Skip to main content
The Journal of International Medical Research logoLink to The Journal of International Medical Research
. 2019 Feb 25;47(4):1696–1704. doi: 10.1177/0300060519828450

Association of ENAM, TUFT1, MMP13, IL1B, IL10 and IL1RN gene polymorphism and dental caries susceptibility in Chinese children

Xiao-Pan Hu 1, Tian-Zhu Song 1, Yan-Yan Zhu 1, Ling-Li Wu 1, Xuan Zhang 1, Jian-Ye Zhou 2, Zhi-Qiang Li 1,3,✉
PMCID: PMC6460591  PMID: 30803280

Short abstract

Objective

To investigate the association between single nucleotide polymorphisms (SNPs) in six candidate genes (enamelin [ENAM]; tuftelin 1 [TUFT1]; matrix metallopeptidase 13 [MMP13]; interleukin 1 beta [IL1B]; interleukin 10 [IL10]; interleukin 1 receptor antagonist [IL1RN]) and dental caries in children from northwest China.

Methods

This case–control study enrolled children (12–15 years) who underwent routine dental examinations. The children were divided into two groups based on the presence of dental caries. A saliva sample was collected and seven SNPs (rs3806804A/G in ENAM, rs3811411T/G in TUFT1, rs2252070A/G and rs597315A/T in MMP13, rs1143627C/T in IL1B, rs1800872A/C in IL10 and rs956730G/A in IL1RN) were genotyped.

Results

A total of 357 children were enrolled in the study: 161 with dental caries and 196 without dental caries. No significant difference was found in the alleles and genotypes of five genes (ENAM, TUFT1, MMP13, IL10 and IL1RN) between those with and without dental caries. A significant relationship was found between the IL1B rs1143627C/T polymorphism and dental caries susceptibility with those carrying the rs1143627CT genotype having a lower risk of dental caries compared with those carrying the CC genotype (odds ratio 0.557; 95% confidence interval 0.326, 0.952).

Conclusion

The IL1B rs1143627C/T polymorphism may be associated with dental caries susceptibility in children from northwest China.

Keywords: Dental caries, single nucleotide polymorphisms (SNPs), ENAM, TUFT1, MMP13, IL1B, IL10, IL1RN

Introduction

Dental caries is a multifactorial infectious disease, which is highly prevalent throughout the world, affecting 60–90% of school-aged children.1 If it does not get treated in a timely manner, the disease continues to develop and results in many negative clinical consequences, such as decayed crowns, ulceration in tissues due to tooth fragments from decayed crowns, pulpal involvement, periapical periodontitis and inflammation of the alveolar bone.2 Dental caries can lead to discomfort, pain and poor quality of life, which seriously affects people’s health.1 Although increasing numbers of prevention and treatment strategies have been applied in childhood dentistry, dental caries remains one of most common childhood diseases.3,4

People that like sugary food and drinks, and those with poor oral hygiene, are regularly seen in our clinical practice, but dental caries is not necessarily evident in their oral cavities. Conversely, some people who seldom consume sugary food and beverages, and have good oral hygiene, still experience tooth decay. In addition, we have also observed that if parents experienced dental caries more often, then their children were more likely to experience dental caries. These observations suggest that genetic factors may play an important role in the occurrence of dental caries.5,6

Along with the considerable progress in molecular biology and the in-depth research in genomics, evidence from the published literature demonstrated that dental caries was closely associated with genetic polymorphisms.6–11 However, some results were inconsistent, especially in people from different geographical locations and ethnic minorities.12–14 Therefore, the aim of this current study was to analyse seven single nucleotide polymorphisms (SNPs; rs3806804A/G, rs3811411T/G, rs2252070A/G, rs597315A/T, rs1143627C/T, rs1800872A/C and rs956730G/A) in six candidate genes (enamelin [ENAM]; tuftelin 1 [TUFT1]; matrix metallopeptidase 13 [MMP13]; interleukin 1 beta [IL1B]; interleukin 10 [IL10]; interleukin 1 receptor antagonist [IL1RN]) and to evaluate their association with the susceptibility for dental caries in children from the northwest part of China.

