Skip to main content
The Journal of Biological Chemistry logoLink to The Journal of Biological Chemistry
. 2019 Feb 8;294(14):5536–5548. doi: 10.1074/jbc.RA118.007153

Ethanol promotes differentiation of embryonic stem cells through retinoic acid receptor-γ

Ryan N Serio ‡, Kristian B Laursen §, Alison M Urvalek §, Steven S Gross ‡,§, Lorraine J Gudas ‡,§,1
PMCID: PMC6462535  PMID: 30737277

Abstract

Ethanol (EtOH) is a teratogen, but its teratogenic mechanisms are not fully understood. The alcohol form of vitamin A (retinol/ROL) can be oxidized to all-trans-retinoic acid (RA), which plays a critical role in stem cell differentiation and development. Using an embryonic stem cell (ESC) model to analyze EtOH's effects on differentiation, we show here that EtOH and acetaldehyde, but not acetate, increase differentiation-associated mRNA levels, and that EtOH decreases pluripotency-related mRNAs. Using reporter assays, ChIP assays, and retinoic acid receptor-γ (RARγ) knockout ESC lines generated by CRISPR/Cas9 and homologous recombination, we demonstrate that EtOH signals via RARγ binding to RA response elements (RAREs) in differentiation-associated gene promoters or enhancers. We also report that EtOH-mediated increases in homeobox A1 (Hoxa1) and cytochrome P450 family 26 subfamily A member 1 (Cyp26a1) transcripts, direct RA target genes, require the expression of the RA-synthesizing enzyme, aldehyde dehydrogenase 1 family member A2 (Aldh1a2), suggesting that EtOH-mediated induction of Hoxa1 and Cyp26a1 requires ROL from the serum. As shown with CRISPR/Cas9 knockout lines, the retinol dehydrogenase gene Rdh10 and a functional RARE in the ROL transporter stimulated by retinoic acid 6 (Stra6) gene are required for EtOH induction of Hoxa1 and Cyp26a1. We conclude that EtOH stimulates stem cell differentiation by increasing the influx and metabolism of ROL for downstream RARγ-dependent transcription. In stem cells, EtOH may shift cell fate decisions to alter developmental outcomes by increasing endogenous ROL/RA signaling via increased Stra6 expression and ROL oxidation.

Keywords: stem cells, differentiation, alcohol, retinol, retinoic acid, alcohol-associated birth defects, RARγ, Rdh10, Stra6, teratogen, ethanol

Introduction

Complex regulatory circuitry is required for maintaining the properties of stem cells so that symmetric self-renewal is not diverted prematurely to drive differentiation toward terminal cell fates (1). High levels of blood ethanol (EtOH) lead to aberrant regulation of normal differentiation in developing embryos and fetuses, making EtOH a teratogen (2–4). Unraveling the mechanisms by which EtOH interferes with endogenous cell signaling pathways that control differentiation is critical for understanding EtOH-mediated toxic effects which lead to disease states that arise during development, i.e. fetal alcohol spectrum disorders (FASD)2 (5) and diseases such as cancers, which are caused in part by changes in cell plasticity (6).

Of particular importance in stem cell differentiation is the interaction between EtOH and the vitamin A (retinol, ROL) metabolite all-trans-retinoic acid (RA), which lies at the nexus of physiological differentiation of stem cells (7, 8). Dysregulated RA signaling (from either supraphysiological or subphysiological levels) leads to several teratogenic phenotypes in common with EtOH (9–11). Several studies have shown interactions between EtOH and RA signaling (4, 12–16), possibly because of the similarities in metabolism between ROL and EtOH. Both EtOH and ROL metabolism rely on parallel two-step oxidation processes; ROL is metabolized to retinaldehyde and then to RA, whereas EtOH is metabolized to acetaldehyde (AcH) and then to acetic acid (Fig. 1A). Some studies have shown that EtOH decreases retinoid production and RAR signaling (13, 14, 16). In contrast, embryos of EtOH-treated mice show higher RA levels in specific sites (15), prompting us to explore the mechanisms underlying the effects of EtOH on RAR signaling in embryonic stem cells (ESCs) in greater depth.

Figure 1.

Figure 1.

Ethanol increases transcript levels of genes necessary for RA-mediated differentiation in ESCs. A, schematic of the metabolic pathways of EtOH and ROL. B, timeline for cell culture experiments. C, -fold changes in mRNA levels by 40 mm EtOH; these transcripts are targets of RA. Treatment groups at 48 and 72 h were compared with untreated ESCs at 24 h, except where indicated by bar. D, -fold changes in mRNA levels by EtOH and 1 mm AcH at 72 h. E, -fold changes in mRNA levels by EtOH or 1 mm acetate ± EtOH at 48 h. y-Axes vary with samples being analyzed, and mRNA levels are shown in arbitrary units. Error bars represent S.E. of independent experiments where n = 3 biological repeats. *, p ≤ 0.05; **, p ≤ 0.01; ***, p ≤ 0.001. F and G, RT-qPCR analysis of relative stabilities of Hoxa1 (F) and Cyp26a1 (G) transcripts after administering 2 μg/ml of actinomycin D to inhibit transcription.

In ESCs, RA is an endogenous agonist for the three retinoic acid receptor (RAR) members (RARα/β/γ) of the nuclear receptor family of transcription factors (8, 17). RA-bound RARs and members of the retinoid X receptor (RXRα/β/γ) family form heterodimers (17), and these RA:RAR/RXR complexes cause displacement of corepressors that maintain chromatin in a transcriptionally inactive state (17, 18). Posttranslational acetylation of histones by histone lysine acetyltransferases, which are components of the multi-protein coactivator complex, increases accessibility for binding of RA:RAR/RXR complexes at cis-acting RA-response elements (RAREs) (19). RAREs are frequently located within promoter and/or enhancer regions that control transcription of lineage-specific genes necessary for stem cell differentiation by bound RA:RAR/RXR complexes (19).

Here we provide evidence that EtOH causes ESC differentiation by increasing RA synthesis by Aldh1a2 following uptake of ROL from the medium by the Stra6 transporter and ROL oxidation by Rdh10. Downstream RA signaling is then dependent on RARγ-mediated transcription via direct RARE activation in primary RA-responsive genes. Elucidating the precise mechanisms underpinning the interactions between EtOH and RA-mediated transcription during ESC differentiation enhances our fundamental understanding of several disease phenotypes during development.

Results

Ethanol decreases pluripotency transcripts and increases transcripts of differentiation-associated genes in embryonic stem cells

To establish the phenotype of alcohol-exposed ESCs we performed quantitative reverse transcriptase PCR (RT-qPCR) on AB1 ESCs 24, 48, and 72 h after 40 mm EtOH addition (Fig. 1B). This EtOH dose is representative of human blood concentrations typical of binge drinking (0.184%) (20). Using alkaline phosphatase staining, we demonstrated a reduction in pluripotency in ESCs upon EtOH treatment for 96 h, as EtOH decreased staining intensity compared with 0.1% DMSO-treated cells by 7.6% (p = 0.020) (Fig. S1A). We additionally compared the mRNA levels of genes associated with pluripotency in EtOH-treated versus untreated cells. We measured lower mRNA levels of Klf4 (78 ± 6%, p = 0.02), Nanog (83 ± 4%, p = 0.003), and Dppa5 (58 ± 7%, p = 0.009) 24 h after EtOH addition, whereas others, including Oct4 (21) and Sall4, were unchanged (Fig. S1B).

Transcripts increased by >2-fold by 40 mm EtOH treatment included those of the homeotic (Hox) family (Hoxa1, Hoxb1, Hoxa5) and Cdx1 (Fig. 1C; Fig. S1C). Because several transcripts increased by EtOH are direct RAR/RXR transcriptional targets (22–24), we then analyzed additional primary RA target genes, RARβ2 and Cyp26a1. We detected increases after 48 h of EtOH treatment (Fig. 1C) compared with vehicle-treated ESCs. We additionally measured transcripts of RA-responsive genes in another ESC WT line, CCE, to rule out any AB1 ESC line-specific effects of EtOH. We found that EtOH also increased transcript levels of RA-responsive genes in CCE cells, and that doses of 40 and 80 mm EtOH elicited similar effects (Fig. S1D). We used either 40 or 80 mm EtOH in subsequent experiments. EtOH treatment did not increase transcript levels of lineage-specific genes that were also unaffected by RA treatment at 48 h, such as Fgf5 (ectoderm) and Sox17 (endoderm) in ESCs (Fig. S1E). Thus, EtOH increases transcript levels of specific RA target genes rather than affecting a broad differentiation phenotype.

To probe for additive effects of EtOH and retinoids we added EtOH to ESCs that were also treated with 1 μm RA or ROL. We used Hoxa1, Cdx1, and Hnf1β as readouts for both RA responsiveness and ESC differentiation and did not detect additional increases in transcript levels compared with RA/ROL-treated cells alone at 48 h (Fig. S1F), suggesting that transcript induction of differentiation-associated genes by RA and EtOH converges on the same pathway.

