Skip to main content
Journal of Virology logoLink to Journal of Virology
. 2019 Apr 17;93(9):e02290-18. doi: 10.1128/JVI.02290-18

Marek's Disease Virus Disables the ATR-Chk1 Pathway by Activating STAT3

Xue Lian a,b,c, Chenyi Bao a,b, Xueqi Li a,b, Xunhai Zhang d, Hongjun Chen e, Yong-Sam Jung a,b, Yingjuan Qian a,b,✉
Editor: Jae U Jungf
PMCID: PMC6475774  PMID: 30787154

MDV is used as a biomedical model to study virus-induced lymphoma due to the similar genomic structures and physiological characteristics of MDV and human herpesviruses. Upon infection, MDV induces DNA damage, which may activate the DDR pathway. The DDR pathway has a dual impact on viruses because it manipulates repair and recombination factors to facilitate viral replication and also initiates antiviral action by regulating other signaling pathways. Many DNA viruses evolve to manipulate the DDR pathway to promote virus replication. In this study, we identified a mechanism used by MDV to inhibit ATR-Chk1 pathways. ATR is a cellular kinase that responds to broken single-stranded DNA, which has been less studied in MDV infection. Our results suggest that MDV infection activates STAT3 to disable the ATR-Chk1 pathway, which is conducive to viral replication. This finding provides new insight into the role of STAT3 in interrupting the ATR-Chk1 pathway during MDV replication.

KEYWORDS: ATR-Chk1 pathway, DNA damage, Marek's disease virus, STAT3, viral replication

ABSTRACT

Oncogenic virus replication often leads to genomic instability, causing DNA damage and inducing the DNA damage response (DDR) pathway. The DDR pathway is a cellular pathway that senses DNA damage and regulates the cell cycle to maintain genomic stability. Therefore, the DDR pathway is critical for the viral lifecycle and tumorigenesis. Marek’s disease virus (MDV), an alphaherpesvirus that causes lymphoma in chickens, has been shown to induce DNA damage in infected cells. However, the interaction between MDV and the host DDR is unclear. In this study, we observed that MDV infection causes DNA strand breakage in chicken fibroblast (CEF) cells along with an increase in the DNA damage markers p53 and p21. Interestingly, we showed that phosphorylation of STAT3 was increased during MDV infection, concomitantly with a decrease of Chk1 phosphorylation. In addition, we found that MDV infection was enhanced by VE-821, an ATR-specific inhibitor, but attenuated by hydroxyurea, an ATR activator. Moreover, inhibition of STAT3 phosphorylation by Stattic eliminates the ability of MDV to inhibit Chk1 phosphorylation. Finally, we showed that MDV replication was decreased by Stattic treatment. Taken together, these results suggest that MDV disables the ATR-Chk1 pathway through STAT3 activation to benefit its replication.

IMPORTANCE MDV is used as a biomedical model to study virus-induced lymphoma due to the similar genomic structures and physiological characteristics of MDV and human herpesviruses. Upon infection, MDV induces DNA damage, which may activate the DDR pathway. The DDR pathway has a dual impact on viruses because it manipulates repair and recombination factors to facilitate viral replication and also initiates antiviral action by regulating other signaling pathways. Many DNA viruses evolve to manipulate the DDR pathway to promote virus replication. In this study, we identified a mechanism used by MDV to inhibit ATR-Chk1 pathways. ATR is a cellular kinase that responds to broken single-stranded DNA, which has been less studied in MDV infection. Our results suggest that MDV infection activates STAT3 to disable the ATR-Chk1 pathway, which is conducive to viral replication. This finding provides new insight into the role of STAT3 in interrupting the ATR-Chk1 pathway during MDV replication.

INTRODUCTION

Marek’s disease (MD) is an avian infectious disease that can cause a variety of clinical syndromes, such as immunosuppression, enlargement and dysfunction of peripheral nerves, and CD4+ T cell transformations that induce lymphoma in visceral organs (1, 2). MD virus (MDV) belongs to the Alphaherpesvirinae subfamily, which shares close genomic and structural functions with herpes simplex virus 1 (HSV-1) and the varicella-zoster virus (VZV) (3, 4). The three MDV serotypes that exist are MDV-1 (gallid alphaherpesvirus 2 [GaHV-2]), MDV-2 (GaHV-3), and MDV-3 (meleagrid alphaherpesvirus 1 [MeHV-1]), but only MDV-1 can induce lymphomagenesis in chicken (4–6). There are four groups in the MDV-1 serotype, and they differ depending on the phenotype of isolates: mild (m) MDV, virulent (v) MDV, very virulent (vv) MDV, and very virulent plus (vv+) MDV (7, 8). Viruses replicate in the nuclei of cells, which often leads to genomic instability, causing DNA damage and induction of the DNA damage response (DDR) (9). MDV was first diagnosed in naturally infected White-Lohmann hens, in which DNA damage and oxidative stress were found to be increased in vivo (10). Trapp-Fragnet et al. demonstrated that MDV replication triggered cellular proliferation and S-phase cell cycle arrest, which was related to the virus protein VP22 (11). VP22, as encoded by the MDV UL49 gene, is a viral particle component involved in viral intercellular spread and replication (12). In addition, Bencherit et al. observed that MDV induced double-strand breaks (DSBs) in vitro and in the peripheral blood mononuclear cells (PBMCs) of MDV-infected chickens, which required VP22 (13). To date, the mechanisms controlling DNA damage in response to MDV replication and reactivation are still not clear.

The DDR is a cellular pathway that detects DNA damage and regulates the cell cycle checkpoints, DNA replication and repairs, and cellular apoptosis (14). There are three DDR pathways: ATM (ataxia telangiectasia mutated), ATR (ATM and Rad3 related), and DNA-PK (DNA-dependent protein kinase). ATM is phosphorylated at serine 1981 to stabilize DSBs and performs this action by being recruited with the MRE11-RAD50-NBS1 (MRN) complex to broken DNA sites and by mediating DNA repair through homologous recombination (HR) (15, 16). DNA-PK is also activated in response to DSBs, which recruit a DNA-PK complex that includes a large catalytic subunit (DNA-PKcs) and two regulatory subunits, Ku70 and Ku86. The DNA ligase IV-XRCC4 complex then rejoins the broken DNA strand ends to repair the DNA by nonhomologous end joining (NHEJ) (17). ATR differs from ATM and DNA-PK and coordinates DNA single-strand breaks (SSBs). ATR regulates DNA replication during the S phase in response to replication stress and is recruited to the stalled replication forks with the ATR-interacting protein (ATRIP), which then binds to replication protein A 70 (RPA70) (18). The double-stranded/single-stranded DNA (ds/ssDNA) junctions bound by RPAs load onto the RAD9-RAD1-HUS1 (9-1-1) complexes through the Rad17-RFC complex with the sequential recruitment of the BRCA1 C terminus (BRCT) repeat protein TopBP1 to activate ATR (19). Chk1 is an ATR effector that becomes phosphorylated and then regulates cell cycle checkpoints by controlling CDC25 phosphatases and, thus, mediates cyclin-dependent kinase 1 (CDK1) that inhibits mitosis and leads to S-phase arrest (20, 21). The tumor protein p53 is the downstream target of Chk1 and Chk2 and regulates p21, which subsequently inhibits the cyclin E/Cdk2 complex to induce G1/S transition arrest (22).

Most tumor viruses promote viral propagation by manipulating the cellular DDR to allow reentry into the cell cycle, which concurrently protects the host by maintaining genome integrity (23). The mechanism by which the virus interacts with the DDR pathway is rather complex. The DDR regulates cellular signaling to protect the genome from accumulating mutations. Tumor viruses antagonize the DDR by suppressing downstream signaling pathways, which leads to increased mutagenesis and genotoxicity that cause tumorigenesis. Herpes simplex virus 1 (HSV-1) is known to mediate the DDR pathway during replication and can selectively choose to activate or suppress the DDR pathway or to use DDR proteins to promote replication. The Epstein-Barr virus (EBV) is an oncogenic virus related to Burkitt’s lymphoma (BL), which deregulates ATM pathways and DNA repair using viral latency proteins, leading to genomic instability (24–26). HSV-1 is an alphaherpesvirus that prevents ATR signaling in HSV-infected cells, which could benefit HSV-1 replication even if it inhibits Chk1 phosphorylation in cells treated with hydroxyurea (HU), a known activator of ATR signaling (27, 28).