Patients and methods

Study population

This case–control study sequentially recruited children from Dibu county, Gannan Tibetan autonomous prefecture, Gansu Province, which is located in the northwest of China. The children were permanent residents in this district and aged 12–15 years. All of the children were recruited during a general health examination at the Key Laboratory of Oral Diseases of Gansu Province, Lanzhou, Gansu Province, China between June 2016 and August 2016. The dental check was performed by two examiners (X.P.H. and T.Z.S.) who had been trained by an experienced dentist (Z.Q.L.). The Kappa value between the two examiners reached 0.8. The dental caries examination followed the World Health Organization criteria.15 Exclusion criteria included the following: (i) any systemic disease; (ii) any other dental diseases such as periodontitis, recurrent oral ulcer and oral genetic disorders. The children had a similar socioeconomic background and oral hygiene status. The children were divided into two groups based on the Decayed, Missing, and Filled Teeth (DMFT) index:11 the case group had a DMFT ≥1; and the control group had a DMFT = 0.

Ethical approval was obtained by the Ethics Committee of the Northwest Minzu University, Lanzhou, Gansu Province, China (no. XBMU-YX-2019001) and written informed consent was provided by all of the children and their parents/carers/legal guardians.

DNA preparation and SNP genotyping

All of children were asked not to eat and not to brush their teeth in the morning of their oral examination. Non-irritating saliva (2 ml) was collected from each child and added to saliva protection fluid (Olegene saliva DNA collector; Guangzhou Deep Blue Gene Technology, Guangzhou, China). The saliva samples were stored at –20°C until processing. Genomic DNA was extracted from each saliva sample using a Genomic DNA Isolation Kit (BioMiao Biological Technology, Beijing, China) according to the manufacturer’s instructions. All of the seven SNPs in the six candidate genes were genotyped using iPLEX MassARRAY® system (Agena Bioscience, San Diego, CA, USA), which was similar to that used in previous research.16 The main steps included: (i) polymerase chain reaction (PCR): PCR volume in the MassARRAY® system contained 0.625 μl of 15 × PCR buffer, 0.325 μl of 25 mM MgCl2, 0.1 μl of 25 mM dNTP Mix, 1 μl of 500 nM primer Mix, 0.1 μl of 5 U/μl Hot Star Taq enzyme, 1 μl of 20 ng/μl DNA template and 1.85 μl of water; (ii) Shrimp alkali enzyme purification (SAP) reaction: The volume contained 0.17 μl of 10 × SAP buffer, 0.3 μl of 1 U/μl SAP enzyme and 1.53 μl of water; (iii) single-base extension reaction included 0.2 μl of iPLEX BufferPlus, 0.2 μl of iPLEX Termination Mix, 0.94 μl of iPLEX Extend Primer Mix, 0.041 μl of iPLEX Enzyme, 0.619 μl of water and 7 μl of PCR + SAP product; and (iv) resin purification: 30 samples were randomly selected for duplicate detection to verify the genotyping results. The PCR primers were designed using AssayDesigner3.1 software (Agena Bioscience) and then synthesized by BioMiao Biotechnology Company. The primer sequences are shown in Table 1.

Table 1.

Polymerase chain reaction primer sequences for seven single nucleotide polymorphisms (SNPs) in six candidate genes (enamelin [ENAM]; tuftelin 1 [TUFT1]; matrix metallopeptidase 13 [MMP13]; interleukin 1 beta [IL1B]; interleukin 10 [IL10]; interleukin 1 receptor antagonist [IL1RN]) that were genotyped using a MassARRAY® system.

SNP Tm, °C Amplicon length, bp Primer sequence
rs3806804A/G in ENAM 48.5 109 F:5ʹ- ACGTTGGATGTTTGCCATTGTACCCAACTC -3′
R:5′- ACGTTGGATGGCTAGCAGGACATAGTGTTC -3′
rs3811411T/G in TUFT1 49 88 F:5′- ACGTTGGATGTCTGTTCTAAAGGGCCTCTG -3′
R:5′- ACGTTGGATGACTGTACAGCTTAGGAGCCG -3′
rs2252070A/G in MMP13 47 101 F:5′- ACGTTGGATGTATAGGCCTGCAATGGTGAG -3′
R:5′- ACGTTGGATGGCCACGTAAGCATGTTTACC -3′
rs597315A/T in MMP13 52 101 F:5′- ACGTTGGATGTACCCATTTCGTACTCACCC -3′
R:5′- ACGTTGGATGAAAATGCTGCTCAGGTCAGG -3′
rs1143627C/T in IL1B 49.8 101 F:5′- ACGTTGGATGCCTCGAAGAGGTTTGGTATC -3′
R:5′- ACGTTGGATGATTTCTCAGCCTCCTACTTC -3′
rs1800872A/C in IL10 45.6 115 F:5′- ACGTTGGATGTCCTCAAAGTTCCCAAGCAG -3′
R:5′- ACGTTGGATGAAAGGAGCCTGGAACACATC -3′
rs956730G/A in IL1RN 48.2 92 F:5′- ACGTTGGATGCAGGCTCTTGTTCTCGTAAC -3′
R:5′- ACGTTGGATGGGCTCAGGTTACCTCAATTC -3′

