The complete genome sequence of a human enterovirus C99 strain isolated from a healthy child in Yunnan, China, in 2013 was determined. The isolate belonged to genotype C, according to phylogenetic and homogeneity analyses.
ABSTRACT
The complete genome sequence of a human enterovirus C99 strain isolated from a healthy child in Yunnan, China, in 2013 was determined. The isolate belonged to genotype C, according to phylogenetic and homogeneity analyses.
ANNOUNCEMENT
Human enterovirus C99 (EV-C99) belongs to Human enterovirus C. EV-C99 is a positive-sense, single-stranded RNA virus. The genome is approximately 7.4 kb, including a 5ʹ untranslated region (UTR), structural polypeptide P1, nonstructural polypeptides P2 and P3, and a 3ʹ UTR. All EV-C99 strains can be classified into three genotypes, A, B, and C (1). EV-C99 strains have been isolated from acute flaccid paralysis (AFP) patients and from oral polio-vaccinated and healthy individuals (1–4). At present, there are very few EV-C99 sequences available in the GenBank database.
A stool sample of a healthy child in Yunnan, China, was inoculated into human embryonic lung diploid fibroblasts (KMB17) and propagated in up to three passages. The sample induced a cytopathic effect (CPE), was stored at −80°C, and was named strain K292/YN/CHN/2013. The viral RNA was extracted from cell culture supernatants using the AxyPrep body fluid viral DNA/RNA miniprep kit (Axygen, Union City, CA). Then, the partial VP1 gene was amplified using the primer pairs 222 and 224 (5) with a PrimeScript one-step reverse transcription-PCR (RT-PCR) kit v.2 (TaKaRa, Dalian, China). The primers used in this study were designed using the primer-walking strategy (6, 7), shown in Table 1. The Tsingke Sequencing Company (Kunming, China) sequenced the positive PCR products using an ABI 3730XL automatic sequencer (Applied Biosystems, Foster City, CA). In order to resolve the alignments into a consensus, DNAStar 6.0 (DNAStar, Inc., Madison, WI) was used to assemble the raw sequences using default parameters. Then, the conflicting positions were inspected manually and amended where manual inspection of the corresponding positions in the chromatograms showed a single peak. The average depth was 3×, based on the read number and length.
TABLE 1.
Primers used for RT-PCR and sequencing of the human enterovirus C99 strain K292/YN/CHN/2013 genome
| Primer namea | Sequence (5′→3′) | Nucleotide position |
|---|---|---|
| 222 | CICCIGGIGGIAYRWACAT | 2969–2951 |
| 224 | GCIATGYTIGGIACICAYRT | 1977–1996 |
| EV991F | TTAAAACAGCTCTGGGGTTG | 1–20 |
| EV992R | CTGAAGTCTGGGCACGCGCT | 2433–2414 |
| EV992F | GCATGCGTCACTATATTGGA | 2741–2760 |
| EV998R | CTCCGAATTAAAGAAAAATT | 7428–7409 |
| EV991r | CCCAGGTAGTGATAGAAC | 1267–1249 |
| EV992r | GTAATAGGGATTTGTGTA | 1707–1696 |
| EV993r | CCATGGTGCAGCTAGACTGT | 2270–2251 |
| EV995f | TTGATCAAATTGCCAGAT | 3549–3566 |
| EV996f | AGGCCATACAACTGATGGA | 5001–5019 |
| EV996r | TTTAAGAGCTTCAAACCA | 6751–6734 |
| EV998f | AACCCAGGTGTTGTTACC | 6602–6619 |
| EV995r | CAGTAAATCATTGATGCAC | 5200–5182 |
F (forward) and R (reverse) indicate the orientation of each primer. Primers named with capital (F, R) and lowercase (f, r) letters were used to perform RT-PCR and sequence the amplicons, respectively.
