, and random coil have a relatively balanced distribution. The structural distribution can maintain the stability and flexibility of St‐2‐1, which can be beneficial for the combination of coenzyme, substrate, and enzyme, to promote the reaction. When St‐2‐1 in an environment with a higher pH, the distribution of the α‐helix, β‐sheet, β‐turn, and random coil can vary greatly. When St‐2‐1 is at pH 6.0, for example, the α‐helix content is increased to 42.5% and the β‐sheet content is decreased to 14.4%. Furthermore, when St‐2‐1 is at pH 7.5, the α‐helix content is increased to 55.5% and the β‐sheet is reduced to 17.2%. These changes increase the rigidity of the protein, which could lead to a reduced binding of the substrate or coenzyme to the protein. The reduced catalytic reaction of the enzyme and substrate could explain the absence of detectable enzyme activity.
Effect of temperature on enzyme activity
Changes in the initial speed of the enzymatic reaction were measured at different temperatures between 10°C and 80°C, at intervals of 5°C. The substrate and coenzyme were TCDCA and NADP+, respectively [Fig. 6(a)]. The activity of the enzyme increased slowly between 15°C and 30°C, and then rapidly between 30°C and 40°C. The enzyme exhibited optimal activity at 40°C. Thus, the enzyme is thermophilic.
Figure 6.
(a) Optimum temperature of activity of St‐2‐1 toward TCDCA; (b) heat endurance of St‐2‐1; (c) thermal denaturation curves of St‐2‐1.
St‐2‐1 thermal stability
The enzyme was kept in a condition at a constant temperature environment at 4°C, 25°C, or 37°C, and the initial speed of the enzymatic reaction was measured at regular intervals to determine its thermal stability [Fig. 6(b)]. When St‐2‐1 was in an environment at 4°C for 71 hours, its activity was 50%. When St‐2‐1 was in an environment at 25°C for 71 hours, its activity was 9%. At 37°C, the enzyme activity rapidly decreased over time and after 65 hours, the enzyme activity was only 9% of the original activity. After 71 hours, the enzyme activity was completely lost.
Our results show that the thermal stability of St‐2‐1 was much greater than that of the five 7α‐HSDHs cloned earlier (Supporting Information Fig. S2).20 For example, Hl‐a‐1 is completely inactivated after treatment at 37°C for 40 hours, and Hl‐a‐2 has only 10% of its original activity after treatment at 37°C for 48 hours.20 With the same treatment, St‐2‐1 had residual activities of 29% and 20%, after 40 and 48 hours, respectively.
Melting temperature characterization
The Tm value reflects the temperature at which the protein conformation is destroyed by half under a condition with a specific light absorption value. For St‐2‐1, the Tm was found to be 56.6°C, indicating that it has a good thermal stability. The thermal denaturation curves of St‐2‐1 are shown in Figure 6(c).
Effect of several metal ions on the enzymatic reaction speed of 7α‐HSDH
Kucuk et al.28 proposed that enzymatic activities could be diminished or obliterated by adding some metal ions (i.e., heavy metal ions) that cause toxicological effects. In our experiments, the effects of Mg2+, K+, Na+, Cu2+, and Mn2+ were tested for their effect on the activity of 7α‐HSDH (Fig. 7). The results indicate that K+, Na+, and Mg2+ increase the enzyme activity at appropriate concentrations. In particular, 25.0 mM K+ had the strongest effect, increasing the enzyme activity by 64.4% (**p < 0.01). Nevertheless, when the K+ concentration reached 50 mM, the enzyme activity decreased, and when it reached 250 mM, the enzyme activity had decreased by 50.2% (**p < 0.01). In contrast, 1.0 mM Na+ increased the enzyme activity by 51.3% (**p < 0.01). When the Na+ concentration reached 5 mM, the enzyme activity decreased, and when it reached 250 mM, the enzyme activity decreased by 68.3% (**p < 0.01). In addition, 0.05 mM Mg2+ increased the enzyme activity by 63.4% (**p < 0.01) and when the Mg2+ concentration reached 0.25 mM, the enzyme activity decreased. When it reached 25 mM, the enzyme activity decreased by 92.5% (***p < 0.01). Moreover, both Cu2+ and Mn2+ showed significant inhibition of enzyme activity when their concentrations were 25.0 mM (***p < 0.01).
Figure 7.
