Molecular phylogeny provides new insights on the taxonomy and composition of Lyperosomum Looss, 1899 (Digenea, Dicrocoeliidae) and related genera

Abstract

Lyperosomum Looss, 1899 is one of the largest genera of the Dicrocoeliidae and is one of the best examples of the systematic complexity and taxonomic instability within this family. We present the molecular analyses based on novel sequences of nuclear and mitochondrial genes obtained from 56 isolates of adult flukes and larval stages of dicrocoeliids belonging to Lyperosomum, Skrjabinus, Zonorchis as well as previously available sequence data. According to obtained results we propose to return Zonorchis clathratus and Z. petiolatus into Lyperosomum, and to recognize L. alagesi as a synonym of L. petiolatum. Our study shows that L. petiolatum commonly occurs in Europe in corvids as well as in several species of migratory songbirds, e.g. Sylvia atricapilla. At the same time, the Turdidae appear to host a distinct species of Lyperosomum. The phylogenetic analysis has clearly demonstrated the paraphylepic nature of Lyperosomum and indicated the need of its thorough revision preferably using specimens from type hosts and type territories of nominal species. In addition, inclusion of numerous not yet sequenced dicrocoeliid genera into future phylogenetic studies is necessary to clarify the interrelationships of taxa within the family and stabilize its system.

Graphical abstract

Highlights

• •Significant discord exists between molecular data and current taxonomy of Lyperosomum.
• •Phylogenetic relationships of Lyperosomum, Skrjabinus and Zonorchis were studied.
• •Lyperosomum is a paraphyletic taxon.
• •Re-evaluation of morphological criteria used in dicrocoeliid systematics is needed.
• •Life cycle of Lyperosomum petiolatum is elucidated for the first time in the nature.

1. Introdution

Lyperosomum Looss, 1899 is one of the more speciose genera of the digenean family Dicrocoeliidae. The genus is characterized by the worldwide distribution and currently contains 33 species, the majority of them are found in biliary ducts of birds (Panin, 1984; Pojmańska, 2008). Two species, i.e. L. soricis (Diesing, 1858) and L. transcarpathicus (Bychovskaja-Pavlovskaja, Vysotzkaja and Kulakova, 1970), were described from shrews (Eulipotyphla), and one species, L. intermedium Denton and Kinsella, 1972, was described from the rice rat Oryzomys palustris (Denton and Kinsella, 1972); the latter species was moved to Dicrocoelium Dujardin, 1845 by Panin (1984). The taxonomy of the Dicrocoeliidae has been unstable and many species were transferred between various genera, mostly due to the high morphological similarity between dicrocoeliid taxa as well as the lack of understanding of the taxonomic value of traditionally used morphological characters (Yamaguti, 1958, 1971; Panin, 1984; Pojmańska, 2008). The genus Lyperosomum is one of the best examples of the systematic complexity and taxonomic instability within this group of digeneans.

Initially, Looss (1899) included 4 species in Lyperosomum with L. longicauda (Rudolphi, 1809) selected as a type species; at the time the genus was placed into the subfamily Dicrocoellinae along with Dicrocoelium. Over the time, a number of additional species have been described or transferred into Lyperosomum by different authors (Skrjabin and Evranova, 1952). In turn, some existing members of Lyperosomum have been transferred into other genera, e.g., Oswaldoia Travassos, 1919 and Lyperosomoides Yamaguti, 1971. Shtrom (1940) proposed a new classification of the Dicrocoellinae, dramatically changed the content of some existing genera and emphasized that Lyperosomum likely contained a number of species that were not closely related to each other. He transferred most species of Lyperosomum known at the time into either Brachylecithum Shtrom, 1940 or Corrigia Shtrom, 1940, while Lyperosomum retained only the type species and received 11 species transferred from other genera. Almost simultaneously, Travassos (1944) published his monographic revision of the Dicrocoeliidae. He also transferred a number of Lyperosomum species into other genera, e. g., Olssoniella Travassos, 1944 or Luztrema Travassos, 1941. According to Travassos (1944) Lyperosomum was characterized by a short forebody and conspicuous ventral sucker which made it similar to Zonorchis Travassos, 1944. However, the two genera differed by the relative position of the testes (oblique in Lyperosomum and symmetrical in Zonorchis). These revisions also proposed numerous other changes within the Dicrocoeliidae with Zonorchis and Platynosomum being particularly affected.

According to the most recent classification of the Dicrocoeliidae by Pojmańska (2008) Lyperosomum is characterized by the testes positioned closely to the ventral sucker, the ovary at substantial distance from the posterior testis, the genital pore usually located anterior to the intestinal bifurcation, the vitellarium forming two relatively short lateral bands of follicles and extending anteriorly past the level of the ovary, and the ventral sucker larger than the oral sucker. However, some of the species currently included in Lyperosomum do not fit one or several of the aforementioned criteria.