STAT3 is a member of the transducers and activators of transcription (STAT) family that responds to cytokines and growth factors and also plays a key role in oncogenesis (29). Activation of STAT3 can assist with the transfer of a signal from a cellular receptor into a nucleus and regulates the transcription of several genes related to embryonic development, inflammation, immunity, and wound healing (30–34). Notably, a few genes regulated by STAT3 are proproliferative and anti-apoptotic and therefore contribute to cancer development (35). Aberrant STAT3 activation contributes to tumor initiation, progression, and metastasis (36, 37). A previous study investigated the role of STAT3 in activating the DDR in response to DNA damage and found that STAT3 was required for phosphorylation of Chk1 (38). In contrast to the involvement of the STAT3-ATR-Chk1 pathway, another report showed that STAT3 is necessary for suppressing phosphorylation of Chk1 (35). The discrepancy between the two studies may be due to STAT3 playing different roles in different cell models and responding to different types of DNA damage (39).

This study aimed to understand the role of the DDR pathways in MDV infection and to reveal the mechanisms by which MDV regulates the cellular DDR pathways. We demonstrated that MDV infection induced DDR pathway activation and disabled the ATR-Chk1 pathway, which affected MDV replication. Finally, we observed that MDV infection activated STAT3, which suppressed ATR-mediated Chk1 phosphorylation and suggested that MDV infection repressed the ATR-Chk1 pathway through STAT3 activation.

RESULTS

MDV infection induces DNA damage in CEF cells.

To examine whether infection with Md5, a virulent strain of MDV, or CVI988, a vaccine strain, induces DNA damage, CEF cells were infected with Md5 or CVI988. Mock and MDV-infected cells at different time points were collected to assess DNA damage by the alkaline comet assay. As shown in Fig. 1A, no DNA migration occurred among most of the control cells, and a linear increase in the length of DNA migration was observed starting from 1 to 4 days postinfection (dpi) in Md5- or CVI988-infected cells. Although some control cells showed DNA migration as the time increased, the DNA migration of MDV-infected cells was enhanced. Especially at 3 and 4 dpi, fragmentation progression resulted in a long tail and a smaller head region in Md5- or CVI988-infected cells. Extension of the DNA tail in a single MDV-infected cell was dependent on the infection time interval (Fig. 1B). The degree of DNA damage in MDV-infected cells at 3 and 4 dpi was evaluated by the percentage of DNA damage in the tail using OpenComet software. Although increasing DNA damage trends were detected in both uninfected and MDV-infected cells, the percentage of DNA damages in uninfected cells was an average of 7.58% ± 0.89%. Infection with Md5 for 3 and 4 dpi resulted in a significantly higher percentage of DNA damages (3 dpi, 31.3% ± 2.3%; 4 dpi, 49.65% ± 2.791%) (Fig. 1C). The results of CVI988 infection were similar to those of Md5. The percentage of DNA damages in the CVI988-infected cells was significantly increased (3 dpi, 26.81% ± 1.71%; 4 dpi, 44.91% ± 3.173%) (Fig. 1D). These data indicate that both Md5 and CVI988 infection induced DNA damage in CEF cells. p53 and p21 are downstream of the DDR pathway and induce apoptosis and are increased by the ATR-Chk1 and ATM-Chk2 pathways. To measure the p53 and p21 protein levels by Western blotting, CEF cells infected with Md5 or CVI988 for 1, 2, 3, or 4 days were harvested. We showed that p53 and p21 levels were increased in MDV-infected cells, which indicates that MDV infection could also activate the other DDR pathways to enhance the levels of p53 and p21 (Fig. 1E and F).

FIG 1.

FIG 1

MDV infection induces DNA damage in CEF cells. CEF cells were infected with 4 × 104 PFU of Md5 or CVI988 (MOI 0.02). (A and B) DNA damage analysis in mock- or MDV-infected CEF cells. CEF cells were infected with Md5 or CVI988, and at 1, 2, 3, and 4 dpi 1 × 105 cells per treatment were collected for the alkaline comet assay. Two slides prepared for each sample were analyzed by fluorescence microscope. (C and D) The degree of DNA damage was indicated by DNA percentage in the tail using OpenComet software (**, P < 0.01). Ten randomly chosen images in each group (the uninfected and infected groups) were analyzed, and more than 100 comets were scored for each case to measure DNA damage. (E and F) CEF cells were infected with Md5 or CVI988, and at 1, 2, 3, and 4 dpi cells were collected for detection of p53, p21, vp22, and actin by Western blotting. Scale bar, 10 μm.

MDV Infection suppresses the ATR-Chk1 pathway.

The DDR pathway is one of the host defense mechanisms against invading pathogens. In turn, viruses also either inhibit the DDR pathway to eliminate the host adverse effects on viral propagation or utilize DDR signaling factors to assist in infection (23). MDV infection induces DNA damage and activates the downstream signal of the DDR pathway in CEF cells. To explore whether MDV inhibits the ATR-Chk1 pathway to improve its ability to replicate, CEF cells that were infected with Md5 or CVI988 were collected at different time points, showing that pChk1 was increased at an early stage of MDV infection. However, the pChk1 levels in virus-infected cells were lower than those in control cells after infection for over 16 h (Fig. 2A and B). Because the commercial pChk1 antibodies poorly recognize endogenous pChk1 in chicken cells, we infected Chk1-overexpressing CEFs with Md5 or CVI988 after a 12-h transfection to amplify the signal. We found that Chk1 phosphorylation was decreased in Md5-infected cells (Fig. 2C). To further amplify pChk1, cells were treated with etoposide (ETP) for 2 h before harvest. This treatment can induce DNA damage that leads to Chk1 phosphorylation. Consistently, the ATR-Chk1 pathway was activated by ETP in CEF cells, and ETP-mediated phosphorylation of Chk1 was attenuated by MDV infection (Fig. 2C). As shown in Fig. 2D, pChk1 activation was also repressed in the cells infected with CVI988. It is noteworthy that γH2AX was slightly decreased by MDV infection in both untreated and ETP-treated cells (Fig. 2C and D). This means that γH2AX accumulation was not affected through suppression of the ATR-Chk1 pathway by MDV infection. We speculate that other DDR pathways might affect γH2AX accumulation because γH2AX is a hallmark of the DDR pathway. In addition, increased STAT3 phosphorylation along with decreased pChk1 was observed in MDV-infected cells. Together, these findings suggest that MDV infection inhibits the phosphorylation of Chk1, the underlying mechanism of which is possibly related to STAT3 activation (Fig. 2C and D).

FIG 2.

FIG 2

MDV infection suppresses the ATR-Chk1 pathway. (A and B) CEF cells were infected with 4 × 104 PFU of Md5 or CVI988 for 12, 16, and 24 h (MOI of 0.02). Western blots were prepared with extracts from these CEF cells for detection of pChk1, Chk1, VP22, and actin. (C and D) CEF cells were transfected with pcDNA3-cChk1 for 12 h and then infected with 4 × 104 PFU of Md5 or CVI988 for 24 h (MOI of 0.02). Cells were treated with 100 μM ETP for 2 h before collection of samples. Western blots were prepared with extracts from these CEF cells for detection of pChk1, pSTAT3, STAT3, γH2AX, VP22, and actin.

The effect of the ATR-Chk1 pathway after MDV infection.