(a) Influence of Cu2+ on St‐2‐1activity; (b) influence of Mn2+on St‐2‐1 activity; (c) influence of Mg2+ on St‐2‐1 activity; (d) influence of Na+ on St‐2‐1 activity; (e) influence of K+ on St‐2‐1 activity. (*p < 0.05, **p < 0.01, ***p < 0.01).
Conclusion
Molecular cloning of the gene encoding for 7α‐HSDH may help in understanding the gene composition and regulation of the metabolic pathways of bile salt–modified bacteria and the phylogenetic evolution of SDRs. From a practical point of view, the enzymes may be useful for the bioconversion of TCDCA to TUDCA.
In this study, a new full‐length gene was successfully cloned from the gut microbiome of black bears by high‐throughput metagenomic sequencing, and the metagenomic sequencing information was experimentally verified. Although short‐chain dehydrogenases show only 15%–30% residue identity, a conserved tertiary structure, highly conserved N‐terminal cofactor‐binding motifs Gly‐XXX‐Gly‐X‐Gly and the Thr‐XXX‐Lys motif short‐chain dehydrogenases indicate that they share a common origin and early evolution.29, 30 Sequence alignments showed that 7α‐HSDH belongs to the SDR superfamily. From the functional characterization, we found that St‐2‐1 is an acidophilic enzyme, which expands the biotransformation environment of the 7α‐HSDHs. The discovery of this enzyme may be beneficial in the development of 7α‐HSDH for acidic environments. At the same time, we also measured the structural changes of St‐2‐1 under different pH values. At pH 5.5, the α‐helix and β‐sheet distributions of St‐2‐1 are relatively balanced and the overall structure of St‐2‐1 is relatively stable and flexible. At pH 6.0 or 7.5, however, the α‐helix component increases significantly, whereas the β‐sheet becomes significantly reduced. The overall rigidity of St‐2‐1 increases and its flexibility decreases, which results in the inability of the catalytic reaction to proceed. In addition, our detailed functional characterization indicates that St‐2‐1 is relatively thermally stable, and St‐2‐1 has higher catalytic activity for CDCA than for CA. Thus, St‐2‐1 would be more favored for the biosynthesis of UDCA with a medicinal value. The discovery of St‐2‐1 expands the natural enzyme bank of the 7α‐HSDHs and may provide a new resource for the synthesis of TUDCA.
Materials and Methods
Ethics statement and sample collection
Before the experiments, all animal work was approved by the Institutional Animal Care and Use Committee of Chongqing University under permit number CBE‐A20140702. All experiments were performed in accordance with the approved guidelines and manufacturers' instructions, unless specifically stated. Fecal samples were collected from captive black bears (Conservation and Research Center for Bear Species in Sichuan Province) immediately after their natural defecation and immediately frozen by liquid nitrogen and sent to the laboratory.
Materials
The E.Z.N.A.® stool DNA kit and the plasmid mini kit (D6942‐01) were purchased from OMEGA (Guangzhou, China). E. coli DH5α, BL21(DE3) pLysS, PrimerSTAR max DNA polymerase (PrimeSTAR Max Premix 2×), T4 DNA ligase, and restriction enzymes were purchased from Takara Biotechnology. Isopropyl β‐D‐1‐thiogalactopyranoside, ampicillin, and the BCA protein assay kit were purchased from Beyotime (Shanghai, China). NADP‐Na2 and NADPH‐Na4 (purity ≥97%) were produced by Roche (Switzerland). All chemicals and solvents used in the present work were of analytical grade and from J&K. Double distilled water was used in all experiments.
Identification of the gene encoding 7α‐HSDH
Before the experiments, we had determined the black bear gut metagenome. The original metagenomic sequences are available at the NCBI Short Reads Archive, under accession number SRP079591.20
The nucleotide sequences of the 7α‐HSDHs, as reported in our previous study,20 were used as models to anchor the homologous proteins. A Localblast program analysis was performed to identify the 7α‐HSDH‐encoding gene (E‐value ≤1e‐5) and sequences with more than 50% identity were kept.
