Skip to main content
Ecology and Evolution logoLink to Ecology and Evolution
. 2019 Apr 9;9(8):4373–4381. doi: 10.1002/ece3.4881

Evolutionary origin of a periodical mass‐flowering plant

Satoshi Kakishima 1,2,, Yi‐shuo Liang 3,4, Takuro Ito 2,5, Tsung-Yu Aleck Yang 6,7, Pei‐Luen Lu 8, Yudai Okuyama 2, Mitsuyasu Hasebe 9,10, Jin Murata 11, Jin Yoshimura 1,12,13,
PMCID: PMC6476870  PMID: 31031912

Abstract

The evolutionary origin of periodical mass‐flowering plants (shortly periodical plants), exhibiting periodical mass flowering and death immediately after flowering, has not been demonstrated. Within the genus Strobilanthes (Acanthaceae), which includes more than 50 periodical species, Strobilanthes flexicaulis on Okinawa Island, Japan, flowers gregariously every 6 years. We investigated the life history of S. flexicaulis in other regions and that of closely related species together with their molecular phylogeny to reveal the evolutionary origin of periodical mass flowering. S. flexicaulis on Taiwan Island was found to be a polycarpic perennial with no mass flowering and, in the Yaeyama Islands, Japan, a monocarpic perennial with no mass flowering. Molecular phylogenetic analyses indicated that a polycarpic perennial was the ancestral state in this whole group including S. flexicaulis and the closely related species. No distinctive genetic differentiation was found in S. flexicaulis among all three life histories (polycarpic perennial, monocarpic perennial, and periodical plant). These results suggest that among S. flexicaulis, the periodical mass flowering on Okinawa Island had evolved from the polycarpic perennial on Taiwan Island via the monocarpic perennial in the Yaeyama Islands. Thus, the evolution of life histories could have taken at the level of local populations within a species.

Keywords: life history, mass flowering, monocarpic perennial, periodicity, polycarpic perennial, Strobilanthes

1. INTRODUCTION

Periodical mass‐flowering plants (called shortly periodical plants), such as bamboos (subfamily Bambusoideae, Poaceae) and Strobilanthes (Acanthaceae), flower and die gregariously and periodically at certain intervals of longer than 2 years (120 years at most) (Janzen, 1976; McClure, 1966). These periodical mass‐flowering plants are referred to as periodical plants because their life cycles are similar to those of periodical cicadas, which exhibit periodical mass emergence at 13‐ or 17‐year intervals in North America (Alexander & Moore, 1962; Simon, 1988). These periodical organisms including periodical plants and cicadas are characterized by the following life history traits: periodicity (reproduction according to a cycle of longer than 2 years), mass emergence and mass flowering (almost all individuals in a population synchronously reproduce), and semelparity and monocarpy (one reproduction event per lifetime).

In plants, the intervals between the two mass‐flowering events are not regular in non‐periodical plants (Sakai et al., 1999; Vander Wall, 2002). Monocarpic perennials are also found in a wide range of families; many of them lack mass flowering (Young & Augspurger, 1991). Other than bamboos and Strobilanthes, monocarpic perennials with synchronized flowering have been reported in several groups such as Cerberiopsis in Apocynaceae (Burd, Read, Sanson, & Jaffré, 2006; Read, Sanson, Burd, & Jaffré, 2008), and Tachigali in Fabaceae (Forget, Kitajima, & Foster, 1999; Kitajima & Augspurger, 1989). If mass flowering occurs periodically (the fixed intervals), these plants should be categorized as periodical plants. However, whether their intervals are periodical or not is unknown.

The periodicity of synchronized flowering is also known in annuals and strict biennials (almost all individuals flower and die in the second year from germination) (Kelly, 1985). Annuals flower synchronously in the same season every year. Most individuals of several strict biennial species flower synchronously every 2 years (Kelly, 1985). Flowering of these annuals and biennials is induced by seasonal changes or individual size (Harper, 1977; Rees, Sheppard, Briese, & Mangel, 1999; Rose, Rees, & Grubb, 2002). In contrast, flowering of periodical plants is induced by time from germination, but not by seasonal changes or individual size (Janzen, 1976). It is indicated by transplantation or propagation of cutting that does not affect timing of flowering in periodical plants (Kakishima, Yoshimura, Murata, & Murata, 2011; Tanimoto & Kobayashi, 1998; Watanabe, Ueda, Manabe, & Akai, 1982). Therefore, periodicity of more than 2 years is unique and found only in periodical plants. Thus, the evolution of periodicity of more than 2 years is a key event in the evolution of periodical plants.

The definition of periodical plants used in this report is as follows: periodicity (more than 2 years fixed year intervals of flowering after germination), mass flowering (almost all individuals in a population synchronously flower) and monocarpy (one flowering event per lifetime). In this definition, monocarpic perennials with either mass flowering or fixed three‐or‐more year periodicity are not considered a periodical plant. We here exclude annuals and strict biennials from periodical plants, because of the lack of yearly counting mechanisms, as explained above.

The evolutionary origins of periodical organisms are still unknown, although several hypotheses have been proposed. In periodical cicadas, the acquisition of periodicity is suggested to have preceded the selection of 13‐ or 17‐year cycles (Ito et al., 2015; Sota et al., 2013; Tanaka, Yoshimura, Simon, Cooley, & Tainaka, 2009; Yoshimura, 1997). However, the evolutionary history of periodical cicadas has not been verified, because non‐periodical, closely related species have not been found. In bamboo, a theoretical study based on phylogenetic inference suggests that the length of mass‐flowering cycles (the interval between two consecutive mass‐flowering events) has been multiplied in several groups, for example, from 15‐year cycles to 30‐, 60‐, 120‐year ones (Veller, Nowak, & Davis, 2015). Although the molecular phylogeny suggests cycle elongation in bamboos, the assumed annual ancestral species is unknown. Not that the information of closely related non‐periodical species has not been enough to verify the ancestral state of these periodical organisms.

To identify the evolutionary pathway from the ancestral state to the periodical mass flowering (emergence), the genus Strobilanthes is a prospective group with more than 50 periodical mass‐flowering species (Daniel, 2006; Janzen, 1976; Wood, 1994). Strobilanthes is distributed in East, Southeast and South Asia and includes approximately 400 species (Hu, Deng, & Wood, 2011). A molecular phylogenetic study indicated that periodical mass flowering has evolved several times independently in Strobilanthes (Moylan, Bennett, Carine, Olmstead, & Scotland, 2004). Here, we focus on Strobilanthes flexicaulis, a subshrub distributed in Japan (Okinawa Island and the Yaeyama Islands) and Taiwan (Taiwan Island) (Seok, Hsieh, & Murata, 2004; Wood & Scotland, 2003; Figures 1a,b and 2a). On Okinawa Island, this species exhibits periodicity by flowering gregariously every 6 years (Kakishima et al., 2011; Figure 1a). Almost all individuals of S. flexicaulis die after flowering and fruiting on Okinawa Island. The mass flowering in 2010 was common in all six surveyed populations on Okinawa Island.

Figure 1.

Figure 1

Mass flowering of Strobilanthes flexicaulis and the morphology of flowers. (a) Mass flowering of S. flexicaulis on Okinawa Island. The flowers of (b) S. flexicaulis on Okinawa Island, (c) Strobilanthes tashiroi on Okinawa Island, (d) Strobilanthes rankanensis on Taiwan Island, and (e) Strobilanthes lanyuensis on Lanyu Island

Figure 2.

Figure 2

Distribution and life histories of Strobilanthes flexicaulis and relatives. (a) Distribution of four Strobilanthes species and the locations of the examined populations. Red, light blue, orange, and yellow lines show distribution of S. tashiroi, S. flexicaulis, S. rankanensis, and S. lanyuensis, respectively. Blue, purple, green, orange, and yellow solid circles show the locations of examined populations of S. flexicaulis on Okinawa Island, S. flexicaulis in the Yaeyama Islands, S. flexicaulis on Taiwan Island, S. rankanensis and S. lanyuensis, respectively. (b) Temporal dynamics of the ratio of flowering individuals calculated from the number of flowering individuals divided by the maximum number of flowering individuals during the surveyed period. OK1, OK2, and OK3 are Okinawa populations of S. flexicaulis. YA1, YA2, and YA3 are Yaeyama populations of S. flexicaulis. TA1, TA2, and TA3 are Taiwan populations of S. flexicaulis. LA is S. lanyuensis. RA is S. rankanensis. N: the number of examined individuals in each population. (c) CVs and survival rates. Blue, purple, and green circles show Okinawa, Yaeyama, and Taiwan populations of S. flexicaulis, respectively. A yellow square shows S. lanyuensis. (d) Consequences of the flowered individuals in the following year. Red, green, and blue show dead, survived with no flowers, and survived with flowers, respectively. The numbers above the bar indicate total sample sizes

Strobilanthes flexicaulis belongs to the Parachampionella group, which includes three other species (S. rankanensis and S. lanyuensis in Taiwan and S. tashiroi in Japan; Figures 1b–d and 2a) and records of one potential species in Sumatra and on Cocos Island (Wood & Scotland, 2003). Strobilanthes tashiroi is a polycarpic perennial (i.e., non‐periodical) herb endemic to the Ryukyu Islands, Japan, including Okinawa Island (Kakishima et al., 2011; Figures 1c and 2a). Strobilanthes rankanensis is a procumbent plant endemic to Taiwan Island (Hu et al., 2011; Figures 1d and 2a). Strobilanthes lanyuensis is morphologically similar to S. flexicaulis and endemic to Lanyu Island, Taiwan (Seok et al., 2004; Figures 1e and 2a).

In this report, we asked two questions: (a) What was the ancestral state of the periodical mass‐flowering S. flexicaulis on Okinawa Island? (b) How did the periodical mass flowering evolve from the ancestral state? We surveyed the overall distribution of the temporal dynamics of the number of flowering individuals for several years and the survival rates after flowering in the Parachampionella group by examining S. flexicaulis in Yaeyama and Taiwan Islands, S. rankanensis, and S. lanyuensis. We then investigated the molecular phylogeny of the Parachampionella group. Based on these data, we discuss the evolutionary pathway of the periodical mass‐flowering S. flexicaulis on Okinawa Island.

2. MATERIALS AND METHODS

2.1. Field observation of life histories

The number of flowering individuals of S. flexicaulis, S. rankanensis, and S. lanyuensis were examined in Japan and Taiwan. The three surveyed populations (OK1, OK2, and OK3) of S. flexicaulis on Okinawa Island were same as in a previous study (Kakishima et al., 2011; Figure 2a; Supporting Information Table S1). We also surveyed the number of flowering individuals of S. flexicaulis in three populations (TA1, TA2, and TA3) in the Yaeyama Islands and three populations (YA1, YA2, and YA3) in Taiwan Island (Figure 2a; Supporting Information Table S1). Field observations of S. rankanensis and S. lanyuensis were performed in one population (RA) on Taiwan Island and one population (LA) on Lanyu Island, respectively (Figure 2a; Supporting Information Table S1). In each population, we first fixed an observation area. The extant of the observation areas was shown in Supporting Information Table S1. Then, we counted all flowering (or fruiting) individuals in the observation area once in the flowering season per year. Even if we found the individuals with flowering buds or fruits but without flowers, these individuals were also treated as the flowering individuals. All flowering individuals were enumerated from 2009 to 2018. The flowering seasons of S. flexicaulis and S. lanyuensis were in winter (from November to the following April). When we observed flowering individuals from November to December, the records were treated as for the following year. For comparisons, the ratio of flowering individuals was calculated as the number of flowering individuals at each site divided by the maximum number during the observation period. The intensity of the mass flowering was measured by the CV (coefficient of variation) between years (Herrera, Jordano, Guitián, & Traveset, 1998; Kelly, 1994; Kelly & Sork, 2002; Silvertown, 1980; Webb & Kelly, 1993). We calculated the CV of Strobilanthes by SD/mean of the number of flowering individuals.

Monocarpic S. flexicaulis on Okinawa Island flowered in winter, bore fruits in spring, and then died in summer (Kakishima et al., 2011). To examine the number of flowering events in their lifetime (monocarpy or polycarpy), we labeled all flowering or fruiting individuals in the observation area of the surveyed populations every winter except the mass‐flowering years (Supporting Information Table S3). In the mass‐flowering years, we arbitrarily chose and labeled representative flowering or fruiting individuals in the observation area of each population on Okinawa Island because too many individuals were flowering (Supporting Information Table S3). The data of OK1–3 from 2009 to 2011 was already published in the previous paper (Kakishima et al., 2011). We checked whether the labeled individuals survived with flowers, survived without flowers or died in the flowering season of the following year (1 year after labeling) to examine whether they are monocarpy or polycarpy. We could not check the reproduction mode of S. rankanensis because the species is a procumbent plant and frequently propagates vegetatively; thus, it is impossible to examine whether the labeled individuals survived or died the year after flowering. Statistical analyses were performed using R for Mac OS X, version 3.4.1 (R Core Team, 2017). We used the generalized linear mixed model (glmer in the R package lme4; Bates, Maechler, Bolker, & Walker, 2015) using a binomial error distribution and logit link function to check the difference in survival rates among species and regions. For multiple comparisons, we used least square means (lsmeans in the R package lsmeans; Lenth, 2016).

2.2. DNA extraction and sequencing

Total genomic DNA was extracted from silica gel‐dried leaf tissue using the method using CTAB (Doyle & Doyle, 1987) with slight modifications after pretreatment with HEPES buffer (pH 8.0) (Setoguchi & Ohba, 1995). The sequences determined in this study were registered in the DNA Data Bank of Japan (DDBJ), which is linked to GenBank, and their accession numbers are provided with the sample information in Supporting Information Table S3.

The PHOTOTROPIN2 (PHOT2) gene was selected as a nuclear DNA (nDNA) marker because PHOT2 has been successfully used to reconstruct the phylogeny of Verbenaceae in Lamiales, including Acanthaceae (Yuan & Olmstead, 2008). Phototropins are blue‐light receptors that control a range of responses that optimize the photosynthetic efficiency of plants (Christie, 2007). The fragments between exon 10 and exon 14 of the PHOT2 gene (five exons and four introns) were initially amplified by polymerase chain reaction (PCR) using the primers 10F and 14R (Yuan & Olmstead, 2008). PCR amplification was carried out using TaKaRa Ex Taq® (TaKaRa Bio, Shiga, Japan) in a total volume of 30 µl. The PCR cycling conditions were an initial step for 2 min at 95°C, followed by 25 cycles of 45 s at 95°C, 45 s at 52°C, and 2.5 min at 72°C, with a final extension for 10 min at 72°C. The PCR products were purified using the GENECLEAN® III Kit (BIO101, CA, USA). Purified DNA fragments were used as templates for the cycle‐sequencing reactions using the BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, CA, USA) with the same primers for PCR: 12F, 12R (Yuan & Olmstead, 2008), exon11F (ATGTAGATGAAGCTGTTCGAG), and intron12R (CATGTCAACAGTAGTTTGAGAG). The primers exon11F and intron12R1 were designed for this study. DNA sequencing was performed with an ABI PRISM® 3130 DNA Sequencer (Applied Biosystems), and the obtained complementary sequences were assembled by Genetyx‐Mac/ATSQ Ver. 5.1 (GENETYX, Tokyo, Japan). When overlapping double peaks were found in the obtained electropherograms, we used the TA‐cloning system (Invitrogen, Carlsbad, CA, USA) for sequencing. At least 16 clones per sample were chosen and sequenced using the same procedure as in the first PCR, followed by direct sequencing. If the nucleotides in the cloned sequences were not detected by direct sequencing, they were considered PCR errors.

We sequenced three chloroplast DNA (cpDNA) regions: trnS‐trnG, trnGtrnR, and matK. The fragments of trnS‐trnG were amplified by PCR using primers trnS (GCU) and trnG (UCC) (Hamilton, 1999). The PCR cycling conditions included an initial step for 2 min at 95°C, followed by 40 cycles of 45 s at 95°C, 45 s at 52°C, and 1 min at 60°C, with a final extension for 10 min at 60°C. Because this region was GC rich, the extension temperature was set lower than general conditions. The PCR products were purified with ExoSAP‐IT (USB, OH, USA) and directly sequenced with the same primers as used for PCR, and primer trnS1 (AATGTAAGGAGTCTGTCTTC) was designed for this study and used as necessary. The sequencing was performed in the same manner as nuclear DNA sequencing. Two other regions (trnGtrnR and matK) were amplified by PCR using primers trnG_1F and trnR_22R for trnGtrnR (Tripp, 2007) and matK‐AF and matK‐8R (Ooi, Endo, Yokoyama, & Murakami, 1995). The PCR cycling conditions were as follows: an initial step for 2 min at 95°C, followed by 40 cycles of 45 s at 95°C, 45 s at 52°C, and 1 min at 72°C, with a final extension for 10 min at 72°C.

2.3. Molecular phylogenetic analyses

Monophyly of the Parachampionella group, including S. flexicaulis, was supported in a previous study (Seok et al., 2004). Four Strobilanthes species from Japan and Taiwan were selected based on the previous study, and S. formosana and S. dimorphotricha were used as outgroup species (24 plant materials in total; Supporting Information Table S3). The sequences were aligned using ClustalW 1.8 (Thompson, Higgins, & Gibson, 1994) and then adjusted manually. The aligned lengths of the combined cpDNA sequences and the PHOT2 sequences were 2,772 and 2,270 bp, respectively. The phylogenetic trees based on cpDNA and nDNA were constructed separately using a Bayesian approach with MrBayes 3.1.2 (Ronquist & Huelsenbeck, 2003) and maximum‐likelihood (ML) phylogenetic analysis using RAxML (Stamatakis, 2014). In the Bayesian phylogenetic analysis, the F81 model for nucleotide substitutions was selected for the tree based on the Bayesian information criterion (BIC) using the program Kakusan4 (Tanabe, 2011). Based on the selected model, we performed two separate runs of the Metropolis‐coupled Markov chain Monte Carlo (MCMCMC) analysis, each with a random starting tree and four chains (one cold and three hot). The MCMCMC was 10 million generations long, and the chain was sampled every 1,000th generation from the cold chain. The first 2,500 sample trees (25% of the total 10,000 sample trees) were discarded as burn‐in after checking that the average standard deviation of the split frequencies (ASDSF) reached a stationary state at <0.01. A 50% majority consensus tree of the output tree file from MrBayes was generated using FigTree ver. 1.3.1 (Rambaut, 2009). The ML phylogenetic analyses were implemented in RAxML 8 (Stamatakis, 2014) with a GTR+G likelihood model for nucleotide substitutions. The ML bootstrap proportions (BPs) and trees were obtained by simultaneously running rapid bootstrapping with 10,000 iterations followed by a search for the most likely tree. In the Bayesian analysis, the 50% majority‐rule consensus tree of all of the post‐burn‐in trees was depicted with Bayesian posterior probabilities (PPs). All the clades in the ML tree were recognized in the Bayesian tree; therefore, the BPs were plotted on the Bayesian trees. The statistically parsimonious networks were constructed using TCS version 1.21 (Clement, Posada, & Crandall, 2000). The incongruence length difference (ILD) test (Farris, Källersjö, Kluge, & Bult, 1994, 1995) was performed to check a significant incongruence between the molecular phylogenetic trees based on cpDNA and nDNA sequences.

3. RESULTS

Three Strobilanthes flexicaulis populations on Okinawa Island exhibited mass flowering in 2016, 6 years after the previous mass flowering in 2010 (Kakishima et al., 2011; Figure 2b; Supporting Information Table S4). In contrast, mass flowering was never observed in S. flexicaulis in the Yaeyama Islands and on Taiwan Island (Figure 2b). In the Yaeyama Islands, flowering was verified in 24 out of the cumulative total of 25 observation‐years for three populations (96%), while on Taiwan island, it was observed in 10 out of the cumulative total of 10 observation‐years for three populations (100%). CVs were high (1.72–2.01) in Okinawa populations exhibiting periodical mass flowering, whereas those in Taiwan populations were low (0.18–0.32) and those in Yaeyama populations were intermediate (0.52–1.01) (Figure 2c; Supporting Information Table S4). These results indicate that the intensity of mass flowering is very high in Okinawa populations.

In Okinawa and Yaeyama populations, most individuals of S. flexicaulis died after flowering and few survived in the next year (survival rates: 1.7%, 7 of 420 individuals in Okinawa populations; 4.4%, 19 of 435 individuals in Yaeyama populations), indicating that they were basically monocarpic (Figure 2c, Supporting Information Table S5). In Okinawa populations, those that flowered in mass‐flowering years all died (0%, 0 of 267 individuals); some of those that flowered in non‐mass‐flowering years survived the next year (4.7%, 7 of 153 individuals). All surviving individuals in both Okinawa and Yaeyama populations flowered and died in the following year. In Taiwan populations, in contrast, 62.9% (158 of 251 individuals) of flowering individuals survived the next year (Figure 2c, Supporting Information Table S5). Among 158 surviving individuals, 82 flowered again and the remaining 76 did not flower in the following year. For comparison of survival rates among “species” (S. flexicaulis on Okinawa Island, S. flexicaulis in the Yaeyama Islands, S. flexicaulis on Taiwan Island, S. tashiroi and S. lanyuensis), we fitted “species” as a fix term, and year and populations as random terms in the generalized linear mixed model. In this analysis, we found a significant difference among species (N = 1,310, χ 2 = 28.237, df = 4, p < 0.001). The survival rate of flowering individuals in Taiwan populations was significantly higher than that in Okinawa and Yaeyama populations (p < 0.001 and p < 0.001, respectively; Figure 2c,d) but was not significantly different from that of S. tashiroi (p = 0.771), indicating that they are polycarpic perennials. For S. rankanensis and S. lanyuensis, flowering individuals were observed every year during the surveyed periods (Figure 2b; Supporting Information Table S4), indicating no mass flowering. In the extremely rare S. lanyuensis, out of 21 individuals, 9 flowered again and 3 survived without flowers the next year (Figure 2d). The survival rate of S. lanyuensis was significantly higher than that of S. flexicaulis in Okinawa and Yaeyama populations (p < 0.001, p < 0.001, respectively) but was not significantly different from that of S. flexicaulis in Taiwan populations and S. tashiroi (p = 0.989, p = 0.992, respectively), indicating a polycarpic perennial. The survival rate of procumbent S. rankanensis cannot be measured because of vegetative propagation, although we confirmed that S. rankanensis was alive at the same place where flowering S. rankanensis had observed in the previous year.

We reconstructed molecular phylogenetic trees within the monophyletic Parachampionella group (Seok et al., 2004) with two outgroup species based on three regions (trnSG, matK, trnGR) of cpDNA and one nDNA gene, PHOT2. The sequences of cpDNA and nDNA were combined because the ILD test (Farris, Källersjö, Kluge, & Bult, 1994, 1995) showed no significant incongruence between the molecular phylogenetic trees based on cpDNA and nDNA sequences (p = 1.000) (Supporting Information Figure S1a,b). A Bayesian tree (Figure 3a) and a ML tree (Supporting Information Figure S1c) based on combined sequences showed no clear incongruence. Both the Bayesian and ML analyses demonstrated that Clade I (S. tashiroi) was a sister to Clade II composed of S. rankanensis, S. lanyuensis, and S. flexicaulis with robust support (posterior probability/bootstrap proportion (PP/BP) = 1.00/99%), although the monophyly of clade II had only a weak support (0.72/99%) (Figure 3a). Within Clade II, both S. rankanensis and S. lanyuensis have species‐specific cpDNA haplotypes and nDNA allele types, indicating species‐specific differentiation. In Taiwan S. flexicaulis, four cpDNA haplotypes, and 13 nDNA allele types were recognized (Figure 3b,c). There was no clear geographical differentiation among S. flexicaulis of the three regions. S. flexicaulis in Okinawa and Yaeyama populations showed no sequence variations with the common cpDNA and nDNA types found in Taiwan populations (Figure 3b,c).

Figure 3.

Figure 3

Bayesian molecular phylogenetic tree and haplotype networks. (a) A Bayesian molecular phylogenetic tree is based on combined sequences (cpDNA and nDNA). Bayesian posterior probabilities and ML bootstrap proportions are shown in each clade. Parsimonious networks are based on (b) cpDNA and (C) nDNA sequences

4. DISCUSSION

We revealed that, among the Parachampionella group, S. flexicaulis on Okinawa Island is a periodical plant, S. flexicaulis in the Yaeyama Islands is a monocarpic perennial, and the remaining populations and species are polycarpic perennials (Figure 2). The ancestral life history of this group is suggested as characteristic of a polycarpic perennial because S. tashiroi (Clade I), which was a sister clade to that of the other species, are polycarpic perennials although statistical supports for Clade II are relatively low (0.72/99%) (Figures 2 and 3). Moreover, in population genetic point of view, it is indicated that Okinawa and Yaeyama populations of S. flexicaulis were derived from the Taiwan populations. This is because we found no genetic variation in both cpDNA and nDNA across S. flexicaulis in Okinawa and Yaeyama, and the cpDNA haplotype or the nDNA allele was shared with Taiwan populations, where we found much higher genetic variation (Figure 3b,c). These observations indicate that the periodical state of S. flexicaulis on Okinawa Island was derived from polycarpic states. Because the Yaeyama Islands are located between Taiwan Island and Okinawa Island (Figure 2a), we could reasonably infer that periodical S. flexicaulis on Okinawa Island evolved from a polycarpic perennial on Taiwan Island via a transient monocarpic perennial in the Yaeyama Islands (Figure 4). Thus, the evolution of periodical S. flexicaulis might have consisted of two steps: (a) the evolution of monocarpy in perennials and (b) the acquisition of periodicity and synchronicity.

Figure 4.

Figure 4

Schematic diagram of evolution of periodical mass flowering in Strobilanthes flexicaulis

The evolutionary acquisition of periodicity appeared in local populations on Okinawa Island of a single species S. flexicaulis. Both the final periodical state on Okinawa Island and the intermediate monocarpic perennial state in the Yaeyama Islands are found together with the ancestral polycarpic perennial state on Taiwan Island in a single species. No clear genetic differentiations in either the cpDNA or nDNA sequences are found among these three regions (Figure 3). The current findings make us hypothesize that both monocarpy and periodicity evolved recently via a change in a few genes. This hypothesis can be examined with comparing phenotypes, gene expression, and genomes among these closely related populations for the identification of the responsible genes (Ellegren et al., 2012).

Our findings, a periodical plant evolved from a polycarpic perennial via a monocarpic perennial, differ from the hypothesis in which the ancestral monocarpic annuals evolved into periodical plants via life cycle multiplication from one year to many years (Veller et al., 2015). The difference between our findings and the life cycle multiplication hypothesis proposed for Bamboos questions whether life cycle multiplication is responsible for the origin of periodicity or only for the elongation of life cycles once short cycle periodicity is established. Life cycle elongation by multiplication of intervals may have occurred after the evolution of periodical plants in Strobilanthes (Janzen, 1976). Different evolutionary mechanisms between Bamboos and Strobilanthes might have happened in the evolution of periodicity and life cycle elongation.

The several factors that might have derived the evolution of periodicity in S. flexicaulis can be considered. The cost of reproduction may play an important role in the evolution between polycarpy and monocarpy (Young & Augspurger, 1991). To verify the cost of reproduction, we need to examine the size of flowering individuals, the number of flowers and fruits per individual and the survival rates over individual lifetime. Two population‐level factors have been proposed to explain mass flowering (masting) in forests: pollination efficiency and predator satiation (Janzen, 1976; Kelly, 1994). These factors might have contributed to the evolution of mass flowering in S. flexicaulis on Okinawa Island (Kakishima et al., 2011). We need to examine further whether these factors are indeed working as selection on Okinawa Island, but not in the Yaeyama Islands and Taiwan Island. Future detailed study may elucidate the causal mechanisms underlying the evolution of periodical plants from polycarpic perennials via monocarpic perennials.

CONFLICT OF INTEREST

None declared.

AUTHOR CONTRIBUTIONS

SK, JM, and JY conceived the study. SK, YL, TYAY, and PL conducted the field works. SK conducted the laboratory works. SK, TI, and YO conducted the analyses. SK, YO, MH, JM, and JY wrote the manuscript. All authors read, revised, and approved the manuscript.

Supporting information

 

ACKNOWLEDGMENTS

We are grateful to K. Nakajima, S. Matsumura, M. Yamada, M. Muramatsu, S. Tsai, G. Song, M. Okazaki and C.F. Hsieh for supporting the field observations. This study was supported by the Asahi Glass Foundation (to SK); the collaborative research program of the National Institute for Basic Biology (NIBB) (to SK and JY); the Japan Advanced Plant Science Network (to SK); the Collaborative Research of Tropical Biosphere Research Center, University of the Ryukyus (to SK); and JSPS KAKENHI Grant Numbers JP20370032 (to JM), JP22255004, JP22370010, JP26257405, and JP15H04420 (to JY), and JP26840126, JP13J03600 and JP17K15182 (to SK). The funders had no role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Kakishima S, Liang Y‐S, Ito T, et al. Evolutionary origin of a periodical mass‐flowering plant. Ecol Evol. 2019;9:4373–4381. 10.1002/ece3.4881

Contributor Information

Satoshi Kakishima, Email: kakishim@gmail.com.

Jin Yoshimura, Email: yoshimura.jin@shizuoka.ac.jp.

DATA ACCESSIBILITY

DNA sequences: DDBJ accessions LC373925–LC373974, LC388312–LC388336, and LC384445–LC384477.

REFERENCES

  1. Alexander, R. D. , & Moore, T. E. (1962). The evolutionary relationships of 17‐year and 13‐year cicadas, and three new species (Homoptera: Cicadidae, Magicicada). University of Michigan Museum of Zoology Miscellaneous Publications, 121, 4373–59. [Google Scholar]
  2. Bates, D. , Maechler, M. , Bolker, B. , & Walker, S. (2015). Fitting linear mixed‐effects models using lme4. Journal of Statistical Software, 67, 4373–48. [Google Scholar]
  3. Burd, M. , Read, J. , Sanson, G. D. , & Jaffré, T. (2006). Age‐size plasticity for reproduction in monocarpic plants. Ecology, 87, 2755–2764. [DOI] [PubMed] [Google Scholar]
  4. Christie, J. M. (2007). Phototropin blue‐light receptors. Annual Review of Plant Biology, 58, 21–45. [DOI] [PubMed] [Google Scholar]
  5. Clement, M. , Posada, D. , & Crandall, C. A. (2000). TCS: A computer program to estimate gene genealogies. Molecular Ecology, 9, 1657–1659. [DOI] [PubMed] [Google Scholar]
  6. Daniel, T. F. (2006). Synchronous flowering and monocarpy suggest plietesial life history for neotropical Stenostephanus chiapensis (Acanthaceae). Proceedings of the California Academy of Sciences, 57, 1011–1018. [Google Scholar]
  7. Doyle, J. J. , & Doyle, J. L. (1987). A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemical Bulletin, 19, 11–15. [Google Scholar]
  8. Ellegren, H. , Smeds, L. , Burri, R. , Olason, P. I. , Backström, N. , Kawakami, T. , … Wolf, J. B. (2012). The genomic landscape of species divergence in Ficedula flycatchers. Nature, 491, 756–760. [DOI] [PubMed] [Google Scholar]
  9. Farris, J. S. , Källersjö, M. , Kluge, A. G. , & Bult, C. (1994). Testing significance of incongruence. Cladistics, 10, 315–319. [Google Scholar]
  10. Farris, J. S. , Källersjö, M. , Kluge, A. G. , & Bult, C. (1995). Constructing a significance test for incongruence. Systematic Biology, 44, 570–572. [Google Scholar]
  11. Forget, P. , Kitajima, K. , & Foster, R. B. (1999). Pre‐ and post‐dispersal seed predation in Tachigali versicolor (Caesalpiniaceae): Effects of timing of fruiting and variation among trees. Journal of Tropical Ecology, 15, 61–81. [Google Scholar]
  12. Hamilton, M. B. (1999). Four primer pairs for the amplification of chloroplast intergenic regions with intraspecific variation. Molecular Ecology, 8, 521–523. [PubMed] [Google Scholar]
  13. Harper, J. L. (1977). Population biology of plants. London, UK: Academic Press. [Google Scholar]
  14. Herrera, C. M. , Jordano, P. , Guitián, J. , & Traveset, A. (1998). Annual variability in seed production by woody plants and the masting concept: Reassessment of principles and relationship to pollination and seed dispersal. American Naturalist, 152, 576–594. [DOI] [PubMed] [Google Scholar]
  15. Hu, J. , Deng, Y. , & Wood, J. R. I. (2011). Strobilanthes In Wu Z. Y., Raven P. H., &Hong D. Y. (Eds.), Flora of China (vol. 19, pp. 381–429). St. Louis, MO: and Beijing, China: MBG Press; and Science Press. [Google Scholar]
  16. Ito, H. , Kakishima, S. , Uehara, T. , Morita, S. , Koyama, T. , Sota, T. , … Yoshimura, J. (2015). Evolution of periodicity in periodical cicadas. Scientific Reports, 5, 14094. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Janzen, D. H. (1976). Why bamboos wait so long to flower. Annual Review of Ecology and Systematics, 7, 347–391. [Google Scholar]
  18. Kakishima, S. , Yoshimura, J. , Murata, H. , & Murata, J. (2011). 6‐year periodicity and variable synchronicity in a mass‐flowering plant. PLoS ONE, 6, e28140. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Kelly, D. (1985). On strict and facultative biennials. Oecologia, 67, 292–294. [DOI] [PubMed] [Google Scholar]
  20. Kelly, D. (1994). The evolutionary ecology of mast seeding. Trends in Ecology & Evolution, 9, 465–470. [DOI] [PubMed] [Google Scholar]
  21. Kelly, D. , & Sork, V. L. (2002). Mast seeding in perennial plants: Why, how, where? Annual Review of Ecology, Evolution, and Systematics, 33, 427–447. [Google Scholar]
  22. Kitajima, K. , & Augspurger, C. K. (1989). Seed and seedling ecology of a monocarpic tropical tree, Tachigalia versicolor . Ecology, 70, 1102–1114. [Google Scholar]
  23. Lenth, R. V. (2016). Least‐squares means: The R Package lsmeans. Journal of Statistical Software, 69, 4373–33. [Google Scholar]
  24. McClure, F. A. (1966). The bamboos. A fresh perspective. Cambridge, MA: Harvard University Press. [Google Scholar]
  25. Moylan, E. C. , Bennett, J. R. , Carine, M. A. , Olmstead, R. G. , & Scotland, R. W. (2004). Phylogenetic relationships among Strobilanthes s.l. (Acanthaceae): Evidence from ITS nrDNA, trnL‐F cpDNA, and morphology. American Journal of Botany, 91, 724–735. [DOI] [PubMed] [Google Scholar]
  26. Ooi, K. , Endo, Y. , Yokoyama, J. , & Murakami, N. (1995). Useful primer designs to amplify DNA fragments of the plastid gene matK from angiosperm plants. Journal of Japanese Botany, 70, 328–331. [Google Scholar]
  27. R Core Team (2017). R: A language and environment for statistical computing. Vienna, Austria: R Foundation for Statistical Computing; Retrieved from https://www.R-project.org/ (accessed 25 March 2018). [Google Scholar]
  28. Rambaut, A. (2009). FigTree v1.3.1. Retrieved from http://tree.bio.ed.ac.uk/software/figtree/ (accessed 25 March 2018).
  29. Read, J. , Sanson, G. D. , Burd, M. , & Jaffré, T. (2008). Mass flowering and parental death in the regeneration of Cerberiopsis candelabra (Apocynaceae), a long‐lived monocarpic tree in New Caledonia. American Journal of Botany, 95, 558–567. [DOI] [PubMed] [Google Scholar]
  30. Rees, M. , Sheppard, A. , Briese, D. , & Mangel, M. (1999). Evolution of size‐dependent flowering in Onopordum illyricum: A quantitative assessment of the role of stochastic selection pressures. The American Naturalist, 154, 628–651. [DOI] [PubMed] [Google Scholar]
  31. Ronquist, F. , & Huelsenbeck, J. P. (2003). MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics, 19, 1572–1574. [DOI] [PubMed] [Google Scholar]
  32. Rose, K. E. , Rees, M. , & Grubb, P. J. (2002). Evolution in the real world: Stochastic variation and the determinants of fitness in Carlina vulgaris . Evolution, 56, 1416–1430. [DOI] [PubMed] [Google Scholar]
  33. Sakai, S. , Momose, K. , Yumoto, T. , Nagamitsu, T. , Nagamasu, H. , Hamid, A. A. , & Nakashizuka, T. (1999). Plant reproductive phenology over four years including an episode of general flowering in a lowland dipterocarp forest, Sarawak, Malaysia. American Journal of Botany, 86, 1414–1436. 10.2307/2656924 [DOI] [PubMed] [Google Scholar]
  34. Seok, D. I. , Hsieh, C. F. , & Murata, J. (2004). A new species of Strobilanthes (Acanthaceae) from Lanyu (Orchid Island), Taiwan, with special reference to the flower structure. Journal of Japanese Botany, 79, 145–154. [Google Scholar]
  35. Setoguchi, H. , & Ohba, H. (1995). Phylogenetic relationships in Crossostylis (Rhizophoraceae) inferred from restriction site variation of chloroplast DNA. Journal of Plant Research, 108, 87–92. [Google Scholar]
  36. Silvertown, J. W. (1980). The evolutionary ecology of mast seeding in trees. Biological Journal of the Linnean Society, 14, 235–250. [Google Scholar]
  37. Simon, C. (1988). Evolution of 13‐ and 17‐year periodical cicadas (Homoptera: Cicadidae: Magicicada). Bulletin of the Entomological Society of America, 34, 163–176. [Google Scholar]
  38. Sota, T. , Yamamoto, S. , Cooley, J. R. , Hill, K. B. , Simon, C. , & Yoshimura, J. (2013). Independent divergence of 13‐ and 17‐y life cycle among three periodical cicada lineages. Proceedings of the National Academy of Sciences of the United States of America, 110, 6919–6924. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Stamatakis, A. (2014). RAxML version 8: A tool for phylogenetic analysis and post‐analysis of large phylogenies. Bioinformatics, 30, 1312–1313. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Tanabe, A. S. (2011). Kakusan4 and Aminosan: Two programs for comparing nonpartitioned, proportional and separate models for combined molecular phylogenetic analyses of multilocus sequence data. Molecular Ecology Resources, 11, 914–921. [DOI] [PubMed] [Google Scholar]
  41. Tanaka, Y. , Yoshimura, J. , Simon, C. , Cooley, J. R. , & Tainaka, K. (2009). The Allee effect in the selection for prime‐numbered cycles in periodical cicadas. Proceedings of the National Academy of Sciences of the United States of America, 106, 8975–8979. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Tanimoto, T. , & Kobayashi, M. (1998). Monocarpic mass flowering of Sasa kurilensis var. jotanii (Bambusoideae) in Mikura‐jima, Izu Islands, Japan. Journal of Japanese Botany, 73, 42–47. [Google Scholar]
  43. Thompson, J. D. , Higgins, D. G. , & Gibson, T. J. (1994). CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position‐specific gap penalties and weight matrix choice. Nucleic Acids Research, 22, 4673–4680. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Tripp, E. A. (2007). Evolutionary relationships within the species‐rich genus Ruellia (Acanthaceae). Systematic Botany, 32, 628–649. [Google Scholar]
  45. Vander Wall, S. B. (2002). Masting in animal‐dispersed pines facilitates seed dispersal. Ecology, 83, 3508–3516. [Google Scholar]
  46. Veller, C. , Nowak, M. A. , & Davis, C. C. (2015). Extended flowering intervals of bamboos evolved by discrete multiplication. Ecology Letters, 18, 653–659. [DOI] [PubMed] [Google Scholar]
  47. Watanabe, M. , Ueda, K. , Manabe, I. , & Akai, T. (1982). Flowering, seeding, germination, and flowering periodicity of Phyllostachys pubescens . The Japanese Forest Society, 64, 107–111. [Google Scholar]
  48. Webb, C. J. , & Kelly, D. (1993). The reproductive biology of the New Zealand flora. Trends in Ecology & Evolution, 8, 442–447. [DOI] [PubMed] [Google Scholar]
  49. Wood, J. R. I. (1994). Notes relating to the flora of Bhutan: XXIX. Acanthaceae, with special reference to Strobilanthes . Edinburgh Journal of Botany, 51, 175–273. [Google Scholar]
  50. Wood, J. R. I. , & Scotland, R. W. (2003). The 2‐lipped species of Strobilanthes (Acanthaceae). Kew Bulletin, 58, 83–129. [Google Scholar]
  51. Yoshimura, J. (1997). The evolutionary origins of periodical cicadas during ice ages. American Naturalist, 149, 112–124. [Google Scholar]
  52. Young, T. P. , & Augspurger, C. K. (1991). Ecology and evolution of long‐lived semelparous plants. Trends in Ecology & Evolution, 6, 285–289. [DOI] [PubMed] [Google Scholar]
  53. Yuan, Y. , & Olmstead, R. G. (2008). Evolution and phylogenetic utility of the PHOT gene duplicates in the Verbena complex (Verbenaceae): Dramatic intron size variation and footprint of ancestral recombination. American Journal of Botany, 95, 1166–1176. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

 

Data Availability Statement

DNA sequences: DDBJ accessions LC373925–LC373974, LC388312–LC388336, and LC384445–LC384477.


Articles from Ecology and Evolution are provided here courtesy of Wiley

RESOURCES