Tm, melting temperature; bp, base pairs; F, forward; R, reverse.

Statistical analyses

All statistical analyses were performed using the SPSS® statistical package, version 17.0 (SPSS Inc., Chicago, IL, USA) for Windows®. The data were entered and validated by double entry. The Hardy–Weinberg equilibrium for the seven SNPs in the six candidate genes was assessed using χ2-test. The differences in allele and genotype frequencies between the two groups were tested using χ2-test. An unconditional logistic regression analysis was used to test each gene polymorphism, in which the potential risk factors were adjusted. A P-value < 0.05 was considered statistically significant.

Results

A total of 357 children (178 males and 179 females) were enrolled in the study. The children were divided into two groups based on the DMFT index score (Table 2). The caries-affected group (DMFT ≥1, case group) included 161 children (84 males and 77 females), while the caries-free group (DMFT = 0, control group) had 196 children (94 males and 102 females). There was no statistical difference in age and sex distribution between the two groups.

Table 2.

Demographic characteristics of the study population of children (n = 357) who were enrolled in this case–control study to examine the role of single nucleotide polymorphisms on the susceptibility to dental caries.

Characteristics Case groupDMFT ≥1n = 161 Control groupDMFT = 0n = 196
Age range, years 12–15 12–15
Age, years 13.8 14.1
Sex
 Male 84 (52.2) 94 (48.0)
 Female 77 (47.8) 102 (52.0)
 DMFT score 3.46 ± 2.1 0.0 ± 0.0

Data presented as mean ± SD or n of subjects (%).

DMFT, Decayed, Missing, and Filled Teeth.

A total of seven different SNPs in six candidate genes were analysed. The characteristics of the distribution of the seven SNPs are shown in Table 3. The Hardy–Weinberg equilibrium for the allele frequencies in the control group are also presented in Table 3.

Table 3.

Characteristics of distribution of the seven single nucleotide polymorphisms (SNPs) in six candidate genes (enamelin [ENAM]; tuftelin 1 [TUFT1]; matrix metallopeptidase 13 [MMP13]; interleukin 1 beta [IL1B]; interleukin 10 [IL10]; interleukin 1 receptor antagonist [IL1RN]) and the Hardy–Weinberg equilibrium (HWE) for the allele frequencies in the control group.

Gene Type of alteration SNP Major/minor allelea MAF in the study population P-value for HWE in the control group
ENAM Upstream rs3806804 A/G 0.3927 NS
TUFT1 Downstream rs3811411 T/G 0.4928 NS
MMP13 Upstream rs2252070 A/G 0.4971 P = 0.001
MMP13 Upstream rs597315 A/T 0.4167 NS
IL1B Upstream rs1143627 C/T 0.4316 NS
IL10 Upstream rs1800872 A/C 0.416 NS
IL1RN Intron rs956730 G/A 0.2977 NS

aMajor allele was the wild-type allele and the minor allele was the mutant-type allele.

MAF, minor allele frequency; NS, not statistically significant (P ≥ 0.05).

The differences in allele frequencies and genotype frequencies between groups were analysed to evaluate the effects of the seven SNPs on the susceptibility for dental caries and the results are presented in Table 4. Individuals with the rs1143627CT genotype in the IL1B gene were less likely to have dental caries compared with those subjects with the CC genotype (odds ratio [OR] 0.557; 95% confidence interval [95% CI] 0.326, 0.952; P = 0.032). However, an association was not found between the susceptibility for dental caries and any of the other six SNPs (rs3806804, rs3811411, rs2252070, rs597315, rs1800872 and rs956730).