Because EtOH is rapidly oxidized to AcH (Fig. 1A) (25), we treated CCE cells with either EtOH or 1 mm AcH for 72 h. AcH caused transcript increases in Hoxa1 (4.29 ± 0.2, p = 0.004), Cdx1 (3.32 ± 0.82, p = 0.046), RARβ2 (5.86 ± 0.5, p = 0.0006), and Cxcl12 (5.75 ± 1.01, p = 0.009), a developmental gene that was not significantly increased by EtOH treatment (Fig. 1D). In contrast, 1 mm acetate treatment for 48 h did not increase mRNA levels of Hoxa1, Cyp26a1, and RARβ2, and inhibited the EtOH-mediated increases in Cyp26a1 transcripts (Fig. 1E). Therefore, we conclude that the EtOH-induced transcript increases result from EtOH metabolism to AcH, and not to acetate.

To determine whether EtOH increases Hoxa1 mRNA levels by enhancing mRNA stability or by increasing transcription, we treated CCE ESCs with EtOH or 1 μm RA for 48 h, isolated RNA immediately from some wells, and added 2 μg/ml of actinomycin D to other wells for 30, 90, or 240 min to block transcription. The differences in the derivatives of the linear regression lines between untreated and EtOH-treated WT ESCs were −0.034 ± 0.09 (p = 0.76) for Hoxa1 (Fig. 1F) and −0.043 ± 0.04 (p = 0.54) for Cyp26a1 (Fig. 1G). The absence of major changes in half-lives of both Hoxa1 and Cyp26a1 mRNAs between vehicle-treated and EtOH-treated ESCs suggests that the increases in transcript levels upon EtOH treatment do not primarily result from increased mRNA stability in the presence of EtOH.

RARγ is required for ethanol regulation of genes involved in stem cell differentiation

RARγ controls the expression of several genes that exhibited increased mRNA levels in response to EtOH, including Hoxa1, Cyp26a1, RARβ2, Crabp2, and Hnf1β (23, 26–28). In addition, our lab has established that RARγ is essential for RA-induced Hoxa1 transcription through its 3′ RARE (29). To define the role of RARγ in EtOH-mediated transcription in more depth, we used an ESC line in which both alleles of a target sequence in exon 8 of RARγ were deleted by CRISPR knockout (RARγE8−/−) (Fig. S2A) (26). We cultured WT and RARγE8−/− ESCs with 40 mm EtOH for 48 h and found that transcript levels of Hoxa1 (11.6 ± 2.2-fold, p = 0.008), Cyp26a1 (9.1 ± 1.1-fold, p = 0.002), RARβ2 (6.7 ± 1.8-fold, p = 0.034), Crabp2 (5.3 ± 1.1-fold, p = 0.018), Cdx1 (20.2 ± 4.4-fold, p = 0.012), Hnf1β, (4.8 ± 1.3-fold, p = 0.044), and the long noncoding RNA Hotairm1 (8.9 ± 1.3-fold, p = 0.003) (30), increased in WT ESCs compared with vehicle-treated cells. In contrast, in RARγE8−/− cells, deletion of RARγ prevented these mRNA increases (Fig. 2A; Fig. S2B).

Figure 2.

Figure 2.

RARγ is required for the expression of a subset of RA-target genes induced by ethanol. A, -fold changes in transcript levels of RA-inducible genes in WT and RARγE8−/− ESCs at 48 h treatment with EtOH (40 mm) or RA (1 μm RA). B, -fold changes in transcript levels of the late differentiation marker Col4a in WT and RARγE8−/− ESCs at 48 h treatment with EtOH (40 mm) or RA (1 μm RA). Treatment groups were compared with untreated ESCs at 48 h, except where indicated by bar. C, β-gal activity of CCE cells transfected with Hoxa1 minigene (13.5 kb of Hoxa1 DNA + 6.5 kb of 5′ + 3 kb of 3′ flanking sequences with in-frame fusion of lacZ) with either WT DR5 RARE (CAGGTTCACCGAAAGTTCAAG) or Hoxa1-lacZ muRARE (C-cTagcCCGAAAaTTacAG), where underlined bases represent consensus RAREs and lowercase bases represent mutations; at 24 h ± EtOH (40 mm) or RA (0.5 μm), normalized to luciferase activity of each sample (15:1 test:control). D, acetylation state of H3K27 near Hoxa1, RARβ2, and Cyp26a1 RAREs after treating ESCs with 80 mm EtOH for 24 h, relative to DMSO-treated controls set to 1. The RAREs analyzed are located in a 3′ enhancer 4.6 kb downstream of the Hoxa1 proximal promoter (pp), in the RARβ2 pp, and in a 5′ enhancer 2 kb upstream of the Cyp26a1 pp. ChIP assays were normalized to pre-immunoprecipitation input DNA. y-Axes vary with samples being analyzed, and mRNA levels are shown in arbitrary units. Error bars represent S.E. of independent experiments where n = 3 biological repeats. n.s., not significant; *, p ≤ 0.05; **, p ≤ 0.01; ***, p ≤ 0.001.

Moreover, transcripts of the late differentiation marker, Col4a, increased in EtOH-treated WT (2.8 ± 0.19-fold, p = 0.0006), but not in RARγE8−/− ESCs (Fig. 2B). Because Col4a transcripts are only induced in RA-treated ESCs at late times (2–3 days) when the cells are fully differentiated (31), these data demonstrate that EtOH causes ESCs to differentiate along an epithelial lineage.

We confirmed the RARγ requirement for EtOH-mediated ESC differentiation using another RARβ+/−γ−/− line (29) treated for 2 h with EtOH ± RA. We found that Hoxa1 and Hoxb1 transcripts increased by 1.6 ± 0.01-fold (p <0.0001) and 1.7 ± 0.18-fold (p = 0.014), respectively, in 40 mm EtOH-treated WT samples, and that RA + EtOH samples displayed a 4.7 ± 0.99-fold (p = 0.021) increase in Hoxa1 and a 6.1 ± 1.0-fold (p = 0.007) increase in Hoxb1 compared with vehicle-treated cells (Fig. S2C). In contrast, Hoxa1 and Hoxb1 transcript levels did not increase in EtOH-treated RARβ+/−γ−/− cells ± RA (Fig. S2D). These data demonstrate that RARγ mediates the effects of EtOH with respect to ESC differentiation.

RARE activation is necessary for ethanol-mediated Hoxa1 transcription in embryonic stem cells

To determine whether a functional RARE is required for signaling by EtOH we next performed a transient transfection in ESCs using Hoxa1-lacZ minigene reporter constructs in which lacZ was cloned into the Hoxa1 coding sequence (22). We used two different constructs; one contained an enhancer with an intact RARE (WT, AGTTCA) and the other contained an RARE that was inactivated by mutation (Hoxa1-lacZ muRARE, AaTTac). We treated these transfected ESCs with vehicle (0.1% DMSO), EtOH (40 mm), or RA (0.5 μm) for 24 h. We observed a 1.5 ± 0.15-fold (p = 0.034) increase in β-gal activity in the EtOH-treated and a 1.9 ± 0.28-fold (p = 0.036) increase in RA-treated WT ESCs transfected with the construct harboring an intact WT RARE (Fig. 2C). We did not observe any increase in β-gal activity in either EtOH- or RA-treated lysates from WT cells transfected with the Hoxa1-lacZ muRARE construct. These results show first, that the effects of EtOH occur at the transcriptional level and second, that there is a requirement for a functional RARE to mediate EtOH-induced transcriptional effects on Hoxa1.

Enrichment of histone 3 lysine acetylation (acetyl-H3) allows RAREs to become more accessible for the RAR/RXR complex to bind and induce transcription. We performed chromatin immunoprecipitation (ChIP) assays using an antibody against the H3K27ac modification, which identifies transcriptionally active enhancers (32), to examine histone acetylation patterns in chromatin near RAREs of genes which exhibited mRNA increases by EtOH. Both Hoxa1 and Cyp26a1 contain at least one RARE at enhancers, whereas RARβ2 contains a RARE near its proximal promoter (18). Genes from the EtOH-treated WT ESCs exhibited >1.5-fold H3K27ac enrichment near RAREs compared with vehicle-treated ESCs (2.1 ± 0.25-fold, p = 0.01, Hoxa1; 2.7 ± 0.54-fold, p = 0.036, RARβ2; 1.6 ± 0.07-fold, p = 0.001, Cyp26a1) (Fig. 2D). These increases in H3K27ac chromatin marks upon EtOH treatment suggest that the chromatin near the RAREs is in a configuration in which transcription is activated.

