Abstract
Objective
The transport and metabolism of glucose are important during mammalian development. High glucose can mediate the biological characteristics of mesenchymal stem cells (MSCs). However, the role of high glucose in the odonto/osteogenic differentiation of stem cells from apical papilla (SCAPs) is unclear.
Materials and Methods
SCAPs were isolated and identified in vitro. Then, SCAPs were cultured in normal α-MEM and high glucose α-MEM separately. MTT assay was applied to observe the proliferation of SCAPs. ALP activity, alizarin red staining, real-time RT-PCR, and western blot were used to detect the odonto/osteogenic capacity of SCAPs as well as the participation of NF-κB pathway.
Results
SCAPs in 25mmol/L glucose group expressed the maximum proteins of RUNX2 and ALP as compared with those in 5, 10, and 15 mmol/L groups. MTT assay showed that 25 mmol/L glucose suppressed the proliferation of SCAPs. ALP assay, alizarin red staining, real-time RT-PCR, and western blot showed 25 mmol/L high glucose can obviously enhance the odonto/osteogenic capacity of SCAPs. Moreover, the NF-κB pathway was activated in 25mmol/L glucose-treated SCAPs and the odonto/osteogenic differentiation was inhibited following the inhibition of NF-κB signaling pathway.
Conclusions
High glucose can enhance the odonto/osteogenic capacity of SCAPs via NF-κB pathway.
1. Introduction
Stem cells from apical papilla (SCAPs), derived from the developing apical complexes, are considered as the attractive candidates for tooth and bone regeneration [1, 2]. They contain the ability to modulate the dental root development and play a key role in the regenerative endodontic procedures in immature teeth with pulp necrosis [3]. Previous studies have revealed that the odonto/osteogenic differentiation capacity of SCAPs can be regulated by many factors in vitro, including proinflammatory cytokines [1, 4], estrogen [5], and inorganic substance [2, 6].
Diabetes mellitus (DM) is a chronic metabolic disease which is characterized by hyperglycemia and can result in some complications including cardiovascular diseases, nephropathy, osteoporosis, and oral diseases [7]. Diabetic patients have an increased risk of suffering osteopenia and osteoporosis, especially with the uncontrolled hyperglycemia [8, 9]. The development of periodontitis is attributed to the hyperglycemia, in which periodontium and alveolar bone are targets of diabetic damage [10, 11]. Pathologic calcifications such as diffuse calcification and pulp stones always appear in dental pulp tissues of diabetic patients [12]. The underlying mechanisms of bone fracture caused by DM, bone formation, and remodeling in its healing process were still poorly known. Thus, an understanding of the relationship between DM-induced high glucose conditions and the osteogenic differentiation of MSCs is urgently needed [13]. Austin et al. have demonstrated that the function of MSCs has a high dependence on glucose and glucose metabolism [14]. Some studies have shown that high glucose medium is a vital prerequisite for the differentiation of embryonic stem cells (ESCs) into cardiac myocytes [15]. Rat bone marrow mesenchymal stromal cells (rBMMSCs) form increased hard tissues indicated by the osteocalcin production and calcium deposition under a high glucose concentration (over 8.0 mM) [16]. Some studies have revealed that high glucose can reduce proliferation of rat BMMSCs [17] but enhance the adipogenic differentiation of mouse BMMSCs [18], human osteosarcoma cell MG63 [19], and human muscle-derived stem cells [20].
Our previous work has revealed that some signaling pathways participate in the odonto/osteogenic differentiation of SCAPs, including nuclear factor kappa B (NF-κB) pathway and mitogen-activated protein kinase (MAPK) pathway [2, 5]. Moreover, NF-κB is an intracellular transduction signaling pathway found nearly in all cell types, which can be triggered by various activators, i.e., trauma, inflammatory factors, and mineral trioxide aggregate (MTA) [21–23]. It has been proved to take part in the regulation of some biological activities including development, immune response, inflammation, and wound healing [24, 25]. Furthermore, it is extensively involved in the differentiation of osteoblast and osteoclast lineages during the process of tooth eruption and orthodontic tooth movement [22, 26]. To date, there is little information regarding how high glucose exerts an effect on the proliferation and differentiation of SCAPs. In this study, SCAPs were cultured in high glucose media and the effect of high glucose on the odonto/osteogenic differentiation of SCAPs was subsequently investigated. Meanwhile, in the involvement of NF-κB, the potential pathway was also extensively evaluated.
2. Materials and Methods
2.1. Cell Isolation, Culture, and Identification
This study was approved by Ethical Committee of Stomatological School of Nanjing Medical University (date of approval: 2009-1-1, reference no. 200900128). The young third molars with no caries and periodontic diseases were collected with informed consents from donors (17–20 years old) at the Oral and Maxillofacial Surgery Department of Jiangsu Provincial Stomatological Hospital, following the approved guidelines set by Ethical Committee of Stomatological School of Nanjing Medical University. The apical papilla complexes were gently obtained from the immature dental roots, disposed into 1 mm3, and handled with type I collagenase (2 mg/mL) and dispase (4 mg/mL) for 1 h at 37°C. Next, single-cell suspension was cultured into cell culture dishes at the density of 1 × 105 cells/mL and incubated in α-MEM supplemented with 10% fetal bovine serum (FBS), 100 U/mL penicillin, and 100 U/mL streptomycin. When reaching 80% confluence, the cells were digested and passaged at the ratio of 1:3. Then, SCAPs were purified according to the standard procedures for magnetic activated cell sorting (MACS) as previously described [27, 28]. Immunocytochemical staining against STRO-1 was used to identify and confirmed the obtained SCAPs and the cells were routinely observed under the phase-contrast inverted microscope. SCAPs at 3-5 passages were used in the following experiments.