Denton and Krissinger (1975) concluded that Lyperosomum contains “a confusing assemblage of species of diverse morphology and uncertain relationships”. One of the best examples of such confusion is the tumultuous taxonomic history of Dicrocoelium petiolatum Railliet, 1900. Shtrom (1940) and Travassos (1944) independently suggested its transfer to Lyperosomum; then it was moved to Zonorchis by Denton and Byrd (1951) and Dicrocoelioides by Dollfus (1954); thereafter, Panin (1984) placed it back in Zonorchis and most recently, the whole genus Zonorchis was synonymized with Skrjabinus Bhalerao, 1936 by Pojmańska (2008).

DNA sequence data provide an important additional, complementary set of characters for phylogenetic inference. Although the history of the molecular systematic studies of the Dicrocoeliidae is relatively short, these studies have already provided important insights into the interrelationships among some key dicrocoeliid taxa and their systematic position (Tkach et al., 2001, 2018; Ribas et al., 2012; Hildebrand et al., 2015, 2016; Aldhoun et al., 2018; Pinto et al., 2018; Hildebrand and Tkach, 2019). Among other contributions, the molecular phylogenetic analyses strongly suggested that the subfamily-based structure as proposed in previous systems of the family, including the most recent revision by Pojmańska (2008) is not supported by the phylogeny and needs to be abandoned (Tkach et al., 2018). Nevertheless, the progress in revealing the interrelationships among dicrocoeliid taxa has been overall slow, mostly due to the insufficient representation of the dicrocoeliid diversity (comprising 47 genera and more than 400 species) in the molecular phylogenetic studies.

We obtained novel DNA sequences for adult and larval stages of several species of dicrocoeliids, mainly from the Lyperosomum petiolatum/collurionis group. We present the results of molecular phylogenetic analyses using nuclear and mitochondrial markers and discuss the obtained data in relation to the systematic position, morphological variability, host specificity and life cycles of these taxa.

2. Material and methods

2.1. Sample collection

Specimens of adult flukes from the family Dicrocoeliidae Looss, 1899 were collected by the authors mostly as a part of long-term helminthological studies carried out in the Czech Republic (Moravia) by Jiljí Sitko and in different regions of the Americas and Africa by Vasyl Tkach. Some additional specimens of adult digeneans, were obtained from birds and small mammals found dead from various causes in different regions of Poland (mainly Lower Silesia and Mazovia districts). Rudimentary-tailed dicrocoeliid xiphidocercariae enclosed in daughter-sporocysts were collected from slugs in different regions of Poland. In the same localities, snails and terrestrial isopods were checked for the presence of dicrocoeliid larval stages (Table 1). Both adult and larval stages were collected live, rinsed in saline, heat-killed with hot water, preserved in 70% ethanol and stored at −20 °C. Measurements and images were taken with an Olympus BX50 microscope equipped with Olympus DP25 digital camera.

Table 1.

The list of dicrocoeliids used in the molecular analyses. GenBank numbers of new sequences obtained in this study are in bold. Abbreviations: A – Aves, C – Crustacea, G – Gastropoda, M – Mammals.