Ethanol increases transcripts associated with retinol metabolism

To determine whether RA is a required intermediate for the EtOH-mediated increases in differentiation-associated genes, such as Hoxa1 and Cyp26a1, we first measured transcript levels of several genes required for RA synthesis from ROL. ROL is primarily metabolized to retinaldehyde by retinol dehydrogenase-10 (Rdh10) (7). Using semiquantitative RT-PCR, we showed that transcripts of Rdh10, but not Rdh5 or Rdh11, were increased by EtOH in WT ESCs (Fig. 3A). By RT-qPCR analysis we also showed EtOH-associated increases in transcript levels of the RARγ target gene Rdh10 (1.7 ± 0.12-fold, p = 0.004) and the intracellular ROL transporter Rbp1 (Crbp1) (6.7 ± 1.3-fold, p = 0.011) (Fig. 3, B and C) in WT ESCs. Crabp2, which transports RA to the nucleus (33), displayed increased transcript levels (5.28 ± 1.1-fold, p = 0.018) in WT ESCs upon EtOH addition. Rbp1 and Crabp2 exhibited regulation by RARγ, because the RARγE8−/− ESC line showed attenuated increases in these transcripts by EtOH compared with those in WT ESCs (Fig. 3C). Transcripts for the retinaldehyde reductase, Dhrs3, but not Dhrs4, were increased by EtOH treatment (15.7 ± 3.1-fold, p = 0.009) in WT ESCs (Fig. 3D). Importantly, Dhrs3 stabilizes the Rdh10-containing retinoid oxidoreductase complex (34). These data show that EtOH increases mRNAs of key genes that metabolize ROL to retinaldehyde. In contrast, the Aldh1a2 mRNA level was not increased by EtOH in WT ESCs (Fig. S3; Fig. 1A).

Figure 3.

Figure 3.

Transcripts involved in RA synthesis are up-regulated following ethanol addition. A, representative semiquantitative RT-PCR analysis of a panel of retinol dehydrogenase family transcripts expressed in ESCs, ±40 mm EtOH and 1 μm RA (n = 2). B, -fold changes in Rdh10 transcript levels in WT and RARγE8−/− ESCs at 48 h treatment with EtOH (40 mm) or RA (1 μm RA). C and D, -fold changes in transcript levels of genes associated with retinoid transport (C) and retinaldehyde reduction (D) in WT and RARγE8−/− ESCs at 48 h treatment with EtOH (40 mm). y-Axes vary with samples being analyzed, and mRNA levels are shown in arbitrary units. Treatment groups were compared with untreated ESCs at 48 h, except where indicated by bar. Error bars represent S.E. of independent biological experiments where n = at least 3 biological repeats. n.s., not significant; *, p ≤ 0.05, **, p ≤ 0.01, ***, p ≤ 0.001.

Aldh1a2 is required for ethanol-mediated transcriptional changes

Because EtOH increased transcripts of genes involved in RA synthesis and nuclear transport, we ablated Aldh1a2 activity using CRISPR/Cas9 targeted to two sequences in intron and exon 5 to generate an Aldh1a2E5−/− ESC line (Fig. 4, A and B). The absence of Aldh1a2 prevented the EtOH-mediated Hoxa1 and Cyp26a1 transcript increases observed in WT cells (Fig. 4C). These data indicate that metabolism of retinaldehyde to RA is required for EtOH to increase Hoxa1 and Cyp26a1 transcripts.

Figure 4.

Figure 4.

RA synthesis by Aldh1a2 is necessary for ethanol-mediated increases in Hoxa1 and Cyp26a1. A, CRISPR/Cas9 deletion strategy using an nCas9 nickase vector. The parental sequence of exon 5 of the Aldh1a2 gene is shown above with single guide RNA (sgRNA) target sequences underlined. Sequences of both edited alleles of the Aldh1a2E5−/− ESC line are shown below with deleted nucleotides represented by dotted lines and mutated sequences in bold. B, Western blotting of Aldh1a2 in WT and Aldh1a2E5−/− ESCs compared with β-actin loading control and measured against a molecular weight (MW) marker. C, quantitative analysis of transcript levels of Hoxa1 (left panel) and Cyp26a1 (right panel) by 40 mm EtOH, 0.1 μm ROL, or EtOH (40 mm) + ROL (0.1 μm). The -fold changes in transcript levels of genes in Aldh1a2E5−/− ESCs grown in 10% fetal calf serum–containing medium are compared with those of WT ESCs grown in standard medium + 10% fetal calf serum (FCS) and in chemically defined KOSR-containing medium. Transcript levels are compared with those of 0.1% DMSO-treated cells set to 1. D–F, reversed phase LC–tandem MS/MS followed by multiple reaction monitoring analysis of selected retinoids was performed on ESCs ± EtOH. D, all-trans-RA ion counts after treating ESCs with 80 mm EtOH or 1 μm RA for 8 h (retention time = 3.5 min). Intracellular RA (E) and 4-oxo-RA (F) concentrations 48 h after 40 mm EtOH addition and 6 h following a switch to medium containing 0.5 μm of additional ROL. Quantitation of RA was calculated in pmol/1 × 106 cells after normalizing to cell number, protein count, and recovery rate. An internal standard (5 μm retinyl acetate) not present in biological samples was added to all samples prior to extraction to calculate extraction efficiency. y-Axes vary with samples being analyzed, and mRNA levels are shown in arbitrary units. Error bars represent S.E. of independent experiments where n = at least 3 biological repeats. *, p ≤ 0.05; **, p ≤ 0.01; ****, p ≤ 0.0001.

To address the role of serum ROL, we next cultured WT ESCs in knockout serum replacement (KOSR) medium , which, unlike fetal calf serum, does not contain ROL. EtOH did not increase Hoxa1 and Cyp26a1 mRNAs in WT ESCs cultured in KOSR medium (Fig. 4C). Adding ROL to the KOSR medium at 0.1 μm, typically found in 10% serum-containing medium (35), restored the EtOH-mediated increases in Hoxa1 (1.7 ± 0.14-fold, p = 0.01) and Cyp26a1 (2.1 ± 0.4-fold, p = 0.035) transcripts to levels similar to those measured in serum-containing medium (1.8 ± 0.05-fold, p <0.0001, Hoxa1; 2.1 ± 0.17-fold, p = 0.0005, Cyp26a1) (Fig. 4C). In contrast, Hoxa1 transcript levels were similarly increased by 1 μm RA in WT ESCs cultured in either serum-containing or KOSR medium (Fig. S4). Collectively, these data demonstrate that ROL, via its two-step oxidation to RA, is required for EtOH-mediated Hoxa1 and Cyp26a1 transcript increases.

Ethanol treatment did not cause detectable increases in RA levels in embryonic stem cells

We measured RA levels in EtOH-treated ESCs using reversed phase HPLC–tandem MS to determine whether increased intracellular RA levels correlated with the increases in Hoxa1 and Cyp26a1 transcripts. Using a triple quadrupole mass spectrometer, we detected a peak for 20 pmol of an RA standard at a retention time of 3.5 min (Fig. S5A). Calibration curves were generated for RA with a limit of detection of 40 fmol and a lower limit of quantitation of 382 fmol (95 nm for 4 × 106 cells, where 1 μl volume = 1 × 106 cells and 4 μl = injection volume) for the transition m/z 301.2 → 123.1, and 341 fmol (85 nm for 4 × 106 cells) for a secondary m/z 301.2 → 159.1 transition (Fig. S5, B and C). We also generated a calibration curve for 4-oxo-RA, a metabolite of RA (Fig. S5D). RA levels in ESCs treated with either vehicle or EtOH were too low to detect, but we detected an RA peak in cells treated with exogenous RA for 8 h (Fig. 4D; Fig. S5E). We observed a second peak at retention time 3.25 min for transition m/z 301.2 → 159.1, but this peak did not correspond to any known RA isomer or metabolite (Fig. S5, F–H).

To increase the sensitivity for RA detection, we next treated WT ESCs with EtOH for 48 h and switched to a medium containing high vitamin A (+0.5 μm ROL) 6 h prior to collecting lysates. This medium contained a 5–10-fold higher ROL concentration than that in standard 10% serum-containing medium (0.05–0.1 μm). In ESCs cultured in 0.5 μm ROL we could measure intracellular RA above the sensitivity threshold of the mass spectrometer, but we still detected no changes in RA levels in EtOH-treated ESCs compared with vehicle-treated cells (Fig. 4E).

RA is oxidized to 4-oxo-RA (36), so we measured 4-oxo-RA as a surrogate for RA and observed a downward trend in 4-oxo-RA levels after EtOH addition that was not statistically significant (Fig. 4F). Thus, we did not observe increases in intracellular RA levels by MS after EtOH addition.