To determine which kinases influence MDV infection, 2 h before virus infection, CEF cells were treated with ATM, ATR, and DNA-PK inhibitors or equivalent concentrations of dimethyl sulfoxide (DMSO). We found that only the ATR inhibitor promoted MDV infection. After 2 days of infection, the plaques in Md5- or CVI988-infected cells treated with the ATR inhibitor (5 μM VE-821) were larger than those in cells treated with DMSO (Fig. 3A and B). MDV mRNA was isolated from Md5- or CVI988-infected cells treated with DMSO or the ATR inhibitor to confirm that the ATR inhibitor increased cellular MDV gene expression. We verified that MDV gene transcription, which included transcription of the ICP4, ICP4-LAT, gB, and VP22 genes, was increased in ATR inhibitor-treated cells at 1 dpi (Fig. 3C). CEF cells were infected with Md5 or CVI988 after pretreatment with two concentrations of ATR inhibitor (1 and 5 μM VE-821) and then collected to check MDV VP22 protein levels. The commercial pChk1 antibodies cannot recognize endogenous pChk1 in ATR inhibitor-treated chicken cells. To amplify the pChk1 signal, 12 h before harvesting the sample, we treated cells with 0.2 mM hydroxyurea (HU), which is a ribonucleotide reductase inhibitor that can activate Chk1 phosphorylation to amplify pChk1 signaling in CEF cells. The results showed that at 2 dpi, VP22 was increased in the cells when the Chk1 phosphorylation was decreased by treatment with the ATR inhibitor compared to levels in cells treated with DMSO (Fig. 3D). We also used HU to elevate the level of pChk1 in CEF cells and found that the plaques in Md5- or CVI988-infected cells treated with HU (0.2 and 0.5 mM) were smaller than those in cells treated with DMSO after 2 days of infection (Fig. 3E and F). We found that MDV gene transcription, which included the ICP4, ICP4-LAT, gB, and VP22 genes, was decreased in HU-treated cells at 1 dpi (Fig. 3G). VP22 was decreased in Md5- or CVI988-infected cells pretreated with two concentrations of HU (0.2 and 0.5 mM) compared to levels in cells pretreated with DMSO (Fig. 2H). Together, these data suggest that the activation of the ATR-Chk1 pathway is not conducive to MDV replication.

FIG 3.

FIG 3

The ATR-Chk1 pathway affects MDV infection. CEF cells were infected with 4 × 104 PFU of Md5 or CVI988 (MOI of 0.02). (A) CEF cells were pretreated with 5 μM VE-821 for 2 h and then infected with Md5 or CVI988 for 2 days. Photographs of MDV plaques were obtained by microscopy. (B) Effect of VE-821 on MDV plaque size was measured at 2 dpi. The mean values are presented as histograms (±SEM; **, P < 0.01). (C) CEF cells were pretreated with VE-821 (5 μM) for 2 h and then infected with Md5 or CVI988 for 1 day. Cells were collected for detection of virus genes (ICP4, ICP4-LAT, gB, and VP22) and actin using RT-PCR. (D) CEF cells were pretreated with VE-821 (1 μM and 5 μM) for 2 h and then infected with Md5 or CVI988 for 2 days. Cells were collected for detection of VP22 and actin by Western blotting. (E) CEF cells were pretreated with HU (0.2 μM and 0.5 μM) for 12 h and then infected with Md5 or CVI988 for 2 days. Photographs of MDV plaques were taken by microscopy. (F) Effect of HU on MDV plaque size was measured at 2 dpi. The mean values are presented as histograms (±SEM; **, P < 0.01). (G) CEF cells were pretreated with HU (0.2 μM and 0.5 μM) for 12 h and then infected with Md5 or CVI988 for 1 day. Cells were collected for detection of virus genes (ICP4, ICP4-LAT, gB, and VP22) and actin using RT-PCR. (H) CEF cells were pretreated with HU (0.2 μM and 0.5 μM) for 12 h and then infected with Md5 or CVI988 for 2 days. The cells were collected for detection of pChk1, Chk1, VP22, and actin by Western blotting. Ctrl, control; CVI, CVI988. Scale bar, 20 μm.

MDV infection suppresses the ATR-Chk1 pathway through STAT3 activation.

STAT3 regulates many cellular signaling pathways, including those involved in inflammation, immunity, and embryonic development. STAT3 plays an important role in tumor development because it regulates the transcription of driver oncogenes and prosurvival and proproliferative genes (31). To determine whether MDV infection regulates STAT3, we collected MDV-infected cells at different time points (3, 6, 12, 24, 48, and 72 h postinfection [hpi]) for Western blotting. The results showed that Md5 or CVI988 infection elevated STAT3 phosphorylation on tyrosine 705 and serine 727 as early as 3 hpi (Fig. 4A and B). As the time of infection increased, the levels of phosphorylated STAT3 (pSTAT3) and STAT3 were gradually increased in MDV-infected cells. In the MDV-infected cells, the levels of p53 and p21 were also increased, but the increase in p21 occurred earlier than that of p53. We speculate that p21 may be upregulated by MDV via a p53-independent mechanism. It was reported that STAT3 interrupted the ATR-Chk1 pathway during the proliferation of EBV-infected B cells (35). We found that MDV infection activated STAT3 and suppressed the ATR-Chk1 pathway. To demonstrate that STAT activation induces pChk1 repression in MDV-infected cells, a STAT3 inhibitor (10 μM Stattic) was used to treat mock- and MDV-infected CEF cells. At 12 and 24 hpi, the cells were prepared for detection of pChk1, Chk1, pSTAT3, and actin by Western blot analysis. We found that Chk1 phosphorylation was increased with Stattic treatment in mock- and Md5-infected cells compared to levels with DMSO treatment (Fig. 5A and B). Similar results were obtained with CVI988 infection (Fig. 5E and F). The levels of phosphorylation of Chk1 in Md5- and CVI988-infected cells were increased compared to those in control cells at 12 hpi, regardless of whether cells were treated with Stattic (Fig. 5A and E). However, Chk1 phosphorylation was suppressed by Md5 or CVI988 in both untreated and Stattic-treated cells at 24 hpi (Fig. 5B and F). To further confirm the relationship between STAT3 and pChk1, we examined the CEF cells that were transfected with STAT3 small interfering RNAs (siRNAs). We observed an increase in levels of pChk1 compared to those in cells transfected with a scrambled siRNA (Fig. 5C and G). Moreover, both the mRNA and protein levels of viral genes were decreased when the cells were transfected with STAT3 siRNA (Fig. 5C, D, G, and H). These data indicate that MDV cannot inhibit the ATR-Chk1 pathway when the STAT3 pathway is blocked, and, thus, viral replication is repressed. These data indicate that STAT3 is a key molecule in the interruption of Chk1 phosphorylation by MDV.

FIG 4.

FIG 4

MDV infection activates STAT3. (A and B) CEF cells were infected with 4 × 104 PFU of Md5 or CVI988 (MOI of 0.02). Then, Western blotting was performed with extracts from untreated cells and MDV-infected cells at 3, 6, 12, 24, 48, and 72 hpi for detection of pSTAT3, STAT3, p53, p21, VP22, and actin.

FIG 5.

FIG 5

MDV infection inhibits the ATR-Chk1 pathway through activating STAT3. CEF cells were infected with 4 × 104 PFU of Md5 or CVI988 (MOI of 0.02). (A and B) The cells were pretreated with 10 μM Stattic for 2 h before viral infection. Then, the cells infected with Md5 for 12 and 24 h were prepared for detection of pChk1, Chk1, pSTAT3, and actin by Western blotting. (C) CEF cells were infected with MDV (MOI of 0.02) and transfected with a scrambled or STAT3 siRNA. The cells were harvested 48 h later, and Western blotting was performed. (D) CEF cells were treated as described for panel C and tested by RT-PCR. (E and F) The cells infected with CVI988 for 12 and 24 h were prepared for Western blotting as described for panels A and B. (G and H) The cells infected with CVI988 for 24 h were detected as described for panels C and D.

Inhibition of STAT3 phosphorylation attenuates MDV replication.