Digenean taxa current/previous names	Host species and geographic origin	Hosts	GenBank Nos
			28S	cox1	nad1
Lyperosomum petiolatum/L. alagesi	Pica pica Czech Republic	A	MK478480 MK478473 MK626683	MK445302 MK445292	MK391419 MK391420
L. petiolatum/L. alaudae	Alauda arvensis Czech Republic	A	MK478485	MK445315	−
L. petiolatum/L. collurionis	Sylvia atricapilla Czech Republic	A	KU212193 MK478474	KU212192 MK445303 MK621923	MK391422 MK391421 MK621918 MK621919 MK621920
Lyperosomum sp. 1	Acrocephalus arundinaceus Czech Republic	A	MK496656	MK445285	–
Lyperosomum sp. 2	Delichon urbica Czech Republic	A	MK496657 MK626682	–	MK391431
L. petiolatum	Emberiza schoeniclus Czech Republic	A	MK478475	MK445304	MK391423
L. petiolatum	Cyanistes caerulaeus Czech Republic	A	MK478476	MK445305	MK391424
L. petiolatum/L. platynosomoides	Parus major Czech Republic	A	MK478483	MK445299	–
L. petiolatum	Motacilla alba Czech Republic	A	MK478477 MK626684	MK445306	MK391425 MK621921
L. petiolatum/L. dujardini	Prunella modularis Czech Republic	A	MK478484 MK478478 MK626685	MK445307 MK445300	MK391426 MK621922
Lyperosomum cf. turdia/Zonorchis petiolatum	Turdus philomelos Czech Republic	A	MK478496	MK445292	MK391427
Lyperosomum cf. turdia/Z. petiolatum	Turdus merula Czech Republic	A	MK478497	MK445293 MK445294 MK445295	MK391428 MK391429 MK507897
Lyperosomum cf. turdia/Z. petiolatum	Turdus merula Poland	A	MK478486	MK445291	–
L. petiolatum/Z. petiolatum	Corvus frugilegus Czech Republic	A	MK478479	–	–
L. petiolatum/Z. petiolatum	Corvus frugilegus Poland	A	MK478472 MK621181	MK445301 MK621924	MK391418
L. petiolatum/Z. petiolatum	Garrulus glandarius Poland	A	MK478481	MK445296	–
L. petiolatum/Zonorchis sp.	Erinaceus roumanicus Poland	M	MK478482	MK445297	–
L. petiolatum sporocysts 1	Limax maximus Poland	G	MK478487 MK618573 MK618574 MK618575	MK445308 MK621925 MK621926 MK621927	–
L. petiolatum sporocysts 1	Deroceras reticulatum Poland	G	MK478488 MK618576	MK445309 MK621928	–
L. petiolatum sporocysts 1	Cepaea nemoralis Poland	G	MK478489	MK445310	–
L. petiolatum sporocysts 2	Limax maximus Poland	G	MK478491	MK445312	–
L. petiolatum metacercariae 1	Porcellio scaber Poland	C	MK478492 MK618577 MK618578 MK618579	MK445313 MK621929 MK621930 MK621931	–
L. petiolatum metacercariae 1	Ligia sp. Poland	C	MK618580	MK621932	–
L. petiolatum metacercariae 2	Porcellio scaber Poland	C	MK478481	MK445296	–
Lyperosomum sp. 3	Pogoniulus scolopaceus Uganda	A	MK480326	–	–
Lyperosomum clathratum/Zonorchis clathratus	Apus apus Czech Republic	A	MK478493 MK478494	MK445289 MK445290 MK445287 MK445288	MK391430
Skrjabinus kalmikensis	Delichon urbica Czech Republic	A	MK478495	MK445286	MK391432
Zonorchis alveyi	Zonotrichia albicollis USA	A	MK480327	–	–
Zonorchis delectans	Caryothraustes poliogaster Costa Rica	A	MK480329	–	–
Zonorchis sp.	Phaenostictus mcleannani Costa Rica	A	MK480328	–	–
Stromitrema koshewnikowi	Hirundo rustica Czech Republic	A	MK474483	MK445284	–
Anenterotrema auritum	Glossophaga soricina Ecuador	M	MH158566	–	–
Brachydistomum ventricosum	Erithacus rubecula Czech Republic	A	KU563713	–	–
Brachylecithum lobatum	Corvus corone Czech Republic	A	KU212200	–	–
Dicrocoelium dendriticum	Marmota bobak Ukraine	M	AF151939	–	–
Dicrocoelium dendriticum	−		–	NC025280	NC025280
Dicrocoeliidae sp. cercariae	Discus pauper Japan	G	MG845913	–	–
Eurytrema pancreaticum	Sheep China	M	KY490000	–	–
Eurytrema pancreaticum	Sheep China	M	KY490004	–	–
Lutziella microacetabulare	Hipposideros armiger Vietnam	M	MH158562	–	–
Lutztrema attenuatum	Turdus merula Poland	A	KT387687	–	–
Lyperosomum collurionis	Sylvia atricapilla Czech Republic	A	AY222259	–	–
Lyperosomum sarothrurae	Sarothrura pulchra Democratic Republic of the Congo	A	KP765767	–	–
Lyperosomum transcarpathicus	Sorex minutus Ukraine	M	AF151943	–	–
Lyperosomum intermedium	Oryzomys palustris USA	M	MH158563	–	–
Lyperosomum sp.	Turdus merula Czech Republic	A	MG560864	–	–
Metadelphis lenti	Lonchophylla robusta Panama	M	MH158568	–	–
Platynosomum illiciens	Callithrix penicillata Brazil	M	MH156571	–	–
Platynosomum illiciens	Mus musculus Brazil	M	MH156570	–	–
Pojmanskatrema balcanica	Neomys fodiens Bulgaria	M	MK426285	–	–

2.2. Molecular data

2.2.1. PCR amplification

DNA was extracted from single individuals of adult digeneans and metacercaria or from a single sporocyst containing cercariae using DNeasy Blood and Tissue Kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions. PCR reactions were performed with the use of KAPA2G Robust HotStart ReadyMix (Sigma-Aldrich) or OneTaq Quick-load Mastermix (New England Biolabs). Approximately 1200 nucleotide (nt) long fragment of partial sequence of the nuclear large ribosomal subunit gene (LSU) including variable domains D1–D3 was amplified by PCR with the forward primers LSU5, digl2 and the reverse primer 1500R (Tkach et al., 2003). The thermocycling profile was as follows: 3 min denaturation at 95 °C; 35 cycles of 30 s at 95 °C, 30 s at 50 °C, and 1 min at 72 °C; and 5 min extension at 72 °C. PCR primers and additional dicrocoeliid-specific internal forward primer di890f and reverse primers di390r and di970r (Tkach et al., 2018) were used in sequencing reactions. Extracted DNA was also used for the amplification of the partial mitochondrial cytochrome c oxidase subunit 1 (cox1) gene and the partial mitochondrial gene nicotinamide adenine dinucleotide dehydrogenase subunit 1 (nad1) gene. The 400–420 nt long cox1 fragment was amplified using the forward primers COIDF1 and the reverse primers COITR1 or COIDR1 (Hildebrand et al., 2016) as well as the forward primer ACOX650F (reverse ACOX650R) (Kudlai et al., 2015), with the following thermocycling profile: 3 min denaturation at 94 °C; 35 cycles of 30 s at 94 °C, 30 s at 50 °C, and 1 min at 72 °C; and 5 min extension at 72 °C. An approximately 520bp long fragment of nad1 gene was amplified using the forward primer NDJ11 and the reverse primer NDJ2a (Kostadinova et al., 2003). The thermocycling profile was as follows: denaturation at 95 °C for 3 min, followed by 35 cycles with 30 s denaturation at 95 °C, 20 s primer annealing at 47 °C, and 45 s at 72 °C for primer extension, with a final extension step of 7 min at 72 °C. Sequences of all primers used in this study are provided in Table 2. Obtained PCR products were purified with Exo-BAP Kit (EURx, Poland), Exo-Sap IT PCR Product Clean-up kit (Affymetrix, USA) or QIAquick Gel Extraction Kit (Qiagen, Germany). Purified products were sequenced directly using ABI BigDye™ chemistry (Applied Biosystems, USA) on an ABI Prism 373xl or an ABI Prism 3100™ automated sequencers.