Stra6 is necessary for ethanol-dependent increases in Hoxa1 and Cyp26a1, but not Dhrs3 transcripts

Stra6 is a ROL transporter that is expressed in some, but not all, tissues and cell types (37, 38), and its high expression is associated with a ROL requirement for differentiation (39). If EtOH induces RA-mediated transcription by enabling increased entry of ROL into ESCs for oxidation to RA, then the loss of Stra6 function should abrogate this effect. We first measured Stra6 mRNAs in WT and RARγ−/− ESCs. Stra6 transcripts were elevated by 18.4 ± 2.8-fold (p = 0.003) in WT ESCs treated with EtOH, but were not elevated in the absence of RARγ (Fig. 5A). We saw effects of EtOH on the long and short Stra6 isoforms similar to those we observed with 1 μm RA, with the long isoform increased to a greater extent by both EtOH and RA treatment (Fig. S6).

Figure 5.

Figure 5.

Stra6 and Rdh10 are required for ethanol-mediated increases in Hoxa1 and Cyp26a1 transcripts. A, -fold changes in transcript levels of the ROL transporter Stra6 in WT and RARγE8−/− ESCs at 48 h treatment with 40 mm EtOH. B, -fold changes in Stra6 mRNA levels in 1 μm RA-treated WT and Stra6RARE−/− ESCs at 48 h. C and D, -fold changes in transcript levels of Stra6 (C), and Hoxa1 (D, top panel), and Cyp26a1 (D, bottom panel) in WT and Stra6RARE−/− ESCs at 48 h treatment with 40 mm EtOH or 0.5 μm ROL. E, -fold changes in Dhrs3 mRNA levels in WT versus Stra6RARE−/− ESCs treated with EtOH or 0.5 μm ROL. F, -fold changes in Dhrs3 mRNA levels in WT versus Aldh1a2E5−/− ESCs treated with EtOH, 0.1 μm ROL, or ROL + EtOH. G, Western blotting of Rdh10 in WT ESC and clones containing gRdh10E2 edits compared with β-actin loading control and measured against a MW marker. Clone 20 was selected for sequencing based on loss of protein expression. H, sequences of both edited alleles of the Rdh10E2−/− ESC line are shown below the WT sequence with deleted nucleotides represented by dotted lines. I, -fold changes of mRNA levels of Hoxa1, Cyp26a1, and Stra6 by EtOH and ROL at 48 h (n = 4). Transcripts levels in 0.1% DMSO-treated WT cells were set to 1. Treatment groups were compared with untreated WT ESCs, except where indicated by bar. y-Axes vary with samples being analyzed, and mRNA levels are shown in arbitrary units. Error bars represent S.E. of independent experiments where n = at least 3 biological repeats. *, p ≤ 0.05; **, p ≤ 0.01; ***, p ≤ 0.001; ****, p ≤ 0.0001.

We compared the effects of EtOH in WT ESCs versus ESCs containing biallelic deletions of the Stra6 RARE, which prevents binding of the RA:RAR/RXR complex (Stra6RARE−/−) (37). First, we verified that Stra6RARE−/− ESCs display a considerably weaker response to RA stimulation than WT ESCs. Treating Stra6RARE−/− ESCs with 1 μm RA for 48 h resulted in a 3.13 ± 1.01-fold (p = 0.044) increase in Stra6 levels compared with a 13.03 ± 0.95-fold (p = 0.0004) increase in WT cells, confirming that RA does not robustly increase Stra6 mRNA in Stra6RARE−/− cells (Fig. 5B). We then detected a 4.68 ± 1.44-fold (p = 0.042) increase in Stra6 mRNA by 40 mm EtOH and a 3.44 ± 0.59-fold (p = 0.015) increase by 0.5 μm ROL in WT ESCs (Fig. 5C). In contrast, Stra6 transcripts were not induced by either 40 mm EtOH or 0.5 μm ROL in Stra6RARE−/− cells (Fig. 5C). Although Hoxa1 and Cyp26a1 mRNAs were similarly increased by both EtOH (1.55 ± 0.12-fold, p = 0.004, Hoxa1; 4.64 ± 1.36-fold, p = 0.024, Cyp26a1) and ROL (1.79 ± 0.11-fold, p = 0.0004, Hoxa1; 5.89 ± 1.4-fold, p = 0.008, Cyp26a1), respectively, in WT ESCs we did not detect increases in Hoxa1 or Cyp26a1 transcripts upon EtOH or ROL treatment of Stra6-RARE−/− cells (Fig. 5D). These data demonstrate that EtOH-mediated increases in Hoxa1 and Cyp26a1 transcript levels depend on greater ROL uptake via Stra6.

We then measured Dhrs3 transcript levels and found no differences between EtOH-dependent increases in WT (1.64 ± 0.15-fold, p = 0.04) and Stra6RARE−/− (1.86 ± 0.31-fold, p = 0.04) ESC lines (Fig. 5E). In addition, Aldh1a2 deletion did not prevent EtOH-mediated Dhrs3 mRNA increases as a 2.39 ± 0.39-fold increase (p = 0.018) was observed in EtOH-treated Aldh1a2−/− ESCs compared with a 1.80 ± 0.3-fold (p = 0.037) change in EtOH-treated WT cells (Fig. 5F). These data indicate that EtOH-mediated increases in Dhrs3 mRNA levels do not require increased ROL import by Stra6 and RA production from retinaldehyde.

Rdh10 is required for ethanol-dependent increases in differentiation-associated genes

To address the potential requirement for Rdh10-dependent oxidation of ROL for EtOH-mediated increases in differentiation-associated transcripts we used CRISPR/Cas9 to generate deletions in both alleles in exon 2 of the Rdh10 gene (Fig. 5, G and H). Adding 0.5 μm ROL to the culture medium caused increases in mRNA levels of Hoxa1, Cyp26a1, and Stra6 in WT (5.31 ± 1.19-fold, p = 0.011, Hoxa1; 22.05 ± 5.17-fold, p = 0.015, Cyp26a1; 4.86 ± 1.29-fold, p = 0.016, Stra6) and Rdh10E2−/− (4.55 ± 1.45-fold, p = 0.05, Hoxa1; 22.02 ± 5.00-fold, p = 0.014, Cyp26a1; 5.01 ± 1.36-fold, p = 0.017, Stra6) ESCs. Transcripts of the same genes were unchanged by 40 mm EtOH in the Rdh10E2−/− ESCs compared with vehicle-treated cells despite induction in WT cells (1.55 ± 0.21-fold, p = 0.038, Hoxa1; 1.87 ± 0.18-fold, p = 0.009, Cyp26a1; 1.61 ± 0.24-fold, p = 0.045, Stra6). These data show that oxidation of intracellular ROL by Rdh10 is required for EtOH-dependent increases in Hoxa1, Cyp26a1, and Stra6 transcripts.

Discussion

The effects of EtOH on RA levels and signaling are highly debated; either potentiation (15) or inhibition (12–14, 16) of RA signaling in cell culture and animal models has been reported. Early studies relied on indirect assessment of RA activity or addition of exogenous ROL (13, 40), as a sensitive method of detecting RA levels was lacking until more recently. Recent studies have found that fluctuations in retinoid levels following EtOH administration often vary in a sex- or tissue-specific manner (15, 16). For example, Kim et al. (16) showed that retinyl esters (REs) were depleted in lungs of adult rats from dams fed 6.7% alcohol between embryonic day 7 and 21, with decreased levels in the ventral prostates and livers of males only. RA levels were not measured in this study, however, and depletion of retinyl esters could imply increased transport and utilization of retinoid stores for RA production in other tissues. Another study used both RE and RA levels as readouts for retinoid activity, revealing a complex physiological response to EtOH (15). Using a 6.5% EtOH-containing diet in mice for 1 month, Napoli and colleagues (15) showed that RE levels were unchanged in the brain and increased in kidneys and testis, yet hippocampal and cortex RA levels were increased by 20-fold and 2-fold, respectively, kidney RA levels were unchanged, and serum and testis RA levels were also increased.

The contextual relationship between EtOH and RA may also be influenced by developmental stage, contributing to differences in the literature. Shabtai et al. (41) demonstrated in Xenopus embryos that a deficiency in Aldh2 expression during gastrulation may create a competition for limiting amounts of Aldh1a2 enzyme and diminish RA production. Using a zebrafish model of high-dose (100 mm) EtOH exposure during gastrulation, addition of RA partially rescued some toxic effects on anteroposterior axis formation, ear development, and craniofacial cartilage defects but exposure to low-dose (1 nm) RA alone or with EtOH recapitulated other FASD-like developmental defects (12). Exposure to pharmacological doses of retinoids, such as through use of the prescription acne medication isotretinoin, also causes severe birth defects resembling an FASD-like phenotype (42). Hence, retinoid teratogenicity is complex, as RA is central to cell differentiation and organismal development (7), and phenotypes present similarly whether low or high levels of RA are present (9–11, 42). The effects of EtOH are equally complex and are associated with both increases and decreases in RA levels in accordance with tissue physiology as well as gene expression patterns at different developmental stages.