We hypothesized that STAT3 interrupts ATR-Chk1 signaling to prevent Chk1 phosphorylation, which suppresses the DDR pathway and enables MDV to more easily infect cells. To confirm this hypothesis, we treated cells with STAT3 inhibitor to inhibit STAT3 activation before cells were infected with Md5 or CVI988. At 4 dpi, the plaques of Md5 or CVI988 in the cells treated with the STAT3 inhibitor (5 and 10 μM Stattic) were smaller than those in cells treated with DMSO (Fig. 6A and B). CEF cells pretreated with two concentrations of the STAT3 inhibitor (5 and 10 μM Stattic) were infected with Md5 or CVI988 for 1, 2, and 4 days, and then the cells were collected to check for the MDV protein VP22. We found that VP22 was decreased in Stattic-treated cells compared with levels in DMSO-treated cells (Fig. 6C and D). To confirm that MDV gene expression was suppressed in cells treated with the STAT3 inhibitor, RNAs isolated from cells treated with DMSO or the STAT3 inhibitor were used to measure MDV gene mRNA levels. We confirmed that expression of VP22 and pp38 mRNAs was decreased in the cells in which the STAT3 pathway was inhibited (Fig. 6E and F). These results demonstrated that MDV replication was suppressed when the activation of STAT3 was inhibited in CEF cells.

FIG 6.

FIG 6

Inhibition of STAT3 phosphorylation attenuates MDV replication. CEF cells were pretreated with DMSO or Stattic (5 and 10 μM, respectively) for 2 h and then infected with 4 × 104 PFU of Md5 or CVI988 (MOI 0.02). (A and B) Images of MDV plaques were obtained by microscope after 4 days of infection, and plaque sizes were measured by ImageJ software. The mean values are presented as histograms (±SEM; *, P < 0.05; **, P < 0.01). (C and D) Western blotting was performed with extracts from Md5- or CVI988-infected cells at 1, 2, and 4 dpi for detection of VP22, pSTAT3, STAT3, and actin. (E and F) The mRNA levels of virus genes (VP22 and pp38) and actin in Md5-and CVI988-infected cells at 0.5, 2, and 4 dpi were measured by RT-PCR. Scale bar, 20 μm.

DISCUSSION

A previous study reported that DNA damage was detected in chicken embryonic stem cells (CESCs) infected with MDV and in the peripheral blood mononuclear cells (PBMCs) of chickens during the lytic phase of MDV infection, which suggests that DNA damage is induced by MDV replication (13). Also, previous studies demonstrated that MDV infection triggers S-phase arrest of the cell cycle and DNA damage (11). S-phase arrest can create an environment for virus replication, which can be regulated by the DDR. Our results confirmed that DNA migration was observed from 1 dpi to 4 dpi in Md5- or CVI988-infected CEF cells (Fig. 1A and B). At 3 dpi and 4 dpi, an obvious increase in DNA damage was detected in CEF cells infected with MDV (Fig. 1C and D). Of note, we used two strains of MDV, Md5 and CVI988/Rispens. Md5 is a virulent isolate that can cause tumors in chickens, and CVI988/Rispens is an attenuated serotype 1 MDV, which is the most efficacious MDV vaccine (40, 41). We showed that the number of cells harboring DNA damage and the extent of damage were increased during the early lytic phase of MDV infection that is associated with MDV replication. These findings are consistent with other published studies that reported that MDV VP22 protein is expressed during the lytic phase and is essential for viral replication and that it is also associated with DNA damage in vivo (11–13, 42). In addition, Bencherit et al. showed that the induction of damage using DNA damage reagents enhanced MDV replication and reactivation from the latent infection phase (13). However, these authors could not verify whether DNA damage and the following DDR play a major role in MDV replication. They simply hypothesized that the DDR pathways, like ATM, may be activated in response to DNA damage during MDV infection. We also found that p53 and p21, as downstream signaling factors in the DDR pathway, were increased throughout 3 and 4 dpi in MDV-infected cells (Fig. 1E and F). However, we found that MDV infection inhibited Chk1 phosphorylation as early as 16 hpi, which indicates that p53 and p21 levels were elevated at a later time, even after Chk1 activation was downregulated much earlier (Fig. 2 and 3). We speculate that MDV infection may regulate p53 and p21 stabilization through other signaling pathways in addition to the ATR-Chk1 pathway.

DNA damage induces the cellular DDR pathway that contributes to host immunity and the viral life cycle. Abnormal proliferation following virus infection induces replicative stress that leads to DDR activation, which regulates the cell cycle, DNA repair, and apoptosis (43). During virus replication, the viral DNA is always recognized as damaged DNA which induces DDR. The host cells try to prevent virus replication and protect the host genome, while the virus has evolved mechanisms to eliminate or exploit the DDR pathway (44). The ATR-Chk1 pathway is important for the stabilization of stalled replication forks. Several DNA viruses, including herpesvirus, adenovirus, and parvovirus, can disable ATR signaling (27, 45, 46). During HSV-1 infection, viral replication proteins and ATR/ATRIP are recruited to viral replication forks and, with ATR-Chk1 pathway inhibition, may lead to replication fork collapse. It has been suggested that HSV-1 utilizes recombination-mediated DNA synthesis, and DSBs by stalled replication forks may activate ATM and homology-directed repairs through the inhibition of the ATR-Chk1 pathway (47, 48). It was also reported that the ATR-Chk1 pathway is disrupted at later times during the lytic phase of Kaposi’s sarcoma-associated herpesvirus (KSHV) replication (49). HSV-1 blocks the ATR-Chk1 pathway using viral replication proteins that bind to sites of DNA damage and obstruct the loading of the Rad9-rad1-Hus1 checkpoint clamps (27, 28). We found that Md5 and CVI988 infection inhibited Chk1 phosphorylation and even prevented pChk1 increases following treatment with the DNA damage inducer ETP (Fig. 2). It is possible that the ATR-Chk1 pathway is detrimental to virus replication. To confirm the effect of the ATR pathway on MDV replication, we used ATR inhibitor VE-821-treated and ATR activator HU-treated CEF cells. MDV replication was promoted when the ATR-Chk1 pathway was blocked (Fig. 3A to D), but MDV replication was inhibited when pChk1 was elevated due to replicative stress induced by HU treatment (Fig. 3E to H). These findings suggest that the ATR-Chk1 pathway is detrimental to MDV propagation. However, our results after HU treatment are the opposite of those of Bencherit et al. (13). This may be due to the different doses of HU and the treatment methods used. Md5- or CVI988-infected cells were pretreated with two concentrations of HU (0.2 and 0.5 mM) in this study, and therefore the ATR-Chk1 pathway was activated before MDV infection. However, Bencherit et al. used low concentrations of HU (10 to 75 μM) to treat cells at 6 hpi. We speculate that MDV infection suppressed ATR-Chk1 pathway activation induced by these low concentrations of HU treatment. In addition, we were concerned that MDV infection might not cause changes in γH2AX. H2AX is a substrate of several phosphoinositide 3-kinase-related protein kinases (PIKKs), such as ATM, ATR, and DNA-PK, which indicates that H2AX phosphorylation plays a key role in the DDR (50–52). The results showed that MDV infection inhibited ETP-induced Chk1 phosphorylation but not γH2AX accumulation. It was found that MDV replication was repressed in CEF cells treated with an ATM inhibitor (KU-55933) (data not shown). This indicates that both the ATR and ATM pathways affect MDV replication but that the effects of these two pathways are opposite. We speculate that the ATM pathway may be activated by MDV infection, which causes γH2AX accumulation and is beneficial for MDV infection. It was reported that polyomavirus makes use of the ATM pathway for optimal virus replication (53). However, due to the lack of ATM-specific antibodies against chickens, the mechanism of the ATM pathway in MDV replication is still unclear.