Table 2.

List of primers used in present study.

LOCUS	PRIMER	SEQUENCE (5′–3′)	REFERENCE
28S	LSU5	TAGGTCGACCCGCTGAAYTTAAGCA	Tkach et al. (2003)
	digl2	AAGCATATCACTAAGCGG	Tkach et al. (2003)
	1500R	GCTATCCTGAGGGAAACTTCG	Tkach et al. (2003)
	di890f	GAGGGCCAATAGTCTGTGGTG	Tkach et al. (2018)
	di390r	GCTTGCAGTTCAACTCCACC	Tkach et al. (2018)
	di970r	ACTGCGCCTGTGGGTTTCG	Tkach et al. (2018)
COX1	ACOX650F	CAGCATATGTTTTGGTTTTTTGG	Kudlai et al. (2015)
	COIDF1	TATTGTTTCAGCATATGTTTTG	Hildebrand et al. (2016)
	COIDR1	CAACAAACCAAGTATCATGCAAC	Hildebrand et al. (2016)
	COITR1	CAACAACAAACCAAGTATCATG	Laskowski and Rocka (2014)
NAD1	NDJ11 (JB11)	AGATTCGTAAGGGGCCTAATA	Morgan et al., 1998
	NDJ2a	CTTCAGCCTCAGCATAAT	Kostadinova et al. (2003)

2.2.2. Phylogenetic analysis

Phylogenetic analysis was performed based on partial sequences of the nuclear large ribosomal subunit rRNA (28S) gene using the newly generated sequences and matching sequences of the representatives of all dicrocoeliid genera available in GenBank (Table 1) including all sequences of the genera formerly included in the Dicrocoeliinae. Forward and reverse sequences were assembled using ContigExpress (Vector NTI Advance 11, Invitrogen) and Sequencher™ ver. 4.2 (GeneCodes Corp., Ann Arbor) software. Contiguous sequences were submitted to GenBank (Table 1). 28S sequences were aligned using Clustal W implemented in MEGA v7 (Kumar et al., 2016). The alignment was trimmed to the length of the shortest sequence. Phylogenetic trees were constructed using Bayesian inference (BI) as implemented in the MrBayes version 3.2.6 software (Ronquist and Huelsenbeck, 2003). The general time reversible model with estimates of invariant sites and gamma distributed among-site variation (GTR + I + G) was chosen as the best-fitting nucleotide substitution model for dataset using JModelTest version 2.1.4 software (Guindon and Gascuel, 2003; Darriba et al., 2012). Sequence of Encyclometra colubrimurorum (Rudolphi, 1819), GenBank accession number AF184254, was used as the outgroup based on the previously published phylogenies (Tkach et al., 2001, 2018). BI analysis was performed as follows: Markov chain Monte Carlo (MCMC) chains was run for 2,000,000 generations, log-likelihood scores were plotted and the final 75% of trees were used to produce the consensus tree.

In addition, partial sequences of the mitochondrial cox1 and nad1 genes obtained from adults and larvae of dicrocoeliids were aligned as above, trimmed to the length of the shortest sequence in each case and concatenated for the combined phylogenetic analysis. The cox1 dataset included a greater number of sequences and thus was also utilized for pairwise nucleotide comparisons carried out using the BioEdit 7.0.9 program (Tom Hall, Ibis Biosciences, Carlsbad, CA, USA, 2007). The phylogenetic analyses were carried out using the BI in the MrBayes program. The parameters for each of the concatenated datasets were estimated separately, using the Akaike information criterion (AIC) calculated by the JModelTest 2.1.4 software. The HKY + G model of nucleotide substitution was identified as the best fitting model for the cox1 and nad1 datasets independently. The sequence of Dicrocoelium dendriticum (NC 025280) was used as outgroup in this analysis based on the results of our 28S rDNA analysis. BI analysis of mitochondrial sequences was performed with the same parameters as the 28S rDNA analysis except for the different nucleotide substitution models. Phylogenetic trees were visualized using the TreeView software.