Our use of ESCs allowed us to determine mechanistically how retinoid signaling in pluripotent stem cells, representing the most primitive stage of development, is affected by EtOH exposure. Additionally, we generally used a dose of EtOH (40 mm) that is representative of a concentration that will be present in the bloodstream of a binge drinking adult (20) to analyze the effects in stem cells without subjecting the cells to concentrations that may be potentially lethal in humans and induce a variety of secondary toxic events.

mRNAs of differentiation genes are increased and pluripotency factor mRNAs are decreased in embryonic stem cells treated with ethanol

Prior studies have shown that EtOH delays or interferes with proper differentiation along specific lineages in cell culture models of directed differentiation (3, 43, 44). Thus, we probed the acute effects of EtOH on selected self-renewal and differentiation-associated genes in undifferentiated ESCs. We detected decreases in some pluripotency marker transcripts, and increases in several differentiation-related transcripts (Fig. 1C; Fig. S1B). The loss of pluripotency in EtOH-treated cells was confirmed using alkaline phosphatase staining (Fig. S1A). Addition of 1 μm RA to cultured ESCs directly increases mRNAs of many lineage factors to cause differentiation along a parietal endoderm (epithelial) lineage (24). We have previously shown that Hoxa1 and Cyp26a1 protein levels are correlated with their mRNA levels (45, 46). We showed here that EtOH addition to cultured ESCs induced transcripts of several differentiation-associated genes, which was recapitulated by administering the EtOH metabolite AcH but not by acetate, suggesting that either EtOH or AcH is responsible for these increases in differentiation-associated mRNAs (Fig. 1, D and E). We speculate that the inhibitory effect of acetate on EtOH-mediated transcript induction of some differentiation-associated genes (Fig. 1E) may result from contributions by acetate-derived acetyl groups to histone acetylation modifications. Moussaieff et al. (47) have demonstrated that 1 mm acetate treatment of ESCs delays endodermal differentiation via its conversion to acetyl-CoA and subsequent transfer of these acetyl groups to histone lysines to maintain transcriptionally active chromatin for pluripotency-related genes.

RARγ binding to RAREs is necessary for ethanol-induced increases in mRNA levels of differentiation-associated genes

The activation of genes associated with differentiation by RA via RARs is well-characterized (7, 19). Activation of RAR-controlled transcriptional hubs in stem cells produces localized effects within RA-controlled chromosomal regions in factories of related differentiation genes containing RAREs that configure to their proper spatial position for transcriptional effects (17, 48). RARγ is an essential transcription factor in RA-dependent differentiation of ESCs (27, 49, 50). Some functional redundancy exists among the three types of RARs in ESCs (26, 51, 52), but only RARγ was demonstrated to mediate F9 embryonic carcinoma cell differentiation and override activity of other RARs (49). Additionally, the loss of RARγ, but not RARα, was associated with differentiation defects and altered Hoxa1 expression (28, 53), which are likely caused by the dynamics of RAR subtype–binding patterns following ligand activation. Both RARα and RARγ occupy a large number of sites genome-wide during ESC differentiation (50). However, whereas RARα is enriched 24–48 h after RA signaling commences to sustain differentiation, RARγ initiates differentiation via direct activation of primary response genes (22, 28, 50, 53). We showed here that the increases in mRNAs induced by EtOH were prevented by ablation of RARγ, implicating direct RARγ/RXR-mediated signaling in promoting transcriptional effects of EtOH on differentiation genes (Fig. 2, A and B; Fig. S2).

Ethanol induction of differentiation-associated transcripts in embryonic stem cells depends on Aldh1a2

We demonstrate here that EtOH treatment of ESCs likely increases intracellular ROL from the serum to generate RA to activate transcription. This transcriptional effect of EtOH requires Aldh1a2 expression, as genetic ablation of Aldh1a2 prevented EtOH-mediated increases in Hoxa1 and Cyp26a1 transcripts (Fig. 4C).

Despite our inability to detect differences in RA levels between EtOH-treated and untreated ESCs (Fig. 4, D and E), depleting medium of ROL caused abrogation of EtOH-mediated transcriptional effects (Fig. 4C). Precedence for potent RA activity in the absence of detectable RA increases by MS is found in the literature. For example, Blaner and colleagues (54) demonstrated that Lrat (lecithin-retinol acyltransferase) ablation in the livers of mice was associated with increases in several RA response genes despite no detectable changes in RA levels measured by a highly sensitive LC-MS protocol. This is in line with our own findings, as an Lrat-deficient state in the liver mimics the natural state of ESCs, which are not equipped for ROL storage as esters (27). Excess retinaldehyde that is not oxidized to RA for downstream transcription would instead be converted back to ROL by Dhrs3 to maintain homeostasis (34).

Restoration of Hoxa1 and Cyp26a1 transcript induction by EtOH occurred upon adding ROL back into ROL-depleted medium, showing a retinoid requirement and implying enhanced sensitivity to available ROL in the presence of EtOH (Fig. 4C). To determine the mechanism underlying increased sensitivity to available ROL by EtOH, we measured mRNAs of genes in the ROL metabolism pathway and found increases in several, including Rbp1, Crabp2, Rdh10, and Dhrs3 (Fig. 3). Rdh10 and Dhrs3 exist in a bifunctional complex to ensure that RA levels are tightly controlled (34). Although increasing the Rdh10 level in the presence of ROL proportionally increases detectable RA levels, an increase in both protein components, Rdh10 and Dhrs3, of the oligomeric complex prevents overall levels of RA from rising intracellularly (34). In our study, both Rdh10 and Dhrs3 mRNAs increase following EtOH treatment, with larger increases in Dhrs3, consistent with higher levels of Dhrs3 being required for fine-tuning retinoid oxidoreductase complex activity (34).

In addition, although Cyp26a1 transcript levels were elevated by EtOH, we do not think that Cyp26a1 is a major contributor to the lack of detectable changes in RA levels after EtOH addition, as levels of 4-oxo-RA, a common polar metabolite formed from Cyp26a1 oxidation of RA, were not increased but rather trended downward (Fig. 4F). This finding is consistent with a model of EtOH causing enhanced sensitivity of ESCs to low amounts of RA generated from ROL metabolized by the retinoid oxidoreductase complex (model, Fig. 6).

Figure 6.

Figure 6.

Model for ethanol regulation of stem cell differentiation via activation of RA signaling. ROL, in complex with Rbp4, is a substrate for Stra6, which imports ROL into the cell. EtOH increases the mRNAs of Stra6 and several genes in the RA synthesis pathway, including Rdh10, Dhrs3, Rbp1, and Crabp2. Intracellular ROL is either converted to 4-oxoretinol via Cyp26a1 or presented to the RA synthesis machinery upon binding to Rbp1. ROL is not stored as retinyl esters in ESCs, as Lrat is not expressed in these cells. The Rdh10/Dhrs3 complex oxidizes ROL to retinaldehyde, which serves as a substrate for Aldh1a2-catalyzed oxidation to all-trans-RA. Newly formed RA is then transported to the nucleus by Crabp2, where it activates the RARγ/RXR transcriptional complex to stimulate expression of RA-responsive genes necessary for ESC differentiation.

Stra6-dependent retinol uptake from the medium facilitates efficient conversion of retinol to retinoic acid by Rdh10 for signaling in ethanol-treated embryonic stem cells

The Stra6 transporter, which facilitates ROL intracellular uptake, exhibited increased mRNA levels following EtOH treatment (Fig. 5A), and loss of Stra6 RARE function was sufficient to abrogate EtOH-mediated increases in Hoxa1 and Cyp26a1 transcripts (Fig. 5D). Stra6 has “gatekeeper” functions in ESCs; in the absence of EtOH we speculate that the “gate” remains closed and ROL cannot enter the cells in high enough quantities to facilitate signaling. Given that ESCs express only a very low level of Lrat for ROL storage as retinyl esters (27), ROL entering the cells via the Stra6 transporter should be preferentially oxidized to RA. This suggests that EtOH may exert more toxicity via greater signaling through the RA pathway in cell types that do not express much Lrat. Because RA levels were not increased despite functional effects on expression of differentiation-related genes, it is likely that a steady influx of ROL through Stra6 followed by ROL conversion to RA via Rdh10 occurs, with efficient usage of newly synthesized RA to trigger nuclear signaling and subsequent differentiation through RARγ-mediated transcription (model, Fig. 6). Our findings in Rdh10-null ESCs further support this model. The activation of differentiation-associated genes by EtOH was completely abrogated in Rdh10-null ESCs (Fig. 5I). These results suggest that ROL is preferentially oxidized by Rdh10 upon EtOH treatment. Despite the failure of ROL to induce differentiation-associated mRNAs in the absence of a functional Stra6 RARE, induction of these mRNAs in Rdh10-null ESCs by EtOH was similar to that in WT. This suggests that once ROL is imported into ESCs it can still signal in the absence of oxidation by Rdh10, possibly via its efficient intracellular conversion to 4-oxoretinol, which serves as a direct ligand for RARs (55, 56).

Conclusions

Our findings collectively improve our understanding of the mechanisms by which EtOH metabolism affects RARγ signaling and differentiation in stem cells. We have demonstrated that EtOH causes stem cell differentiation via the activation of RA:RARγ-mediated transcription in pluripotent stem cells. We propose a model of enhanced ROL uptake in EtOH-treated ESCs, whereby EtOH causes Stra6-dependent ROL uptake into ESCs, followed by its conversion to RA by Rdh10 and Aldh1a2. RA is then transported to the nucleus to bind RARγ for RA:RAR/RXR-mediated transcription (Fig. 6). Because ESCs represent an early stage in a dynamic cascade of events in early embryogenesis, they serve as a good model for studying EtOH stem cell toxicity. Our lab has previously shown that exogenous RA stimulates target gene transcription in doses as low as 100 pm (24), and thus EtOH effects, via changes in RA signaling, can potentially greatly shift the trajectory of cell fate decisions to alter developmental outcomes. Our data raise the exciting possibility that stem cell–related complications of EtOH exposure may be amenable to manipulation of RAR target genes for the prevention of EtOH-associated toxicities and diseases.

Experimental procedures

Cell culture and reagents

AB1, CCE, RARβ+/−γ−/−, RARγE8−/−, and Stra6RARE−/− ESCs were cultured as described previously (24, 26, 29, 37, 45). Cells were treated with 95% EtOH; 1 mm AcH (Calbiochem); 1 mm sodium acetate (Sigma), pH = 7.4; 0.1, 0.5, or 1 μm ROL (Sigma); and all-trans-RA (Sigma) at concentrations of 0.1 or 1 μm dissolved in 100% DMSO. AcH was aliquoted from a freshly opened bottle and tubes were stored at −20 °C for no more than 2 months. Each aliquot was immediately discarded after being added to the medium. Retinoids were prepared in dim light from a 1 mm stock solution. We used 1 μm RA for experiments to differentiate ESCs along an extraembryonic endoderm lineage, and 0.5 μm as a positive control for stimulating RARE activation in the β-gal assay. 0.1% DMSO was added to each treatment group not containing RA. ESCs were seeded in 6-well plates and harvested simultaneously for treatments conducted 72, 48, or 24 h prior to collecting lysates. Reagents were changed twice daily ∼12 h apart, with the final reagent change completed 8 h prior to harvest. EtOH was used at concentrations of 40 mm and 80 mm in various experiments. 103 units/ml of leukemia inhibitory factor was added to medium for all experiments, including medium in which KnockOutTM SR (Gibco) replaced ESC-grade fetal calf serum.

β-gal assay

β-gal assays were performed as described previously (22). CCE cells were grown in 6-well plates and transfected the following day with 2–3 μg of either WT Hoxa1 minigene-lacZ or Hoxa1-lacZ muRARE constructs. A pGL3-luciferase construct with an upstream SV40 promoter was simultaneously transfected at 0.1–0.2 μg (15:1 ratio sample:control) to normalize β-gal activity to luciferase expression. Cells were treated 48 h after transfection with DMSO (0.05%), 40 mm EtOH, or 0.5 μm RA for 24 h with a reagent change 8 h prior to harvest. RA doses above 0.5 μm did not cause additional stimulation of reporter assays. Cells were collected in TEN buffer and sonicated to prepare lysates for the β-gal assays.

Generation of Aldh1a2E5−/− and Rdh10E2−/− lines

CRISPR constructs for Aldh1a2E5−/− line creation were generated using the pX461, pSpCas9n(BB)-2A-GFP nickase vector (Addgene #48140). The CRISPRevolution Synthetic RNA kit was used in generating Rdh10E2−/− cells (Synthego, San Francisco, CA). Single cell dilutions were plated and grown for 1 week. Colonies were subsequently grown in 24-well plates and harvested in PBS. Clones were genotyped for genome editing by PCR amplification followed by restriction digestion. Clones lacking the restriction site were Sanger sequenced on both alleles and double-positive knockout clones were expanded in culture (see supporting “Materials and methods”).

ChIP assays

Experiments were performed as described previously (18) with described antibodies (see supporting “Materials and methods”). Primers used for PCR analyses are detailed in Table S1.

Retinoid extraction and HPLC–tandem MS analysis

Lysates were collected in PBS and extracted using 50% acetonitrile/butanol and saturated K2HPO4 (57). The organic phase was vacuum dried and reconstituted in 100% acetonitrile before loading. Retinoid separation was conducted using HPLC (Agilent, Palo Alto, CA) and Jet Stream electrospray ionization in positive ion mode. Reversed phase HPLC–tandem MS analysis was performed as described previously (58) (see supporting “Materials and methods”).

Statistical treatment of the data

Statistical analysis was conducted on at least three independent biological replicates for each experiment using GraphPad Prism 7.0 software. The mean ± S.E. was determined. Analysis of variance (ANOVA) was used to determine statistical significance within sets of three or more groups, and Student's t test was used to compare two independent populations. A two-tailed p value <0.05 was considered statistically significant.

Accession numbers

NCBI Gene identifiers for murine genes featured in this study include aldehyde dehydrogenase 1 family member A2 (Aldh1a2, ID: 19378), retinol dehydrogenase 10 (Rdh10, ID: 98711), retinoic acid receptor γ (RARγ, ID: 5916), and stimulated by retinoic acid 6 (Stra6, ID: 20897).

Author contributions

R. N. S., K. B. L., A. M. U., and L. J. G. conceptualization; R. N. S., K. B. L., and A. M. U. data curation; R. N. S. formal analysis; R. N. S. and L. J. G. funding acquisition; R. N. S. validation; R. N. S. and K. B. L. investigation; R. N. S. visualization; R. N. S., K. B. L., S. S. G., and L. J. G. methodology; R. N. S. writing-original draft; R. N. S., K. B. L., A. M. U., S. S. G., and L. J. G. writing-review and editing; S. S. G. and L. J. G. resources; S. S. G. software; S. S. G. and L. J. G. supervision; S. S. G. and L. J. G. project administration.

Supplementary Material

Supporting Information

Acknowledgments

We thank members of the Gudas and Gross laboratories for insights they provided. We especially thank Dr. YuLiang Ma for assistance with mass spectrometer operation and data analysis.

This research was supported by the National Institutes of Health Grants F31-AA024024 (to R. N. S.) and T32-CA062948, R01-AA018332, and R21-AA021484 (to L. J. G.). The authors declare that they have no conflicts of interest with the contents of this article. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health.

2
The abbreviations used are:
FASD
fetal alcohol spectrum disorders
AcH
acetaldehyde
ESC
embryonic stem cell
KOSR
knockout serum replacement (medium)
n.s.
not significant
RA
all-trans retinoic acid
RAR
retinoic acid receptor
RARE
retinoic acid response element
RE
retinyl esters
ROL
retinol
RT-qPCR
quantitative reverse transcriptase PCR
RXR
retinoid X receptor.

References

  • 1. Young R. A. (2011) Control of the embryonic stem cell state. Cell 144, 940–954 10.1016/j.cell.2011.01.032 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Arzumnayan A., Anni H., Rubin R., and Rubin E. (2009) Effects of ethanol on mouse embryonic stem cells. Alcohol. Clin. Exp. Res. 33, 2172–2179 10.1111/j.1530-0277.2009.01057.x [DOI] [PubMed] [Google Scholar]
  • 3. Veazey K. J., Carnahan M. N., Muller D., Miranda R. C., and Golding M. C. (2013) Alcohol-induced epigenetic alterations to developmentally crucial genes regulating neural stemness and differentiation. Alcohol. Clin. Exp. Res. 37, 1111–1122 10.1111/acer.12080 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Yelin R., Kot H., Yelin D., and Fainsod A. (2007) Early molecular effects of ethanol during vertebrate embryogenesis. Differentiation 75, 393–403 10.1111/j.1432-0436.2006.00147.x [DOI] [PubMed] [Google Scholar]
  • 5. Smith S. M., Garic A., Flentke G. R., and Berres M. E. (2014) Neural crest development in fetal alcohol syndrome. Birth Defects Res. Part C. Embryo Today Rev. 102, 210–220 10.1002/bdrc.21078 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. López-Lázaro M. (2016) A local mechanism by which alcohol consumption causes cancer. Oral. Oncol. 62, 149–152 10.1016/j.oraloncology.2016.10.001 [DOI] [PubMed] [Google Scholar]
  • 7. Gudas L. J., and Wagner J. A. (2011) Retinoids regulate stem cell differentiation. J. Cell Physiol. 226, 322–330 10.1002/jcp.22417 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Samarut E., and Rochette-Egly C. (2012) Nuclear retinoic acid receptors: Conductors of the retinoic acid symphony during development. Mol. Cell Endocrinol. 348, 348–360 10.1016/j.mce.2011.03.025 [DOI] [PubMed] [Google Scholar]
  • 9. Clagett-Dame M., and Knutson D. (2011) Vitamin A in reproduction and development. Nutrients 3, 385–428 10.3390/nu3040385 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Zachman R. D., and Grummer M. A. (1998) The interaction of ethanol and vitamin A as a potential mechanism for the pathogenesis of fetal alcohol syndrome. Alcohol. Clin. Exp. Res. 22, 1544–1556 10.1111/j.1530-0277.1998.tb03948.x [DOI] [PubMed] [Google Scholar]
  • 11. Sulik K. K., Cook C. S., and Webster W. S. (1988) Teratogens and craniofacial malformations: Relationships to cell death. Development 103, (suppl.) 213–231 [DOI] [PubMed] [Google Scholar]
  • 12. Marrs J. A., Clendenon S. G., Ratcliffe D. R., Fielding S. M., Liu Q., and Bosron W. F. (2010) Zebrafish fetal alcohol syndrome model: Effects of ethanol are rescued by retinoic acid supplement. Alcohol 44, 707–715 10.1016/j.alcohol.2009.03.004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Molotkov A., and Duester G. (2002) Retinol/ethanol drug interaction during acute alcohol intoxication in mice involves inhibition of retinol metabolism to retinoic acid by alcohol dehydrogenase. J. Biol. Chem. 277, 22553–22557 10.1074/jbc.M201603200 [DOI] [PubMed] [Google Scholar]
  • 14. Yelin R., Schyr R. B., Kot H., Zins S., Frumkin A., Pillemer G., and Fainsod A. (2005) Ethanol exposure affects gene expression in the embryonic organizer and reduces retinoic acid levels. Dev. Biol. 279, 193–204 10.1016/j.ydbio.2004.12.014 [DOI] [PubMed] [Google Scholar]
  • 15. Kane M. A., Folias A. E., Wang C., and Napoli J. L. (2010) Ethanol elevates physiological all-trans-retinoic acid levels in select loci through altering retinoid metabolism in multiple loci: A potential mechanism of ethanol toxicity. FASEB J. 24, 823–832 10.1096/fj.09-141572 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Kim Y. K., Zuccaro M. V., Zhang C., Sarkar D., and Quadro L. (2015) Alcohol exposure in utero perturbs retinoid homeostasis in adult rats. Hepatobiliary Surg. Nutr. 4, 268–277 10.3978/j.issn.2304-3881.2015.01.06 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Mark M., Ghyselinck N. B., and Chambon P. (2006) Function of retinoid nuclear receptors: Lessons from genetic and pharmacological dissections of the retinoic acid signaling pathway during mouse embryogenesis. Annu. Rev. Pharmacol. Toxicol. 46, 451–480 10.1146/annurev.pharmtox.46.120604.141156 [DOI] [PubMed] [Google Scholar]
  • 18. Urvalek A. M., and Gudas L. J. (2014) Retinoic acid and histone deacetylases regulate epigenetic changes in embryonic stem cells. J. Biol. Chem. 289, 19519–19530 10.1074/jbc.M114.556555 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Gudas L. J. (2013) Retinoids induce stem cell differentiation via epigenetic changes. Semin. Cell Dev. Biol. 24, 701–705 10.1016/j.semcdb.2013.08.002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Stowell A. R., and Stowell L. I. (1998) Estimation of blood alcohol concentrations after social drinking. J. Forensic. Sci. 43, 14–21 [PubMed] [Google Scholar]
  • 21. Simandi Z., Horvath A., Wright L. C., Cuaranta-Monroy I., De Luca I., Karolyi K., Sauer S., Deleuze J. F., Gudas L. J., Cowley S. M., and Nagy L. (2016) OCT4 acts as an integrator of pluripotency and signal-induced differentiation. Mol. Cell 63, 647–661 10.1016/j.molcel.2016.06.039 [DOI] [PubMed] [Google Scholar]
  • 22. Langston A. W., Thompson J. R., and Gudas L. J. (1997) Retinoic acid-responsive enhancers located 3′ of the Hox A and Hox B homeobox gene clusters. Functional analysis. J. Biol. Chem. 272, 2167–2175 10.1074/jbc.272.4.2167 [DOI] [PubMed] [Google Scholar]
  • 23. Al Tanoury Z., Gaouar S., Piskunov A., Ye T., Urban S., Jost B., Keime C., Davidson I., Dierich A., and Rochette-Egly C. (2014) Phosphorylation of the retinoic acid receptor RARγ2 is crucial for the neuronal differentiation of mouse embryonic stem cells. J. Cell Sci. 127, 2095–2105 10.1242/jcs.145979 [DOI] [PubMed] [Google Scholar]
  • 24. Chen A. C., and Gudas L. J. (1996) An analysis of retinoic acid-induced gene expression and metabolism in AB1 embryonic stem cells. J. Biol. Chem. 271, 14971–14980 10.1074/jbc.271.25.14971 [DOI] [PubMed] [Google Scholar]
  • 25. Seitz H. K., and Stickel F. (2007) Molecular mechanisms of alcohol-mediated carcinogenesis. Nat. Rev. Cancer 7, 599–612 10.1038/nrc2191 [DOI] [PubMed] [Google Scholar]
  • 26. Laursen K. B., and Gudas L. J. (2018) Combinatorial knockout of RARα, RARβ, and RARγ completely abrogates transcriptional responses to retinoic acid in murine embryonic stem cells. J. Biol. Chem. 293, 11891–11900 10.1074/jbc.RA118.001951 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Kashyap V., Laursen K. B., Brenet F., Viale A. J., Scandura J. M., and Gudas L. J. (2013) RARγ is essential for retinoic acid induced chromatin remodeling and transcriptional activation in embryonic stem cells. J. Cell Sci. 126, 999–1008 10.1242/jcs.119701 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Gillespie R. F., and Gudas L. J. (2007) Retinoid regulated association of transcriptional co-regulators and the polycomb group protein SUZ12 with the retinoic acid response elements of Hoxa1, RARβ2, and Cyp26A1 in F9 embryonal carcinoma cells. J. Mol. Biol. 372, 298–316 10.1016/j.jmb.2007.06.079 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Kashyap V., Gudas L. J., Brenet F., Funk P., Viale A., and Scandura J. M. (2011) Epigenomic reorganization of the clustered Hox genes in embryonic stem cells induced by retinoic acid. J. Biol. Chem. 286, 3250–3260 10.1074/jbc.M110.157545 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Zhang X., Lian Z., Padden C., Gerstein M. B., Rozowsky J., Snyder M., Gingeras T. R., Kapranov P., Weissman S. M., and Newburger P. E. (2009) A myelopoiesis-associated regulatory intergenic noncoding RNA transcript within the human HOXA cluster. Blood 113, 2526–2534 10.1182/blood-2008-06-162164 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Gudas L. J., and Wang S. Y. (1986) The regulation of collagen type IV(alpha 1) and other genes during the retinoic acid induced differentiation of wild type and mutant mouse teratocarcinoma stem cells. Prog. Clin. Biol. Res. 226, 181–189 [PubMed] [Google Scholar]