In this study, we found that increased STAT3 phosphorylation along with decreased pChk1 was observed in MDV-infected cells, which indicates that there is an underlying mechanism for regulating the ATR-Chk1 pathway that is related to STAT3 activation (Fig. 2C and D). Although the contribution of STAT3 to tumorigenesis has been attributed to its function in transcription that activates prosurvival and proproliferative genes, such as c-Myc and cyclins, reports have shown that another mechanism linking STAT3 and DDR regulation in EBV-driven cells is involved (35, 54). Koganti et al. showed that STAT3 suppressed Chk1 phosphorylation via caspase-7 activation, which results in bypass of the intra-S-phase to facilitate primary human cell proliferation (35). We observed that MDV infection elevated STAT3 phosphorylation, indicating that STAT3 was activated in MDV-infected cells (Fig. 4). Therefore, we used Stattic, a STAT3 inhibitor, to explore the relationships among the MDV, STAT3, and ATR-Chk1 pathways. The results showed that the STAT3 inhibitor caused pChk1 elevation in both normal and MDV-infected cells (Fig. 5A, B, E, and F). Moreover, MDV did not prevent Chk1 phosphorylation when STAT3 was knocked down in cells (Fig. 5C and G). These results suggest that MDV infection interrupts the ATR-Chk1 pathway through inducing STAT3 activation. Of note, when STAT3 activation was inhibited by Stattic or STAT3 siRNAs, MDV replication was inhibited in CEF cells (Fig. 5 and 6). This indicates that MDV cannot inhibit the ATR-Chk1 pathway when the STAT3 pathway is blocked, and, thus, viral replication is repressed. A recent report suggested that JAK-STAT signaling was downregulated in the macrophages of MD-resistant chicken, which supports the idea that JAK-STAT activation is important in MDV infection (55). Previous reports have indicated that virus-induced reactive oxygen species (ROS) overproduction related to activity of NADPH oxidase led to STAT3 activation and was associated with oncogenesis (56–58). Indeed, we also found that the NADPH oxidase inhibitors apocynin (APO) and diphenyleneiodonium (DPI), which lead to decreased ROS generation, can suppress STAT3 phosphorylation to inhibit MDV replication (data not shown). Therefore, we speculate that STAT3 could be activated through intracellular ROS accumulation by MDV infection, resulting in inhibition of the ATR-Chk1 pathway and promotion of virus proliferation. The results of this study indicate that STAT3 is a key molecule for MDV to use in interrupting the ATR-Chk1 pathway.

In conclusion, this study has revealed that MDV infection can inhibit activation of the cellular ATR-Chk1 pathway through STAT3 activation to promote viral replication. A working model of the regulation of MDV replication by STAT3 and the ATR-Chk1 pathway is summarized in Fig. 7. DNA damage induced by MDV, which can activate the DDR pathway, is not conducive for MDV replication. Activation of the ATR-Chk1 pathway by HU also prevents MDV replication. Therefore, MDV inhibits ATR-Chk1 pathway signaling transduction through activation of STAT3. Although we lack specific antibodies that react with chicken proteins to probe other DDR pathways, our results provide a mechanistic link between MDV infection and the DDR pathway and reveal how MDV manipulates the ATR-Chk1 pathway to assist viral replication.

FIG 7.

FIG 7

A mechanism used by MDV to disable the ATR-Chk1 pathway via activation of STAT3. MDV infection induces DNA damage, which can activate the ATR-Chk1 pathway. MDV replication was promoted when the ATR-Chk1 pathway was blocked using the ATR inhibitor VE-821. In contrast, MDV replication was suppressed by ATR-Chk1 pathway activation caused by the ATR activator HU. The phosphorylation of Chk1 was also attenuated by MDV infection through STAT3 activation. Together, these data suggest that MDV infection inhibits the phosphorylation of Chk1 to subsequently promote viral replication, the underlying mechanism of which is related to STAT3 activation.

MATERIALS AND METHODS

Cell, viruses, antibodies, and reagents.

Chicken embryo fibroblast (CEF) cells were prepared from 9-day-old specific-pathogen-free (SPF) White Leghorn chicken embryos using standard techniques. CEF cells were grown in Dulbecco's modified Eagle's medium (DMEM) (Thermo Fisher Scientific, Inc., MA, USA) supplemented with 5% fetal bovine serum (Pan Biotech UK, Ltd., Dorset, UK) and 1% penicillin-streptomycin solution (MDBio, Qingdao, China) and maintained at 37°C in 5% CO2. A virulent strain of MDV, Md5, and a vaccine strain, CVI988, were propagated in CEF cultures. The primary antibodies used included mouse monoclonal anti-Chk1 (at 1:1,000, catalog number sc-8408; Santa Cruz Biotechnology, TX, USA), rabbit polyclonal anti-phospho-Chk1 Ser345 (at 1:1,000, 2348; Cell Signaling Technology, MA, USA), rabbit monoclonal anti-phospho-STAT3 Ser727 (at 1:1,000, 94994; Cell Signaling Technology, MA, USA), mouse monoclonal anti-phospho-STAT3 Tyr705 (at 1:1,000, sc-8059; Santa Cruz Biotechnology, TX, USA), mouse monoclonal anti-STAT3 (at 1:1,000, sc-8019; Santa Cruz Biotechnology, TX, USA), rabbit anti-actin (at 1:6,000, A2066; Sigma-Aldrich, St. Louis, MO, USA), and mouse monoclonal anti-VP22 (a gift from Hongjun Chen, Shanghai Veterinary Research Institute, Chinese Academic of Agricultural Sciences, China). The secondary antibodies used included a horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG(H+L) antibody (at 1:2,000, catalog number AP308P; Millipore, MA, USA), and an HRP-conjugated goat anti-rabbit IgG(H+L) antibody (1:2,000, AP307P; Millipore, MA, USA). The inhibitors used in this experiment included an ATR inhibitor (VE-821; Selleck, TX, USA), a STAT3 inhibitor (Stattic; Selleck, TX, USA), apocynin (APO; Sigma-Aldrich, St. Louis, MO, USA), and diphenyleneiodonium (DPI; Sigma-Aldrich, St. Louis, MO, USA).

Generation of rat anti-p53 and anti-p21 antisera.

The chicken p53 and p21 genes were amplified from CEF cDNA by PCR and then cloned into the pGEX-4T-1 vector (Novagen, Darmstadt, Germany). Fusion proteins were expressed in Escherichia coli BL21 by induction with 1 mM isopropyl β-d-thiogalactopyranoside for 5 h. Glutathione S-transferase (GST)-tagged proteins were purified using glutathione resin according to the manufacturer’s instructions (GeneScript, Nanjing, China). Female Wister rats (12 weeks old) were injected intravenously with 100 μg of the fusion proteins in complete Freund’s adjuvant, which was followed by two boosts 14 and 28 days after the first immunization. Antiserum was collected 14 days after the final immunization.

The alkaline comet assay.

The comet assay was performed as previously described. Briefly, CEF cells were infected with 4 × 104 PFU of Md5 or CVI988 (multiplicity of infection [MOI] of 0.02). At 1, 2, 3 and 4 dpi, cells were digested with trypsin and resuspended in phosphate-buffered saline (PBS). Next, 1 × 105 single cells were mixed with 100 μl of 0.7% low-melting-point agarose, layered onto a glass microscope slide, and then covered with 1 ml of 1% normal melting point agarose. The slides were left on ice-cold lysis buffer (2.5 M NaCl, 100 mM EDTA, 10mM Tris-HCl, and 1% Triton X-100, pH 10.0) for 12 h. All slides were placed in an alkaline electrophoresis buffer (300 mM NaOH and 1 mM EDTA, pH >13) for 60 min (buffer was changed every 20 min), and electrophoresis was performed at 25 V and 300 mA for 20 min. Then, the slides were washed three times with neutralization buffer (0.4 M Tris-HCl, pH 7.5), stained with propidium iodide (2.5 μg/ml) for 10 min, and imaged with a fluorescence microscope. The extent of DNA damage was measured by analysis of 10 randomly chosen images in each group (the uninfected and infected groups) with OpenComet software. The DNA percentages in the tails of >100 comets were scored for each case to measure DNA damage.

