Skip to main content
PMC home page
Frontiers in Microbiology logoLink to Frontiers in Microbiology
. 2019 Apr 10;10:750. doi: 10.3389/fmicb.2019.00750

The Zn(II)2Cys6-Type Transcription Factor ADA-6 Regulates Conidiation, Sexual Development, and Oxidative Stress Response in Neurospora crassa

Xianyun Sun 1,2,*, Fei Wang 1,3, Nan Lan 1,2, Bo Liu 3, Chengcheng Hu 1,2, Wei Xue 1,2, Zhenying Zhang 1, Shaojie Li 1,2
PMCID: PMC6468284  PMID: 31024511

Abstract

Conidiation and sexual development are critical for reproduction, dispersal and better-adapted survival in many filamentous fungi. The Neurospora crassa gene ada-6 encodes a Zn(II)2Cys6-type transcription factor, whose deletion resulted in reduced conidial production and female sterility. In this study, we confirmed the positive contribution of ada-6 to conidiation and sexual development by detailed phenotypic characterization of its deletion mutant and the complemented mutant. To understand the regulatory mechanisms of ADA-6 in conidiation and sexual development, transcriptomic profiles generated by RNA-seq from the Δada-6 mutant and wild type during conidiation and sexual development were compared. During conidial development, differential expressed genes (DEGs) between the Δada-6 mutant and wild type are mainly involved in oxidation-reduction process and single-organism metabolic process. Several conidiation related genes are positively regulated by ADA-6, including genes that positively regulate conidiation (fluffy and acon-3), and genes preferentially expressed during conidial development (eas, con-6, con-8, con-10, con-13, pcp-1, and NCU9357), as the expression of these genes were lower in the Δada-6 mutant compared to wild type during conidial development. Phenotypic observation of deletion mutants for other genes with unknown function down-regulated by ada-6 deletion revealed that deletion mutants for four genes (NCU00929, NCU05260, NCU00116, and NCU04813) produced less conidia than wild type. Deletion of ada-6 resulted in female sterility, which might be due to that ADA-6 affects oxidation-reduction process and transmembrane transport process, and positively regulates the transcription of pre-2, poi-2, and NCU05832, three key genes participating in sexual development. In both conidiation and the sexual development process, ADA-6 regulates the transcription of cat-3 and other genes participating in reactive oxygen species production according to RNA-seq data, indicating a role of ADA-6 in oxidative stress response. This was further confirmed by the results that deletion of ada-6 led to hypersensitivity to oxidants H2O2 and menadione. Together, these results proved that ADA-6, as a global regulator, plays a crucial role in conidiation, sexual development, and oxidative stress response of N. crassa.

Keywords: conidiation, ada-6, sexual development, oxidative stress response, Neurospora crassa

Introduction

Conidial production is critical for reproduction, dispersal and survival in many filamentous fungi. Sexual reproduction is a key feature that distinguishes eukaryotic organisms from prokaryotic organisms. It produces better-adapted progenies by driving genetic recombination and eliminating deleterious mutations (Ni et al., 2011; Heitman et al., 2013). Neurospora crassa is a multicellular ascomycete fungus in the family Sordariomycetes and has long been used as an excellent model organism for genetic and biochemical researches as well as the study of morphological development (Springer, 1993; Perkins and Davis, 2000; Davis and Perkins, 2002). From vegetative growth to conidiation or sexual reproduction, morphological changes were evident. Behind it, transcriptional levels of many genes are altered (Greenwald et al., 2010; Wang et al., 2012; Lehr et al., 2014). For example, 25% predicted genes in the genome of N. crassa are differentially expressed during conidiation (Greenwald et al., 2010), as well as during sexual development (Lehr et al., 2014). Transcription factors play important roles in activating or repressing gene expression in response to developmental signals. Thus, identification of transcription factors, which are crucial to conidial and sexual development, and characterization of their mechanisms are critical steps toward deeper understanding of how fungal morphogenesis is regulated.

Several transcription factors required for basal hyphae growth, asexual sporulation, and sexual development have been reported in N. crassa (Colot et al., 2006; Carrillo et al., 2017). Among identified 273 transcription factor genes, 33 genes were found specifically affect asexual development (Carrillo et al., 2017). Some of these genes have been extensively studied. For example, fl is required for the formation of major constriction chains (Matsuyama et al., 1974; Bailey and Ebbole, 1998). Overexpression of fl under the control of a heterologous promoter is sufficient to induce conidiation in a liquid medium which is unfavorable for conidiation (Bailey-Shrode and Ebbole, 2004). Some transcription factor genes, such as hsf-2/NCU08480 (Thompson et al., 2008) and chc-1/NCU00749 (Sun et al., 2011), were found to regulate the extent of conidiation or conidiation in response to environmental conditions. Deletion of hsf-2 does not affect hyphal growth and aerial hyphal development but dramatically reduces conidial yield (Thompson et al., 2008). CHC-1 is involved in CO2-mediated conidiation suppression, and chc-1 deletion results in earlier conidial formation than wild type, especially at a higher CO2 concentration (Sun et al., 2011). N. crassa is heterothallic with two mating types, designated mat a and mat A. Both of the mating types can form protoperithecia when nitrogen source is depleted (Davis and de Serres, 1970). Among identified transcription factor genes, ten of them were found to specifically affect sexual development (Carrillo et al., 2017). For example, ff-7/NCU04001 is required for initiation of sexual development, and deletion mutant of ff-7 does not produce protoperithecia, perithecia as well as ascopores (Colot et al., 2006; Carrillo et al., 2017); Deletion of bek-1/NCU00097 results in aberrant perithecia, which exhibit defective beaks and cannot produce ascopores (Colot et al., 2006; Carrillo et al., 2017).

In addition to these specific transcriptional regulators, some transcription factors were showed to participate in regulating both asexual sporulation and sexual development. Knockout mutants of 25 transcription factor genes display significant defects in both asexual sporulation and sexual development (Colot et al., 2006; Carrillo et al., 2017). Most of these genes were named as all development altered (ada) genes (Colot et al., 2006), including ada-1/NCU00499, ada-2/NCU02017, ada-3/NCU02896, ada-4/NCU03320, ada-5/NCU03931, ada-6/NCU04866 and ada-7/NCU09739. These transcription factors play crucial roles in fungal growth and development by regulating gene expression on a global scale. However, the regulatory roles of most of these newly found transcription factors in growth and development needs further confirmation, and their molecular mechanisms are not addressed. Among them, ada-6/NCU04866 is a representative gene, which codes a Zn(II)2Cys6 transcription factor (Borkovich et al., 2004). Deletion of ada-6 results in slower growth, dramatic reduction in conidiation and female infertility during sexual development (Colot et al., 2006), suggesting ADA-6 is an important transcription factor. However, the confirmation of its function is still required and their mechanism has not been investigated.

ADA-6 orthologs are widely distributed in filamentous fungi by sequence alignment1. The ortholog of ADA-6 in N. discreta has a predicted function involved in embryonic development2. In Aspergillus oryzae, the ADA-6 ortholog has predicted role in hyphal growth, positive regulation of secondary metabolite and sporocarp development during sexual reproduction3.

In this study, we confirmed the positive role of ADA-6 in growth and development by detailed phenotypic characterization of its deletion mutant and the complemented strain. By comparing transcriptomic profiles generated by RNA-seq from the Δada-6 mutant and wild type during conidiation and sexual development, as well as by analyzing the contribution of the genes or biological pathway influenced by ada-6 deletion, we explored the mechanisms by which ADA-6 promotes conidiation and sexual development. We also found that deletion of ada-6 causes hypersensitive to oxidants H2O2 and menadione. Together, our results proved that ADA-6 is a global regulator of conidiation, sexual development and oxidative stress response in N. crassa.

Materials and Methods

Strains and Media

Most strains of N. crassa used in this study, including FGSC#4200 (wild type), FGSC#11022 (Δada-6/NCU04866; a), and knockout mutants for genes responsive to ada-6 deletion, were purchased from the Fungal Genetics Stock Center. All the strains were cultured at 28°C if it’s not mentioned.

Media used in this study include Vogel’s slant medium (1 × Vogel’s salts, 2% sucrose, and 1.5% Bacto Agar), Vogel’s plate medium (1 × Vogel’s salts, 2% glucose, and 0.75% Bacto Agar), liquid Vogel’s medium (1 × Vogel’s salts, 2% glucose), the agar medium for transformant regeneration (1 × Vogel’s salts, 1 M sorbitol, 1 × FGS, and 1.5% Bacto Agar), and the agar medium for filling race tubes [1 × Vogel’s salts, 2% carbon source (glucose, sucrose, xylose, xylan, or carboxymethyl cellulose sodium), and 1.5% Bacto Agar].

Complementation of the ada-6 Deletion Mutant

The plasmid pCB1532-ada6 used for complementation was created by inserting a 4547 bp DNA fragment, containing the ada-6 gene (2230 bp) flanked by a 1238 bp upstream regulatory region and a 1079 bp downstream region, into the plasmid pCB1532 which harbors a sulfonylurea resistant allele of the Magnaporthe grisea ILV1 as a selective marker (Sweigard et al., 1997). Briefly, the DNA fragment was amplified from the wild-type strain FGSC#4200 using primers Ada6F-EcoRI: GGAATTCGTAAAGTGACTGGAAGGTGG and Ada6R-HindIII: CCCAAGCTTATCAATAACATAACTGCCCCC (EcoRI and HindIII sites were underlined), digested by EcoRI and HindIII and ligated into plasmid pCB1532. The construct pCB1532-ada6 was transformed into the Δada-6 mutant FGSC#11022 according to the previously reported protoplast transformation method (Royer and Yamashiro, 1992). 15 μg/ml of chlorimuron ethyl (Sigma) was added to the top agar to inhibit the growth of non-transformed protoplasts. Obtained transformants were subjected to serial transfers on slants with 15 μg/ml chlorimuron ethyl to favor homokaryon formation (Ebbole and Sachs, 1990) and further verified by PCR.

Analysis of Hyphal Growth, Conidiation, and Sexual Development

Hyphal extension of wild type and the Δada-6 mutant were analyzed in race tube. Briefly, one piece of mycelium mat (2 mm × 10 mm) for each strain was separately inoculated on one end of the race tube containing solid Vogel’s medium with different carbon source [2% glucose, 2% sucrose, 2% xylose, 2% xylan, and 2% carboxymethyl cellulose sodium (CMC-Na), respectively]. Inoculated race tubes were incubated at 28°C and the leading edge of the colony were marked every 24 h. The hyphal extension was then documented and measured by a ruler.

For conidiation analysis, mycelium for each strain was inoculated on Vogel’s slants and grown at 28°C with continuous light for 7 days. Conidia produced were washed by 5 ml distilled water and counted with a hemocytometer.

For protoperithecium and perithecium formation analysis, the mycelial mat or conidia suspension of the strain used as female parent was first inoculated on solid synthetic crossing medium with 0.1% sucrose and grown for 5 days under constant darkness at 25°C. Then the opposite mating-type strain was inoculated as male parent and incubated at 25°C for another 7 days under constant darkness. The protoperithecium and perithecium formation were checked and documented by an optical microscope equipped with a Zeiss CCD.

Transcriptomic Profiling Analysis

Genome-wide transcriptional profiles for wild type and the Δada-6 mutant during conidiation, and at the initiate stage of protoperithecium formation were obtained by RNA sequencing, while transcriptional profiles for vegetative growth were used as control. Briefly, N. crassa wild-type strain and the Δada-6 mutant were inoculated on Vogel’s plates covered with cellophane and grown at 28°C in darkness for 24 h. The mycelia were then transferred into 150-ml flasks containing 75 ml of liquid Vogel’s medium. Cultures were incubated at 28°C with constant agitation at 180 rpm for 18 h, and the mycelia were harvested by vacuum filtration. For conidial development analysis, the mycelial mats were transferred onto the surface of agar plates (9 cm) to induce conidial development at 28°C under constant light. Cultures were sampled at 12 h intervals. For sexual development analysis, the mycelial mats were inoculated on solid synthetic crossing medium with 0.1% sucrose and grown for 4 days under constant darkness at 25°C. Then, the mycelia were harvested and total RNA was extracted according to the standard TRIzol protocol (Invitrogen Corporation, Carlsbad, CA, United States).

RNA samples were sent to Beijing Genomics Institute (BGI) for RNA-seq analysis using the Illumina Hiseq2000 with a 50 bp single-end module (Illumina, San Diego, CA, United States). The obtained raw data was treated, mapped to N. crassa genome and transformed into expression value following standard BGI workflow. The gene expression level was calculated by using RPKM (Reads per kb per million reads). The differences in gene expression between samples was compared by comparing RPKM values (Grabherr et al., 2011), and those with fold change more than 2 (FDR < 0.001) were thought to be differentially expressed genes (DEGs). In addition, genes with RPKM less than 12 at all time points were thought to be low abundant transcripts and removed from the DEGs lists. The expressions of some genes, crucial for development and oxidative stress responses, were verified by time course experiment using real time PCR.

RT-qPCR Analysis

Samples were prepared as described above. Then mycelia were harvested and immediately frozen and ground into fine powder in liquid nitrogen. Total RNA was extracted and treated with DNase I to remove genomic DNA according to the standard TRIzol protocol (Invitrogen Corporation, Carlsbad, CA, United States). cDNA was prepared with a FastQuant RT Kit (with gDNase) (Tiangen, Beijing) according to the product’s instruction. qPCR was performed on a BIO-RAD CFX96TM Real-Time System (Bio-Rad, Hercules, CA, United States) with KAPA SYBR FAST qPCR mix (Kapa Biosystems, Wilmington, MA, United States) according to the product’s protocol. Each cDNA sample was analyzed in duplicate and at least three independent experiments were conducted. The average threshold cycle was used to calculate relative expression level according to 2-ΔΔCt method (Livak and Schmittgen, 2001). And the expression level was normalized to the level of β-tubulin. The primer pairs used for RT-qPCR assay were shown in Supplementary Table S1.

Susceptibility Tests of the Strains to Oxidative Stress

N. crassa wild-type strain and knockout mutants (ada-6, nox-1, cat-2, and cat-3) were separately inoculated onto ϕ90-mm plates (containing 15-ml liquid Vogel’s medium) and allowed to grow at 28°C in darkness for 24 h. The mycelial mat were punched and the round mat (ϕ2-mm) were inoculated on the center of plates (ϕ90-mm) with or without oxidant (H2O2 or menadione), and incubated at 28°C for 22 h (control), 32 h (25 μg/ml menadione) and 48 h (10 mM H2O2), respectively. Each test was duplicated and the experiment was independently repeated at least three times. The relative growth inhibition rates (mutant growth under oxidant stress was compared to wild type grown under oxidant stress and normalized by growth under non- oxidant condition) of each strain were calculated based on colony diameters after 22 h of incubation.

Results

Phenotypic Characterization of the Δada-6 Mutant

The phenotype of the Δada-6 mutant has been described by Colot et al. (2006). Deletion of ada-6 resulted in reduced hyphal growth and altered asexual and sexual development. However, the deletion of ada-6 only slightly affected colony growth. In race tubes containing solid Vogel’s medium with different carbon sources, the colony growth of the Δada-6 mutant were slightly slower than that of wild type: with 2% glucose, 2% sucrose, 2% xylose, 2% xylan, and 2% carboxymethyl cellulose sodium (CMC-Na) as carbon sources, the growth rate of the Δada-6 mutant was 6.5, 6.6, 5.6, 7.2, and 4.9 cm/day, respectively, while the growth rate of wild type was 8.5, 8.3, 7.5, 8.3, and 5.6 cm/day, respectively (Figure 1A).

FIGURE 1.

FIGURE 1

Open in a new tab

Deletion of ada-6 results in reduced hyphal growth, less conidial production, and female sterility in N. crassa. (A) Hyphal growth characterization of the ada-6 deletion mutant (Δada-6) and wild type (WT) grown with different carbon source. Strains were grown in race tube containing solid Vogel’s medium with different carbon sources. Inoculated race tubes were incubated at 28°C and the leading edge of the colony were marked every 24 h. The hyphal extension was then measured by a ruler. The means of hyphal extension rates from three race tubes are shown and standard deviations are indicated by error bars. (B) Conidiation characterization of wild type (WT), the ada-6 deletion mutant (Δada-6) and it’s complemented transformant (Δada-6; ada-6). Strains were grown in Vogel’s slants at 28°C with continuous light for 7 days and then imaged. Conidia produced on slants were counted with a hemocytometer. The means of conidial counts from three slants are shown and standard deviations are indicated by error bars. (C) Conidiophore structure of wild type (WT), the ada-6 deletion mutant (Δada-6) and it’s complemented transformant (Δada-6; ada-6). Bar, 50 μm. (D) Protoperithecium and perithecium formation by crossing of the ada-6 deletion mutant (Δada-6, a) with wild type (#2225, A). The ada-6 deletion mutant (Δada-6, a) or wild type (#2225, A) were used as female parent and first grown on solid crossing medium for 5 days under constant darkness at 25°C, then the opposite mating type strain was inoculated as male parent and incubated at 25°C for another 7 days under constant darkness. Protoperithecium and perithecium formation was checked and imaged.

The most dramatic effects caused by ada-6 deletion were the defects in asexual sporulation and sexual development. On slants containing solid Vogel’s medium with 2% sucrose, aerial hyphal growth of the Δada-6 mutant was only slightly shorter than that of wild type (Figure 1B), but the conidial production of the Δada-6 mutant was reduced by 93% as compared with that of wild type (Figure 1B). Unlike the deletion mutant of fl in which conidial development stops at the major constriction formation stage (Bailey and Ebbole, 1998), the Δada-6 mutant was capable to pass through all conidial development stages to produce mature conidia (Figure 1C).

To investigate the contribution of ADA-6 to sexual development, we analyzed the formation of protoperithecium and perithecium on solid synthetic crossing medium. When using the Δada-6 (a) as female parent and wild type FGSC#2225 (A) as male parent, only a very few and small protoperithecium formed but no perithecium was observed (Figure 1D). While using wild type 2225 (A) as female parent and the Δada-6 (a) as male parent, normal protoperithecium and perithecium were produced (Figure 1D). These results suggest that deletion of ada-6 resulted in female sterility.

To confirm the role of ADA-6 in growth and development, we generated a plasmid pCB1532-ada6 which carries the full length of ada-6 gene with its regulatory regions as described in Materials and Methods. By transforming this plasmid into the Δada-6 mutant FGSC#11022, complemented transformants (Δada-6; ada-6) were obtained and phenotypically compared the growth and development to wild type FGSC#4200 (WT). As expected, the complemented transformants (Δada-6; ada-6) displayed phenotypes resembling wild-type conidiation and sexual development (Figure 1B–D).

Genome-Wide Transcriptional Responses to ada-6 Deletion

To understand the regulatory roles of ADA-6 in growth, conidiation and sexual development, transcriptomic profiles generated by RNA-seq from the Δada-6 mutant and wild type during conidial development or sexual development were compared. Among 9403 detected genes, 330, 441, and 1547 genes were found to be transcriptionally changed for more than two folds upon ada-6 deletion after conidiation induction for 0, 12, and 24 h, respectively (Supplementary Data S1). For sexual development, 1024 genes were found to be transcriptionally changed for more than two folds upon ada-6 deletion after 4 days of induction of sexual development (Supplementary Data S1).

To functionally understand the DEGs, functional classification and gene set enrichment analysis were conducted. In the vegetative growth stage (or conidiation induction for 0 h), DEGs between the Δada-6 mutant and wild type were mainly enriched in carbohydrate metabolic process (14 up- and 2 down-regulated genes), xylan catabolic process (5 up- and 2 down-regulated genes) and glucose import (6 up- and 2 down-regulated genes) (Supplementary Table S2). After 12 h of conidiation induction, DEGs between the Δada-6 mutant and wild type were mostly enriched in oxidation-reduction process (30 up- and 6 down-regulated genes) and transmembrane transport process (21 up- and 3 down-regulated genes) (Supplementary Table S2). While after 24 h of conidiation induction, DEGs between the Δada-6 mutant and wild type are mostly involved in oxidation-reduction process (107 up- and 111 down-regulated genes) and single-organism metabolic process (188 up- and 195 down-regulated genes) (Supplementary Table S2). During sexual development, DEGs between the Δada-6 mutant and wild type mostly participated in oxidation-reduction process (41 up- and 66 down-regulated genes) and transmembrane transport process (42 up- and 34 down-regulated genes) (Supplementary Table S2).

Under all tested conditions, the expression of 14 genes (cat-3, NCU02910, NCU03323, NCU04917, NCU5126, NCU05230, sut-28, NCU06170, NCU07088, NCU07095, cdt-2, NCU08223, pho-3, adh-9) were commonly increased and the expression of 13 genes (NCU00496, NCU00719, NCU05629, NCU05762, NCU05859, NCU06140, NCU08455, eas, gao-1, NCU09210, NCU10610, NCU11340, NCU17271) were commonly reduced in response to ada-6 deletion (Tables 1–4). Among these genes, seven genes (sut-28, cdt-2, NCU17271, NCU10610, NCU05762, NCU05230, NCU05126) encode proteins as integral components of plasma membrane, five genes (cat-3, gao-1, NCU09210, NCU05762, adh-9) are involved in oxidation-reduction process, and nine genes (NCU11340, NCU08455, NCU08223, NCU07088, NCU06170, NCU05859, NCU05629, NCU03323, NCU02310) encode proteins with unknown function (Table 1).

Table 1.

Genes transcriptionally response to ada-6 deletion under all tested conditions.

Genes Function annotation RPKM Δada6-0 h RPKM Δada6-12 h RPKM Δada6-24 h RPKM Δada6-4 d RPKM WT-0 h RPKM WT-12 h RPKM WT-24 h RPKM WT-4 d
Down-regulated genes
NCU04866 ada-6 0 0.046 0.0883 0.0408 7.1396 40.4223 19.06 5.1192
NCU00496 hypothetical protein 1.2303 5.8881 3.8363 1.6779 2.8212 17.7147 17.029 5.7047
NCU00719 hypothetical protein, direct target of ADV-1 5.0315 3.9651 0.4172 2.4077 20.5478 9.5147 2.9358 4.8644
NCU05629 hypothetical protein 0.2144 1.9056 1.126 0.3899 4.8593 24.0909 7.9924 3.4413
NCU05762 hypothetical protein with oxidoreductase activity 0 2.7995 0.768 0.6382 0.1248 12.6732 15.5484 48.4745
NCU05859 hypothetical protein 0.4292 3.301 1.0565 14.3203 0.9269 20.0974 10.7257 30.5766
NCU06140 Ribosome biogenesis protein – Nop58p/Nop5 0.4019 4.3793 0.3957 1.7814 2.0093 22.6131 1.4656 4.6589
NCU08455 hypothetical protein 2.7386 48.0429 4.5419 14.67816 8.6476 206.8643 76.1128 83.6734
NCU08457 eas, rodlet protein 18.8768 1248.747 270.4869 25.5233 82.9049 10027.32 17750.16 3584.603
NCU09209 gao-1, galactose oxidase-1 7.0806 88.2866 34.087 6.212 41.5362 229.2223 364.781 57.7112
NCU09210 dyp-type peroxidase 20.2343 196.3718 52.1181 14.9053 97.0414 549.4004 363.9373 146.3083
NCU10610 hypothetical protein, ADV-1 target gene 2.8556 17.463 3.6971 4.4715 6.3875 38.4268 12.0849 10.8455
NCU11340 hypothetical protein 0 0.4074 0.1956 3.2504 0.1589 0.4009 0.7726 23.0234
NCU17271 hypothetical protein, 0 1.0222 0.3569 0.3707 0.1087 7.2247 6.9613 15.6349
Up-regulated genes
NCU00355 cat-3, catalase-3, 506.5213 574.7889 75.3423 395.3921 237.5218 167.5816 19.7186 62.2595
NCU02910 hypothetical protein, 4.0495 162.2868 8.8953 24.4277 1.8065 18.1556 1.5146 6.7358
NCU03323 hypothetical protein, 54.8567 49.9469 200.5951 170.4939 18.786 17.1281 24.8718 72.6286
NCU04917 hypothetical protein 10.2662 11.3526 0.967 12.4997 2.6423 1.0812 0.2604 0.0796
NCU05126 hypothetical protein, 46.7857 345.4155 39.8113 152.3996 17.3499 166.6553 7.9653 3.9733
NCU05230 hypothetical protein, 5.8748 4.9093 14.3553 58.097 2.0887 1.83 3.7382 28.0041
NCU05897 sut-28, sugar transporter-28, 1.0343 426.2465 56.7384 84.4806 0.5171 196.3384 15.1294 36.3927
NCU06170 hypothetical protein, 126.9334 528.2828 59.6491 114.3088 40.5712 86.7585 18.3686 16.1066
NCU07088 hypothetical protein, 20.7894 434.8265 40.0778 49.252 3.2792 46.1012 8.5424 2.611
NCU07095 similar to peptidase s41 family protein 6.1777 17.0835 17.7064 14.0421 0.5295 6.6802 0.3218 2.3609
NCU08114 cdt-2, hexose transporter 1.7284 14.7541 11.7635 4598.378 0.5286 4.7714 3.4605 1849.146
NCU08223 hypothetical protein, ADV-1 target gene 1.878 48.883 118.263 23.4981 0.5723 4.7835 9.3052 2.7113
NCU08643 pho-3, Acid phosphatase 88.4357 111.5176 8.885 17.0138 25.8364 37.9268 1.9942 1.9201
NCU09798 adh-9, aryl-alcohol dehydrogenase, 47.3846 39.8375 8.9522 43.8845 18.4233 11.511 3.1077 4.2254
Open in a new tab

(1) WT, wild type; Δada6, ada-6 deletion mutant; -0 h, samples of N. crassa in vegetative growth stage; -12, samples of N. crassa after 12 h of conidiation induction, -24, samples of N. crassa after 24 h of conidiation induction; -4 d, samples of N. crassa after 4 days of sexual development induction. (2) Locus numbers and function were annotated according to the N. crassa genome assembly (http://fungidb.org/fungidb/). (3) RPKM, Reads Per Kilobase of exon model per Million mapped reads.

Table 4.

Transcriptional response to ada-6 deletion by the genes involved in sexual development and oxidative stress response.

Locus Function annotation RPKM Δada6-0 h RPKM Δada6-4 d RPKM WT-0 h RPKM WT-4 d
Genes participating in sexual development
NCU00552 al-1, phytoene desaturase     31.6069     2478.7951     51.6463     990.8349
NCU01427 al-3, geranylgeranyl pyrophosphate synthetase     11.8371     605.0731     16.8135     120.2416
NCU02925 fbm-1, fruiting body maturation-1     0.9891     23.4505     0.0609     836.3750
NCU04533 App     5.3825     8.0260     4.7362     1253.4752
NCU05758 pre-2, pheromone receptor     0.1754     12.2255     0.3274     31.7476
NCU05768 poi-2, mating response protein POI2     4.0454     8.0569     1.0016     2263.0728
NCU05832 methyltransferase     81.2262     225.2263     89.1113     93.2263
Genes involved in oxidative stress response
NCU00355 cat-3, catalase-3     506.5213     395.3921     237.5218     62.2595
NCU02110 nox-1, NADPH oxidase 1     16.3379     40.627793     12.9428     13.0752
NCU02133 sod-1, superoxide dismutase     491.3552     58.7633     550.0388     220.3283
NCU03151 Peroxisomal membrane protein     304.0955     210.8447     326.5764     99.0474
NCU03651 mdh-2, malate dehydrogenase-2     121.4947     13.5248     117.2605     40.4284
NCU05169 cat-4, catalase-4     6.1927     7.6502     5.1961     19.9277
NCU05858 fam-2, fatty acid oxygenase     1.6038     8.1275     1.2828     39.4565
NCU07850 nor-1, NoxR     68.7881     32.1234     61.9067     15.5760
NCU07966 trm-1, calcium-transporting ATPase 3     0.9297     183.4750     0.9405     75.4148
NCU08114 cdt-2, hexose transporter     1.7284     4598.3782     0.5286     1849.1457
NCU08791 cat-1, catalase-1     159.6162     33.7654     188.7525     192.4185
NCU09210 dyp-type peroxidase     20.2343     14.9053     97.0414     146.3083
NCU10775 nox-2, NADPH oxidase 1     94.5026     30.2639     81.3519     12.8031
NCU11286 Peroxidase/oxygenase     0.0001     0.1906     0.0001     20.0431
Open in a new tab

(1) WT, wild type; Δada6, ada-6 deletion mutant; -0 h, samples of N. crassa in vegetative growth stage; -4 d, samples of N. crassa after 4 days of sexual development induction. (2) Locus numbers and function were annotated according to the N. crassa genome assembly (http://fungidb.org/fungidb/). (3) RPKM, Reads Per Kilobase of exon model per Million mapped reads.

Genes Regulated by ADA-6 Are Involved in Oxidation-Reduction Process

During both conidiation and sexual development, the most seriously affected biological process by ada-6 deletion is oxidation-reduction reaction. After conidiation induction for 12 and 24 h, 36 and 218 genes, respectively, which involved in oxidation-reduction process, were differentially expressed between the Δada-6 mutant and wild type (Supplementary Data S1). The expressions of some crucial genes were verified by time course experiment using real time PCR (Figure 2). During the conidiation induction, the transcriptional levels of 15 genes, involved in oxidation-reduction reaction, were increased in wild type. However, their transcriptional levels in the Δada-6 mutant were obviously lower than those in wild type (Table 2). Most of these 15 DGEs encode oxidase or dehydrogenase, including NCU08856 (myo-inositol oxygenase), NCU05858 (fatty acid oxygenase), NCU09209 (galactose oxidase), NCU10015 (methanesulfonate monooxygenase), NCU04474 (sulfite oxidase), NCU01853 (choline dehydrogenase), NCU03893 (short-chain dehydrogenase/reductase SDR), NCU02287 (acyl-CoA dehydrogenase-1), and three peroxidase encoding genes (NCU09210, cat-1 and cat-4) (Table 2). There were 13 genes in wild type were down-regulated during conidiation, but their transcriptional levers in the Δada-6 mutant were higher than those in wild type. These 13 DGEs include three oxidase encoding genes (NCU06402, NCU04983 and NCU01546), two peroxidase encoding genes (cat-3 and NCU10051), two dehydrogenase encoding genes (NCU09798 and NCU01754), and two hydrolase encoding genes (NCU01720 and NCU05969), etc. (Table 2).

FIGURE 2.

FIGURE 2

Open in a new tab

The expressions of some DGEs, crucial for development and oxidative stress responses, were determined by time course experiment using RT-qPCR. Wild type (WT) and the ada-6 deletion mutant (Δada-6) were inoculated on Vogel’s plates and allowed to grow at 28°C in darkness for 24 h. The mycelia were then transferred into 150-ml flasks containing 75 ml of liquid Vogel’s medium (2% sucrose). Cultures were incubated at 28°C with constant agitation at 180 rpm for 18 h, and the mycelia were harvested by vacuum filtration and transferred onto the surface of agar plates (9 cm) to induce conidial development at 28°C under constant light. Cultures were sampled after induction for 6, 12, and 24 h. The total RNA was extracted and transcriptional levels of indicated genes were analyzed by RT-qPCR.

Table 2.

Transcriptional responses to ada-6 deletion by the genes involved in oxidation-reduction process.

Genes Function annotation RPKM Δada6-0 h RPKM Δada6-12 h RPKM Δada6-24 h RPKM WT-0 h RPKM WT-12 h RPKM WT-24 h
Genes involved in oxidative stress response or with antioxidant activity
NCU00355 Cat-3 506.5213 574.7889 75.34231 237.5218 167.5816 19.71859
NCU00598 trx-4, thioredoxin-4 35.076 62.3528 67.1768 37.2486 67.8260 25.4097
NCU02110 Nox-1 16.33786 44.27099 22.52937 12.94278 22.54903 11.09398
NCU03297 ccp-1, cytochrome c peroxidase 179.2891 93.8437 369.5966 195.4672 82.2211 120.0121
NCU03646 L-ascorbate peroxidase 9.7929 48.4457 58.8551 5.0478 47.5253 27.9330
NCU03714 trx-5, thioredoxin-5 10.6542 11.0685 90.3788 11.0683 10.8925 16.1468
NCU04268 peroxiredoxin 2 family 301.3897 58.4775 67.2506 274.8588 47.7068 203.4202
NCU05169 Cat-4 6.192728 12.84018 10.87036 5.196066 12.67001 47.45783
NCU05770 Cat-2 42.99698 259.8382 422.92 69.11465 264.3265 149.3483
NCU06556 trx-6, thioredoxin-6 424.7498 343.7312 1242.284 344.6572 251.2739 328.9048
NCU06880 prx-1, peroxiredoxin-1 145.9389 173.7802 36.7785 152.3986 176.3585 85.6079
NCU07386 mrp-1, Fe superoxide dismutase 48.5932 37.0135 15.4648 49.4635 33.9387 33.3602
NCU08791 Cat-1 159.6162 112.2809 200.6002 188.7525 172.519 456.6022
NCU09210 dyp-type peroxidase 20.2343 196.3718 52.1181 97.0414 549.4004 363.9373
NCU09534 ara-2, peroxiredoxin HYR1 74.8098 299.9837 261.9622 77.8472 170.2767 87.7308
NCU11046 with predicted peroxidase activity 13.1388 18.1692 128.2936 17.0875 27.9754 56.6314
NCU16942 Peroxidase/oxygenase 0.8903 7.5761 27.7938 0.7507 10.7828 12.9403
Genes involved in other oxidation-reduction process
NCU01104 ATP-dependent RNA helicase MSS116 5.6171 7.3674 6.1332 6.4801 10.3741 27.1635
NCU01546 coproporphyrinogen III oxidase 972.8109 637.7059 85.5117 958.0831 314.1893 20.422
NCU01720 glycoside hydrolase 161.6695 106.5222 53.2707 151.4619 97.1703 13.9335
NCU01754 adh-1, alcohol dehydrogenase-1 4265.2542 2337.2632 287.2989 3179.784 681.5673 175.516
NCU01853 choline dehydrogenase. 0.1569 11.6424 5.4089 0.1255 18.4795 25.5386
NCU02020 Metallo reductase transmembrane component 61.6191 51.6116 18.341 44.9787 23.8857 8.8337
NCU02287 acd-1, acyl-CoA dehydrogenase-1 22.8972 179.2092 60.9954 22.7506 293.4145 141.8511
NCU02852 cyp450-31 1.5528 13.122 13.2107 0.8943 15.9223 47.17308
NCU03893 SDR, short-chain dehydrogenase/reductase 99.5548 305.6223 302.4207 138.3449 472.3083 724.727
NCU04474 sulfite oxidase 8.4909 57.1755 8.5554 19.0601 108.0158 76.0423
NCU04865 pks-3, polyketide synthase-3 1.48028 1.846 0.4664 1.241 4.3744 9.1439
NCU04924 cut-1, phosphatidyl synthase 148.4949 59.6279 580.4246 151.5253 129.0153 1104.3985
NCU04983 lathosterol oxidase 154.7887 126.3888 19.9136 144.1937 54.862 11.0899
NCU05185 NADPH-P450 reductase. 15.7645 22.016 42.4126 12.8737 22.3024 116.3517
NCU05338 hypothetical protein 336.5657 307.6338 354.3336 359.5338 174.4177 17.5311
NCU05858 fatty acid oxygenase. 1.6038 8.8979 6.9641 1.2829 61.5339 24.8003
NCU05969 gh61-9, endo-1,4-beta-glucanase 198.02688 156.592 24.2704 76.7552 75.7995 19.4804
NCU06402 C-4 methylsterol oxidase 1578.38 524.4148 183.2211 1578.4012 228.4653 83.66
NCU08856 myo-inositol oxygenase 0.2543 16.4827 9.9163 0.3255 64.2152 25.9664
NCU09209 galactose oxidase 7.0806 88.2866 34.087 41.5362 229.2223 364.781
NCU09798 aryl-alcohol dehydrogenase 47.3846 39.8375 8.9522 18.4233 11.511 3.1077
NCU10051 flavohemoglobin 3568.8831 507.7287 867.6508 3361.9474 186.2688 479.5577
Open in a new tab

(1) WT, wild type; Δada6, ada-6 deletion mutant; -0 h, samples of N. crassa in vegetative growth stage; -12, samples of N. crassa after 12 h of conidiation induction; -24, samples of N. crassa after 24 h of conidiation induction. (2) Locus numbers and function were annotated according to the N. crassa genome assembly (http://fungidb.org/fungidb/). (3) RPKM, Reads Per Kilobase of exon model per Million mapped reads.

Oxidation-reduction reaction is involved in many processes. The foremost is oxidative stress response pathway, which affect fungal growth, development and stress responses. During the conidiation induction, 15 genes involved in oxidative stress response or with antioxidant activity were differentially expressed between the Δada-6 mutant and wild type (Table 2). After 24 h of conidiation induction, the transcriptional levels of 11 genes (nox-1, cat-2, cat-3, NCU03646, NCU09534, NCU16942, ara-2, NCU16942, ccp-1, NCU11046, trx-4, trx-5 and trx-6) in the Δada-6 mutant were obviously higher than those in wild type. Among these 11 genes, the transcriptional levels of nox-1 and cat-3 in the Δada-6 mutant were higher than those in wild type by both 12 and 24 h after conidiation induction (Table 2 and Figure 2). NOX-1 participates in reactive oxygen species (ROS) production, and CAT-3 activity increases during exponential growth and is induced under various stress conditions (Chary and Natvig, 1989; Peraza and Hansberg, 2002). The gene cat-2 encodes catalase-2, which is mainly found in aerial hyphae and conidia (Peraza and Hansberg, 2002). The coding products of NCU03646, NCU09534, NCU16942, ara-2, NCU16942, ccp-1, NCU11046 have peroxidase activity, and trx-4, trx-5 and trx-6 encode thioredoxin. All these genes are induced by ROS or other stresses (Circu and Aw, 2010; Matsuo and Yodoi, 2013). The higher transcription of these 11 genes in the Δada-6 mutant than those in wild type may suggest that the Δada-6 mutant produce more ROS than wild type during the conidiation induction. For the genes cat-1, cat-4, NCU07386 (mrp-1, Fe superoxide dismutase), NCU09210 (dyp-type peroxidase), NCU04268 (peroxiredoxin 2), and NCU06880 (prx-1, peroxiredoxin-1), their transcriptional levels in the Δada-6 mutant were obviously lower than those in wild type after 24 h of conidiation induction (Table 2). The transcriptional levels of cat-1 and cat-4 were increased in wild type but not changed in the Δada-6 mutant during the late period of conidiation (Table 2). CAT-1 is highly abundant in conidia and function mainly in condia germination (Peraza and Hansberg, 2002; Wang et al., 2007), CAT-4 is located in the cytosol (Schliebs et al., 2006), and both CAT-4 and dyp-type peroxidase (NCU09210) were induced during the conidiation (Greenwald et al., 2010). As expression of these genes is correlated with conidiation, the lower transcription of the cat-1, cat-4, and NCU09210 in the Δada-6 mutant compared with those in wild type is consistent with the less sporulation phenotype of the Δada-6 mutant.

During sexual development, 107 genes involved in oxidation-reduction process were found differentially expressed between the Δada-6 mutant and wild type (Supplementary Table S2 and Table 4). After 4 days of sexual development induction, the transcriptional levels of 61 genes in wild type were increased or not changed, but were obviously lower in the Δada-6 mutant than in wild type. While the transcriptional levels of 26 genes were obviously higher in the Δada-6 mutant than in wild type. Among these 107 genes, 15 genes are involved in oxidative stress response or with antioxidant activity (Table 4). After 4 days of sexual development induction, the transcriptional levels of 7 genes (nox-1, nox-2, nox-R, cat-3, NCU03151, NCU08114, and NCU07966) in the Δada-6 mutant were obviously higher than those in wild type. NOX-1, NOX-2, and NOX-R participate in ROS production, and CAT-3 activity increases during exponential growth and is induced under various stress conditions (Chary and Natvig, 1989; Peraza and Hansberg, 2002). NCU03151 encodes a peroxisomal membrane protein, and NCU08114 (cdt-2) encodes a hexose transporter. The higher expression of these seven genes in the Δada-6 mutant suggests that the Δada-6 mutant may be still metabolically active and produced more ROS than wild type after 4 days of sexual development induction. For the genes sod-1, cat-1, cat-4, NCU09210, NCU07966, NCU05858, NCU11286, and NCU03651, their transcriptional levels in the Δada-6 mutant were obviously lower than those in wild type (Table 4). As expression of these genes is correlated with conidiation, the lower expression of these eight genes in the Δada-6 mutant than in wild type is consistent with their phenotypic characteristics, as asexual development is companied with sexual development after 4 days of sexual development induction.

Genes Regulated by ADA-6 Are Involved in Conidiation and Vegetative Cell Wall Development

Many genes are associated with conidiation in N. crassa. Among the genes positively regulating conidiation, acon-3 and fl were differentially expressed between the Δada-6 mutant and wild type (Table 3). The result was verified by time course experiment, in which the expression profiles of acon-3 and fl were analyzed by real time PCR (Figure 2). During the conidiation induction, the transcriptional level of acon-3 and fl in wild type were significantly increased after conidiation induction. At 12 h, the acon-3 and fl transcriptional level was 11.2 times and 6.1 times higher than that at the initial time point, respectively. However, the transcriptional increases of acon-3 and fl were only 1.7-fold and 3-fold in the Δada-6 mutant after 12 h induction. Similar results were found at 24 h of conidiation induction. The transcriptional levels of acon-3 and fl in the Δada-6 mutant were lower than those in wild type during the entire experiment (Figure 2).

Table 3.

Transcriptional response to ada-6 deletion by the genes involved in conidiation and vegetative cell wall development.

Genes Function annotation RPKM Δada6-0 h RPKM Δada6-12 h RPKM Δada6-24 h RPKM WT-0 h RPKM WT-12 h RPKM WT-24 h
Genes positively regulating conidiation
NCU04866 Ada-6     0     0.045997     0.088329     7.139561     40.42227     19.05998
NCU00116 Aab-1, TF subunit     41.0876     104.1344     177.4739     48.6871     114.6333     560.9975
NCU00269 Set-2     1.868055     2.594838     22.58605     2.667073     3.150217     6.208719
NCU00929 hypothetical protein     9.3544     4.7866     7.945482     7.22975     4.6107335     25.61734
NCU04813 hypothetical protein     13.3412     12.7783     9.8237     13.9730     15.9312     27.8958
NCU05260 Protein kinase     7.46533     3.77964     5.44357     6.425309     4.244103     19.1833
NCU07617 Acon-3     0.186927     1.389872     3.91145     0.635499     8.159488     4.862642
NCU08726 fl, fluffy     9.121856     17.91114     14.32059     17.76177     36.69432     45.58477
Genes which deletion mutants with enhanced conidial production
NCU00355 Cat-3     506.5213     574.7889     75.34231     237.5218     167.5816     19.71859
Genes preferentially expressed during conidiation
NCU07324 Con-13     0.300536     2.568501     2.56481     0.480817     7.380787     57.28341
NCU07325 Con-10     10.91534     72.60819     263.9326     7.64009     77.11508     984.083
NCU08457 Eas     18.87683     270.4869     1248.747     82.90488     10027.32     17750.16
NCU08769 Con-6     3.702609     38.78643     69.66419     1.057798     72.8696     2500.538
NCU09235 Con-8     12.17338     203.7125     271.1714     26.04317     922.9603     1041.627
NCU09357 stage V sporulation protein K     0.651945     13.99727     7.899063     3.809303     11.22863     23.29247
Genes encoding vegetative cell wall protein
NCU05974 Mwg1     224.3592     118.3476     191.3125     193.3397     63.22570     86.4393
NCU07277 Acw-8     569.5978     480.884     407.5197     517.1306     321.3095     64.3942
Open in a new tab

(1) WT, wild type; Δada6, ada-6 deletion mutant; -0 h, samples of N. crassa in vegetative growth stage; -12, samples of N. crassa after 12 h of conidiation induction; -24, samples of N. crassa after 24 h of conidiation induction. (2) Locus numbers and function were annotated according to the N. crassa genome assembly (http://fungidb.org/fungidb/). (3) RPKM, Reads Per Kilobase of exon model per Million mapped reads.

For DEGs with unknown functions, we analyzed conidiation of the corresponding gene deletion mutants grown on Vogel’s slants and found that mutants for four genes, including NCU00929, NCU05260, NCU00116, and NCU04813, displayed reduced conidial production (Figure 3). NCU05260 encodes a protein kinase, NCU00116 encodes a CCAAT-binding transcription factor subunit AAB-1 (Chen et al., 1998), and both NCU00929 and NCU04813 encode hypothetical protein. The transcriptional levels of these four genes were increased dramatically at 24 h after conidiation induction, but their transcriptional levels were lower in the Δada-6 mutant than those in wild type (Table 3).

FIGURE 3.

FIGURE 3

Open in a new tab

Conidial production of the knockout mutants of genes regulated by ADA-6. (A) Wild type and knockout mutants were inoculated and grown on Vogel’s slants at 28°C with constant darkness for 1 day, and then transferred to constant light for another 6 days. Conidial production of each strain was documented as images. (B) Conidial production was measured as number of conidia per slant. Standard deviations from three replicates were marked by error bars.

Some conidiation related genes, including eas, con-6, con-8, con-10, con-13, and NCU09357 (encoding stage V sporulation protein K), were highly expressed in wild type during the late period of conidiation (Table 3 and Figure 2). However, the transcriptional levels of these genes in the Δada-6 mutant were much lower than those in wild type in the mid-late period of conidiation (Table 3 and Figure 2). This result is consistent with the phenotype of reduced conidial production in the Δada-6 mutant. After the 24 h of conidiation induction, the wild type had produced many spores, while the Δada-6 mutant produced only a few spores (data not shown). In consistent with this phenotype, the genes encoding cell wall proteins in vegetative hyphae, including acw-8 and mwg1 (Maddi et al., 2009), were higher expressed in the Δada-6 mutant than those in wild type in the mid-late period of conidiation (Table 3 and Figure 2).

Some genes negatively influence conidial development and their deletion resulted in earlier or enhanced conidial production (Michán et al., 2003; Sun et al., 2011, 2012). Among these genes, cat-3 was differentially expressed between the Δada-6 mutant and wild type (Table 3 and Figure 2). As shown in Figure 2, the expression of cat-3 was not increased during conidiation in wild type. However, the transcriptional level of cat-3 in the Δada-6 mutant was higher than those in wild type during the entire period of conidiation induction.

Regulation of the Genes Involved in Sexual Development by ADA-6

A large number of N. crassa genes have been identified to be required for sexual development. Among them, only five genes (app, poi-2, pre-2, fbm-1, and NCU05832) were found differentially expressed between the Δada-6 mutant and wild type during sexual development according to RNA-seq data (Table 4). NCU05832 encodes a methyltransferase, whose homologue in A. fumigatus negatively regulates sexual sporulation, and its deletion resulted in formation of a cellular spore4. The transcription of NCU05832 was not induced in wild type, but induced in the Δada-6 mutant during sexual development. After 4 days of sexual development induction, the transcriptional level of NCU05832 in the Δada-6 mutant was 142% higher than that of wild type (Table 4). This result indicates that NCU05832 is negatively regulated by ADA-6.

The app (abundant perithecial protein) is an indicator of sexual development, and its transcripts occur only after the onset of sexual development (Nowrousian et al., 2007). pre-2 (NCU005758) is a pheromone receptor encoding gene, and plays a vital role during mating in N. crassa (Kim and Borkovich, 2006). poi-2 is essential for differentiation of female reproduction structures and perithecial development (Kim and Nelson, 2005). fbm-1 encodes fruiting body maturation-1, whose homologue in N. discreta is Kynurenine 3-monooxygenase and related to flavoprotein monooxygenases5. The transcripts of app, poi-2, pre-2, and fbm-1 increased during sexual development, but were obviously lower in the Δada-6 mutant than those in wild type. After 4 days of sexual development induction, transcriptional level of app, poi-2, pre-2, and fbm-1 in the Δada-6 was only 0.6, 0.4, 38.5, and 2.8%, respectively, of that in wild type (Table 4). This result suggests that ADA-6 positively regulates the transcription of pre-2 and poi-2, which promote sexual development. The lower expression of app and fbm-1 in the Δada-6 mutant might be the consequence of female sterility of the Δada-6 mutant.

Deletion of ada-6 Causes Hypersensitivity to Oxidants

During both conidiation and sexual development, RNA-seq data suggest that ADA-6 regulate the transcription of cat-3 and genes participating in ROS production. If it is true, deletion of ada-6 might cause an alteration in the sensitivity to oxidants. To confirm this, we inoculated knockout mutants (ada-6, nox-1, cat-2, and cat-3) and wild type on plates with or without oxidants (10 mM H2O2 or 25 μg/ml menadione), and the relative growth inhibition rates of each strain were calculated after 22 h of incubation. The Δcat-3 strain displayed hypersensitivity phenotype to H2O2 (Figure 4A): the relative growth inhibition of the Δcat-3 strain (87%) is higher than that of wild type (70%) (Figure 4B), while, the sensitivity of the Δcat-3 mutant to menadione was similar to that of wild type (Figure 4). This result is consistent with previous report (Michán et al., 2003). The sensitivity of the Δcat-2 mutant to both H2O2 and menadione was similar to wild type, and the Δnox-1 mutant showed slight hypersensitive to menadione and similar sensitive to H2O2 with wild type (Figure 4). The Δada-6 mutant was more sensitive than wild type to both H2O2 and menadione (Figure 4A). On the plates with 10 mM H2O2, the growth of the Δada-6 mutant and wild type was inhibited by 75 and 70%, respectively. On the plates with 25 μg/ml menadione, the growth of the Δada-6 mutant and wild type was inhibited by 63 and 58%, respectively. Above results, together with RNA-seq data suggest that ADA-6 might play a role in oxidative stress response.

FIGURE 4.

FIGURE 4

Open in a new tab

Susceptibility test of N. crassa wild type and knockout mutants (ada-6, nox-1, cat-2, and cat-3) to oxidants. (A) Susceptibility test of the strains to oxidants. Wild type and the mutants were inoculated in ϕ90-mm plates (containing 15-ml liquid Vogel’s medium) and allowed to grow at 28°C in darkness for 24 h. The mycelial mat were punched and the round mat with ϕ4-mm were inoculated in the center of plates (ϕ-90 mm) with or without oxidant (H2O2 or menadione), and incubated at 28°C for indicated time, respectively. Each test was duplicated and the experiment was independently repeated at least three times. (B) Relative growth inhibition rates were calculated based on colony diameters after 22 h of incubation. Values from three replicates were used for a statistical analysis. Means of the inhibition rates are shown, and standard deviations are marked with error bars. Differences between the mutants and the WT were statistically analyzed by the analysis of variance. Values with P < 0.001, 0.001 < P < 0.01, and 0.01 < P < 0.05 are marked with ∗∗∗, ∗∗, and ∗, respectively.

Discussion

Global transcription factors control fungal growth, development and stress responses by regulating gene transcription on a global scale. Several transcription factors encoding genes named as all development altered (ada) were previously identified, and their deletion resulted in significant defects in basal hyphal growth, asexual sporulation, and sexual development (Colot et al., 2006; Carrillo et al., 2017). One of them is ada-6 (NCU04866), whose deletion resulted in slower growth, dramatic reduction in conidiation and female infertility (Colot et al., 2006). However, the regulatory role of ADA-6 in growth and development needs further confirmation by mutant complementation, and its mechanism has not been addressed. Here we first confirmed the positive role of ADA-6 in growth and development by detailed phenotypic characterization of its deletion mutant and the complemented mutant. Then, by comparing transcriptomic profiles and functional analysis of genes influenced by ada-6 deletion, we explored the mechanisms by which ADA-6 promotes conidiation and sexual development. Our results demonstrate that ADA-6 might play a role in conidiation by regulating oxidation-reduction process and single-organism metabolic process. Moreover, ADA-6 positively regulates the transcription of fluffy and acon-3, two key genes required for the initiation of asexual sporulation by controlling the formation of major constriction chains (Matsuyama et al., 1974; Springer and Yanofsky, 1989; Bailey and Ebbole, 1998; Bailey-Shrode and Ebbole, 2004; Chung et al., 2011). Deletion of ada-6 also resulted in female sterility. ADA-6 regulates some genes associated with sexual development, including pre-2, poi-2, and NCU05832, three key genes required for sexual development (Kim and Nelson, 2005; Kim and Borkovich, 2006).

Oxidation-reduction reaction is involved in many pathways. The foremost of these is oxidative stress response pathway, which affects fungal growth, development and stress responses. ADA-6 regulates the transcription of cat-3 and genes participating in ROS production according to RNA-seq data, indicating a role of ADA-6 in oxidative stress response. This was confirmed by the hypersensitivity phenotype of the Δada-6 mutant to oxidants H2O2 and menadione.

Numerous studies have found the role of ROS in the regulation of conidiation and sexual development (Michán et al., 2003; Aguirre et al., 2005; Cano-Domínguez et al., 2008). In N. crassa, formation of conidia from growing hyphae includes three morphogenetic developmental stages: growing hyphae to adherent mycelium, adherent mycelium to aerial hyphae, and aerial hyphae to conidia. A hyperoxidant state develops at the start of these morphogenetic transitions (Hansberg et al., 1993; Toledo et al., 1995). Oxidative stress due to lack of CAT-3 induces hyphal adhesion, and development of more aerial hyphae and conidia (Michán et al., 2003). NOX-1, NOX-2, and NOX-R participates in ROS production, and NOX-1 elimination results in complete female sterility, decreased asexual development, and reduction of hyphal growth in N. crassa (Cano-Domínguez et al., 2008). All these studies indicate that ROS, whose accumulation is induced by eliminating ROS-decomposion (CAT-3) or activating ROS-generation (NOX-1), is a critical cell differentiation signal promoting conidiation and sexual development. In our study, ADA-6 regulates the transcription of oxidative stress related genes, including nox-1, cat-3, etc., during both conidiation and sexual development. Based on above result, we speculate that more ROS may accumulate in cells of the Δada-6 mutant during development or stress response process. This was further confirmed by the results that deletion of ada-6 resulted in hypersensitive to oxidative stress inducers H2O2 and menadione. Based on previous studies, this ROS accumulation can promote conidiation and sexual development in N. crassa (Hansberg et al., 1993; Toledo et al., 1995; Cano-Domínguez et al., 2008). However, the Δada-6 mutant still exhibited reduced conidial production and female sterility. These results indicate that regulation of development and oxidative stress response by ADA-6 may be independent.

In summary, our study showed that ADA-6, as a global regulator, plays positive roles in conidiation and sexual development, and regulates oxidative stress response of N. crassa. Combining transcriptomic profiles and functional assay, we explored the mechanisms by which ADA-6 promotes conidiation and sexual development, and regulates oxidative stress response. This work has augmented our knowledge of the functions and mechanisms of global regulators that influence growth, development and stress responses in filamentous fungi.

Author Contributions

XS designed the study and wrote the manuscript. XS, FW, NL, and CH performed the main experiments. SL, BL, WX, and ZZ contributed to the data analysis and the data interpretation.

Conflict of Interest Statement

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Funding. This project was supported by grants 31370024 (to XS) from National Natural Science Foundation of China.

Supplementary Material

The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fmicb.2019.00750/full#supplementary-material

Click here for additional data file. (2.9MB, XLS)
Click here for additional data file. (16.4KB, DOCX)
Click here for additional data file. (31.6KB, XLSX)

References

  1. Aguirre J., Rios-Momberg M., Hewitt D., Hansberg W. (2005). Reactive oxygen species and development in microbial eukaryotes. Trends Microbiol. 13 111–118. 10.1016/j.tim.2005.01.007 [DOI] [PubMed] [Google Scholar]
  2. Bailey L. A., Ebbole D. J. (1998). The fluffy gene of Neurospora crassa encodes a Gal4p-type C6 zinc cluster protein required for conidial development. Genetics 148 1813–1820. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bailey-Shrode L., Ebbole D. J. (2004). The fluffy gene of Neurospora crassa is necessary and sufficient to induce conidiophore development. Genetics 166 1741–1749. 10.1534/genetics.166.4.1741 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Borkovich K. A., Alex L. A., Yarden O., Freitag M., Turner G. E., Read N. D., et al. (2004). Lessons from the genome sequence of Neurospora crassa: tracing the path from genomic blueprint to multicellular organism. Microbiol. Mol. Biol. Rev. 68 1–108. 10.1128/MMBR.68.1.1-108.2004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Cano-Domínguez N., Alvarez-Delfin K., Hansberg W., Aguirre J. (2008). NADPH oxidases NOX-1 and NOX-2 require the regulatory subunit NOR-1 to control cell differentiation and growth in Neurospora crassa. Eukaryot.Cell 7 1352–1361. 10.1128/EC.00137-08 [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Carrillo A. J., Schacht P., Cabrera I. E., Blahut J., Prudhomme L., Dietrich S., et al. (2017). Functional profiling of transcription factor genes in Neurospora crassa. G3 7 2945–2956. 10.1534/g3.117.043331 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Chary P., Natvig D. O. (1989). Evidence for three differentially regulated catalase genes in Neurospora crassa: effects of oxidative stress, heat shock, and development. J. Bacteriol. 171 2646–2652. 10.1128/jb.171.5.2646-2652.1989 [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Chen H., Crabb J. W., Kinsey J. A. (1998). The neurospora aab-1 gene encodes a CCAAT binding protein homologous to yeast HAP5. Genetics 148 123–130. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Chung D. W., Greenwald C., Upadhyay S., Ding S., Wilkinson H. H., Ebbole D. J., et al. (2011). acon-3, the Neurospora crassa ortholog of the developmental modifier, medA, complements the conidiation defect of the Aspergillus nidulans mutant. Fungal Genet. Biol. 48 370–376. 10.1016/j.fgb.2010.12.008 [DOI] [PubMed] [Google Scholar]
  10. Circu M. L., Aw T. Y. (2010). Reactive oxygen species, cellular redox systems, and apoptosis. Free Radic. Biol. Med. 48 749–762. 10.1016/j.freeradbiomed.2009.12.022 [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Colot H. V., Park G., Turner G. E., Ringelberg C., Crew C. M., Litvinkova L., et al. (2006). A high-throughput gene knockout procedure for neurospora reveals functions for multiple transcription factors. Proc. Natl. Acad. Sci. U.S.A. 103 10352–10357. 10.1073/pnas.0601456103 [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Davis R. H., de Serres F. J. (1970). Genetic and microbiological research techniques for Neurospora crassa. Method Enzymol. 17 79–143. 10.1016/0076-6879(71)17168-6 [DOI] [Google Scholar]
  13. Davis R. H., Perkins D. D. (2002). Neurospora: a model of model microbes. Nat. Rev. Genet. 3 397–403. 10.1038/nrg797 [DOI] [PubMed] [Google Scholar]
  14. Ebbole D. J., Sachs M. S. (1990). A rapid and simple method for isolation of Neurospora crassa homokaryons using microconidia. Fungal Genet. Newslett. 37 17–18. 10.4148/1941-4765.1472 [DOI] [Google Scholar]
  15. Grabherr M. G., Haas B. J., Yassour M., Levin J. Z., Thompson D. A., Amit I., et al. (2011). Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nat. Biotechnol. 29 644–652. 10.1038/nbt.1883 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Greenwald C. J., Kasuga T., Glass N. L., Shaw B. D., Ebbole D. J., Wilkinson H. H. (2010). Temporal and spatial regulation of gene expression during asexual development of Neurospora crassa. Genetics 186 1217–1230. 10.1534/genetics.110.121780 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Hansberg W., de Groot H., Sies H. (1993). Reactive oxygen species associated with cell differentiation in Neurospora crassa. Free Radic. Biol. Med. 14 287–293. 10.1016/0891-5849(93)90025-P [DOI] [PubMed] [Google Scholar]
  18. Heitman J., Sun S., James T. Y. (2013). Evolution of fungal sexual reproduction. Mycologia 105 1–27. 10.3852/12-253 [DOI] [PubMed] [Google Scholar]
  19. Kim H., Borkovich K. A. (2006). Pheromones are essential for male fertility and sufficient to direct chemotropic polarized growth of trichogynes during mating in Neurospora crassa. Eukaryot. Cell 5 544–554. 10.1128/EC.5.3.544-554.2006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Kim H., Nelson M. A. (2005). Molecular and functional analyses of poi-2, a novel gene highly expressed in sexual and perithecial tissues of Neurospora crassa. Eukaryot.Cell 4 900–910. 10.1128/EC.4.5.900-910.2005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Lehr N. A., Wang Z., Li N., Hewitt D. A., López-Giráldez F., Trail F., et al. (2014). Gene expression differences among three Neurospora species reveal genes required for sexual reproduction in Neurospora crassa. PLoS One 9:e110398. 10.1371/journal.pone.0110398 [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Livak K. J., Schmittgen T. D. (2001). Analysis of relative gene expression data using Real-time quantitative PCR and the 2-ΔΔCt method. Methods 25 402–408. 10.1006/meth.2001.1262 [DOI] [PubMed] [Google Scholar]
  23. Maddi A., Bowman S. M., Free S. J. (2009). Trifluoromethanesulfonic acid-based proteomic analysis of cell wall and secreted proteins of the ascomycetous fungi Neurospora crassa and Candida albicans. Fungal Genet. Biol. 46 768–781. 10.1016/j.fgb.2009.06.005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Matsuo Y., Yodoi J. (2013). Extracellular thioredoxin: a therapeutic tool to combat inflammation. Cytokine Growth Factor Rev. 24 345–353. 10.1016/j.cytogfr.2013.01.001 [DOI] [PubMed] [Google Scholar]
  25. Matsuyama S. S., Nelson R. E., Siegel R. W. (1974). Mutations specifically blocking differentiation of macroconidia in Neurospora crassa. Dev. Biol. 41 278–287. 10.1016/0012-1606(74)90306-6 [DOI] [PubMed] [Google Scholar]
  26. Michán S., Lledías F., Hansberg W. (2003). Asexual development is increased in Neurospora crassa cat-3-null mutant strains. Eukaryot. Cell 2 798–808. 10.1128/EC.2.4.798-808.2003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Ni M., Feretzaki M., Sun S., Wang X., Heitman J. (2011). Sex in fungi. Annu. Rev. Genet. 45 405–430. 10.1146/annurev-genet-110410-132536 [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Nowrousian M., Piotrowski M., Kück U. (2007). Multiple layers of temporal and spatial control regulate accumulation of the fruiting body-specific protein APP in Sordaria macrospora and Neurospora crassa. Fungal Genet. Biol. 44 602–614. 10.1016/j.fgb.2006.09.009 [DOI] [PubMed] [Google Scholar]
  29. Peraza L., Hansberg W. (2002). Neurospora crassa catalases, singlet oxygen and cell differentiation. Biol. Chem. 383 569–575. 10.1515/BC.2002.058 [DOI] [PubMed] [Google Scholar]
  30. Perkins D. D., Davis R. H. (2000). Neurospora at the millennium. Fungal Genet. Biol. 31 153–167. 10.1006/fgbi.2000.1248 [DOI] [PubMed] [Google Scholar]
  31. Royer J. C., Yamashiro C. T. (1992). Generation of transformable spheroplasts from mycelia, macroconidia, microconidia and germinating ascospores of Neurospora crassa. Fungal Genet. Newslett. 39 76–79. 10.4148/1941-4765.1440 [DOI] [Google Scholar]
  32. Schliebs W., Würtz C., Kunau W.-H., Veenhuis M., Rottensteiner H. (2006). A eukaryote without catalase-containing microbodies: Neurospora crassa exhibits a unique cellular distribution of its four catalases. Eukaryot. Cell 5 1490–1502. 10.1128/EC.00113-06 [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Springer M. L. (1993). Genetic control of fungal differentiation: the three sporulation pathways of Neurospora crassa. BioEssays 15 365–374. 10.1002/bies.950150602 [DOI] [PubMed] [Google Scholar]
  34. Springer M. L., Yanofsky C. (1989). A morphological and genetic analysis of conidiophore development in Neurospora crassa. Gene. Dev. 3 559–571. 10.1101/gad.3.4.559 [DOI] [PubMed] [Google Scholar]
  35. Sun X., Yu L., Lan N., Wei S., Yu Y., Zhang H., et al. (2012). Analysis of the role of transcription factor VAD-5 in conidiation of Neurospora crassa. Fungal Genet. Biol. 49 379–387. 10.1016/j.fgb.2012.03.003 [DOI] [PubMed] [Google Scholar]
  36. Sun X., Zhang H., Zhang Z., Wang Y., Li S. (2011). Involvement of a helix-loop-helix transcription factor CHC-1 in CO2-mediated conidiation suppression in Neurospora crassa. Fungal Genet. Biol. 48 1077–1086. 10.1016/j.fgb.2011.09.003 [DOI] [PubMed] [Google Scholar]
  37. Sweigard J., Chumley F. G., Carroll A., Farrall L., Valent B. (1997). A series of vectors for fungal transformation. Fungal Genet. Newslett. 44 52–53. 10.4148/1941-4765.1287 [DOI] [Google Scholar]
  38. Thompson S., Croft N. J., Sotiriou A., Piggins H. D., Crosthwaite S. K. (2008). Neurospora crassa heat shock factor 1 is an essential gene; a second heat shock factor-like gene, hsf2, is required for asexual spore formation. Eukaryot.Cell 7 1573–1581. 10.1128/EC.00427-07 [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Toledo I., Rangel P., Hansberg W. (1995). Redox imbalance at the start of each morphogenetic step of Neurospora crassa conidiation. Arch. Biochem. Biophys. 319 519–524. 10.1006/abbi.1995.1326 [DOI] [PubMed] [Google Scholar]
  40. Wang N., Yoshida Y., Hasunuma K. (2007). Loss of catalase-1 (Cat-1) results in decreased conidial viability enhanced by exposure to light in Neurospora crassa. Mol. Genet. Genomics 277 13–22. 10.1007/s00438-006-0170-4 [DOI] [PubMed] [Google Scholar]
  41. Wang Z., Lehr N. A., Trail F., Townsend J. P. (2012). Differential impact of nutrition on developmental and metabolic gene expression during fruiting body development in Neurospora crassa. Fungal Genet. Biol. 49 405–413. 10.1016/j.fgb.2012.03.004 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Click here for additional data file. (2.9MB, XLS)
Click here for additional data file. (16.4KB, DOCX)
Click here for additional data file. (31.6KB, XLSX)

Articles from Frontiers in Microbiology are provided here courtesy of Frontiers Media SA

RESOURCES