Table 4.

Distribution of allele and genotype frequencies in the seven single nucleotide polymorphisms (SNPs) in six candidate genes (enamelin [ENAM]; tuftelin 1 [TUFT1]; matrix metallopeptidase 13 [MMP13]; interleukin 1 beta [IL1B]; interleukin 10 [IL10]; interleukin 1 receptor antagonist [IL1RN]) and unconditional logistic regression analysis.

Gene SNP Genotypes and allelesa Case groupDMFT ≥ 1n = 161b Control groupDMFT = 0n = 196b Statistical significance Odds ratio (95% confidence interval)c
ENAM rs3806804 (A/G) AA (reference) 56 (40.6) 56 (33.9)
AG 63 (45.7) 81 (49.1) NS 0.778 (0.474, 1.277)
GG 19 (13.8) 28 (17.0) NS 0.679 (0.340, 1.353)
AG+GG 82 (59.4) 109 (66.1) NS 0.752 (0.471, 1.202)
A 175 (63.4) 193 (58.5)
G 101 (36.6) 137 (41.5) NS 0.813 (0.585, 1.129)
TUFT1 rs3811411 (T/G) TT (reference) 35 (23.0) 41 (21.0)
TG 89 (58.6) 111 (56.9) NS 0.939 (0.553, 1.596)
GG 28 (18.4) 43 (22.1) NS 0.763 (0.396, 1.470)
TG+GG 117 (77.0) 154 (79.0) NS 0.890 (0.534, 1.484)
T 159 (52.3) 193 (49.5)
G 145 (47.7) 197 (50.5) NS 0.893 (0.662, 1.206)
MMP13 rs2252070 (A/G) AA (reference) 38 (24.4) 32 (16.6)
AG 92 (59.0) 119 (61.7) NS 0.651 (0.378, 1.121)
GG 26 (16.7) 42 (21.8) NS 0.521 (0.265, 1.027)
AG+GG 118 (75.6) 161 (83.4) NS 0.617 (0.364, 1.045)
A 168 (53.8) 183 (47.4)
G 144 (46.2) 203 (52.6) NS 0.773 (0.573, 1.042)
MMP13 rs597315 (A/T) AA (reference) 58 (37.7) 78 (40.0)
AT 79 (51.3) 99 (50.8) NS 1.073 (0.684, 1.684)
TT 17 (11.0) 18 (9.2) NS 1.270 (0.603, 2.675)
AT+TT 96 (62.3) 117 (60.0) NS 1.103 (0.715, 1.703)
A 195 (63.3) 255 (65.4)
T 113 (36.7) 135 (34.6) NS 1.095 (0.801, 1.495)
IL1B rs1143627 (C/T) CC (reference) 44 (34.6) 42 (26.6)
CT 56 (44.1) 96 (60.8) P = 0.032 0.557 (0.326, 0.952)
TT 27 (21.3) 20 (12.7) NS 1.289 (0.630, 2.638)
CT+TT 83 (65.4) 116 (73.4) NS 0.683 (0.411, 1.135)
C 144 (59.0) 180 (57.0)
T 110 (41.0) 136 (43.0) NS 1.011 (0.724, 1.411)
IL10 rs1800872 (A/C) AA (reference) 54 (33.5) 61 (31.1)
AC 81 (50.3) 106 (54.1) NS 0.863 (0.541, 1.377)
CC 26 (16.2) 29 (14.8) NS 1.013 (0.532, 1.928)
AC+CC 107 (66.5) 135 (68.9) NS 0.895 (0.573, 1.398)
A 189 (58.7) 228 (58.2)
C 133 (41.3) 164 (41.8) NS 0.978 (0.725, 1.319)
IL1RN rs956730 (G/A) GG (reference) 74 (48.4) 90 (46.6)
GA 70 (45.8) 88 (45.6) NS 0.967 (0.623, 1.501)
AA 9 (5.9) 15 (7.8) NS 0.730 (0.302, 10762)
GA+AA 79 (51.6) 103 (53.4) NS 0.933 (0.610, 1.427)
G 218 (71.2) 268 (69.4)
A 88 (28.8) 118 (30.6) NS 0.917 (0.660, 1.274)

Data presented as n of subjects or alleles (%).

aWild-type homozygote genotypes or alleles were used as references.

bTotal sample sizes for each SNP are different because the genotypes of some SNPs were unreadable.

cAdjusted for sex and age.

NS, not statistically significant (P ≥ 0.05).

Discussion

The development of dental caries is known to result from interactions between the presence of oral bacteria, host characteristics, dietary choices and length of exposure time.17 The host’s genetic makeup appears to play an important role the development of dental caries.5 In order to minimize the impact of dietary, environmental and other factors, permanent residents from an autonomous county in Gansu Province were chosen for this current study. The geographical area in which they live is small and population mobility is limited, which should have reduced sample heterogeneity. To avoid trauma and reduce the chances of being infected, a non-irritating saliva sample, rather than a blood sample, was chosen for DNA analysis in the present study, although blood samples would have been easier to test than saliva samples.

Enamel is a hard, highly mineralized substance, covering the crown that acts as a barrier to protect the tooth.18 The formation of enamel is controlled by genetic factors.18 The susceptibility for dental caries could also be influenced by genetic inheritance.19 For example, TUFT1 genotypes appear to interact with the levels of Streptococcus mutans in children.20 Some previous studies showed that genetic polymorphisms of the amelogenin (rs5933871, rs5934997 and rs17878486), ENAM (rs12640848 and rs7671281) and TUFT1 (rs2337360 and rs3790506) genes were closely associated with the susceptibility for dental caries, while other studies did not find the same association.21–25 The present study investigated the association between the rs3806804 polymorphism in ENAM and the rs3811411 polymorphism in TUFT1 with dental caries susceptibility, but no correlations were found in Chinese children.

Matrix metalloproteinases (MMPs) play an important role in the control and progression of dental caries because they are involved in enamel and dentin formation.26,27 Polymorphisms of the related MMP genes, including MMP2, MMP3, MMP9, MMP10, MMP13, MMP14, MMP16 and MMP20, were reported to be associated with dental caries.28–32 These studies showed that rs1711437 and rs1784418 in MMP20, rs2046315 in MMP16, rs2252070 in MMP13, rs17576 in MMP9, rs679620 in MMP3 and rs2287074 in MMP2 might decrease or increase dental caries susceptibility.28–32 According to one of the studies,32 carriers of the mutant allele (G) for MMP13 (rs2252070A/G) showed a significantly decreased risk of dental caries (OR 0.538; 95% CI 0.313, 0.926). In the current study, no relationship was found with MMP13 (rs2252070A/G) (OR 0.773; 95% CI 0.573, 1.042) or MMP13 (rs597315A/T) (OR 1.095; 95% CI 0.801, 1.495). Therefore, the precise nature of the relationship between dental caries and MMPs needs to be studied further in the future.

There is evidence that cytokines are important in regulating and controlling the inflammatory response to bacterial infection.33,34 Genetic and immunological differences between hosts may also be an important risk factor for dental caries. Although the role that cytokines play in the aetiology and mechanism of dental caries remains unclear, it was found that S. mutans, an important factor in dental caries development, could stimulate proinflammatory cytokine production.35,36 To date, only one study has evaluated the association between interleukin (IL)-1β, IL-1 receptor antagonist and IL-10 and dental caries susceptibility.37 It found that the level of S. mutans was positively correlated with the saliva IL-1β concentration and inversely correlated with saliva IL-1 receptor antagonist concentration; but there were no associations between IL1B, IL1RN and IL10 gene polymorphisms and dental caries.37 In the current study, individuals with the IL1B rs1143627CT genotype had a lower risk of dental caries compared with those with the CC genotype (OR 0.557; 95% CI 0.326, 0.952; P = 0.032). However, the sample size in this current study was limited. Therefore, whether it really affects the susceptibility for dental caries and its related mechanisms requires further investigation.

In conclusion, the findings of the current case–control study suggest that individuals from the northwest part of China with the IL1B rs1143627CT genotype had a lower risk of dental caries compared with those with the CC genotype. However, other candidate genes that are related to dental caries susceptibility need to be studied in different populations from a range of geographical locations.

Acknowledgements

Our sincere thanks go to all the volunteers who agreed to take part in this study.

Declaration of conflicting interest

The authors declare that there are no conflicts of interest.

Funding

This work was supported by a grant from the Fundamental Research Funds for the Central Universities (Northwest Minzu University; no. 31920170024) and a grant from the Innovation Group Project of Basic Research in Gansu Province (no. 17JR5RA274).

References

  • 1.Peterson PE. The World Oral Health Report 2003: continuous improvement of oral health in the 21st century – the approach of the WHO Global Oral Health Programme. Community Dent Oral Epidemiol 2003; 31: 3–23. [DOI] [PubMed] [Google Scholar]
  • 2.Shaghaghian S, Abolvardi M, Akhlaghian M. Factors affecting dental caries of preschool children in Shiraz, 2014. J Dent (Shiraz) 2018; 19: 100–108. [PMC free article] [PubMed] [Google Scholar]
  • 3.Liu W Z, Su LY, Xie XD, et al. Prevalence and years lived with disability for dental caries among children aged 0–14 years in China, 1990–2016. Biomed Environ Sci 2018; 31: 376–381. [DOI] [PubMed] [Google Scholar]
  • 4.Bashirian S, Shirahmadi S, Seyedzadeh-Sabounchi S, et al. Association of caries experience and dental plaque with sociodemographic characteristics in elementary school-aged children: a cross-sectional study. BMC Oral Health 2018; 18: 7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Shuler CF. Inherited risks for susceptibility to dental caries. J Dent Educ 2001; 65: 1038–1045. [PubMed] [Google Scholar]
  • 6.Piekoszewska-Ziętek P, Turska-Szybka A, Olczak-Kowalczyk D. Single nucleotide polymorphism in the aetiology of caries: systematic literature review. Caries Res 2017; 51: 425–435. [DOI] [PubMed] [Google Scholar]
  • 7.Cogulu D, Onay H, Ozdemir Y, et al. The role of vitamin D receptor polymorphisms on dental caries. J Clin Pediatr Dent 2016; 40: 211–214. [DOI] [PubMed] [Google Scholar]
  • 8.Yildiz G, Ermis RB, Calapoglu NS, et al. Gene-environment interactions in the etiology of dental caries. J Dent Res 2016; 95: 74–79. [DOI] [PubMed] [Google Scholar]
  • 9.Alyousef YM, Borgio JF, AbdulAzeez S, et al. Association of MBL2 gene polymorphism with dental caries in Saudi children. Caries Res 2017; 51: 12–16. [DOI] [PubMed] [Google Scholar]
  • 10.Eckert S, Feingold E, Cooper M, et al. Variants on chromosome 4q21 near PKD2 and SIBLINGS are associated with dental caries. J Hum Genet 2017; 62: 491–496. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Hu XP, Li ZQ, Zhou JY, et al. Analysis of the association between polymorphisms in the vitamin D receptor (VDR) gene and dental caries in a Chinese population. Genet Mol Res 2015; 14: 11631–11638. [DOI] [PubMed] [Google Scholar]
  • 12.Kong YY, Zheng JM, Zhang WJ, et al. The relationship between vitamin D receptor gene polymorphism and deciduous tooth decay in Chinese children. BMC Oral Health 2017; 17: 111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Olszowski T, Milona M, Janiszewska-Olszowska J, et al. The lack of association between FCN2 gene promoter region polymorphisms and dental caries in Polish children. Caries Res 2017; 51: 79–84. [DOI] [PubMed] [Google Scholar]
  • 14.Izakovicova HL, Borilova Linhartova LP, Kastovsky J, et al. Vitamin D receptor TaqI gene polymorphism and dental caries in Czech children. Caries Res 2017; 51: 7–11. [DOI] [PubMed] [Google Scholar]
  • 15.World Health Organization. Oral health surveys: basic methods, 4th ed Geneva: World Health Organization, 1997, pp.1–21. [Google Scholar]
  • 16.Li ZQ, Hu XP, Zhou JY, et al. Genetic polymorphisms in the carbonic anhydrase VI gene and dental caries susceptibility. Genet Mol Res 2015; 14: 5986–5993. [DOI] [PubMed] [Google Scholar]
  • 17.Kutsch VK, Young DA. New directions in the etiology of dental caries disease. J Calif Dent Assoc 2011; 39: 716–721. [PubMed] [Google Scholar]
  • 18.Lacruz RS, Habelitz S, Wright JT, et al. Dental enamel formation and implications for oral health and disease. Physiol Rev 2017; 97: 939.–. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Simmer JP, Hu JC. Dental enamel formation and its impact on clinical dentistry. J Dent Educ 2001; 65: 896–905. [PubMed] [Google Scholar]
  • 20.Slayton RL, Cooper ME, Marazita ML. Tuftelin, mutans streptococci, and dental caries susceptibility. J Dent Res 2005; 84: 711–714. [DOI] [PubMed] [Google Scholar]
  • 21.Kang SW, Yoon I, Lee HW, et al. Association between AMELX polymorphisms and dental caries in Koreans. Oral Dis 2011; 17: 399–406. [DOI] [PubMed] [Google Scholar]
  • 22.Deeley K, Letra A, Rose EK, et al. Possible association of amelogenin to high caries experience in a Guatemalan-Mayan population. Caries Res 2008; 42: 8–13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Gerreth K, Zaorska K, Zabel M, et al. Association of ENAM gene single nucleotide polymorphisms with dental caries in Polish children. Clin Oral Investig 2016; 20: 631–636. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Patir A, Seymen F, Yildirim M, et al. Enamel formation genes are associated with high caries experience in Turkish children. Caries Res 2008; 42: 394–400. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Divakar DD, Alanazi SAS, Assiri MYA, et al. Association between ENAM polymorphisms and dental caries in children. Saudi Journal of Biological Sciences 2018; 10.1016/j.sjbs.2018.01.010. [DOI] [PMC free article] [PubMed]
  • 26.Fanchon S, Bourd K, Septier D, et al. Involvement of matrix metalloproteinases in the onset of dentin mineralization. Eur J Oral Sci 2004; 112: 171–176. [DOI] [PubMed] [Google Scholar]
  • 27.Shimada Y, Ichinose S, Sadr A, et al. Localization of matrix metalloproteinases (MMPs-2, 8, 9 and 20) in normal and carious dentine. Aust Dent J 2009; 54: 347–354. [DOI] [PubMed] [Google Scholar]
  • 28.Karayasheva D, Glushkova M, Boteva E, et al. Association study for the role of matrix metalloproteinases 2 and 3 gene polymorphisms in dental caries susceptibility. Arch Oral Biol 2016; 68: 9–12. [DOI] [PubMed] [Google Scholar]
  • 29.Antunes LA, Antunes LS, Küchler EC, et al. Analysis of the association between polymorphisms in MMP2, MMP 3, MMP9, MMP20, TIMP1, and TIMP2 genes with white spot lesions and early childhood caries. Int J Paediatr Dent 2016; 26: 310–319. [DOI] [PubMed] [Google Scholar]
  • 30.Lewis DD, Shaffer JR, Feingold E, et al. Genetic association of MMP10, MMP14, and MMP16 with dental caries. Int J Dent 2017; 8465125. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Tannure PN, Küchler EC, Lips A, et al. Genetic variation in MMP20 contributes to higher caries experience. J Dent 2012; 40: 381–386. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Tannure PN, Küchler EC, Falagan-Lotsch P, et al. MMP13 polymorphism decreases risk for dental caries. Caries Res 2012; 46: 401–407. [DOI] [PubMed] [Google Scholar]
  • 33.Floege J, Gröne HJ. Progression of renal failure: what is the role of cytokines? Nephrol Dial Transplant 1995; 10: 1575–1586. [PubMed] [Google Scholar]
  • 34.Miller AH, Maletic V, Raison CL. Inflammation and its discontents: the role of cytokines in the pathophysiology of major depression. Biol Psychiatry 2009; 65: 732–741. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Benabdelmoumene S, Dumont S, Petit C, et al. Activation of human monocytes by Streptococcus mutans serotype f polysaccharide: immunoglobulin G fc receptor expression and tumor necrosis factor and interleukin-1 production. Infect Immun 1991; 59: 3261–3266. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Soell M, Holveck F, Schöller M, et al. Binding of streptococcus mutans SR protein to human monocytes: production of tumor necrosis factor, interleukin 1, and interleukin 6. Infect Immun 1994; 62: 1805–1812. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Cogulu D, Onay H, Ozdemir Y, et al. Associations of interleukin (IL)-1β, IL-1 receptor antagonist, and IL-10 with dental caries. J Oral Sci 2015; 57: 31–36. [DOI] [PubMed] [Google Scholar]

Articles from The Journal of International Medical Research are provided here courtesy of SAGE Publications

RESOURCES