DNA isolation, amplification, and sequencing
Total genomic DNA was isolated from the stool samples using the E.Z.N.A.® stool DNA kit according to the manufacturer's instructions. The gene that encoded the 7α‐HSDH was discovered by the above process and amplified by the polymerase chain reaction (PCR) using the following primers: BamH1‐St‐2‐1‐F (5′‐CGC GGATCCATGGGTAAATTAGATGGTAAGGT‐3′) and Xho1‐St‐2‐1‐R (5′‐CCG CTCGAGTTATTTACTAACATCATCCCCATAC‐3′). The restriction endonuclease sites for BamHI and XhoI are underlined. The digested PCR product was purified and cloned into the pGEX‐6p‐2 vector and incubated overnight at 16°C in the presence of T4 DNA ligase. The resulting expression construct was then transformed into E. coli DH5α competent cells, and the recombinant plasmid was extracted and verified by sequencing. The sequence of the insert DNA was sequenced to confirm the insertion and the absence of any mutations.
Gene expression and protein purification
E. coli BL21 (DE3) was transformed with the expression construct. BL21 (DE3) containing the expression construct was grown in LB medium (1000 mL in a 2 L shake flask) containing 50 μg/mL ampicillin. When the OD600 was 0.8, target gene expression was induced by adding isovalery l‐β‐D‐1 thiogalactopyranoside at a final concentration of 0.2 mM and the incubation temperature was adjusted from 37°C to 16°C overnight. The cells were harvested by centrifugation at 8000g for 5 min at 4°C. The following operations were performed at 4°C. The pellet was resuspended in 0.01 M PBS (4°C cold storage), and the cells were broken up with a nano‐homogenizer machine (Model: FB‐110X; Shanghai). The cell lysate was centrifuged at 14000g for 20 min at 4°C. Recombination proteins were purified according to the manufacturer's instructions, and PreScission Protease was used to excise the GST tag from the recombinant proteins.
Protein purity was checked by SDS‐PAGE (performed with a 15% acrylamide gel), which was stained with Coomassie brilliant blue R‐250. The molecular weight, under denaturing conditions, was determined by comparison to standard markers. Protein concentration was determined using the BCA assay kit according to the manufacturer's instructions.
Sequence alignment and phylogenetic analysis
Multiple amino acid sequence alignments of St‐2‐1 with known proteins were performed using DNAMAN software. A phylogenetic tree of St‐2‐1 and the known 7α‐HSDHs was constructed using MEGA5 software.
Characterization of melting temperature
Melting temperature was estimated using CD (222 nm, far UVCD) by following the changes in the spectrum with increases in temperature from 20°C to 90°C. CDpal software was used to analyze the heat denaturation data to determine the stability of the protein. The two‐state model and the autofit program were used to determine the melting temperature (Tm) for the protein samples. Measurements were made for a minimum of three times.
Relative molecular mass determination
Gel filtration was performed on an AKTA prime plus protein purification system to determine the molecular weight of St‐2‐1. A column (2.0 × 90 cm) containing Sephacryl S‐200 (Pharmacia) equilibrated with 50 mM phosphate‐buffered saline (pH 7.5) and 200 mM NaCl. Standard protein (filtered by a 0.45 μm organic membrane) was injected into the injection valve and elution was carried out with the same buffer at a flow rate of 1 mL/min. The molecular weight markers (GE Healthcare, China agency) were beta‐amylase (200 kDa), alcohol dehydrogenase (150 kDa), albumin (66 kDa), carbonic anhydrase (29 kDa), and cytochrome c (12.4 kDa). The void volume was determined using Blue Dextran 2000. The eluate was collected into 5 mL tubes (2 mL/tube for a total of 50 tubes), and the absorbance of the standard proteins was determined at 280 nm. The elution profile was then plotted and the standard curve was fitted. The absorbance of the enzyme solution to be tested was measured in the same manner, and the molecular weight of the native enzyme was determined from the standard curve. The enzyme solution used for the absorbance detection was also subjected to matrix assisted laser desorption ionization‐time of flight mass spectrometry (MALDI‐TOF‐MS, matrix: SA).
Determination of enzymatic properties
Enzyme assays and kinetic characterization
One unit of enzyme activity is defined as the amount of enzyme that releases 1 μm of reducing NADP+ as NADPH per minute, under the assay conditions (U/mL/min). Enzyme activity was determined spectrophotometrically at 340 nm and at 25°C by measuring the reduction of NADP+. The standard assay mixture (2 mL) for determining 7α‐HSDH activity was 50 mM TCDCA, 50 mM disodium hydrogen phosphate–citrate buffer at pH 5.5, and 50 mM NADP+.