3. Results

We obtained sequence data from a total of 56 isolates of dicrocoeliids, including adult stages from birds (20 species) and mammals (1) and larval stages from slugs (2), snails (1) and isopods (2). Fifty-one partial 28S rDNA sequences and sixty-four mitochondrial (partial cox1 and nad1 genes) sequences were obtained from adult trematodes belonging to the genera Lyperosomum, Skrjabinus, Zonorchis and Stromitrema (Table 1).

Upon trimming to the length of the shortest sequence the 28S alignment was 1159 nt long; only two ambiguously aligned nucleotide positions were excluded from the analysis. The Bayesian phylogenetic analysis of the 28S rDNA alignment generated a phylogenetic tree containing a number of strongly supported clades as well as several unresolved polytomies (Fig. 1). Rather unexpectedly, sequences of dicrocoeliids obtained from a variety of passeriform birds and morphologically identified as Z. petiolatus (specimens from Corvus frugilegus and Garrulus glandarius), L. alagesi (specimens from Pica pica), L. collurionis (specimens from Sylvia atricapilla), L. dujardini (specimens from Prunella modularis), L. platynosomoides (specimen from Parus major) and as Lyperosomum sp. (specimens from Motacilla alba and Emberiza schoeniclus), proved to be identical to each other and to the sequences previously deposited in GenBank as L. collurionis from Sylvia atricapilla (AY222259, KU212193, MG560854, MG560860), G. glandarius (MG560861) and P. modularis (MG560863). Moreover, sequences from the juvenile dicrocoeliids found in hedgehog Erinaceus roumanicus were also identical to the sequences listed above.

Fig. 1.

Phylogenetic interrelationships of Dicrocoeliidae based on Bayesian analysis of partial sequences of the 28 S rDNA gene. Numbers above internodes indicate posterior probabilities greater than 70%. The scale bar indicates the number of substitutions per site. New sequences obtained in this study are in bold. The symbol (*) marks migrating bird. Additional data regarding the sequences are presented in Table 1.

Sporocysts and cercariae obtained from slugs and snails (Limax maximus, Deroceras reticulatum, Cepaea nemoralis), and metacercariae isolated from isopods (Porcellio scaber, Ligia sp.) in different regions of Poland (Lower Silesia, Mazovia, Pomerania) corresponded morphologically to the description of L. petiolatum (syn. Dicrocoelioides petiolatum and Z. petiolatus) larvae provided by Timon-David (1960). All our isolates of sporocysts and cercariae from molluscs as well as metacercariae from isopods showed 100% similarity in 28S rRNA with the sequences from birds mentioned above.

All members of Lyperosomum appeared in the tree within a major, 100% supported clade that also included representatives of Skrjabinus, Zonorchis, Platynosomum, Eurytrema and newly described genus Pojmanskatrema Hildebrand and Tkach, 2019 (Hildebrand and Tkach, 2019). Interestingly, this major group of the dicrocoeliids did not include any of the species from mammals present in the analysis (Fig. 1). This “avian” clade included two subclades. One comprised L. petiolatum (syn. Z. petiolatus), L. collurionis, Lyperosomum sp. from Turdus merula and T. philomelos, and L. clatrathum (syn. Z. clathratus) from Apus apus (Fig. 1, Table 1). The second clade consisted of a well-supported (100%) cluster of Zonorchis from the Americas (the region where the type species of Zonorchis was described) and L. sarothrurae from Africa. It also included dicrocoeliids likely acquired by migratory birds on their wintering grounds, such as Skrjabinus kalmikensis and Lyperosomum sp. from Delichon urbica and Acrocephalus arundinaceus (Fig. 1, Table 1). These latter specimens morphologically resembled L. oswaldoi, but did not fully correspond to its description.

Elsewhere in the tree, Stromitrema koshewnikowi clustered with Lutziella microacetabulare albeit with somewhat low posterior probability support (89%). Since both taxa form extremely long branches, we consider this topology with some caution.

The cox1 alignment was 363 nt long and did not require any gaps whereas the nad1 alignment was 462 nt long and also did not require any gaps. Analysis of cox1 mtDNA sequences showed 100% identity of isolates from all corvid birds as well as from Erinaceus roumanicus and the majority of the isolates from larvae. Sequences of adult trematodes from S. atricapila, E. schoeniclus, C. caerulaeus and sporocysts found in Limax maximus (Lower Silesia, Poland), were identical to each other and differed by only 3 nucleotides from specimens from the Corvidae. The sequences of dicroceliids from M. alba and P. modularis were identical to each other, but slightly different from sequences of specimens obtained from other passerine hosts. At the same time, we observed higher levels of sequence divergence among isolates from different specimens of Turdus spp. and Apus apus. The pairwise cox1 sequence divergence presented as percentage of similarity and the absolute numbers of variable sites is shown in Table 3.

Table 3.