2.2. MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyl-2,5-Tetrazoliumbromide) Assay
To study the effects of high glucose on the proliferation capacity of SCAPs, the cells at passage 3 were seeded into 96-well plates (Corning, Life Sciences) at a density of 2 × 103 cells/well for 24 h, starved in serum-free media for another 24 h, and, respectively, cultured in normal α-MEM (containing 5 mmol/L glucose) and high glucose concentration α-MEM (containing 25mmol/L). After 0, 1, 3, 5, and 7 days of culture, 20μl fresh MTT solution (5 mg/ml, Sigma-Aldrich) was added into the wells of each group and incubated for 4 h at 37°C. Culture media were eliminated and formazan was dissolved in 150 μl/well dimethyl sulfoxide (DMSO, Sigma). The absorbance (OD value) was measured at the wavelength of 490 nm using a microtiter plate reader (Titertek, Helsinki, Finland).
2.3. Alkaline Phosphatase (ALP) Activity
SCAPs were seeded into the 96-well plates (Corning, Life Sciences) at a density of 2 × 103 cells/well and, respectively, cultured in normal glucose concentration media (containing 5 mmol/L glucose) or high glucose concentration media (containing 25 mmol/L glucose). At days 3 and 7, ALP activity of each group was measured using an ALP kit (Biosino Bio-technology & Science Inc.) and normalized on the basis of equivalent protein concentrations.
2.4. Alizarin Red Staining
SCAPs were separately cultured in four different media solutions ( normal culture media containing 5 mmol/L glucose, high glucose concentration media containing 25 mmol/L glucose, mineralized media (MM) containing 5 mmol/L glucose, and mineralized media containing 25 mmol/L glucose) for 14 days. MM is the mineralization-inducing medium containing α-MEM, 10% FBS, 100 U/mL penicillin, 100 g/mL streptomycin, 2 mmol/L L-glutamine (Sigma-Aldrich), 50 mg/L ascorbic acid (Sigma-Aldrich), 10 mmol/L β-glycerophosphate (Sigma-Aldrich), and 10 nmol/L dexamethasone (Sigma-Aldrich). Alizarin red staining was performed as previously described [29–31]. To quantify the calcified nodules, the alizarin red was eluted from the stained cells with 1 ml/well 10% cetylpyridinium chloride in 10 mM sodium phosphate (pH7.0). The calcium concentration was calculated as previously reported [29] and the final concentrations were normalized to total protein contents.
2.5. Real-Time Reverse Transcriptase-Polymerase Chain Reaction (Real-Time RT-PCR)
To investigate the odonto/osteoblast-related gene changes after the inhibition of NF-κB pathway, SCAPs were cultured in normal culture media containing 5 mmol/L glucose or high glucose concentration media containing 25 mmol/L glucose or high glucose concentration media containing 25 mmol/L glucose + BMS345541. The total cellular RNA was extracted by adding TRIzol reagent (Invitrogen, Carlsbad, CA) into cell samples, respectively, according to the manufacturer's instructions. The mRNA was reversed using a PrimeScript RT Master Mix Kit (TaKaRaBiotech., Japan). Real-time RT-PCR was performed by using SYBR® Premix Ex Taq™ kit (TaKaRaBiotech., Japan) and ABI 7300 real-time PCR system. Primers used in this experiment were exhibited in Table 1. GAPDH was used as an internal control. The genes expression was calculated by the 2−△△CT method as previously reported [30].
Table 1.
Sense and antisense primers for real-time reverse transcription polymerase chain reaction.
| Genes | Primers | Sequences (5'-3') |
|---|---|---|
| ALP | Forward | GACCTCCTCGGAAGACACTC |
| Reverse | TGAAGGGCTTCTTGTCTGTG | |
| RUNX2 | Forward | TCTTAGAACAAATTCTGCCCTTT |
| Reverse | TGCTTTGGTCTTGAAATCACA | |
| DSPP | Forward | ATATTGAGGGCTGGAATGGGGA |
| Reverse | TTTGTGGCTCCAGCATTGTCA | |
| OSX | Forward | CCTCCTCAGCTCACCTTCTC |
| Reverse | GTTGGGAGCCCAAATAGAAA | |
| OCN | Forward | AGCAAAGGTGCAGCCTTTGT |
| Reverse | GCGCCTGGGTCTCTTCACT | |
| GAPDH | Forward | GAAGGTGAAGGTCGGAGTC |
| Reverse | GAGATGGTGATGGGATTTC |
2.6. Western Blot Analysis
In order to investigate the effects of high glucose on the odonto/osteogenic differentiation of SCAPs, SCAPs cultured in 5 mmol/L glucose and 25 mmol/L high glucose medium were, respectively, collected at days 3 and 7 and then lysed in RIPA lysis buffer (Beyotime, China). To detect the expression of NF-κB pathway-related proteins, SCAPs treated by 25 mmol/L high glucose for 0 min, 15 min, 30 min, and 60 min were, respectively, harvested to get the cytoplasmic and nuclear proteins with a Keygen Kit (Keygen Bio-tech, Nanjing, China). The same amount of protein was placed into a 10% sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto 0.22 μm polyvinylidene fluoride (PVDF, Millipore) membranes. Then, the transferred membranes were blocked in 5% BSA at room temperature for 2 h and incubated with primary antibodies including DSP (sc-33586, Santa Cruz), RUNX2 (ab76956, Abcam, UK), OSX (ab22552, Abcam, UK), OCN (ab93876, Abcam, UK), ALP (ab95462, Abcam, UK), P65(#8242, Cell Signaling Technology), p-P65(#3033, Cell Signaling Technology), IκBα(#4814, Cell Signaling Technology), p-IκBα(#2859, Cell Signaling Technology), H3(#9728, Cell Signaling Technology), and β-ACTIN(AP0060, Bioworld) overnight at 4°C. β-ACTIN and H3 served as the internal controls. Finally, the membranes were washed with PBST three times followed by incubation with the secondary antibodies for 1 h at 37°C and then visualized with Image Quant LAS4000 system (GE Healthcare).
2.7. Statistical Analysis
Data were calculated by Student's t-test. P value less than 0.05 was considered to be statistically significant. All the statistical analyses were performed with SPSS 17.0 software (SPSS Inc., Chicago, IL). Image-Pro Plus 5.0 (Media Cybernetics, Inc, Rockville, MD) software was used for the grayscale analysis. All the results were exhibited as means ± SD and experiments were repeated in triplicate.
3. Results
3.1. Effects of High Glucose on the Proliferation of SCAPs
SCAPs at passage3 were fibroblast-like (Figure 1(a)) and purified SCAPs were positive against STRO-1 (Figure 1(b)). Western blot assay showed that the expression of osteo/odontogenic markers (RUNX2 and ALP) was gradually upregulated accompanying with the increased glucose concentrations from 5mmol/L to 25mmol/L, and the highest level was in 25mmol/L group. Then 25mmol/L glucose was used in the following experiments (Figure 1(c)). MTT assay showed the OD values of SCAPs cultured in high glucose media were significantly lower than those in normal media at days 3, 5, and 7 (values were presented as means ± SD, n = 6, P < 0.05 or P < 0.01, Figure 1(d)), indicating that the proliferation ability of SCAPs was inhibited by high glucose.
Figure 1.
Effects of high glucose on proliferation of SCAPs. (a) Immunocytochemical staining against PBS as negative control. (b) Immunocytochemical staining against STRO-1. (c) Protein expression of RUNX2 and ALP was enhanced with the increased glucose concentrations from 5 mmol/L to 25 mmol/L, in which the highest level was detected in 25 mmol/L group. ∗P < 0.05, ∗∗ P < 0.01. (d) MTT assay showed that OD values of SCAPs in 25 mmol/L group were significantly lower than those in control group at days 3, 5, and 7. Values were presented as means ± SD, n = 6, ∗P < 0.05; ∗∗ P < 0.01.
3.2. Effects of High Glucose on the Odonto/Osteogenic Differentiation of SCAPs
ALP activity of SCAPs cultured in high glucose was significantly higher than those in 5mmol/L glucose at days 3 and 7 (Figure 2(a), P < 0.01). Alizarin red staining assay showed that SCAPs in MM+25 mmol/L glucose group formed more calcified nodules than those in MM+5mmol/L glucose group (Figure 2(b)). Meanwhile, CPC quantitative calcium assay demonstrated the higher calcium deposition in MM+25mmol/L glucose group than MM+5 mmol/L glucose group (Figure 2(c), P < 0.01), indicating that high glucose can enhance the mineralization capacity of SCAPs. Real-time RT-PCR showed that the expression of ALP, RUNX2, OSX, OCN, and DSPP was enhanced in high glucose-treated SCAPs at day 3 (Figure 3(a)) or day 7 (Figure 3(b)) as compared with that in control group. Western blot results demonstrated that the expression of odonto/osteogenic proteins (ALP, RUNX2, DSP, OSX, and OCN) was significantly increased after the treatment of 25mmol/L glucose for 3 and 7 days as compared with that in control group (Figures 3(c), 3(d), and 3(e)).
Figure 2.
Effects of high glucose on mineralization of SCAPs. (a) ALP activity of SCAPs cultured in 25 mmol/L group was higher than those in 5 mmol/L group at days 3 and 7. Values were presented as means ± SD, n = 6 ∗∗P < 0.01. (b) Alizarin red staining showed that the calcified nodules formed in uninduced media (without mineralized media) has no significant difference between 25 mmol/L group and control group. However, SCAPs in 25 mmol/L group produced more calcified nodules than those in 5 mmol/L group, when cultured in the mineralize-induced media. (c) Quantitative calcium assay demonstrated the higher calcium deposition in 25 mmol/L group as compared with that in 5 mmol/L group. Data were presented as means± SD, n = 3. ∗∗P < 0.01.
Figure 3.
Effects of high glucose on the odonto/osteogenic differentiation of SCAPs. (a, b) The expression of odonto/osteogenic genes (ALP, RUNX2, OSX, OCN, and DSPP) in 25 mmol/L high glucose-treated SCAPs was significantly higher than that in 5 mmol/L group at days 3 and 7. GAPDH served as an internal control. Values were presented as means± SD, n = 6. ∗∗P < 0.01. (c) Western blot showed the odonto/osteogenic proteins (e.g., ALP, RUNX2, OSX, OCN, and DSP) in 25 mmol/L group were significantly higher than those in 5 mmol/L group at days 3 and 7. ACTIN served as an internal control. (d) Grayscale analysis of panel C. ∗P < 0.05; ∗∗P < 0.01.
3.3. NF-κB Pathway Involvement in High Glucose-Mediated Odonto/Osteogenic Differentiation of SCAPs
NF-κB pathway proteins changed after the treatment of high glucose for 15, 30, and 60 min. The expression of p-IκBα increased at 15min and then decreased. Cytoplasmic p-P65 protein expression was obviously upregulated at 15 min and slowly decreased, while the protein expression ofnulearP65 was increased at 15 min and then gradually decreased at 30 min and 60 min (P< 0.01, Figures 4(a) and 4(b)). To confirm the role of NF-κB pathway in high glucose-mediated odonto/osteogenic differentiation of SCAPs, BMS345541 (IKK inhibitor) was used to inhibit NF-κB pathway prior to the high glucose treatment. Real-time RT-PCR results showed that the expression of odonto/osteogenic genes including ALP, RUNX2, OSX, OCN, and DSPP was significantly downregulated, as compared with that in high glucose-treated SCAPs (P< 0.01, Figure 4(c)).
Figure 4.
NF-κB pathway involvement in high glucose-mediated odonto/osteogenic differentiation of SCAPs. (a) The protein levels of P65, p-P65, IκBα, and p-IκBα in the cytoplasm of 25 mmol/L high glucose-treated SCAPs at 0, 15, 30, and 60 min, respectively. β-ACTIN served as an internal control. The nuclear P65 expression of 25 mmol/L high glucose-treated SCAPs at 0, 15, 30, and 60 min, respectively. Histone 3 served as an internal control. (b) Quantitative analysis for the ratios of p-IκBα/IκBα and p-P65/P65 and grayscale analysis of panel A after 25 mmol/L glucose treatment at indicated time points. Values were presented as means± SD, n = 6. ∗ P< 0.05; ∗∗P< 0.01. (c) The expression of odonto/osteogenic genes (ALP, RUNX2, OSX, OCN, and DSPP) in 25 mmol/L+BMS345541 group was obviously decreased as compared with that in 25 mmol/L group. Values were presented as means ± SD, ∗∗2−∆∆Ct ≥ 2, P< 0.01; ∗ 1 < 2−∆∆Ct < 2, P < 0.05, n=3.
4. Discussion
Patients with DM may suffer some skeletal disorders including osteoporosis, periodontal diseases, and the diabetic foot syndrome, indicating that DM is associated with specific alterations of bone metabolism [32]. In the context of diabetogenesis, the key biological issues are how bone tissues originate, proliferate, and differentiate [8]. Recruitment of an adequate amount of MSCs to the microenvironment around the bone injury is essential for effective bone repair [33]. It is well known that SCAPs are the most important stem cells for dental tissue regeneration [4]. Thus, it will make sense to investigate the proliferation and odonto/osteogenic differentiation of SCAPs under a high glucose microenvironment.
In the present study, STRO-1+ SCAPs were successfully isolated and MTT assay showed that 25mmol/L high glucose reduced the proliferation ability of SCAPs. Mechanistically, high glucose environment may induce an adaptive response to the increased oxidative stress and promote reactive oxygen species (ROS) removal, resulting in a decreased proliferation of stem cells [34, 35]. Some studies have demonstrated that high glucose can inhibit the proliferation ability of BMSCs by activating GSK3β to suppress cyclin D1 and CXCR-4 [36].
High glucose has the ability to attenuate the differentiation capacity of ESCs into neurocytes [37], BMSCs, and hPDLSCs into osteoblasts [34, 36]. In contrast, high glucose can promote the osteogenic differentiation capacity of human periodontal ligament fibroblasts [38]. To date, effects of high glucose on the odonto/osteogenic differentiation of SCAPs are still not determined. This study demonstrated for the first time that 25 mmol/L high glucose can enhance the odonto/osteogenic differentiation of SCAPs. Previous studies have found the appearance of pulp stones and thickened predentin in diabetic rat [39, 40]. Moreover, positive correlation between Type II diabetes mellitus and pulp stones has been revealed through analyses of various clinical cases [41]. It has been reported that advanced glycation end-products (AGE) can stimulate the osteogenic differentiation, which is verified by the upregulation of ALP activity, osteopontin (OPN), and osteocalcin (OCN) in rat dental pulp cells [39].
An increase in osteogenic differentiation level after the high glucose treatment was indicated by an upregulation of several odonto/osteogenic markers including ALP/ALP, RUNX2/RUNX2, DSPP/DSP, OSX/OSX, and OCN/OCN[42]. ALP/ALP is mainly generated by osteoblasts and was thought to participate in the degradation of pyrophosphate to provide sufficient inorganic phosphate for the occurrence of mineralization [43]. RUNX2/RUNX2 and OSX/OSX are both important transcription factors necessary for the osteogenic differentiation [44], in which OSX is a downstream gene of RUNX2 and regulated by RUNX2 [45]. OCN/OCN is highly presented in the bone extracellular matrix and actively involved in bone formation [46]. As the specific marker of the odontogenesis, DSPP/DSP mainly appears in the dentin or predentin structures [47, 48]. Alkaline phosphatase (ALP) activity and alizarin red staining confirmed the enhanced odonto/osteogenic differentiation ability of SCAPs in high glucose media.
In this study, NF-κB signaling pathway was activated after high glucose treatment and the increased odonto/osteogenic capability of SCAPs can be blocked by the NF-κB signaling pathway inhibitor (BMS345541). Various studies have proved that high glucose can activate NF-κB signaling in different cells [21, 23, 49–51]. Some reports have revealed that reactive oxygen species (ROS) is a crucial signal driving the differentiation of both adipose-derived stem cells (ADSCs) and myeloid-derived suppressor cells (MDSCs) into adipocytes after high glucose exposure. ROS may modulate the activity of transcription factors directly, such as NF-κB, thus changing the related gene expression [20, 52]. Moreover, high glucose can induce the expression as well as the secretion of Par-4 in islet beta cells while TLR-2/4 expression is significantly upregulated in retinal microvascular endothelial cells after high glucose treatment, which subsequently causes the activation of NF-κB [53–55].
Together, high glucose is transported into SCAPs by glucose transporters (GLUT) [56], and then IκBα is degraded and released from the p50/p65 complex, which leads to the translocation of P65 into nuclei and the activation of NF-κB. The odonto/osteogenic genes are expressed later which ultimately result in the committed differentiation of SCAPs (Figure 5).
Figure 5.

Schematic diagram for the activation of NF-κB pathway by high glucose. High glucose is absorbed by SCAPs mainly by glucose transporters (GLUT). High glucose can induce the phosphorylation of IkBα in the cytoplasm, which subsequently leads to the rapid hydrolysis of IkBα. P65 is then phosphorylated and transported into nuclei, which finally causes the activation of NF-κB pathway and odonto/osteogenic differentiation of stem cells.
5. Conclusions
In summary, high glucose could reduce the proliferation ability of SCAPs. Meanwhile, the odonto/osteogenic differentiation capacity of SCAPs was enhanced in high glucose environment by activation of NF-κB pathway. This work provides a novel insight into the interactions between high glucose and apexogenesis mediated by SCAPs, in which high glucose may have a crucial influence on the odontogenesis and pulp calcification [40, 41, 56]. More extensive investigations should be performed to explore the potential applications of high glucose in clinical endodontic treatments.
Acknowledgments
This work was supported by Open Program of Jiangsu Key Laboratory of Oral Diseases (JSKLOD-KF-1503), National Natural Science Foundation of China (81371144), Medical Talent Project of Jiangsu Province (ZDRCA2016086), Science and Technology Development Project of Jiangsu Province (BE2017731), and the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD; 2014-37).
Data Availability
The data used to support the findings of this study are available from the corresponding author upon request.
Conflicts of Interest
The authors declare no conflicts of interest.
Authors' Contributions
Yanping Wang and Yanqiu Wang contributed equally to this manuscript.
References
- 1.Ma S., Liu G., Jin L., et al. IGF-1/IGF-1R/hsa-let-7c axis regulates the committed differentiation of stem cells from apical papilla. Scientific Reports. 2016;6(1, article no 36922) doi: 10.1038/srep36922. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Yan M., Wu J., Yu Y., et al. Mineral trioxide aggregate promotes the odonto/osteogenic differentiation and dentinogenesis of stem cells from apical papilla via nuclear factor kappa b signaling pathway. Journal of Endodontics. 2014;40(5):640–647. doi: 10.1016/j.joen.2014.01.042. [DOI] [PubMed] [Google Scholar]
- 3.Chrepa V., Pitcher B., Henry M. A., Diogenes A. Survival of the apical papilla and its resident stem cells in a case of advanced pulpal necrosis and apical periodontitis. Journal of Endodontics. 2017;43(4):561–567. doi: 10.1016/j.joen.2016.09.024. [DOI] [PubMed] [Google Scholar]
- 4.Wang F., Jiang Y., Huang X., et al. Pro-inflammatory cytokine TNF-alpha attenuates bmp9-induced osteo/ odontoblastic differentiation of the stem cells of dental apical papilla (SCAPs) International Journal of Experimental Cellular Physiology, Biochemistry, and Pharmacology. 2017;41(5):1725–1735. doi: 10.1159/000471865. [DOI] [PubMed] [Google Scholar]
- 5.Li Y., Yan M., Wang Z., et al. 17beta-estradiol promotes the odonto/osteogenic differentiation of stem cells from apical papilla via mitogen-activated protein kinase pathway. Stem Cell Research & Therapy. 2014;5(6):p. 125. doi: 10.1186/scrt515. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Bellamy C., Shrestha S., Torneck C., Kishen A. Effects of a bioactive scaffold containing a sustained transforming growth factor-beta1-releasing nanoparticle system on the migration and differentiation of stem cells from the apical papilla. Journal of Endodontics. 2016;42(9):1385–1392. doi: 10.1016/j.joen.2016.06.017. [DOI] [PubMed] [Google Scholar]
- 7.Choi H. Y., Park J. H., Jang W. B., et al. High glucose causes human cardiac progenitor cell dysfunction by promoting mitochondrial fission: role of a GLUT1 blocker. Biomolecules & Therapeutics. 2016;24(4):363–370. doi: 10.4062/biomolther.2016.097. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Maddaloni E., D’Eon S., Hastings S., et al. Bone health in subjects with type 1 diabetes for more than 50 years. Acta Diabetologica. 2017;54(5):479–488. doi: 10.1007/s00592-017-0973-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Pujia A., Gazzaruso C., Montalcini T. An update on the potential role of C-peptide in diabetes and osteoporosis. Endocrine Journal. 2017;58(3):408–412. doi: 10.1007/s12020-017-1286-5. [DOI] [PubMed] [Google Scholar]
- 10.Bertrand K. A., Shingala J., Evens A., Birmann B. M., Giovannucci E., Michaud D. S. Periodontal disease and risk of non-hodgkin lymphoma in the health professionals follow-up study. International Journal of Cancer. 2017;140(5):1020–1026. doi: 10.1002/ijc.30518. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Lamster I. B., Pagan M. Periodontal disease and the metabolic syndrome. International Dental Journal. 2017;67(2):67–77. doi: 10.1111/idj.12264. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Bender I., Bender A. Diabetes Mellitus and the Dental Pulp. Journal of Endodontics. 2003;29(6):383–389. doi: 10.1097/00004770-200306000-00001. [DOI] [PubMed] [Google Scholar]
- 13.Lin Y., Li Y., Rui Y., et al. The effects of high glucose on tendon-derived stem cells: implications of the pathogenesis of diabetic tendon disorders. Oncotarget . 2017;8(11) doi: 10.18632/oncotarget.15418. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Nuschke A., Rodrigues M., Wells A. W., Sylakowski K., Wells A. Mesenchymal stem cells/multipotent stromal cells (MSCs) are glycolytic and thus glucose is a limiting factor of in vitro models of MSC starvation. Stem Cell Research & Therapy. 2016;7(1, article no 179) doi: 10.1186/s13287-016-0436-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Crespo F. L., Sobrado V. R., Gomez L., Cervera A. M., McCreath K. J. Mitochondrial reactive oxygen species mediate cardiomyocyte formation from embryonic stem cells in high glucose. Stem Cells. 2010;28(7):1132–1142. doi: 10.1002/stem.441. [DOI] [PubMed] [Google Scholar]
- 16.Yamawaki I., Taguchi Y., Komasa S., Tanaka A., Umeda M. Effects of glucose concentration on osteogenic differentiation of type II diabetes mellitus rat bone marrow-derived mesenchymal stromal cells on a nano-scale modified titanium. Journal of Periodontal Research. 2017;52(4):761–771. doi: 10.1111/jre.12446. [DOI] [PubMed] [Google Scholar]
- 17.Stolzing A., Coleman N., Scutt A. Glucose-induced replicative senescence in mesenchymal stem cells. Rejuvenation Research. 2006;9(1):31–35. doi: 10.1089/rej.2006.9.31. [DOI] [PubMed] [Google Scholar]
- 18.Chuang C. C., Yang R. S., Tsai K. S., Ho F. M., Liu S. H. Hyperglycemia enhances adipogenic induction of lipid accumulation: involvement of extracellular signal-regulated protein kinase 1/2, phosphoinositide 3-kinase/Akt, and peroxisome proliferator-activated receptor gamma signaling. Endocrinology. 2007;148(9):4267–4275. doi: 10.1210/en.2007-0179. [DOI] [PubMed] [Google Scholar]
- 19.Shao X., Cao X., Song G., Zhao Y., Shi B. Metformin rescues the MG63 osteoblasts against the effect of high glucose on proliferation. Journal of Diabetes Research. 2014;2014:6. doi: 10.1155/2014/453940.453940 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Aguiari P., Leo S., Zavan B., et al. High glucose induces adipogenic differentiation of muscle-derived stem cells. Proceedings of the National Acadamy of Sciences of the United States of America. 2008;105(4):1226–1231. doi: 10.1073/pnas.0711402105. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Huang W., Gou F., Long Y., et al. High glucose and lipopolysaccharide activate NOD1- RICK-NF-kappaB inflammatory signaling in mesangial cells. Experimental and Clinical Endocrinology & Diabetes. 2016;124(08):512–517. doi: 10.1055/s-0042-105641. [DOI] [PubMed] [Google Scholar]
- 22.Wang Y., Yan M., Fan Z., Ma L., Yu Y., Yu J. Mineral trioxide aggregate enhances the odonto/osteogenic capacity of stem cells from inflammatory dental pulps via NF-kappaB pathway. Oral Diseases. 2014;20(7):650–658. doi: 10.1111/odi.12183. [DOI] [PubMed] [Google Scholar]
- 23.Li J., Yan M., Wang Z., et al. Effects of canonical NF-kappaB signaling pathway on the proliferation and odonto/osteogenic differentiation of human stem cells from apical papilla. BioMed Research International. 2014;2014:12. doi: 10.1155/2014/319651.319651 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Espin-Palazon R., Traver D. The NF-kappaB family: Key players during embryonic development and HSC emergence. Experimental Hematology. 2016;44(7):519–527. doi: 10.1016/j.exphem.2016.03.010. [DOI] [PubMed] [Google Scholar]
- 25.Valko M., Leibfritz D., Moncol J., Cronin M. T. D., Mazur M., Telser J. Free radicals and antioxidants in normal physiological functions and human disease. The International Journal of Biochemistry & Cell Biology. 2007;39(1):44–84. doi: 10.1016/j.biocel.2006.07.001. [DOI] [PubMed] [Google Scholar]
- 26.van Heerden B., Kasonga A., Kruger M., Coetzee M. Palmitoleic acid inhibits RANKL-Induced osteoclastogenesis and bone resorption by suppressing NF-kappaB and MAPK signalling pathways. Nutrients. 2017;9(5, article no 441) doi: 10.3390/nu9050441. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Wang S., Mu J., Fan Z., et al. Insulin-like growth factor 1 can promote the osteogenic differentiation and osteogenesis of stem cells from apical papilla. Stem Cell Research. 2012;8(3):346–356. doi: 10.1016/j.scr.2011.12.005. [DOI] [PubMed] [Google Scholar]
- 28.Wang Y., Lu Y., Li Z., et al. Oestrogen receptor alpha regulates the odonto/osteogenic differentiation of stem cells from apical papilla via ERK and JNK MAPK pathways. Cell Proliferation. 2018;51(6) doi: 10.1111/cpr.12485.e12485 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Yu J., He H., Tang C., et al. Differentiation potential of STRO-1+ dental pulp stem cells changes during cell passaging. BMC Cell Biology. 2010;11, article 32 doi: 10.1186/1471-2121-11-32. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Yu Y., Mu J., Fan Z., et al. Insulin-like growth factor 1 enhances the proliferation and osteogenic differentiation of human periodontal ligament stem cells via ERK and JNK MAPK pathways. Histochemistry & Cell Biology. 2012;137(4):513–525. doi: 10.1007/s00418-011-0908-x. [DOI] [PubMed] [Google Scholar]
- 31.Lei G., Yan M., Wang Z., et al. Dentinogenic capacity: Immature root papilla stem cells versus mature root pulp stem cells. Biology of the Cell. 2011;103(4):185–196. doi: 10.1042/BC20100134. [DOI] [PubMed] [Google Scholar]
- 32.Ma P., Gu B., Xiong W., et al. Glimepiride promotes osteogenic differentiation in rat osteoblasts via the PI3K/Akt/eNOS pathway in a high glucose microenvironment. PLoS ONE. 2014;9(11):p. e112243. doi: 10.1371/journal.pone.0112243. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Wang X., Wang Y., Gou W., Lu Q., Peng J., Lu S. Role of mesenchymal stem cells in bone regeneration and fracture repair: a review. International Orthopaedics. 2013;37(12):2491–2498. doi: 10.1007/s00264-013-2059-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Kato H., Taguchi Y., Tominaga K., et al. High glucose concentrations suppress the proliferation of human periodontal ligament stem cells and their differentiation into osteoblasts. Journal of Periodontology. 2016;87(4):e44–e51. doi: 10.1902/jop.2015.150474. [DOI] [PubMed] [Google Scholar]
- 35.McClelland Descalzo D. L., Satoorian T. S., Walker L. M., Sparks N. R. L., Pulyanina P. Y., Zur Nieden N. I. Glucose-induced oxidative stress reduces proliferation in embryonic stem cells via FOXO3A/beta-catenin-dependent transcription of p21(cip1) Stem Cell Reports. 2016;7(1):55–68. doi: 10.1016/j.stemcr.2016.06.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Zhang B., Liu N., Shi H., et al. High glucose microenvironments inhibit the proliferation and migration of bone mesenchymal stem cells by activating GSK3beta. Journal of Bone and Mineral Metabolism. 2016;34:140–150. doi: 10.1007/s00774-015-0662-6. [DOI] [PubMed] [Google Scholar]
- 37.Yang P., Shen W., Albert Reece E., Chen X., Yang P. High glucose suppresses embryonic stem cell differentiation into neural lineage cells. Biochemical and Biophysical Research Communications. 2016;472(2):306–312. doi: 10.1016/j.bbrc.2016.02.117. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Seubbuk S., Sritanaudomchai H., Kasetsuwan J., Surarit R. High glucose promotes the osteogenic differentiation capability of human periodontal ligament fibroblasts. Molecular Medicine Reports. 2017;15(5):2788–2794. doi: 10.3892/mmr.2017.6333. [DOI] [PubMed] [Google Scholar]
- 39.Nakajima Y., Inagaki Y., Hiroshima Y., Kido J., Nagata T. Advanced glycation end-products enhance calcification in cultured rat dental pulp cells. Journal of Endodontics. 2013;39(7):873–878. doi: 10.1016/j.joen.2012.11.027. [DOI] [PubMed] [Google Scholar]
- 40.Inagaki Y., Yoshida K., Ohba H., et al. High glucose levels increase osteopontin production and pathologic calcification in rat dental pulp tissues. Journal of Endodontics. 2010;36(6):1014–1020. doi: 10.1016/j.joen.2010.03.018. [DOI] [PubMed] [Google Scholar]
- 41.Nayak M., Kumar J., Prasad L. A radiographic correlation between systemic disorders and pulp stones. Indian Journal of Dental Research. 2010;21(3):369–373. doi: 10.4103/0970-9290.70806. [DOI] [PubMed] [Google Scholar]
- 42.Chen S., Gluhak-Heinrich J., Wang Y. H., et al. Runx2, osx, and dspp in tooth development. Journal of Dental Research. 2009;88(10):904–909. doi: 10.1177/0022034509342873. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Mikami Y., Tsuda H., Akiyama Y., et al. Alkaline phosphatase determines polyphosphate-induced mineralization in a cell-type independent manner. Journal of Bone and Mineral Metabolism. 2016;34(6):627–637. doi: 10.1007/s00774-015-0719-6. [DOI] [PubMed] [Google Scholar]
- 44.Kidwai F., Edwards J., Zou L., Kaufman D. S. Fibrinogen induces RUNX2 activity and osteogenic development from human pluripotent stem cells. Stem Cells. 2016;34(8):2079–2089. doi: 10.1002/stem.2427. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Lee M.-H., Kwon T.-G., Park H.-S., Wozney J. M., Ryoo H.-M. BMP-2-induced Osterix expression is mediated by Dlx5 but is independent of Runx2. Biochemical and Biophysical Research Communications. 2003;309(3):689–694. doi: 10.1016/j.bbrc.2003.08.058. [DOI] [PubMed] [Google Scholar]
- 46.Duan R. P., Wu L., Lin Y. F., Liu L., Tian W. The gene expression patterns of bone-marrow mesenchymal stem cells under different osteogenic induction. Sichuan Da Xue Xue Bao Yi Xue Ban37. 2006;37:856–859. [PubMed] [Google Scholar]
- 47.Wu G., Deng Z., Fan X., et al. Odontogenic potential of mesenchymal cells from hair follicle dermal papilla. Stem Cells and Development. 2009;18(4):583–590. doi: 10.1089/scd.2008.0066. [DOI] [PubMed] [Google Scholar]
- 48.Nakashima M., Tachibana K., Iohara K., Ito M., Ishikawa M., Akamine A. Induction of reparative dentin formation by ultrasound-mediated gene delivery of growth/differentiation factor 11. Human Gene Therapy. 2003;14(6):591–597. doi: 10.1089/104303403764539369. [DOI] [PubMed] [Google Scholar]
- 49.Wang Y., Yan M., Yu Y., Wu J., Yu J., Fan Z. Estrogen deficiency inhibits the odonto/osteogenic differentiation of dental pulp stem cells via activation of the NF-kappaB pathway. Cell and Tissue Research. 2013;352(3):551–559. doi: 10.1007/s00441-013-1604-z. [DOI] [PubMed] [Google Scholar]
- 50.Yang J., Chen L., Ding J. MicroRNA-24 inhibits high glucose-induced vascular smooth muscle cell proliferation and migration by targeting HMGB1. Gene. 2016;586(2):268–273. doi: 10.1016/j.gene.2016.04.027. [DOI] [PubMed] [Google Scholar]
- 51.Huang Y., Guo W., Zeng J., et al. Prediabetes enhances periodontal inflammation consistent with activation of toll-like receptor-mediated nuclear factor-kappaB pathway in rats. Journal of Periodontology. 2016;87(5):e64–e74. doi: 10.1902/jop.2015.150522. [DOI] [PubMed] [Google Scholar]
- 52.Zmijewski J. W., Zhao X., Xu Z., Abraham E. Exposure to hydrogen peroxide diminishes NF-kappaB activation, IkappaB-alpha degradation, and proteasome activity in neutrophils. American Journal of Physiology-Cell Physiology. 2007;293(1):C255–C266. doi: 10.1152/ajpcell.00618.2006. [DOI] [PubMed] [Google Scholar]
- 53.QiNan W., XiaGuang G., XiaoTian L., WuQuan D., Ling Z., Bing C. Par-4/NF-kappaB mediates the apoptosis of islet beta cells induced by glucolipotoxicity. Journal of Diabetes Research. 2016;2016:17. doi: 10.1155/2016/4692478.4692478 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Zhao M., Li C., Liu Y. Toll-like receptor (TLR)-2/4 expression in retinal ganglion cells in a high-glucose environment and its implications. Genetics and Molecular Research. 2016;15(2) doi: 10.4238/gmr.15026998. [DOI] [PubMed] [Google Scholar]
- 55.Ye E. A., Steinle J. J. miR-146a attenuates inflammatory pathways mediated by TLR4/NF-kappaB and TNFalpha to protect primary human retinal microvascular endothelial cells grown in high glucose. Mediators of Inflammation. 2016;2016:9. doi: 10.1155/2016/3958453.3958453 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Ida-Yonemochi H., Nakatomi M., Harada H., Takata H., Baba O., Ohshima H. Glucose uptake mediated by glucose transporter 1 is essential for early tooth morphogenesis and size determination of murine molars. Developmental Biology. 2012;363(1):52–61. doi: 10.1016/j.ydbio.2011.12.020. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The data used to support the findings of this study are available from the corresponding author upon request.