RNA extraction and RT-PCR.

Total RNA was extracted from 4 × 106 uninfected and MDV-infected cells using TRIzol reagent (Thermo Fisher Scientific Inc, MA, USA) according to the manufacturer’s instructions. mRNA was reverse transcribed using oligo(dT)23 VN (Vazyme, Nanjing, China) and HiScript II reverse transcriptase (Vazyme, Nanjing, China) in 20-μl volumes. Reaction systems were incubated at 42°C for 2 min and then centrifuged at 4 × g. DNA Wiper mix was added for removal of genomes, and then incubation was repeated at 25°C for 5 min, at 50°C for 45 min, and at 85°C for 2 min. Reverse transcription-PCR (RT-PCR) primers were designed using Primer, version 5.0. The primer sequences for viral and cellular gene amplification are described in Table 1.

TABLE 1.

Primer pairs used for RT-PCR

Namea Sequence Length (bp)
MDV-gB-RT-F CTTCACAGTTGGGTGGGAC 338
MDV-gB-RT-R GAGCCAGGGATTTGGATAG
MDV-ICP4-F GTGCTGCCGTAACATTAGC 271
MDV-ICP4-R CTTCGTGGAGATGAGGTTGTG
MDV-ICP4-LAT-F CCTCTTCATCTTCCTCCTCT 329
MDV-ICP4-LAT-R TGTCACCTGAATATCATTGC
MDV-VP22-F ATGGGGGATTCTGAAAG 750
MDV-VP22-R GTTATTCGCTATCACTGC
MDV-pp38-F AGCAGTGCGAAGGAGGAAC 281
MDV-pp38-R ACCGACTAACATACCAGCGA
Chicken-p53-F GCCCCATCCTCACCATCCTTAC 285
Chicken-p53-R CCTCATTGATCTCCTTCAGC
Chicken-STAT3-F GCCGAATCACAACTACAGACTC 239
Chicken-STAT3-R CTGACTTTGGTGGTGAACTGC
Chicken-actin-F GAGACCTTCAACACCCCAGCCATG 287
Chicken-actin-R GCGACGTAGCACAGCTTCTCCTTG
a

F, forward; R, reverse.

MDV plaque size measurement assay.

CEF cells were pretreated with reagents and infected with Md5 or CVI988 (MOI of 0.02). Digital images of 50 individual plaques were obtained with an Eclipse Ti-U inverted research microscope (Nikon, Tokyo, Japan). Plaque areas were measured using ImageJ software, and mean values were determined for each group.

Immunoblot analysis.

Cells were lysed in 2× SDS sample buffer (2% SDS, 10% glycerol, 60 mM Tris [pH 6.8] with 5% β-mercaptoethanol and 0.01% bromophenol blue). The samples were briefly sonicated and then denatured by incubation at 98°C for 10 min. After that, the samples were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and then transferred to a nitrocellulose transfer membrane (Pall Corporation, NY, USA) using a Mighty Small Transfer Tank system (Hoefer, MA, USA). Then, the nitrocellulose membranes were blocked with PBST buffer (5% nonfat milk powder, 10 mM Na2HPO4, 137 mM NaCl, 2 mM KH2PO4, 2.7 mM KCl, and 0.25% Tween 20) for 30 min at room temperature. The membranes were incubated with primary antibody overnight at 4°C. After the membranes were washed three times with PBST buffer, they were incubated with HRP-conjugated secondary antibody for 4 h at 4°C. Then, the membranes were washed with PBST buffer three times, reacted with enhanced chemiluminescence reagent (Youqing Biology, Nanjing, China), and imaged using a BioSpectrum Imaging System (UVP, CA, USA).

Construction of expression plasmids and transient transfections.

Full-length DNA fragments encoding the chicken Chk1 (GenBank accession number NM_204345) were amplified by PCR from the cDNA of CEF cells with the forward primer cChk1-F (5'-CTAGAATTCATGGCGGTGCCCTTCGTGGAGGACT-3') and the reverse primer, Chk1-R (5'-TATCTCGAGTCAGGGTGGGGGCAGCCACACCT-3'). Then the Chk1 DNA was cloned into the expression vectors pcDNA3-2×FLAG (with two copies of a FLAG tag) and pcDNA3 (Invitrogen, USA) to generate the recombinant plasmids pcDNA3-2×Flag-cChk1 and pcDNA3-cChk1, respectively. The CEF cells were seeded into six-well plates for 16 h before transfection. Transfections were performed using Lipofectamine 2000 transfection reagent (Invitrogen, USA) according to the manufacturer’s instructions. After 12-h transfections, Chk1 overexpression was tested in CEF cells infected with Md5 or CVI988 for 24 h. After Western blot analysis, cells were treated with 100 μM etoposide (ETP; Sigma-Aldrich, St. Louis, MO, USA) for 2 h before being collected.

Knockdown of STAT3 in CEF cells.

CEF cells were infected with MDV (MOI of 0.02) and transfected with a scrambled or STAT3 small interfering RNA (siRNAs) (number 1, 5′-AGA UGA AAG UGG AGA AUU dTdT-3′ [sense] and 5′-UUC UCC ACC ACU UUC AUC UUU dTdT-3′ [antisense]; number 2, 5′-GCA UGU CGU UUG CGG AAA UUU dTdT-3′ [sense] and 5′-AUU UCC GCA AAA CGA CAU GCU U dTdT-3′ [antisense]). The cells were harvested after 48 h and analyzed by Western blotting and RT-PCR.

Statistical treatment.

The data are presented as the means and the standard errors of the means (SEM) or the median. The difference between two groups in the comet assay and MDV plaque size assay was determined by Student's t test. One-way analysis of variance (ANOVA) was used to compare differences in multiple groups. All statistical tests were conducted using GraphPad Prism, version 7.0 (GraphPad Software, Inc., San Diego, CA). P values of <0.05 were considered statistically significant, as indicated in the figure legends.

ACKNOWLEDGMENTS

This work was supported by the National Natural Science Foundation (grant 31472218), Fundamental Research Funds for the Central Universities (Y0201700559), a grant from the Natural Science Foundation of Jiangsu Province (BK20140711), and the Priority Academic Program Development of Jiangsu Higher Education Institutions.

X. Lian, Y.-S. Jung, and Y. Qian designed the research. X. Lian, C. Bao, and X. Li performed laboratory experiments. X. Lian, C. Bao, X. Zhang, H. Chen, Y.-S. Jung, and Y. Qian analyzed and interpreted the data. X. Lian, Y.-S. Jung, and Y. Qian drafted the manuscript, and all authors commented on it. Y. Qian supervised the entire project.

We declare that we have no conflicts of interest.