Pairwise comparisons of 363 nt long fragment of mitochondrial cox1 gene of Lyperosomum specimens from different avian hosts collected in this study. Numbers of variable nucleotide positions are above diagonal; percentages of pairwise nucleotide similarity are below diagonal. The alignment did not contain indels.

Lyperosomum isolates from different hosts	Corvus frugilegus	Pica pica	Alauda arvensis	Sylvia atricapilla	Motacilla alba	Prunella modularis	Turdus merula 1	Turdus merula 2	Turdus philomelos	Apus 1	Apus 2	Apus 3	Delichon urbica
Corvus frugilegus MK445301	–	0	3	3	3	2	25	29	30	50	51	49	59
Pica pica MK445292	100	–	3	3	3	2	25	29	30	50	51	49	59
Alauda arvensis MK445315	99.2	99.2	–	0	4	5	26	30	31	51	52	50	61
Sylvia atricapilla MK445303	99.2	99.2	100	–	4	5	26	30	31	51	52	50	61
Motacilla alba MK445306	99.2	99.2	98.9	98.9	–	5	26	30	31	52	53	51	58
Prunella modularis MK445307	99.4	99.4	98.6	98.6	98.6	–	23	27	28	52	53	51	59
Turdus merula 1 MK445293	93.3	93.3	93.0	93.0	93.0	93.8	–	5	6	47	47	45	56
Turdus merula 2 MK445295	92.2	92.2	92.0	92.0	92.0	92.8	98.6	–	1	50	52	50	58
Turdus philomelos MK445292	92.0	92.0	91.7	91.7	91.7	92.5	98.4	99.7	–	51	53	51	59
Apus apus 1 MK445287	86.6	86.6	86.4	86.4	86.1	86.1	87.4	86.6	86.4	–	2	2	52
Apus apus 2 MK445288	86.4	86.4	86.1	86.1	85.8	85.8	87.4	86.1	85.8	99.4	–	2	54
Apus apus 3 MK445290	86.9	86.9	86.6	86.6	86.4	86.4	88.0	86.6	86.4	99.4	99.4	–	52
Delichon urbica MK445315	84.2	84.2	83.7	83.7	84.5	84.2	85.0	84.5	84.2	86.1	85.6	86.1	–

The concatenated alignment of the two mitochondrial genes was 825 nt long. The BI phylogenetic analysis of concatenated mitochondrial sequences (cox1 + nad1) from closely related dicrocoeliids parasitic in birds produced a tree topology (Fig. 2) generally similar to that seen in the 28S tree, with specimens from Turdus spp. forming a distinct, 98% supported clade (Fig. 2).

Fig. 2.

Bayesian analysis of the cytochrome c oxidase subunit 1 (cox1) gene combined with nicotinamide adenine dinucleotide dehydrogenase subunit 1 gene (nad1) of Lyperosomum spp. constructed using MrBayes. Numbers below internodes indicate posterior probabilities greater than 70%. All sequences, except for D. dendriticum, have been obtained in this study. Additional data regarding the sequences are presented in Table 1.

4. Discussion

Our molecular analysis based on the partial sequences of the 28S rRNA gene shows a significant discord between the molecular data and the current classification of the Dicrocoeliidae based on morphological characters alone which further corroborates the conclusions made by Tkach et al. (2018). Our study included a substantial diversity of flukes that currently are, or historically were, classified as Lyperosomum (Fig. 1, Table 1). Similar to the results of Tkach et al. (2018) our data further demonstrate non-monophyly of the sub-families within the Dicrocoeliidae recognized by Pojmańska (2008). In part, species of Lyperosomum showed closer relationships with the representatives of the subfamily Leipertrematinae instead of the Dicrocoeliinae where they were placed by Pojmańska (2008). Our results also allow to re-evaluate the relative value of some of the morphological characters traditionally used in the dicrocoeliid systematics. For instance, the location of the testes is one of the features often utilized for the differentiation among dicrocoeliid taxa. While it remains a useful character for distinguishing among species, in our analysis the genera Lutziella, Stromitrema and some species of Metadelphis with symmetrical testes showed close affinities with representatives of Brachylecithum or Lutztrema which have tandem testes (Fig. 1). Another interesting result in this respect is the high level of support for the clade containing Zonorchis from the Americas (flukes with elliptical, fusiform body and symmetrical testes located close to the ventral sucker and to each other, with short vitellaria) and Lyperosomum sarothrurae (Baer, 1959) from Africa (a highly elongated fluke with tandem testes and long vitelline fields) (Fig. 1). This suggests the need for a re-evaluation of the morphological criteria used in dicrocoeliid systematics.