Geneious Basic 5.6.5 software was used to analyze nucleic acid and protein sequence alignments. The viral genome sequence of the strain K292/YN/CHN/2013 was 7,453 nucleotides (nt) in length, excluding the poly(A) tail. The open reading frame (ORF) of the strain encodes the structural protein region P1 (2,649 nt) and the functional protein regions P2 (1,722 nt) and P3 (2,259 nt). The sequence was flanked by a 3ʹ UTR (71 nt) and a 5ʹ UTR (752 nt). The contents of A, U, G, and C were 30.2%, 24.9%, 22.3%, and 22.7%, respectively, with a GC content of 44.9%. All complete genome sequences of EV-C99 available in GenBank were identified using BLAST. The sequences were aligned using the ClustalW multiple alignment method. The strain shared 81.2 to 92.2% and 87.3 to 93.1% nucleotide similarity with other Chinese strains in the complete VP1 gene and the complete genome, respectively. The isolate was defined as an EV-C99 strain according to the enterovirus type demarcation criterion (strains with >75% nucleotide or >88% amino acid homology with VP1 sequences belong to the same serotype) (7). The strain K292/YN/CHN/2013 is assigned to genotype C, according to the results of the phylogenetic analyses (Fig. 1). In addition, similarity plot and bootscanning analysis was performed using Simplot v.3.5.1; the K292/YN/CHN/2013 strain revealed intraserotypic genetic recombination events.
FIG 1.
Phylogenetic analysis of EV-C99 based on complete VP1 sequences. The tree was created using the neighbor-joining method with the Kimura two-parameter model of nucleotide substitution in MEGA v.6.06, with a bootstrap value of 1,000. The tip/taxon labels include the strain names and GenBank accession numbers. The triangle indicates the strain isolated in this study, and circles indicate other Chinese isolates.
Data availability.
The complete genome sequence of K292/YN/CHN/2013 has been deposited in GenBank under the accession no. KT946713.
ACKNOWLEDGMENTS
Funding for this research was provided by Yunnan Provincial Science and Technology Department (grant 2017FA006) and the Chinese Academy of Medical Sciences Initiative for Innovative Medicine (grant 2016-I2M-3-026).
REFERENCES
- 1.Brouwer L, van der Sanden SMG, Calis JCJ, Bruning AHL, Wang S, Wildenbeest JG, Rebers SPH, Phiri KS, Westerhuis BM, van Hensbroek MB, Pajkrt D, Wolthers KC. 2018. High frequency of polio-like enterovirus C strains with differential clustering of CVA-13 and EV-C99 subgenotypes in a cohort of Malawian children. Arch Virol 163:2645–2653. doi: 10.1007/s00705-018-3878-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Adeniji JA, Oragwa AO, George UE, Ibok UI, Faleye TOC, Adewumi MO. 2017. Preponderance of enterovirus C in RD-L20B-cell-culture-negative stool samples from children diagnosed with acute flaccid paralysis in Nigeria. Arch Virol 162:3089–3101. doi: 10.1007/s00705-017-3466-2. [DOI] [PubMed] [Google Scholar]
- 3.Sun Q, Zhang Y, Cui H, Zhu S, Li X, Huang G, Tang H, Yan D, Wang D, Xu W. 2014. Complete genome sequence analysis of two human enterovirus C99 strains isolated in Xinjiang Uighur Autonomous Region, China, in 2011. Arch Virol 159:359–364. doi: 10.1007/s00705-013-1839-8. [DOI] [PubMed] [Google Scholar]
- 4.Xu A, Tao Z, Wang H, Zhang Y, Song L, Li Y, Liu G, Liu Y, Yang H, Fan Q, Ji F, Zhang Y, Yang J, Feng L, Xu W, Zhao Z. 2011. The complete genome analysis of two enterovirus 96 strains isolated in China in 2005 and 2009. Virus Genes 42:323–330. doi: 10.1007/s11262-011-0584-x. [DOI] [PubMed] [Google Scholar]
- 5.Nix WA, Oberste MS, Pallansch MA. 2006. Sensitive, seminested PCR amplification of VP1 sequences for direct identification of all enterovirus serotypes from original clinical specimens. J Clin Microbiol 44:2698–2704. doi: 10.1128/JCM.00542-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Zhang J, Zhang H, Zhao Y, Guo C, Yang Z, Ma S. 2017. Molecular characterization of a new human coxsackievirus B2 associated with severe hand-foot-mouth disease in Yunnan Province of China in 2012. Arch Virol 162:307–311. doi: 10.1007/s00705-016-3075-5. [DOI] [PubMed] [Google Scholar]
- 7.Zhang H, Zhao Y, Liu H, Sun H, Huang X, Yang Z, Ma S. 2017. Molecular characterization of two novel echovirus 18 recombinants associated with hand-foot-mouth disease. Sci Rep 7:8448. doi: 10.1038/s41598-017-09038-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The complete genome sequence of K292/YN/CHN/2013 has been deposited in GenBank under the accession no. KT946713.