REFERENCES

  • 1.Calnek BW. 2001. Pathogenesis of Marek's disease virus infection. Curr Top Microbiol Immunol 255:25–55. [DOI] [PubMed] [Google Scholar]
  • 2.Boodhoo N, Gurung A, Sharif S, Behboudi S. 2016. Marek's disease in chickens: a review with focus on immunology. Vet Res 47:119. doi: 10.1186/s13567-016-0404-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.McGeoch DJ, Dolan A, Ralph AC. 2000. Toward a comprehensive phylogeny for mammalian and avian herpesviruses. J Virol 74:10401–10406. doi: 10.1128/JVI.74.22.10401-10406.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.McPherson MC, Delany ME. 2016. Virus and host genomic, molecular, and cellular interactions during Marek's disease pathogenesis and oncogenesis. Poult Sci 95:412–429. doi: 10.3382/ps/pev369. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Bulow VV, Biggs PM. 1975. Differentiation between strains of Marek's disease virus and turkey herpesvirus by immunofluorescence assays. Avian Pathol 4:133–146. doi: 10.1080/03079457509353859. [DOI] [PubMed] [Google Scholar]
  • 6.Reddy SM, Izumiya Y, Lupiani B. 2017. Marek's disease vaccines: current status, and strategies for improvement and development of vector vaccines. Vet Microbiol 206:113–120. doi: 10.1016/j.vetmic.2016.11.024. [DOI] [PubMed] [Google Scholar]
  • 7.Witter RL. 1997. Increased virulence of Marek's disease virus field isolates. Avian Dis 41:149–163. doi: 10.2307/1592455. [DOI] [PubMed] [Google Scholar]
  • 8.Witter RL, Calnek BW, Buscaglia C, Gimeno IM, Schat KA. 2005. Classification of Marek's disease viruses according to pathotype: philosophy and methodology. Avian Pathol 34:75–90. doi: 10.1080/03079450500059255. [DOI] [PubMed] [Google Scholar]
  • 9.Pancholi NJ, Price AM, Weitzman MD. 2017. Take your PIKK: tumour viruses and DNA damage response pathways. Philos Trans R Soc Lond B Biol Sci 372:20160269. doi: 10.1098/rstb.2016.026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Keles H, Fidan AF, Cigerci IH, Kucukkurt I, Karadas E, Dundar Y. 2010. Increased DNA damage and oxidative stress in chickens with natural Marek's disease. Vet Immunol Immunopathol 133:51–58. doi: 10.1016/j.vetimm.2009.07.003. [DOI] [PubMed] [Google Scholar]
  • 11.Trapp-Fragnet L, Bencherit D, Chabanne-Vautherot D, Le Vern Y, Remy S, Boutet-Robinet E, Mirey G, Vautherot JF, Denesvre C. 2014. Cell cycle modulation by Marek's disease virus: the tegument protein VP22 triggers S-phase arrest and DNA damage in proliferating cells. PLoS One 9:e100004. doi: 10.1371/journal.pone.0100004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Dorange F, Tischer BK, Vautherot JF, Osterrieder N. 2002. Characterization of Marek's disease virus serotype 1 (MDV-1) deletion mutants that lack UL46 to UL49 genes: MDV-1 UL49, encoding VP22, is indispensable for virus growth. J Virol 76:1959–1970. doi: 10.1128/JVI.76.4.1959-1970.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Bencherit D, Remy S, Le Vern Y, Vychodil T, Bertzbach LD, Kaufer BB, Denesvre C, Trapp-Fragnet L. 2017. Induction of DNA damages upon Marek's disease virus infection: implication in viral replication and pathogenesis. J Virol 91:e01658-17. doi: 10.1128/JVI.01658-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Turnell AS, Grand RJ. 2012. DNA viruses and the cellular DNA-damage response. J Gen Virol 93:2076–2097. doi: 10.1099/vir.0.044412-0. [DOI] [PubMed] [Google Scholar]
  • 15.Derheimer FA, Kastan MB. 2010. Multiple roles of ATM in monitoring and maintaining DNA integrity. FEBS Lett 584:3675–3681. doi: 10.1016/j.febslet.2010.05.031. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Beucher A, Birraux J, Tchouandong L, Barton O, Shibata A, Conrad S, Goodarzi AA, Krempler A, Jeggo PA, Lobrich M. 2009. ATM and Artemis promote homologous recombination of radiation-induced DNA double-strand breaks in G2. EMBO J 28:3413–3427. doi: 10.1038/emboj.2009.276. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Burma S, Chen DJ. 2004. Role of DNA-PK in the cellular response to DNA double-strand breaks. DNA Repair (Amst) 3:909–918. doi: 10.1016/j.dnarep.2004.03.021. [DOI] [PubMed] [Google Scholar]
  • 18.Cortez D, Guntuku S, Qin J, Elledge SJ. 2001. ATR and ATRIP: partners in checkpoint signaling. Science 294:1713–1716. doi: 10.1126/science.1065521. [DOI] [PubMed] [Google Scholar]
  • 19.Cimprich KA, Cortez D. 2008. ATR: an essential regulator of genome integrity. Nat Rev Mol Cell Biol 9:616–627. doi: 10.1038/nrm2450. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Furnari B, Rhind N, Russell P. 1997. Cdc25 mitotic inducer targeted by chk1 DNA damage checkpoint kinase. Science 277:1495–1497. doi: 10.1126/science.277.5331.1495. [DOI] [PubMed] [Google Scholar]
  • 21.Sanchez Y, Wong C, Thoma RS, Richman R, Wu Z, Piwnica-Worms H, Elledge SJ. 1997. Conservation of the Chk1 checkpoint pathway in mammals: linkage of DNA damage to Cdk regulation through Cdc25. Science 277:1497–1501. doi: 10.1126/science.277.5331.1497. [DOI] [PubMed] [Google Scholar]
  • 22.Hollingworth R, Grand RJ. 2015. Modulation of DNA damage and repair pathways by human tumour viruses. Viruses 7:2542–2591. doi: 10.3390/v7052542. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Nikitin PA, Luftig MA. 2012. The DNA damage response in viral-induced cellular transformation. Br J Cancer 106:429–435. doi: 10.1038/bjc.2011.612. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Bose S, Yap LF, Fung M, Starzcynski J, Saleh A, Morgan S, Dawson C, Chukwuma MB, Maina E, Buettner M, Wei W, Arrand J, Lim PV, Young LS, Teo SH, Stankovic T, Woodman CB, Murray PG. 2009. The ATM tumour suppressor gene is down-regulated in EBV-associated nasopharyngeal carcinoma. J Pathol 217:345–352. doi: 10.1002/path.2487. [DOI] [PubMed] [Google Scholar]
  • 25.Choudhuri T, Verma SC, Lan K, Murakami M, Robertson ES. 2007. The ATM/ATR signaling effector Chk2 is targeted by Epstein-Barr virus nuclear antigen 3C to release the G2/M cell cycle block. J Virol 81:6718–6730. doi: 10.1128/JVI.00053-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Gruhne B, Sompallae R, Masucci MG. 2009. Three Epstein-Barr virus latency proteins independently promote genomic instability by inducing DNA damage, inhibiting DNA repair and inactivating cell cycle checkpoints. Oncogene 28:3997–4008. doi: 10.1038/onc.2009.258. [DOI] [PubMed] [Google Scholar]
  • 27.Mohni KN, Livingston CM, Cortez D, Weller SK. 2010. ATR and ATRIP are recruited to herpes simplex virus type 1 replication compartments even though ATR signaling is disabled. J Virol 84:12152–12164. doi: 10.1128/JVI.01643-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Mohni KN, Smith S, Dee AR, Schumacher AJ, Weller SK. 2013. Herpes simplex virus type 1 single strand DNA binding protein and helicase/primase complex disable cellular ATR signaling. PLoS Pathog 9:e1003652. doi: 10.1371/journal.ppat.1003652. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Levy DE, Darnell JE Jr.. 2002. Stats: transcriptional control and biological impact. Nat Rev Mol Cell Biol 3:651–662. doi: 10.1038/nrm909. [DOI] [PubMed] [Google Scholar]