  • 32. Creyghton M. P., Cheng A. W., Welstead G. G., Kooistra T., Carey B. W., Steine E. J., Hanna J., Lodato M. A., Frampton G. M., Sharp P. A., Boyer L. A., Young R. A., and Jaenisch R. (2010) Histone H3K27ac separates active from poised enhancers and predicts developmental state. Proc. Natl. Acad. Sci. U.S.A. 107, 21931–21936 10.1073/pnas.1016071107 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Delva L., Bastie J. N., Rochette-Egly C., Kraïba R., Balitrand N., Despouy G., Chambon P., and Chomienne C. (1999) Physical and functional interactions between cellular retinoic acid binding protein II and the retinoic acid-dependent nuclear complex. Mol. Cell Biol. 19, 7158–7167 10.1128/MCB.19.10.7158 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Belyaeva O. V., Adams M. K., Wu L., and Kedishvili N. Y. (2017) The antagonistically bifunctional retinoid oxidoreductase complex is required for maintenance of all-trans-retinoic acid homeostasis. J. Biol. Chem. 292, 5884–5897 10.1074/jbc.M117.776914 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Liu L., and Gudas L. J. (2005) Disruption of the lecithin:retinol acyltransferase gene makes mice more susceptible to vitamin A deficiency. J. Biol. Chem. 280, 40226–40234 10.1074/jbc.M509643200 [DOI] [PubMed] [Google Scholar]
  • 36. White J. A., Guo Y. D., Baetz K., Beckett-Jones B., Bonasoro J., Hsu K. E., Dilworth F. J., Jones G., and Petkovich M. (1996) Identification of the retinoic acid-inducible all-trans-retinoic acid 4-hydroxylase. J. Biol. Chem. 271, 29922–29927 10.1074/jbc.271.47.29922 [DOI] [PubMed] [Google Scholar]
  • 37. Laursen K. B., Kashyap V., Scandura J., and Gudas L. J. (2015) An alternative retinoic acid-responsive Stra6 promoter regulated in response to retinol deficiency. J. Biol. Chem. 290, 4356–4366 10.1074/jbc.M114.613968 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Chen Y., Clarke O. B., Kim J., Stowe S., Kim Y. K., Assur Z., Cavalier M., Godoy-Ruiz R., von Alpen D. C., Manzini C., Blaner W. S., Frank J., Quadro L., Weber D. J., Shapiro L., Hendrickson W. A., and Mancia F. (2016) Structure of the STRA6 receptor for retinol uptake. Science 353, aad8266 10.1126/science.aad8266 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Bouillet P., Sapin V., Chazaud C., Messaddeq N., Décimo D., Dollé P., and Chambon P. (1997) Developmental expression pattern of Stra6, a retinoic acid-responsive gene encoding a new type of membrane protein. Mech. Dev. 63, 173–186 10.1016/S0925-4773(97)00039-7 [DOI] [PubMed] [Google Scholar]
  • 40. Deltour L., Ang H. L., and Duester G. (1996) Ethanol inhibition of retinoic acid synthesis as a potential mechanism for fetal alcohol syndrome. FASEB J. 10, 1050–1057 10.1096/fasebj.10.9.8801166 [DOI] [PubMed] [Google Scholar]
  • 41. Shabtai Y., Bendelac L., Jubran H., Hirschberg J., and Fainsod A. (2018) Acetaldehyde inhibits retinoic acid biosynthesis to mediate alcohol teratogenicity. Sci. Rep. 8, 347 10.1038/s41598-017-18719-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42. Collins M. D., and Mao G. E. (1999) Teratology of retinoids. Annu. Rev. Pharmacol. Toxicol. 39, 399–430 10.1146/annurev.pharmtox.39.1.399 [DOI] [PubMed] [Google Scholar]
  • 43. Gao W., Zhou P., Ma X., Tschudy-Seney B., Chen J., Magner N. L., Revzin A., Nolta J. A., Zern M. A., and Duan Y. (2014) Ethanol negatively regulates hepatic differentiation of hESC by inhibition of the MAPK/ERK signaling pathway in vitro. PLoS One 9, e112698 10.1371/journal.pone.0112698 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44. Sánchez-Alvarez R., Gayen S., Vadigepalli R., and Anni H. (2013) Ethanol diverts early neuronal differentiation trajectory of embryonic stem cells by disrupting the balance of lineage specifiers. PLoS One 8, e63794 10.1371/journal.pone.0063794 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45. Langton S., and Gudas L. J. (2008) CYP26A1 knockout embryonic stem cells exhibit reduced differentiation and growth arrest in response to retinoic acid. Dev. Biol. 315, 331–354 10.1016/j.ydbio.2007.12.021 [DOI] [PubMed] [Google Scholar]
  • 46. Fernandez C. C., and Gudas L. J. (2009) The truncated Hoxa1 protein interacts with Hoxa1 and Pbx1 in stem cells. J. Cell Biochem. 106, 427–443 10.1002/jcb.22023 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47. Moussaieff A., Rouleau M., Kitsberg D., Cohen M., Levy G., Barasch D., Nemirovski A., Shen-Orr S., Laevsky I., Amit M., Bomze D., Elena-Herrmann B., Scherf T., Nissim-Rafinia M., Kempa S., Itskovitz-Eldor J., Meshorer E., Aberdam D., and Nahmias Y. (2015) Glycolysis-mediated changes in acetyl-CoA and histone acetylation control the early differentiation of embryonic stem cells. Cell Metab. 21, 392–402 10.1016/j.cmet.2015.02.002 [DOI] [PubMed] [Google Scholar]
  • 48. Feuerborn A., and Cook P. R. (2015) Why the activity of a gene depends on its neighbors. Trends Genet. 31, 483–490 10.1016/j.tig.2015.07.001 [DOI] [PubMed] [Google Scholar]
  • 49. Taneja R., Roy B., Plassat J. L., Zusi C. F., Ostrowski J., Reczek P. R., and Chambon P. (1996) Cell-type and promoter-context dependent retinoic acid receptor (RAR) redundancies for RAR beta 2 and Hoxa-1 activation in F9 and P19 cells can be artefactually generated by gene knockouts. Proc. Natl. Acad. Sci. U.S.A. 93, 6197–6202 10.1073/pnas.93.12.6197 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50. Mendoza-Parra M. A., Walia M., Sankar M., and Gronemeyer H. (2011) Dissecting the retinoid-induced differentiation of F9 embryonal stem cells by integrative genomics. Mol. Syst. Biol. 7, 538 10.1038/msb.2011.73 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51. Kastner P., Mark M., and Chambon P. (1995) Nonsteroid nuclear receptors: What are genetic studies telling us about their role in real life? Cell 83, 859–869 10.1016/0092-8674(95)90202-3 [DOI] [PubMed] [Google Scholar]
  • 52. Taneja R., Bouillet P., Boylan J. F., Gaub M. P., Roy B., Gudas L. J., and Chambon P. (1995) Reexpression of retinoic acid receptor (RAR) gamma or overexpression of RAR alpha or RAR beta in RAR gamma-null F9 cells reveals a partial functional redundancy between the three RAR types. Proc. Natl. Acad. Sci. U.S.A. 92, 7854–7858 10.1073/pnas.92.17.7854 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53. Boylan J. F., Lohnes D., Taneja R., Chambon P., and Gudas L. J. (1993) Loss of retinoic acid receptor gamma function in F9 cells by gene disruption results in aberrant Hoxa-1 expression and differentiation upon retinoic acid treatment. Proc. Natl. Acad. Sci. U.S.A. 90, 9601–9605 10.1073/pnas.90.20.9601 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54. Wongsiriroj N., Jiang H., Piantedosi R., Yang K. J., Kluwe J., Schwabe R. F., Ginsberg H., Goldberg I. J., and Blaner W. S. (2014) Genetic dissection of retinoid esterification and accumulation in the liver and adipose tissue. J. Lipid Res. 55, 104–114 10.1194/jlr.M043844 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55. Achkar C. C., Derguini F., Blumberg B., Langston A., Levin A. A., Speck J., Evans R. M., Bolado J. Jr., Nakanishi K., Buck J., and Gudas L. J. (1996) 4-Oxoretinol, a new natural ligand and transactivator of the retinoic acid receptors. Proc. Natl. Acad. Sci. U.S.A. 93, 4879–4884 10.1073/pnas.93.10.4879 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56. Lane M. A., Chen A. C., Roman S. D., Derguini F., and Gudas L. J. (1999) Removal of LIF (leukemia inhibitory factor) results in increased vitamin A (retinol) metabolism to 4-oxoretinol in embryonic stem cells. Proc. Natl. Acad. Sci. U.S.A. 96, 13524–13529 10.1073/pnas.96.23.13524 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57. Suh M. J., Tang X. H., and Gudas L. J. (2006) Structure elucidation of retinoids in biological samples using postsource decay laser desorption/ionization mass spectrometry after high-performance liquid chromatography separation. Anal. Chem. 78, 5719–5728 10.1021/ac060492j [DOI] [PubMed] [Google Scholar]
  • 58. Diani-Moore S., Ma Y., Gross S. S., and Rifkind A. B. (2014) Increases in levels of epoxyeicosatrienoic and dihydroxyeicosatrienoic acids (EETs and DHETs) in liver and heart in vivo by 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) and in hepatic EET:DHET ratios by cotreatment with TCDD and the soluble epoxide hydrolase inhibitor AUDA. Drug Metab. Dispos. 42, 294–300 10.1124/dmd.113.055368 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59. Talbot N. C., Rexroad C. E. Jr., Pursel V. G., and Powell A. M. (1993) Alkaline phosphatase staining of pig and sheep epiblast cells in culture. Mol. Reprod. Dev. 36, 139–147 10.1002/mrd.1080360204 [DOI] [PubMed] [Google Scholar]
  • 60. LaRosa G. J., and Gudas L. J. (1988) An early effect of retinoic acid: Cloning of an mRNA (Era-1) exhibiting rapid and protein synthesis-independent induction during teratocarcinoma stem cell differentiation. Proc. Natl. Acad. Sci. U.S.A. 85, 329–333 10.1073/pnas.85.2.329 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supporting Information

Articles from The Journal of Biological Chemistry are provided here courtesy of American Society for Biochemistry and Molecular Biology

RESOURCES