The kinetic constants for oxidization of TCDCA were determined at varying the concentrations in disodium hydrogen phosphate–citrate buffer at pH 5.5 and at 25°C. The kinetic parameters were calculated using the substrate inhibition equation: v = V max [S]/(K m + [S](1 + [S]/K s),31 where [S] is the substrate concentration. Each measurement was performed at least three times.
Influence of pH on enzyme activity
A 50 mM disodium hydrogen phosphate–citrate buffer (pH 3.5–5.5), with sodium phosphate buffer (pH 5.5–8.0), Tris–HCl (pH 8.0–9.0), and glycine‐NaOH (pH 9.0–12) was used to determine the optimum pH for St‐2‐1 activity. To 20 μL of NADP+ (50 mM), a certain concentration of the enzyme solution to be tested was added to a total of 1955 μL of the buffer. The mixture was then adjusted to zero absorbance at 340 nm at 25°C, and then 50 mM TCDCA was added. The absorbance values were recorded over the next 30 seconds. The enzyme solution to be tested was added to a 50 mM disodium hydrogen phosphate–citrate buffer (pH 5.5) and allowed to react at 15°C–70°C for 20 min. The optimum temperature of the enzyme was measured in the same manner as above. Purified enzyme samples were used, and all experiments were performed in triplicate.
Effect of pH on the secondary structure of St‐2‐1
Different buffers (50 mM) were configured using citric acid and sodium dihydrogen phosphate for a final pH of 3.5, 5.5, 6.0, and 7.5. Under 222 nm absorbance, enzyme solutions were mixed with the above buffers of different pH values to achieve an absorbance of 0.8–1 nm, and the final concentration of the enzyme was approximately 0.5 mg/mL. The secondary structure of the proteins under the different pH values was then determined by circular dichroism spectrometry (Chirascan, United Kingdom), and the secondary structure was calculated using CDpro (CONTIN/LL, SELCON3, CDSSTR).
Thermal stability
To determine the thermal stability of 7α‐HSDH (St‐2‐1) activities, the enzyme was incubated at 4°C, 25°C, or 37°C for various times, the longest being 71 hours (in 50 mM disodium hydrogen phosphate–citrate buffer, pH 5.5). The remaining enzymatic activity was measured under standard conditions.
Effect of metal ions on enzyme activity
Hydrochlorides, such as NaCl, KCl, MgCl2, MnCl2, and CuCl2, were dissolved in 50 mM disodium hydrogen phosphate–citrate buffer, pH 5.5, and configured to have a gradient of different metal ion concentrations. TCDCA was used as the substrate, NADP+ was the coenzyme, and the initial rate of enzymatic reaction was measured at room temperature (25°C). The activation or inhibition by metal ions was evaluated based on the initial activity of the enzyme without metal ions (considered as 100%).
Conflicts of Interest
The authors declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.
Author Contribution
Experiments were designed by Liancai Zhu, Bochu Wang, Jun Tan, Na Qi and performed by Shijin Tang, Yinping Pan, Deshuai Lou, Shunlin Ji, QiongYang, Zhi Zhang, Biling Yang, Wenyan Zhao. Manuscript was written by Shijin Tang and edited by Liancai Zhu and Bochu Wang.
Supporting information
Fig.S1 (A) Optimum pH of H1‐a‐1 toward TCDCA; (B) Optimum pH of H1‐a‐2 toward TCDCA; (C) Optimum pH of S1‐a‐1 toward TCDCA; (D) Optimum pH of S1‐a‐2 toward TCDCA; (F) Optimum pH of Y1‐a‐1 toward TCDCA.
Figure S2 (A) Heat endurance of S1‐a‐1;(B) Heat endurance of S1‐a‐2;(C) Heat endurance of H1‐a‐1; (D) Heat endurance of H1‐a‐2;(E) Heat endurance of Y1‐a‐1.
Acknowledgments
This work was supported by National Science and Technology Major Projects for “Major New Drugs Innovation and Development”(2017ZX09309006‐003), and Fundamental Research Funds for the Central Universities (2018CDPTCG0001/37), and the Fundamental Research Funds for the Central Universities of China (No. 106112017CDJXY230003).
Contributor Information
Liancai Zhu, Email: zhuliancai75@126.com.
Na Qi, Email: qina@cqu.edu.cn.
Bochu Wang, Email: wangbc2000@126.com.
References
- 1. Lindblad A, Glaumann H, Strandvik B (1998) A two‐year prospective study of the effect of ursodeoxycholic acid on urinary bile acid excretion and liver morphology in cystic fibrosis‐associated liver disease. Hepatology 27:166–174. [DOI] [PubMed] [Google Scholar]
- 2. Hosonuma K, Sato K, Yamazaki Y, Yanagisawa M, Hashizume H, Horiguchi N, Kakizaki S, Kusano M, Yamada M (2015) A prospective randomized controlled study of long‐term combination therapy using ursodeoxycholic acid and bezafibrate in patients with primary biliary cirrhosis and dyslipidemia. Am J Gastroenterol 110:423–431. [DOI] [PubMed] [Google Scholar]
- 3. Rautiainen H, Kärkkäinen P, Karvonen AL, Nurmi H, Pikkarainen P, Nuutinen H, Färkkilä M (2005) Budesonide combined with UDCA to improve liver histology in primary biliary cirrhosis: a three‐year randomized trial. Hepatology 41:747–752. [DOI] [PubMed] [Google Scholar]
- 4. Duan WM, Rodrigues CM, Zhao LR, Steer CJ, Low WC (2002) Tauroursodeoxycholic acid improves the survival and function of nigral transplants in a rat model of Parkinson's disease. Cell Transplant 11:195–205. [PubMed] [Google Scholar]
- 5. Bossche LVD, Borsboom D, Devriese S, Welden SV, Holvoet T, Devisscher L, Hindryckx P, Vos MD, Laukens D (2016) Tauroursodeoxycholic acid protects bile acid homeostasis under inflammatory conditions and dampens Crohn's disease‐like ileitis. Lab Invest 97:519. [DOI] [PubMed] [Google Scholar]
- 6. Lack L, Jr DF, Walker T, Singletary GD (1973) Synthesis of conjugated bile acids by means of a peptide coupling reagent. J Lipid Res 14:367. [PubMed] [Google Scholar]
- 7. Momose T, Tsubaki T, Iida T, Nambara T (1997) An improved synthesis of taurine‐ and glycine‐conjugated bile acids. Lipids 32:775–778. [DOI] [PubMed] [Google Scholar]
- 8. Samuelsson B, Bergman S, Bak TA, Varde E, Westin G (1960) Preparation of ursodeoxycholic acid and 3alpha,7beta,12alpha‐trihydroxycholanic acid. Bile acids and steroids 94. Acta Chem Scand 14:17–20. [Google Scholar]
- 9. Sutherland JD, Macdonald IA, Forrest TP (1982) The enzymic and chemical synthesis of ursodeoxycholic and chenodeoxycholic acid from cholic acid. Prep Biochem 12:307–321. [DOI] [PubMed] [Google Scholar]
- 10. Ridlon JM, Kang DJ, Hylemon PB, Bajaj JS (2014) Bile acids and the gut microbiome. Curr Opin Gastroenterol 30:332–338. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Russell DW (2009) Fifty years of advances in bile acid synthesis and metabolism. J Lipid Res 50:S120–S125. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Yang Q, Wang B, Zhang Z, Lou D, Tan J, Zhu L (2017) The effects of macromolecular crowding and surface charge on the properties of an immobilized enzyme: activity, thermal stability, catalytic efficiency and reusability. RSC Adv 7:38028–38036. [Google Scholar]
- 13. Liu Y, Lv T, Ren J, Wang M, Wu Q, Zhu D, Liu Y, Lv T, Ren J, Wang M (2011) The catalytic promiscuity of a microbial 7 alpha‐hydroxysteroid dehydrogenase. Reduction of non‐steroidal carbonyl compounds. Steroids 76:1136–1140. [DOI] [PubMed] [Google Scholar]
- 14. Zhu D, Stearns JE, Ramirez M, Hua L (2006) Enzymatic enantioselective reduction of α‐ketoesters by a thermostable 7α‐hydroxysteroid dehydrogenase from Bacteroides fragilis . Tetrahedron 37:4535–4539. [Google Scholar]
- 15. Ferrandi EE, Bertolesi GM, Polentini F, Negri A, Riva S, Monti D (2012) In search of sustainable chemical processes: cloning, recombinant expression, and functional characterization of the 7α‐ and 7β‐hydroxysteroid dehydrogenases from Clostridium absonum. Appl Microbiol Biotech 95:1221–1233. [DOI] [PubMed] [Google Scholar]
- 16. Coleman JP, Hudson LL, Adams MJ (1994) Characterization and regulation of the NADP‐linked 7 alpha‐hydroxysteroid dehydrogenase gene from Clostridium sordellii. J Bacteriol 176:4865–4874. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Mallonee DH, White WB, Hylemon PB (1990) Cloning and sequencing of a bile acid‐inducible operon from Eubacterium sp. strain VPI 12708. J Bacteriol 172:7011–7019. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Bennett MJ, Mcknight SL, Coleman JP (2003) Cloning and characterization of the NAD‐dependent 7alpha‐Hydroxysteroid dehydrogenase from Bacteroides fragilis . Curr Microbiol 47:475–484. [DOI] [PubMed] [Google Scholar]
- 19. Yoshimoto T, Higashi H, Kanatani A, Lin XS, Nagai H, Oyama H, Kurazono K, Tsuru D (1991) Cloning and sequencing of the 7 alpha‐hydroxysteroid dehydrogenase gene from Escherichia coli HB101 and characterization of the expressed enzyme. J Bacteriol 173:2173–2179. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Song C, Wang B, Tan J, Zhu L, Lou D (2017) Discovery of tauroursodeoxycholic acid biotransformation enzymes from the gut microbiome of black bears using metagenomics. Sci Rep 7:45495. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Liu L, Schmid RD (2011) Identification, cloning, heterologous expression, and characterization of a NADPH‐dependent 7β‐hydroxysteroid dehydrogenase from Collinsella aerofaciens. Appl Microbiol Biotech 90:127–135. [DOI] [PubMed] [Google Scholar]
- 22. Persson B, Krook M, Jörnvall H. Short‐chain dehydrogenases/reductases. Springer US, 1995. [Google Scholar]
- 23. Kedishvili NY (2013) Enzymology of retinoic acid biosynthesis and degradation. J Lipid Res 54:1744–1760. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Ji Q, Tan J, Zhu L, Lou D, Wang B (2016) Preparing tauroursodeoxycholic acid (TUDCA) using a double‐enzyme‐coupled system. Biochem Eng J 105:1–9. [Google Scholar]
- 25. Martínez D, Cutiño‐Avila B, Pérez ER, Menéndez C, Hernández L, Monte‐Martínez AD (2014) A thermostable exo‐β‐fructosidase immobilised through rational design. Food Chem 145:826–831. [DOI] [PubMed] [Google Scholar]
- 26. Oppermann UCT, Persson B, Filling C, Jörnvall H (1997) Structure‐function relationships of SDR hydroxysteroid dehydrogenases. Adv Exp Med Biol 414:403–415. [DOI] [PubMed] [Google Scholar]
- 27. Teilum K, Olsen JG, Kragelund BB (2011) Protein stability, flexibility and function. Biochim Biophys Acta 1814:969–976. [DOI] [PubMed] [Google Scholar]
- 28. Kucuk M, Gulcin İ (2016) Purification and characterization of the carbonic anhydrase enzyme from Black Sea trout ( Salmo trutta Labrax Coruhensis) kidney and inhibition effects of some metal ions on enzyme activity. Environ Toxicol Pharmacol 44:134–139. [DOI] [PubMed] [Google Scholar]
- 29. Filling C, Berndt KD, Benach J, Knapp S, Prozorovski T, Nordling E, Ladenstein R, Jörnvall H, Oppermann U (2002) Critical residues for structure and catalysis in short‐chain dehydrogenases/reductases. J Biol Chem 277:25677–25684. [DOI] [PubMed] [Google Scholar]
- 30. Persson B, Kallberg Y, Oppermann U, Jörnvall H (2003) Coenzyme‐based functional assignments of short‐chain dehydrogenases/reductases (SDRs). Chem Biol Interact 143:271–278. [DOI] [PubMed] [Google Scholar]
- 31. Kennedy JF, Norris TA (1997) Fundamentals of enzyme kinetics (revised edition). Carbohydr Polym 34:409–409. [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Fig.S1 (A) Optimum pH of H1‐a‐1 toward TCDCA; (B) Optimum pH of H1‐a‐2 toward TCDCA; (C) Optimum pH of S1‐a‐1 toward TCDCA; (D) Optimum pH of S1‐a‐2 toward TCDCA; (F) Optimum pH of Y1‐a‐1 toward TCDCA.
Figure S2 (A) Heat endurance of S1‐a‐1;(B) Heat endurance of S1‐a‐2;(C) Heat endurance of H1‐a‐1; (D) Heat endurance of H1‐a‐2;(E) Heat endurance of Y1‐a‐1.