The 28S tree contains a well-supported clade formed by Lyperosomum parasitic in birds as well as the genera Skrjabinus and Zonorchis, but this clade does not include all representatives of Lyperosomum (Fig. 1). Although some of the previous phylogenetic studies as well as our results strongly suggest the need for separation of some species currently placed in Lyperosomum (e.g., L. intermedium and L. trascarpathicus, both from mammals), we refrain from introducing systematic/nomenclatural changes at this time. Denser sampling of dicrocoeliid taxa for molecular analyses as well as additional morphological studies are necessary for confident delineation among taxa separated by our phylogenetic results. Unfortunately, the cursory original diagnosis of genus Lyperosomum by Looss (1899) does not provide a sufficient ground for its clear differentiation from other dicrocoeliid genera. Looss (1899) separated species of Dicrocoelium with elongated body into a new genus Lyperosomum with L. longicauda (Rudolphi, 1809) as a type-species. Unfortunately, we did not have in our material specimens fully corresponding to the description of L. longicauda. Some of our specimens from the Corvidae with elongated body had diagonally positioned testes characteristic of L. longicauda, but their eggs were larger than in previous descriptions of the species (Dolfus, 1957; Macko and Macková, 1995).

Our molecular study based on 28S rDNA demonstrated that specimens from C. frugilegus, G. glandarius, P. pica and S. atricapilla were identical (Fig. 1, Table 1). Traditionally, the flukes from these birds were identified based on their host specificity, as Z. petiolatus (from C. frugilegus, G. glandarius), L. alagesi (P. pica) and L. collurionis (S. atricapilla). In addition, the 28S sequences of larval forms, i.e. sporocysts and metacercariae from slugs, snails and woodlice, showed 100% identity to the adult digeneans from these 4 avian hosts. Combination of molecular results and morphological analysis allowed us to identify all these adult flukes and larval stages as L. petiolatum. It should be noted that sequences of mitochondrial DNA of L. petiolatum isolates obtained from different hosts showed some intraspecific variation (Table 3).

So far, the life-cycles of only 15 dicrocoeliids are known (Skrjabin and Evranova, 1952; Krissinger, 1984; Panin, 1984; Manga-González et al., 2005; Pinto et al., 2014; Hildebrand et al., 2016). One type of the life-cycles (observed in members of Brachylecithum, Brachydistomum, Lutztrema) is characterized by the presence of long-tailed xiphidocercariae, which leave the first intermediate host (a land snail) in mucoid balls that are eaten by the second intermediate host (an arthropod). Dicrocoeliids with the second type of life-cycles (Conspicuum, Eurytrema, Platynosomum) possess xiphidocercariae with a short or rudimentary tail, which leave the snail enclosed in daughter-sporocysts. The life cycle of L. petiolatum (syns. D. petiolatum and Z. petiolatus) belongs to the second type, and was revealed experimentally by Timon-David (1960), with the snail Helicella (Helicopsis) arenosa and terrestrial isopods (Armadillo officinalis, Armadillidium vulgare) used as intermediate hosts (Timon-David, 1960). Thus, in the present study, the full life cycle of L. petiolatum was confirmed for the first time from the nature. Unfortunately, a full comparison of our data on the morphology of the life cycle stages with those reported by Timon-David (1960) is difficult because the latter author did not provide ranges for the majority of morphometric characters and did not mention some essential characters. Nevertheless, the morphology of the life cycle stages in our material fits well the description by Timon-David. Based on our data from natural infection and the data from experimental infection by Timon-David (1960) L. petiolatum apparently has a relatively low specificity to the intermediate hosts.

Lyperosomum petiolatum is one of the most commonly reported Lyperosomum species in the Central Europe. As previously noted by several authors (Denton and Bird, 1951; Mettrick, 1963; Macko, 1968; Macko and Macková, 1995) this species exhibits significant morphological variability which is confirmed by our morphological study based on freshly collected material. Genetically identical samples from different avian hosts examined by us included forms with oblique and symmetrical testes as well as forms with the varying length of vitelline fields. We have also observed the change in proportion of the acetabulum to body size ratio in the process of fluke maturation (Fig. 3). Both the literature and our data demonstrate that L. petiolatum does not show a narrow definitive host specificity. The inconsistency in the relative position of testes, namely the presence of a morphotype with symmetrical testes was the reason for the transfer of L. petiolatum into Zonorchis by Travassos (1944) and Denton and Byrd (1951). At the same time, several morphologically similar species, e.g., L. alagesi (Skrjabin and Udinzev, 1930), L. alaudae (Shtrom and Sondak, 1935) and L. collurionis (Skrjabin and Isaitschikoff, 1927) remained in Lyperosomum.

Fig. 3.

Representatives of Lyperosomum petiolatum from different hosts: a – Pica pica; b – Garrulus glandarius; c – Corvus frugilegus; d – Corvus frugilegus, subadult specimen; e, f – Sylvia atricapilla. Lyperosomum sp., from Turdus merula: g – specimen fixed after death; h – specimen fixed under pressure. Scale bars – 1 mm.

Dicrocoeliids occurring in the Turdidae were traditionally identified as Z. petiolatus due to their morphological similarity to flukes parasitizing corvids (Denton and Bird, 1951; Panin, 1984; Mettrick, 1963). Our 28S sequences from specimens originated from Turdus merula and T. philomelos were identical to the sequences of Lyperosomum sp. from Turdus sp. (MG560864, MG560865) recently published by Aldhoun et al. (2018). At the same time, sequences from Turdus differed by 5 nt (99.6% similarity) from sequences from the specimens obtained from corvids (C. frugilegus, G. glandarius and P. pica; Fig. 1). The results from 28S rDNA were further corroborated by the mtDNA sequences which showed 6.7–8.0% difference between specimens from Turdus spp. and corvids, C. frugilegus and P. pica (Table 3; Fig. 2). This strongly suggests the status of the form parasitizing Turdidae as a separate species. Morphological comparison of our material with published descriptions did not allow for an unambiguous species identification of Lyperosomum from Turdus spp., although they appear to be somewhat similar to L. turdia (Ku, 1938) described from T. merula and T. cardis in China and Japan. However, due to the great geographic distance between our collecting sites and the type territory of L. turdia we are hesitant to assign this name to the European specimens in the absence of sequence data from the Far East.

Lyperosomum clathratum is characterized by symmetrical testes which was previously a reason for the transfer of this species into Zonorchis by Odening (1964). However, it appeared on the phylogenetic trees within Lyperosomum as a sister taxon to the clade of L. petiolatum + Lyperosomum from Turdus spp. (Fig. 1, Fig. 2). The genus Zonorchis was originally established for digeneans founds in the Americas (the type species is Z. microrchis (Travassos, 1916) from Brazil) and is represented in our tree by three species characterized by the typical Zonorchis morphotype, all collected from birds in North and Central America (Fig. 1). These species form a 100% supported clade not closely related to L. clathratum which suggests that the relative position of testes alone is not a suitable character for distinguishing among genera in this group of digeneans. Lyperosomum clathratum does not seem to be a typical representative of the European fauna and is likely acquired by A. apus on wintering grounds in Africa, based on the fact that we only found this species in spring in birds returning after overwintering in Africa. This hypothesis is partly supported by the close relationship between this species and Lyperosomum sp. from the speckled tinkerbird Pogoniulus scolopaceus in Uganda.

One of the main problems in the systematics of Lyperosomum and the Dicrocoeliidae as a whole is the insufficient knowledge of the extent of the intraspecific morphological variability. This variability is associated in part with the crowding effect which can be quite pronounced due to the parasitism in a limited space such as the gall bladder and bile ducts (e.g., Tkach and Bray, 1995; Pinto et al., 2015, 2017). In addition, these flukes grow continuously throughout their lives, and their anatomical features undergo partial changes including the size and proportions of the gonads (Macko, 1968; Sitko, 1994, 1995). Thus, in longer living birds such as some corvids, the same species may have a somewhat different appearance than in a bird with a shorter life span. Considering that many dicrocoeliid species were described based on a single specimen or very few specimens (e.g., L. collurionis, L. alagesi, L. alaudae, S. kalmikensis, S. skrjabini) the role of morphological variability was likely underestimated in dicrocoeliid taxonomy. When it comes to the higher level systematics, recently published molecular data as well as the results of the present study have demonstrated that the relative value of some of the morphological criteria broadly used in dicrocoeliid systematics (e.g., relative position of testes, body size and proportions, presence/absence of digestive system) needs to be re-assessed using a combination of morphological examination of properly fixed specimens and evidence provided by DNA sequences.

5. Conclusions

The obtained molecular data and the morphological examination of newly collected material combined with literature data, allow us to make several systematic conclusions and nomenclature changes.

• 1.
  Based on our results we propose the following taxonomic changes:

  • a)
    we return Zonorchis clathratus and Z. petiolatus into Lyperosomum as L. clathratum and L. petiolatum.
  • b)
    we recognize L. alagesi as a synonym of L. petiolatum
  • c)
    Turdidae host a distinct species of Lyperosomum morphologically similar to L. petiolatum.
• 2.The dicrocoeliids parasitic in Sylvia atricapilla in Central Europe belong to L. petiolatum and not to L. collurionis. We disagree with Aldhoun et al. (2018) who proposed to place L. collurionis among synonyms of L. petiolatum; the lack of specimens matching the original description of L. collurionis from the type host Lanius collurio prevents a quality re-description of the species at this time.
• 3.Lyperosomum petiolatum occurs commonly in Europe in corvids as well as in some migratory songbirds besides S. atricapilla, e. g., Emberiza schoeniclus Motacilla alba and Prunella modularis.
• 4.Some morphological characters previously considered as critically important for separation between major lineages of the Dicrocoeliidae, proved to be useful only at species level or even demonstrate intraspecific variability. Subfamilies based on traditional characters turned out to be non-monophyletic. Therefore, we agree with the recent decision by Tkach et al. (2018) to abandon the subfamily-based classification of the Dirocoeliidae.
• 5.Phylogenetic relationships of species previously included in Lyperosomum demonstrated the paraphyletic nature of the genus and indicate the need of its thorough revision based on both morphological and molecular data.
• 6.The systematic status and interrelationships among members of Zonorchis occurring in the New World and the Old World need further clarification. However, a well-grounded decision cannot be made without inclusion of several other morphologically close genera, e.g., Conspicuum and Lubens, into the future phylogenetic studies.

Conflicts of interest

The authors declare that they have no competing interests.

Appendix A. Supplementary data

The following is the Supplementary data to this article: