Abstract
Background
This is a case–control study aimed at evaluating clinical as well as molecular risk factors for occurrence of ATT induced hepatitis in Northern Indian population.
Methods
100 patients of tuberculosis were recruited from both Outdoor patient department and wards of Lok Nayak Hospital, New Delhi. 40 out of 100 patients who developed ATT induced hepatitis were taken as test group and 60 out of 100 patients who didn’t develop liver dysfunction on ATT were taken as controls and studied and compared for clinical factors such as age, gender, nutritional status, HBsAg carrier, chronic hepatitis C and HIV infection. Molecular factors i.e. NAT2 acetylator status, GSTT1 and M1 null mutations were also determined in all of the patients in each group and compared.
Results
Mean body weight and serum albumin were significantly lower in the ATT induced hepatitis patients as compared to the control group. No preferential association was observed between age and gender with ATT induced hepatitis. HBsAg carrier (OR-6.5; P = 0.03), HIV infection (OR-5.1; P = 0.01), slow acetylator phenotype (OR-3.85; P = 0.02), GSTM1 null mutation (OR-2.72; P = 0.02) and GSTT1 null mutation (OR-3.12; P = 0.02) were found to be positively co-related to ATT induced hepatitis according to the univariate analysis. HBsAg carrier (OR-23.18; P = 0.01), HIV infection (OR-16.92; P = 0.02), Slow acetylator phenotype (OR-70.90; P = 0.001), GSTM1 null mutation (OR-37.03; P = 0.002) and GSTT1 null mutation (OR-8.19; P = 0.014) were also found to be independently increasing the risk of ATT induced hepatitis using multivariate analysis.
Conclusion
The present study established a positive co-relation between malnutrition, HBsAg carrier, HIV infection, NAT2 slow acetylators, GSTM1 null mutation, GSTT1 null mutation and ATT induced hepatitis.
Abbreviations: ALT, Alanine Aminotransferase; AST, Aspartate Aminotransferase; ATT, Anti-tubercular Therapy; ATD, Anti-tubercular Drugs; HAV, Hepatitis A Virus; HBsAg, Hepatitis B Surface Antigen; HBV, Hepatitis B Virus; HCV, Hepatitis C Virus; HEV, Hepatitis E Virus; HIV, Human Immunodeficiency Virus; GST, Glutathione-S-transferase
Keywords: ATT induced hepatitis, GSTT1, NAT2, pulmonary tuberculosis
Introduction
India has the highest rate of tuberculosis, accounting for one-fifth of the global incidence and antitubercular drugs are the commonest cause of drug-induced liver disease in our country.1,2 The consequences of this clinical side effect are interrupted regimen, longer duration of therapy, drug resistance, inadequate response to treatment, severe hepatitis in a few cases and considerable morbidity to the patients.3 Various risk factors have been proposed for increasing the risk of ATT induced hepatitis.4,5 These include demographic factors4,6, 7, 8, 9 such as increasing age, gender, clinical factors9, 10, 11, 12 such as alcohol intake, malnutrition, hepatitis B, hepatitis C and HIV as well as molecular factors such as NAT2 polymorphism, GST mutations and CYP2E mutations.11, 12, 13, 14, 15 Multiple studies done till now support these conclusions but many studies also produced contradictory results.4,6,11
N-acetylation polymorphism was illustrated with isoniazid 35 years ago. A pair of alleles at a single gene locus controls the N-acetylation and its phenotypic deficiency is transmitted as an autosomal recessive trait. The individual NAT2 phenotypes can be classified as rapid, intermediate or slow acetylators according to their acetylation activity.14,15 It has been reported in various studies that individuals possessing slow acetylator phenotype are poor metabolizers, being at higher risk of developing adverse reaction to drugs mainly due to accumulation of toxic metabolites or low detoxification of drugs and/or their toxic metabolites.13,16, 17, 18
Glutathione (GSH) plays an important protective role as an intracellular free radical scavenger by conjugating with toxic reactive metabolites that are generated from biotransformations of drugs and xenobiotics.19,20 Glutathione S-transferases (GST) catalyzes these conjugation reactions, and they exist in several isoforms with varying tissue-specific expression. Deficiency in GST activity, because of homozygous null mutations at GSTM1 and GSTT1 loci, may modulate susceptibility to drug and xenobiotic induced hepatotoxicity.21,22
The present study aimed at evaluating clinical as well as molecular risk factors for occurrence of ATT induced hepatitis in Northern Indian population.
Materials and Methods
A case–control study was conducted for the assessment of clinical and molecular risk factors for ATT induced hepatotoxicity. 100 patients of Tuberculosis were recruited from both Outdoor patient department and Wards of Lok Nayak Hospital, New Delhi and started on Anti-Tubercular Treatment. 40 out 0f 100 patients who developed ATT Induced Hepatitis were included as the test group while the remaining 60 patients who didn’t develop ATT Induced Hepatitis were included as controls. Both the test and control group was age and sex matched.
The diagnosis of ATT induced hepatitis was established using International consensus criteria for drug induced hepatitis.
These criteria include:
-
•
AST/ALT > than three times the Upper Limit of Normal (ULN) or twice the ULN of bilirubin in the presence of symptoms such as anorexia, nausea, vomiting, right upper abdominal pain and jaundice.
-
•
AST/ALT > than 5 times the (ULN) in the absence of symptoms.
Exclusion criteria:
-
•
Patients presenting with clinically and laboratory confirmed chronic liver disease.
-
•
Patients with higher than two fold the ULN of Liver Function Tests (LFTs) prior to beginning of treatment.
-
•
Patients medicating on potentially hepatotoxic drugs.
-
•
Patients with acute hepatitis (Hepatitis A, B, C, E).
-
•
Patients with history of significant alcohol intake more than 2 drinks per day for males and more than 1 drink per day for females for 5 years.
-
•
HIV positive patients on both ART and ATT were excluded from the study.
-
•
HBsAg carrier and chronic hepatitis C patients with pulmonary Koch’s with normal baseline liver function tests were included in the study.
Biochemical and Pathological Tests
All the patients were subjected to a detailed history. Biochemical and pathological parameters included detailed liver function tests (AST, ALT, alkaline phosphatase, total bilirubin and its fractions), total proteins and fractions and prothrombin time for diagnosis of ATT induced hepatitis.
Serological tests for hepatitis: All the cases and controls were screened for hepatitis virus markers. The tests performed to detect acute infection were: HAV (IgM anti-HAV), HBV (HBsAg and IgM anti-HBc), HCV (anti-HCV) and HEV (IgM anti-HEV).
In order to confirm acute HBV infection in patients who were positive for HBsAg; IgM-HBcAb, IgG-HBcAb, HBeAg and IgGHBeAb were done. Those who tested IgM-HBcAb negative, IgG-HBcAb positive, HBeAg negative and IgG-HBeAb positive with normal Liver function tests were labeled as HBsAg carriers. In those with anti-HCV positive, presence of HCV RNA was detected using PCR to confirm acute HCV infection. All patients with positive markers for acute hepatitis were excluded from the study.
Characterization of NAT2 Genotypes
DNA was extracted from whole blood (2 mL) by the phenol extraction method25 and stored at 4 °C for further processing. Genotyping was performed by generation of 895 bp intronless NAT2 PCR fragment using sets of primers mentioned in Table 1. For identification, NAT2 genotyping was carried out by PCR-RFLP at 3 major polymorphic sites of gene coding for T481C (rs1799929, NAT2*5), G509A (rs1799930, NAT2*6) and G587A (rs1799931, NAT2*7). The alleles obtained after digesting with respective restriction enzymes and its condition are mentioned in Table 2. Table 3 depicts the relationship between NAT2 genotypes and respective phenotypes.
Table 1.
Primers NAT2 and GST Gene.
| Gene | Forward primer | Reverse primer | Product size |
|---|---|---|---|
| NAT2 | ATGGACATTGAAGCATATTTTGAAAGAATT | AAGGGTTTATTTTGTTCCTTATTCTAAAT | 896 bp |
| GSTM1 | GAACTCCCTGAAAAGCTAAAGC | GGGCTCAAATATACGGTGGA | 215 bp |
| GSTT1 | TTCCTTACTGGTCCTCACATCTC | GATCATGGCCAGCACCC | 480 bp |
Table 2.
Restriction Fragment Length Polymorphism (RFLP) to Characterize NAT2 Alleles.
| Restriction enzymes | Allele (S) | Restriction digestion condition | Gel strength (agarose) |
|---|---|---|---|
| Kpn1 | NAT2*5 | 37 °C for 3 h | 2% |
| Taq1 | NAT2*6 | 56 °C for 4 h | 3% |
| BamH1 | NAT2*7 | 37 °C for 3 h | 2% |
Table 3.
Characterization of NAT2 Genotypes.
| Phenotype | Zygosity | Alleles |
|---|---|---|
| RA | Homozygotes for wild type | NAT2*4/*4 |
| IA | Heterozygotes for mutant allele | NAT2*4/*5, *4/*6 and *4/*7 |
| SA | Homozygotes for mutant allele | NAT2*5/*5, *5/*6, *5/*7, *6/*6, *6/*7 and *7/*7 |
Genotype Analysis of GST Gene
Genotyping of GST M1 and GST T1 genes were carried out by multiplex Polymerase Chain Reaction (PCR) protocol using primer sets as described in Table 1. The PCR products were visualized on agarose gel using ethidium bromide staining and the products: 215 bp and 480 bp, depending on the GST genotype were designated as GST M1 and GST T1 respectively.
Statistical Analysis
The data obtained from the study was tabulated and analyzed using SPSS software (v. 20). Quantitative data was expressed as mean ± standard deviation. It was analyzed using Mann Whitney U test and Student's t-test as applicable. The categorical data was expressed as proportions and was analyzed using Chi square test or Fisher’s test as applicable. Results found to be significant with univariate analysis were then subjected to a stepwise multivariate logistic regression analysis model as well.
Results
Most common symptom of ATT induced hepatitis was nausea (77.5%) followed by vomiting (65.0%), anorexia (62.5%) and jaundice (20.0%). The mean duration of onset of symptoms was observed to be 20.48 days (s.d. 12.90) with the earliest onset within 4 days of initiation of ATT. The mean elevation of AST was observed to be 376.88 U/L and that of ALT was 302.53 U/L. Mean rise in Total bilirubin was observed to be 2.41 mg/dl however the mean ALP observed in test population was only 120.78 U/L. The mean age of patients with ATDH was not found to be significantly different from that of control group {37.75 ± 14.05 years vs. 33.17 ± 11.07 years (P = 0.157)}. The ratio of male to female was 1.23 and 1.30 in cases and controls, respectively showing no association between gender and increased risk of ATT induced hepatitis in our population. Malnutrition was found to be an independent risk factor for occurrence of ATT induced hepatitis as depicted by the significant differences in the bodyweight {54.13 ± 10.68 vs. 61.62 ± 8.64 (P = 0.014)} and serum albumin concentration {3.22 ± 0.31 vs. 3.75 ± 0.32 g/dl (P = 0.04)} of the two groups of patients. HBsAg carrier state {OR: 6.5 (95% C.I. 1.1–32.81; P = 0.031)} and HIV infection {OR: 5.12 (95% C.I. 1.2–20.4; P = 0.018)} were found to be positively co-related to ATT induced hepatitis. No association was found between chronic hepatitis C and increased risk of ATDH.
NAT2 Polymorphism
The risk of ATT induced hepatitis was significantly higher in slow acetylators than in rapid/intermediate acetylator (56.25% vs. 25%, P = 0.05). Logistic regression showed that, slow acetylator was a risk factor for anti-TB Drug induced hepatitis having an Odds ratio of 3.85 (95% C.I. 1.68–8.84; P value 0.02). Genotype analysis of test and control group of populations showed that NAT2*5*6 genotype was the most frequent genotype in the hepatitis group followed by *5*7 and *6*7. On the other hand NAT2*4*5 was the most frequent genotype in the control group of patients. Allelic analysis showed that *5 was the most common allele in test group (67.5%) followed by *6 (55.0%), *7 (42.5%) and *4 (35.0%) which is consistent with the increasing order of enzyme activity (NAT2*4> NAT2*7> NAT2*6> NAT2*5)23 (Table 4).
Table 4.
Demographic and Clinical Features of Patients with and without ATT Induced Hepatitis.
| Patients with ATT induced hepatitis (40) | Pulmonary Koch’s patients on ATT without hepatitis (60) | P-Value | |
|---|---|---|---|
| Mean age (years) | 37.75 | 33.17 | 0.157 |
| Male/female | 22/18 | 34/26 | 0.435 |
| Mean body weight (kg) | 54.13 | 61.62 | 0.014 |
| BMI (kg/m2) | 21.49 | 23.55 | 0.282 |
| Mean albumin (g/dl) | 3.22 | 3.75 | 0.04 |
| HBsAg carrier state | 4 | 1 | 0.031 |
| Chronic hepatitis C | 3 | 1 | 0.072 |
| HIV infection | 6 | 2 | 0.018 |
GST Genotypes
The GSTM1 null mutation {OR: 2.72 (C.I. 1.17–6.29; P = 0.02)} and GSTT1 null mutation {OR: 3.12 (C.I. 1.18–8.22; P = 0.02)} were found to be positively co-related to ATT induced hepatitis in our study. The combination of GSTM1 and GSTT1 null mutation was observed in 22.50% of the cases as compared to 1.67% of controls. An odd ratio of 17.12 (95% C.I. 3.33–88.00; P value 0.002) was calculated which suggests a statistically significant increase in risk of ATT induced hepatitis in patients with combined null GSTM1 and GSTT1 mutations (Table 5).
Table 5.
Molecular Risk Factors of ATT Induced Hepatitis.
| NAT2 Phenotypes | Patients with ATT induced hepatitis (40) | Pulmonary Koch’s patients on ATT without hepatitis (60) | P-Value |
|---|---|---|---|
| Rapid acetylators | 1 (2.50%) | 4 (6.67%) | 0.174 |
| Intermediate acetylators | 12 (30.00%) | 35(58.33%) | 0.003 |
| Slow acetylators | 27 (67.50%) | 21 (35.00%) | 0.001 |
| NAT2 genotypes | |||
| *4*4 | 1 (2.50%) | 4 (6.67%) | 0.174 |
| *4*5 | 8 (20.00%) | 22 (36.67%) | 0.037 |
| *4*6 | 3 (7.50%) | 8 (13.33%) | 0.181 |
| *4*7 | 1 (2.50%) | 5 (3.33%) | 0.114 |
| *5*5 | 1 (2.50%) | 2 (3.33%) | 0.405 |
| *5*6 | 9 (22.50%) | 11 (18.33%) | 0.305 |
| *5*7 | 8 (20.00%) | 3 (5.00%) | 0.009 |
| *6*6 | 1 (2.50%) | 1 (1.67%) | 0.385 |
| *6*7 | 8 (20.00%) | 3 (5.00%) | 0.009 |
| *7*7 | 0 (0.00%) | 1 (1.67%) | 0.206 |
| GST mutations | |||
| GSTM1 null | 13 (32.50%) | 8 (13.33%) | 0.011 |
| GSTT1 null | 19 (47.50%) | 15 (25.00%) | 0.010 |
| Both null | 9 (22.50%) | 1 (1.67%) | 0.001 |
Multivariate Analysis
Statistically significant risk factors by univariate analysis, such as acetylator status, GST enzyme mutations, body weight, serum albumin, HBsAg and HIV were further evaluated in a stepwise multivariate logistic regression analysis model. Using multivariate logistic regression, variables found to be positively co-related with increased risk of ATT induced hepatitis have been shown in Table 6.
Table 6.
Multivariate Analysis.
| Variables | Odds ratio | C.I. | P-Value |
|---|---|---|---|
| Weight | 1.15 | 1.05–1.26 | 0.030 |
| Serum albumin | 5.66 | 0.42–76.06 | 0.191 |
| HBsAg | 23.18 | 1.90–282.90 | 0.014 |
| HIV | 16.92 | 1.37–208.86 | 0.027 |
| NAT2 slow acetylator phenotype | 70.90 | 6.19–811.93 | 0.001 |
| GSTM1 null mutation | 37.03 | 3.83–333.33 | 0.002 |
| GSTT1 null mutation | 8.19 | 1.52–43.47 | 0.014 |
C.I.: Confidence interval; HBsAg: Hepatitis B surface antigen; HIV: Human Immunodeficiency Virus.
Discussion
ATT is a major cause of Drug Induced Liver Injury accounting for 58% of cases.23 ATT induced hepatitis was suspected in all Koch’s patients presenting with anorexia, nausea, vomiting, jaundice or fever after initiation of ATT. The clinical presentation was found to be comparable to data from other studies.5,24,25 The mean duration of onset of symptoms was found to be 20.48 days with most patients developing mild hepatitis; severe hepatitis (AST/ALT elevation more than 10 times ULN) was seen in only 2 out of the 40 patients of ATT induced hepatitis. This is in contrast to the findings of Anand et al. (2006) and Devarbhavi et al. (2013) who found that seventeen out of sixty nine patients and sixty nine out two hundred sixty nine patients respectively developed serious complications from ATT-induced hepatitis.7,25
Contrasting results were obtained while comparing demographic data between our study and various previous studies. Several studies suggest that increasing age and female gender are risk factors for ATT induced hepatitis.3,5,13,26 However no statistically significant association was found between age or gender and ATT induced hepatitis in our study. Bose et al. (2011), Singhla et al. (2010) and Anand et al. (2006) also didn’t find significant effect of sex on the incidence of hepatotoxicity.5,7,16 In another study Devarbhavi et al. found no correlation between age and gender with outcomes in ATT induced liver injury.25 It was evident from our study that malnutrition is an independent risk factor for occurrence of ATT induced hepatitis as depicted by the significant differences in the bodyweight and serum albumin concentration of the two groups of patients. However upon using multivariate logistic regression only body weight was found to be an independent risk factor for increased risk of ATDH. On reviewing data from other studies similar results were observed.4,5 Huang et al. (2002) noted that the patients with hepatotoxicity were older and had a lower body mass index compared with those without hepatotoxicity.13 In another study by Pande et al. (1996), incidence of hepatotoxicity was found to be three times higher in malnourished patients.6 Anand et al. (2006) on the other hand observed that malnutrition did not play a significant role as a risk factor as long as drug dosages were correct as per body weight.7 HBsAg carrier state and HIV infection were found to be positively co-related to ATT induced hepatitis using both univariate and multivariate analysis. However, in another study by Devarbhavi et al. HbsAg or HIV status didn’t influence survival.25 In a study from Hong Kong, 16% of patients with TB with hepatitis B surface antigen developed symptomatic hepatitis compared with 4.7% in those without hepatitis B infection.26 HIV infection has been demonstrated to be a risk factor for ATT induced hepatitis in a retrospective trial in the US and by Ungo et al.12,27
NAT2 slow acetylator phenotype differs widely in different parts of the world as well as India. Geographical variation in slow acetylator phenotype has been huge ranging from Caucasians (58%), France (53%), South Africa (41%), Berlin (62%) to Japan (10%), China (20%).28, 29, 30, 31, 32 In India different studies vary in estimation of Slow acetylator phenotype, but mostly it’s said to be high at approximately 60%.33
NAT2 slow acetylator phenotype was found to be the strongest risk factor for ATT induced hepatitis according to the multivariate analysis. Studies by Huang et al. (2002), Ohno et al. (2000) {RR: 28.0 (95% CI: 26.0–30.0, P = 0.04) for slow acetylators} and Bose et al. (2011) support the above hypothesis.13,16,34 In a very recent study from India by Gupta et al. (2013) the risk of anti-TB Drug Induced Hepatitis (DIH) occurrence was significantly higher in slow acetylators than in rapid/intermediate acetylators (31.5% vs. 17.5%, P = 0.02).18 However in one of the first studies on NAT2 polymorphism from India by Roy et al. (2001) NAT2 genes did not differ significantly between patients with ATT induced hepatitis and those without hepatitis.35 In another study done in North Indian population, slow acetylator phenotype didn’t differ significantly between test and control groups. However, genotypic variant NAT2*5/*7 was significantly higher in test group as compared to controls.36 The differences between our results and some of the studies previously conducted could be due to differences in sample size and large ethnic variation due large percentage of migrants residing in the city and differences in selection criteria used for test and controls.
Various studies have drawn different conclusions on the association of GST mutations and ATT induced hepatitis.16,22,35 In an Indian study by Roy et al. (2001), it was found that the frequency of homozygous ‘null’ mutation at the GSTM1 gene was significantly higher among cases (n = 17, 52%) than controls (n = 8, 24%) (P < 0.05, relative risk 2.13, 95% CI: 1.25–3.10).35 However, frequency of mutations at GSTT1 was not found to differ between cases and controls. On the contrary recently published data by Chatterjee et al. (2010) suggests that there was no significant association of DIH with the anti-TB therapy and GSTM1 homozygous deletion.37 Leiro et al. (2008) was amongst the first ones to suggest that the null mutation at GSTT1 locus could be a potential risk factor for ATDH.21 Our study on the other hand demonstrated a positive co-relation between both GSTM1 and T1 null mutation and ATT induced hepatitis with the risk being magnified to multiple folds in cases of simultaneous null mutations of both the alleles.
To conclude the present study could establish a positive co-relation between malnutrition, HBsAg carrier, HIV infection, NAT2 slow acetylators, GSTM1 null mutation, GSTT1 null mutation and ATT induced hepatitis. Given the high incidence of tuberculosis in our population the incidence of ATT induced hepatitis is also high.2 Thus it will be prudent on the part of the clinicians to look for the above risk factors while treating Koch’s patients with Anti-tubercular therapy.
Contribution of Authors
-
1
Dr. Premashis Kar: concept and design of study, acquisition and analysis of data, drafting of manuscript and revising it critically for important intellectual content, final approval of manuscript.
-
2
Rahul Karna: analysis of data, drafting of manuscript and revising it critically for important intellectual content, final approval of manuscript.
-
3
Rajesh Ruttala: analysis of data, drafting of manuscript, final approval of manuscript.
-
4
Dr Shilpa Arora: concept and design of the study, acquisition of data and analysis and interpretation of data, drafting of manuscript, final approval of the manuscript.
-
5
Dr. Anita Chakravarty: concept and design of study, acquisition of data, drafting of manuscript, final approval of manuscript.
-
6
Dr Suresh Kumar: concept and design of study, acquisition and analysis of data, drafting of manuscript, final approval of manuscript.
Compliance with Ethical Standards
Ethical Approval: “All procedures performed in studies involving human participants were in accordance with the ethical standards of the institutional and/or national research committee and with the 1964 Helsinki declaration and its later amendments or comparable ethical standards.”
Informed Consent: “Informed consent was obtained from all individual participants included in the study.”
Conflicts of Interest
The authors have none to declare.
References
- 1.Sandhu G.K. Tuberculosis: current situation, challenges and overview of its control programs in India. J Glob Infect Dis. 2011;3:143–150. doi: 10.4103/0974-777X.81691. https://doi.org/10.4103/0974-777X.81691. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Yee D., Valiquette C., Pelletier M., Parisien I., Rocher I., Menzies D. Incidence of serious side effects from first-line antituberculosis drugs among patients treated for active tuberculosis. Am J Respir Crit Care Med. 2003;167(June (11)):1472–1477. doi: 10.1164/rccm.200206-626OC. [DOI] [PubMed] [Google Scholar]
- 3.Sharma S.K. Antituberculosis drugs and hepatotoxicity. Infect Genet Evol. 2004;4:167–170. doi: 10.1016/j.meegid.2003.01.001. https://doi.org/10.1016/j.meegid.2003.01.001. [DOI] [PubMed] [Google Scholar]
- 4.Sharma S.K., Balamurugan A., Saha P.K., Pandey R.M., Mehra N.K. Evaluation of clinical and immunogenetic risk factors for the development of hepatotoxicity during antituberculosis treatment. Am J Respir Crit Care Med. 2002;166(October (7)):916–919. doi: 10.1164/rccm.2108091. [DOI] [PubMed] [Google Scholar]
- 5.Singla R., Sharma S.K., Mohan A. Evaluation of risk factors for antituberculosis treatment induced hepatotoxicity. Indian J Med Res. 2010;132(July):81–86. [PubMed] [Google Scholar]
- 6.Pande J.N., Singh S.P., Khilnani G.C., Khilnani S., Tandon R.K. Risk factors for hepatotoxicity from antituberculosis drugs: a case–control study. Thorax. 1996;51(February(2)):132–136. doi: 10.1136/thx.51.2.132. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Anand A., Seth A., Paul M., Puri P. Risk factors of hepatotoxicity during anti-tuberculosis treatment. Med J Armed Forces India. 2006;62(January(1)):45–49. doi: 10.1016/S0377-1237(06)80155-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Shakya R., Rao B.S., Shrestha B. Incidence of hepatotoxicity due to antitubercular medicines and assessment of risk factors. Ann Pharmacother. 2004;38(June(6)):1074–1079. doi: 10.1345/aph.1D525. [DOI] [PubMed] [Google Scholar]
- 9.Krishnaswamy K., Prasad C.E., Murthy K.J. Hepatic dysfunction in undernourished patients receiving isoniazid and rifampicin. Trop Geogr Med. 1991;43(April(1–2)):156–160. [PubMed] [Google Scholar]
- 10.Wu J.C., Lee S.D., Yeh P.F. Isoniazid-rifampin-induced hepatitis in hepatitis B carriers. Gastroenterology. 1990;98(February(2)):502–504. doi: 10.1016/0016-5085(90)90846-s. [DOI] [PubMed] [Google Scholar]
- 11.McGlynn K.A., Lustbader E.D., Sharrar R.G., Murphy E.C., London W.T. Isoniazid prophylaxis in hepatitis B carriers. Am Rev Respir Dis. 1986;134(October(4)):666–668. doi: 10.1164/arrd.1986.134.4.666. [DOI] [PubMed] [Google Scholar]
- 12.Ungo J.R., Jones D., Ashkin D. Antituberculosis drug-induced hepatotoxicity. The role of hepatitis C virus and the human immunodeficiency virus. Am J Respir Crit Care Med. 1998;157(June(6 Pt 1)):1871–1876. doi: 10.1164/ajrccm.157.6.9711039. [DOI] [PubMed] [Google Scholar]
- 13.Huang Y.-S., Chern H.-D., Su W.-J. Polymorphism of the N-acetyltransferase 2 gene as a susceptibility risk factor for antituberculosis drug-induced hepatitis. Hepatol Baltim Md. 2002;35(April(4)):883–889. doi: 10.1053/jhep.2002.32102. [DOI] [PubMed] [Google Scholar]
- 14.Lin H.J., Han C.Y., Lin B.K., Hardy S. Ethnic distribution of slow acetylator mutations in the polymorphic N-acetyltransferase (NAT2) gene. Pharmacogenetics. 1994;4(June(3)):125–134. doi: 10.1097/00008571-199406000-00003. [DOI] [PubMed] [Google Scholar]
- 15.Butcher N.J., Boukouvala S., Sim E., Minchin R.F. Pharmacogenetics of the arylamine N-acetyltransferases. Pharmacogenomics J. 2002;2(1):30–42. doi: 10.1038/sj.tpj.6500053. [DOI] [PubMed] [Google Scholar]
- 16.Bose P.D., Sarma M.P., Medhi S., Das B.C., Husain S.A., Kar P. Role of polymorphic N-acetyl transferase2 and cytochrome P4502E1 gene in antituberculosis treatment-induced hepatitis. J Gastroenterol Hepatol. 2011;26(February(2)):312–318. doi: 10.1111/j.1440-1746.2010.06355.x. [DOI] [PubMed] [Google Scholar]
- 17.Lee S.-W., Chung L.S.-C., Huang H.-H., Chuang T.-Y., Liou Y.-H., Wu L.S.-H. NAT2 and CYP2E1 polymorphisms and susceptibility to first-line anti-tuberculosis drug-induced hepatitis. Int J Tuberc Lung Dis. 2010;14:622–626. [PubMed] [Google Scholar]
- 18.Gupta V.H., Amarapurkar D.N., Singh M. Association of N-acetyltransferase 2 and cytochrome P450 2E1 gene polymorphisms with antituberculosis drug-induced hepatotoxicity in Western India. J Gastroenterol Hepatol. 2013;28(August(8)):1368–1374. doi: 10.1111/jgh.12194. [DOI] [PubMed] [Google Scholar]
- 19.Whalen R., Boyer T.D. Human glutathione S-transferases. Semin Liver Dis. 1998;18(4):345–358. doi: 10.1055/s-2007-1007169. [DOI] [PubMed] [Google Scholar]
- 20.Hussey A.J., Kerr L.A., Cronshaw A.D., Harrison D.J., Hayes J.D. Variation in the expression of Mu-class glutathione S-transferase isoenzymes from human skeletal muscle. Evidence for the existence of heterodimers. Biochem J. 1991;273(January(Pt 2)):323–332. doi: 10.1042/bj2730323. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Leiro V., Fernández-Villar A., Valverde D. Influence of glutathione S-transferase M1 and T1 homozygous null mutations on the risk of antituberculosis drug-induced hepatotoxicity in a Caucasian population. Liver Int. 2008;28(July(6)):835–839. doi: 10.1111/j.1478-3231.2008.01700.x. [DOI] [PubMed] [Google Scholar]
- 22.Huang Y.-S., Su W.-J., Huang Y.-H. Genetic polymorphisms of manganese superoxide dismutase, NAD(P)H:quinone oxidoreductase, glutathione S-transferase M1 and T1, and the susceptibility to drug-induced liver injury. J Hepatol. 2007;47(July(1)):128–134. doi: 10.1016/j.jhep.2007.02.009. [DOI] [PubMed] [Google Scholar]
- 23.Devarbhavi H., Dierkhising R., Kremers W.K., Sandeep M.S., Karanth D., Adarsh C.K. Single-center experience with drug-induced liver injury from India: causes, outcome, prognosis, and predictors of mortality. Am J Gastroenterol. 2010;105(November(11)):2396–2404. doi: 10.1038/ajg.2010.287. [DOI] [PubMed] [Google Scholar]
- 24.Hein D.W., Doll M.A., Fretland A.J. Molecular genetics and epidemiology of the NAT1 and NAT2 acetylation polymorphisms. Cancer Epidemiol Prev Biomark. 2000;9(January(1)):29–42. [PubMed] [Google Scholar]
- 25.Devarbhavi H., Singh R., Patil M., Sheth K., Adarsh C.K., Balaraju G. Outcome and determinants of mortality in 269 patients with combination anti-tuberculosis drug-induced liver injury. J Gastroenterol Hepatol. 2013;28(January(1)):161–167. doi: 10.1111/j.1440-1746.2012.07279.x. [DOI] [PubMed] [Google Scholar]
- 26.Wong W.M., Wu P.C., Yuen M.F. Antituberculosis drug-related liver dysfunction in chronic hepatitis B infection. Hepatol Baltim Md. 2000;31(January(1)):201–206. doi: 10.1002/hep.510310129. [DOI] [PubMed] [Google Scholar]
- 27.Dworkin M.S., Adams M.R., Cohn D.L. Factors that complicate the treatment of tuberculosis in HIV-infected patients. J Acquir Immune Defic Syndr. 1999;39(August(4)):464–470. doi: 10.1097/01.qai.0000152400.36723.85. [DOI] [PubMed] [Google Scholar]
- 28.Zhao B., Seow A., Lee E.J., Lee H.P. Correlation between acetylation phenotype and genotype in Chinese women. Eur J Clin Pharmacol. 2000;56(December(9–10)):689–692. doi: 10.1007/s002280000203. [DOI] [PubMed] [Google Scholar]
- 29.Hildebrand M., Seifert W. Determination of acetylator phenotype in Caucasians with caffeine. Eur J Clin Pharmacol. 1989;37(September(5)):525–526. doi: 10.1007/BF00558136. [DOI] [PubMed] [Google Scholar]
- 30.Gross M., Kruisselbrink T., Anderson K. Distribution and concordance of N-acetyltransferase genotype and phenotype in an American population. Cancer Epidemiol Prev Biomark. 1999;8(August(8)):683–692. [PubMed] [Google Scholar]
- 31.Bach P.H., Higgins-Opitz S.B., Bima B., Leary W.P. Isoniazid acetylator status of Black South African tuberculosis patients. South Afr Med J Suid-Afr Tydskr Vir Geneeskd. 1976;50(29):1132–1134. [PubMed] [Google Scholar]
- 32.Kita T., Tanigawara Y., Chikazawa S. N-Acetyltransferase2 genotype correlated with isoniazid acetylation in Japanese tuberculous patients. Biol Pharm Bull. 2001;24(May(5)):544–549. doi: 10.1248/bpb.24.544. [DOI] [PubMed] [Google Scholar]
- 33.Singh N., Dubey S., Chinnaraj S., Golani A., Maitra A. Study of NAT2 gene polymorphisms in an indian population. Mol Diagn Ther. 2009;13(March(1)):49–58. doi: 10.1007/BF03256314. [DOI] [PubMed] [Google Scholar]
- 34.Ohno M., Yamaguchi I., Yamamoto I. Slow N-acetyltransferase 2 genotype affects the incidence of isoniazid and rifampicin-induced hepatotoxicity. Int J Tuberc Lung Dis Off J Int Union Tuberc Lung Dis. 2000;4(March(3)):256–261. [PubMed] [Google Scholar]
- 35.Roy B., Chowdhury A., Kundu S. Increased risk of antituberculosis drug-induced hepatotoxicity in individuals with glutathione S-transferase M1 “null” mutation. J Gastroenterol Hepatol. 2001;16(September(9)):1033–1037. doi: 10.1046/j.1440-1746.2001.02585.x. [DOI] [PubMed] [Google Scholar]
- 36.Sharma S.K., Jha B.K., Sharma A. Genetic polymorphisms of N-acetyltransferase 2 & susceptibility to antituberculosis drug-induced hepatotoxicity. Indian J Med Res. 2016;144(December(6)):924–928. doi: 10.4103/ijmr.IJMR_684_14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Chatterjee S., Lyle N., Mandal A., Kundu S. GSTT1 and GSTM1 gene deletions are not associated with hepatotoxicity caused by antitubercular drugs. J Clin Pharm Ther. 2010;35(August(4)):465–470. doi: 10.1111/j.1365-2710.2009.01101.x. [DOI] [PubMed] [Google Scholar]