  • 30.Takeda K, Noguchi K, Shi W, Tanaka T, Matsumoto M, Yoshida N, Kishimoto T, Akira S. 1997. Targeted disruption of the mouse Stat3 gene leads to early embryonic lethality. Proc Natl Acad Sci U S A 94:3801–3804. doi: 10.1073/pnas.94.8.3801. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Li X, Bhaduri-McIntosh S. 2016. A central role for STAT3 in gammaherpesvirus-life cycle and -diseases. Front Microbiol 7:1052. doi: 10.3389/fmicb.2016.01052. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Avery DT, Deenick EK, Ma CS, Suryani S, Simpson N, Chew GY, Chan TD, Palendira U, Bustamante J, Boisson-Dupuis S, Choo S, Bleasel KE, Peake J, King C, French MA, Engelhard D, Al-Hajjar S, Al-Muhsen S, Magdorf K, Roesler J, Arkwright PD, Hissaria P, Riminton DS, Wong M, Brink R, Fulcher DA, Casanova JL, Cook MC, Tangye SG. 2010. B cell-intrinsic signaling through IL-21 receptor and STAT3 is required for establishing long-lived antibody responses in humans. J Exp Med 207:155–171. doi: 10.1084/jem.20091706. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Siegel AM, Heimall J, Freeman AF, Hsu AP, Brittain E, Brenchley JM, Douek DC, Fahle GH, Cohen JI, Holland SM, Milner JD. 2011. A critical role for STAT3 transcription factor signaling in the development and maintenance of human T cell memory. Immunity 35:806–818. doi: 10.1016/j.immuni.2011.09.016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Dauer DJ, Ferraro B, Song L, Yu B, Mora L, Buettner R, Enkemann S, Jove R, Haura EB. 2005. Stat3 regulates genes common to both wound healing and cancer. Oncogene 24:3397–3408. doi: 10.1038/sj.onc.1208469. [DOI] [PubMed] [Google Scholar]
  • 35.Koganti S, Hui-Yuen J, McAllister S, Gardner B, Grasser F, Palendira U, Tangye SG, Freeman AF, Bhaduri-McIntosh S. 2014. STAT3 interrupts ATR-Chk1 signaling to allow oncovirus-mediated cell proliferation. Proc Natl Acad Sci U S A 111:4946–4951. doi: 10.1073/pnas.1400683111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Buettner R, Mora LB, Jove R. 2002. Activated STAT signaling in human tumors provides novel molecular targets for therapeutic intervention. Clin Cancer Res 8:945–954. [PubMed] [Google Scholar]
  • 37.Yu H, Pardoll D, Jove R. 2009. STATs in cancer inflammation and immunity: a leading role for STAT3. Nat Rev Cancer 9:798–809. doi: 10.1038/nrc2734. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Barry SP, Townsend PA, Knight RA, Scarabelli TM, Latchman DS, Stephanou A. 2010. STAT3 modulates the DNA damage response pathway. Int J Exp Pathol 91:506–514. doi: 10.1111/j.1365-2613.2010.00734.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Hau PM, Tsao SW. 2017. Epstein-Barr virus hijacks DNA damage response transducers to orchestrate its life cycle. Viruses 9:E341. doi: 10.3390/v9110341. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Gimeno IM, Dunn JR, Cortes AL, El-Gohary AE-G, Silva RF. 2014. Detection and differentiation of CVI988 (Rispens vaccine) from other serotype 1 Marek's disease viruses. Avian Dis 58:232–243. doi: 10.1637/10666-091713-Reg.1. [DOI] [PubMed] [Google Scholar]
  • 41.Witter RL, Sharma JM, Fadly AM. 1980. Pathogenicity of variant Marek's disease virus isolants in vaccinated and unvaccinated chickens. Avian Diseases 24:210–232. doi: 10.2307/1589781. [DOI] [Google Scholar]
  • 42.Dorange F, El Mehdaoui S, Pichon C, Coursaget P, Vautherot JF. 2000. Marek's disease virus (MDV) homologues of herpes simplex virus type 1 UL49 (VP22) and UL48 (VP16) genes: high-level expression and characterization of MDV-1 VP22 and VP16. J Gen Virol 81:2219–2230. doi: 10.1099/0022-1317-81-9-2219. [DOI] [PubMed] [Google Scholar]
  • 43.Nikitin PA, Luftig MA. 2011. At a crossroads: human DNA tumor viruses and the host DNA damage response. Future Virol 6:813–830. doi: 10.2217/fvl.11.55. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Weitzman MD, Lilley CE, Chaurushiya MS. 2010. Genomes in conflict: maintaining genome integrity during virus infection. Annu Rev Microbiol 64:61–81. doi: 10.1146/annurev.micro.112408.134016. [DOI] [PubMed] [Google Scholar]
  • 45.Blackford AN, Patel RN, Forrester NA, Theil K, Groitl P, Stewart GS, Taylor AM, Morgan IM, Dobner T, Grand RJ, Turnell AS. 2010. Adenovirus 12 E4orf6 inhibits ATR activation by promoting TOPBP1 degradation. Proc Natl Acad Sci U S A 107:12251–12256. doi: 10.1073/pnas.0914605107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Adeyemi RO, Pintel DJ. 2014. The ATR signaling pathway is disabled during infection with the parvovirus minute virus of mice. J Virol 88:10189–10199. doi: 10.1128/JVI.01412-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Schumacher AJ, Mohni KN, Kan Y, Hendrickson EA, Stark JM, Weller SK. 2012. The HSV-1 exonuclease, UL12, stimulates recombination by a single strand annealing mechanism. PLoS Pathog 8:e1002862. doi: 10.1371/journal.ppat.1002862. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Mohni KN, Dee AR, Smith S, Schumacher AJ, Weller SK. 2013. Efficient herpes simplex virus 1 replication requires cellular ATR pathway proteins. J Virol 87:531–542. doi: 10.1128/JVI.02504-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Hollingworth R, Skalka GL, Stewart GS, Hislop AD, Blackbourn DJ, Grand RJ. 2015. Activation of DNA damage response pathways during lytic replication of KSHV. Viruses 7:2908–2927. doi: 10.3390/v7062752. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Burma S, Chen BP, Murphy M, Kurimasa A, Chen DJ. 2001. ATM phosphorylates histone H2AX in response to DNA double-strand breaks. J Biol Chem 276:42462–42467. doi: 10.1074/jbc.C100466200. [DOI] [PubMed] [Google Scholar]
  • 51.Ward IM, Minn K, Chen J. 2004. UV-induced ataxia-telangiectasia-mutated and Rad3-related (ATR) activation requires replication stress. J Biol Chem 279:9677–9680. doi: 10.1074/jbc.C300554200. [DOI] [PubMed] [Google Scholar]
  • 52.An J, Huang YC, Xu QZ, Zhou LJ, Shang ZF, Huang B, Wang Y, Liu XD, Wu DC, Zhou PK. 2010. DNA-PKcs plays a dominant role in the regulation of H2AX phosphorylation in response to DNA damage and cell cycle progression. BMC Mol Biol 11:18. doi: 10.1186/1471-2199-11-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Dahl J, You J, Benjamin TL. 2005. Induction and utilization of an ATM signaling pathway by polyomavirus. J Virol 79:13007–13017. doi: 10.1128/JVI.79.20.13007-13017.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Yu H, Kortylewski M, Pardoll D. 2007. Crosstalk between cancer and immune cells: role of STAT3 in the tumour microenvironment. Nat Rev Immunol 7:41–51. doi: 10.1038/nri1995. [DOI] [PubMed] [Google Scholar]
  • 55.Chakraborty P, Kuo R, Vervelde L, Dutia BM, Kaiser P, Smith J. 2019. Macrophages from susceptible and resistant chicken lines have different transcriptomes following Marek's disease virus infection. Genes (Basel) 10:74. doi: 10.3390/genes10020074. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Chen X, Kamranvar SA, Masucci MG. 2016. Oxidative stress enables Epstein-Barr virus-induced B-cell transformation by posttranscriptional regulation of viral and cellular growth-promoting factors. Oncogene 35:3807–3816. doi: 10.1038/onc.2015.450. [DOI] [PubMed] [Google Scholar]
  • 57.Ma Q, Cavallin LE, Leung HJ, Chiozzini C, Goldschmidt-Clermont PJ, Mesri EA. 2013. A role for virally induced reactive oxygen species in Kaposi's sarcoma herpesvirus tumorigenesis. Antioxid Redox Signal 18:80–90. doi: 10.1089/ars.2012.4584. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Yuan K, Lei Y, Chen HN, Chen Y, Zhang T, Li K, Xie N, Wang K, Feng X, Pu Q, Yang W, Wu M, Xiang R, Nice EC, Wei Y, Huang C. 2016. HBV-induced ROS accumulation promotes hepatocarcinogenesis through Snail-mediated epigenetic silencing of SOCS3. Cell Death Differ 23:616–627. doi: 10.1038/cdd.2015.129. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Virology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES