Skip to main content
Data in Brief logoLink to Data in Brief
. 2019 Mar 26;24:103830. doi: 10.1016/j.dib.2019.103830

Structural characteristics of a mitochondrial control region from Myotis bat (Vespertilionidae) mitogenomes based on sequence datasets

Md M Rahman a,b, Kwang B Yoon c, Yung C Park b,
PMCID: PMC6477160  PMID: 31032389

Abstract

The datasets included sequences of a control region from Myotis bat mitogenomes. The control region (1706–2005 bp) of the Myotis mitogenomes was divided into three domains similar to that of other mammals, which included the common conserved blocks (ETAS domain, Central domain, and CSB domain). Several long tandem repeat sequences were present between the upstream of control regions and ETAS1. The size, base composition, and copy number of the long tandem repeat sequences differed between the Myotis species. Short tandem repeat sequences were also found between CSB1 and CSB2 in the CSB domain.

Keywords: Myotis, Control region, Tandem repeat sequence, CSB, ETAS


Specification table

Subject area Biology
More specific subject area Evolutionary Biology
Type of data Table, figure, and word file
How data was acquired Downloaded from NCBI GenBank
Data format Analyzed DNA sequence
Experimental factors Alignment of Myotis control region with Clustal W implemented in Geneious Pro 5.5.9, Tandem Repeats Finder program [1]
Experimental features Features of domains and repeated sequences of the mitochondrial control region of the genus Myotis bats
Data source location Myotis formosus[2] and M. macrodactylus[3] samples were collected in South Korea, M. muricola[4] in Malaysia, and M. davidii[5] and M. brandtii[6] in China
Data accessibility M. muricola:https://www.ncbi.nlm.nih.gov/nuccore/NC_029422.1?from=15460&to=17224&report=fasta
M. davidii:https://www.ncbi.nlm.nih.gov/nuccore/NC_025568.1?from=15461&to=17464&report=fasta
M. brandii:https://www.ncbi.nlm.nih.gov/nuccore/NC_025308.1?from=15451&to=17400&report=fasta
M. formosus:https://www.ncbi.nlm.nih.gov/nuccore/HQ184048.1?from=15454&to=17159&report=fasta
M. macrodactylus:https://www.ncbi.nlm.nih.gov/nuccore/KF440685.1?from=15462&to=17466&report=fasta
Related research article F. Liu, Y. Song, S.Yan, J. Luo, F. Jiang, Structure and sequence variation of the mitochondrial DNA control region in Myotis macrodactylus, Chin. J. Zoo. 44 (2009) 19–27.
Value of the data
  • These data will provide fundamental information to future molecular evolutionary studies of Myotis bats.

  • The data will contribute to understanding rapid evolution in control regions of mammalian mitogenomes.

  • The characteristics of the primary sequence of the control region will provide valuable information on population genetics, phylogeny, and phylogeography, which would be helpful in decision-making in bat ecological control and management programs.

1. Data

The mitochondrial control region (CR), which is the most rapidly evolving region of the mitochondrial DNA, is one of the most commonly used molecular markers in population genetics and phylogenetic studies. We reported the structural characteristics of the CR from the genus Myotis, such as tandem repeat sequences and sequence composition, by analyzing the sequences extracted from five whole genomes. These characteristics may be responsible for the fast evolution of CR [2], [3], [4], [5], [6]. The datasets of CR sequences showed three common domains: extended terminal associated sequences (ETAS), central domain (CD), and conserved sequence block (CSB) (Fig. 1). Several copies of long tandem repeat sequences were located between the CR upstream and ETAS1 with the final copy positioned on ETAS1 (Fig. 1). Several short tandem repeat sequences were located between CSB1 and CSB2 (Fig. 2). The conserved sequence motifs (GYRCAT) were present in both regions of ETAS1 and ETAS2 within the ETAS domain. Highly conserved sequences were also found in the five regions of F to B boxes in the CD, and the three regions of CSB1 to CSB3 in the CSB domain (Fig. 2).

Fig. 1.

Fig. 1

Schematic diagram of the mitochondrial control region (CR) of the genus Myotis. The CR consists of three domains (ETAS, CD, and CSB). Highly conserved blocks were present in ETAS1-2, F—B, and CSB1-3 of the three domains. Long tandem repeats were present between CR upstream and ETAS1 and short tandem repeats were present between CSB1 and CSB2. Each copy of long and short repeat was marked in the figure.

Fig. 2.

Fig. 2

Dataset of the aligned CR sequences of Myotis bats. The datasets include only one copy of the tandem repeat sequences, which were underlined and indicated as long and short repeat sequences. The shaded areas indicate highly conserved sequences of ETAS1-2 blocks within ETAS, F-B blocks within the CD, and CSB1-3 blocks within CSB. The putative point of arrest of replication is indicated as (<STOP>). Regions of two GYRCAT (Y Created by potrace 1.16, written by Peter Selinger 2001-2019 C or T, R = A or G) motifs are indicated as boxes.

2. Experimental design, materials, and methods

2.1. Sequence data collection

Whole mitogenome sequences of five species of the genus Myotis (M. muricola, M. brandtii, M. formosus, M. macrodactylus, and M. davidii) have been previously reported [2], [3], [4], [5], [6]. We extracted the CR sequences of these five mitogenomes from GenBank (Table 1, Table 2).

Table 1.

Tandem repeat sequences in mitochondrial control region of Myotis bats.

Species (Accession no.) Long repeat sequence
Short repeat sequence
References for whole mitogenome sequences
Motif sequence Length of a repeat sequence (bp) Copy number Total length of long repeat sequence region (bp) Motif sequence Copy number Total length of short repeat sequence region (bp)
M. muricola (KT213444) CCACATGAATATTAAGCAAGTACTTTAACAACATTAATATTACATAATACATTATATGTATAATTGTACATTAACTTATTTA 82 5.3 433 CGCATA 58.2 349 [4]
M. davidii (KM233172) TTAATATTACATTAGACATTACATGTATAATTGTACATTAAACTATCAACCACATGAATATTAAACAAGTACATACTAACA 81 9.1 741 CATACG 68.8 413 [5]
M. brandtii (KM199849) ATATATATATTAACATTACATAACACATTCTATGTATAATCGTACATTAAATTATCTTCCACATGAATATTAAGCATGTAC 81 9.3 757 CATACG 60.8 365 [6]
M. formosus (HQ184048) ATTAATATTACATAATACATTGTATGTATAATCGTACATTAAATTATTTCCCACATTAATATAAGCAAGTACATAGTTAT 80 5.3 420 ACGCAT 53.8 323 [2]
M. macrodactylus (KF440685) AATTGTACATTAAATTATTTTCCACATGAATATTAAACAAGTACATACTAACATTAATATTACATAATACATTATATGTAT 81 8.9 721 CATACG 60.5 363 [3]

Table 2.

Size (bp) of three domains in mitochondrial control region of five Myotis bats including each of one copy of long and short repeat sequences.

Species ETAS CD CSB Total size
M. muricola 317 392 388 1097
M. davidii 289 400 261 950
M. brandtii 293 392 263 948
M. formosus 313 395 365 1073
M. macrodactylus 368 393 323 1084
Mean ± SD 316 ± 31.5 394.4 ± 3.4 320 ± 57.9 1030.4 ± 74.8

2.2. Processing and analysis of mitochondrial control region sequences of Myotis bats

2.2.1. Sequence and primary structure of the mitochondrial control region

The CR sequences from Myotis bats were aligned using Clustal W implemented in Geneious Pro 5.5.9 (Auckland, New Zealand) and edited with BioEdit 7.02 (Tom Hall, USA). The CR sequences were annotated and characterized using other mammalian CR sequences [7], [8], [9], [10], [11], [12] as references. The size of the CR sequences ranged from 1706 (M. formosus) to 2005 bp (M. mcrodactylus) in length. The CR sequences were subdivided into three main domains: ETAS, CD, and CSB (Fig. 1).

2.2.2. Detection and analysis of tandem repeat sequences

The tandem repeat sequences in the CR region were investigated using Tandem Repeats Finder program [1], and we discovered the motif of the tandem repeat sequences, length of repeats, and copy number. Two type of tandem repeat sequences were found in the CR. Tandem repeats with long sequence motifs were present between CR upstream and ETAS-1 in the ETAS domain, and tandem repeats with short sequence motifs were present between CSB1 and CSB-2 (Fig. 1 and Table 2). The size of the long repeat sequence ranged from 80 bp in M. formosus to 82 bp in M. muricola and the copy number ranged from 5.3 copies in M. muricola and M. formosus to 9.3 copies in M. brandtii. The size of the short repeat sequence was 6 bp in all CRs, and the copy number ranged from 53.8 copies in M. formosus to 68.8 copies in M. davidii (Table 1). Excluding these tandem repeat regions, except for each copy of the long and short repeat motifs, the size of the CR ranged from 948 bp in M. brandtii to 1097 bp in M. muricola (Table 2).

2.2.3. Detection and analysis of the conserved region

We discovered sequence-conserved regions through the mitochondrial CRs based on comparative analysis of the datasets. The conserved sequences identified within the domains were in ETAS1-2, F—B boxes, and CSB1-3 (Fig. 2). ETAS1 was more conserved than ETAS2, suggesting that the former might be functionally more important in mtDNA replication than ETAS2 [7], [8], [13], [14]. The conserved sequence motif ‘GYRCAT’ was present in two locations within ETAS: one of them within ETAS1 and the other within ETAS2 (Fig. 2). The putative point of arrest of D-loop synthesis, ‘ACCCC’, was situated within ETAS2, next to the 3′ end of GYRCAT (Fig. 2). Similarly, putative points of arrest of D-loop synthesis were proposed to be ACCCC in rhinolophid bats [10] and ACCCC, GCCCC, or TCCCC in leaf-nosed bats [11].

Acknowledgements

This study was supported by Basic Science Research Program through the National Research Foundation of Korea [NRF-2015R1D1A1A01061097] funded by the Ministry of Education and 2015 Research Grant from Kangwon National University [No. 520150254].

Footnotes

Transparency document associated with this article can be found in the online version at https://doi.org/10.1016/j.dib.2019.103830.

Transparency document

The following is the transparency document related to this article:

Multimedia component 1
mmc1.doc (31.5KB, doc)

References

  • 1.Benson G. Tandem repeats finder: a program to analyze DNA sequences. Nucleic Acids Res. 1999;27:573–580. doi: 10.1093/nar/27.2.573. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Yoon K.B., Park Y.C. Complete mitochondrial genome and codon usage of the Nepalese whiskered bat Myotis muricola (Vespertilionidae) Genet. Mol. Res. 2015;14:14637–14645. doi: 10.4238/2015.November.18.27. [DOI] [PubMed] [Google Scholar]
  • 3.Wang S.Q., Li Y.J., Yin A.G., Zhang W., Jiang J.J., Wang W.L., Hu M. The complete mitochondrial genome of David's myotis, Myotis davidii (Myotis, Vespertilionidae) DNA Mapp. Seq. Anal. 2016;27:1587–1588. doi: 10.3109/19401736.2014.958681. [DOI] [PubMed] [Google Scholar]
  • 4.Jiang J., Wang S., Li Y., Zhang W., Yin A., Hu M. The complete mitochondrial genome of insect-eating brandt's bat, Myotis brandtii (Myotis, Vespertilionidae) DNA Mapp. Seq. Anal. 2014;27:1403–1404. doi: 10.3109/19401736.2014.947601. [DOI] [PubMed] [Google Scholar]
  • 5.Nam T.W., Kim H.R., Cho J.Y., Park Y.C. Complete mitochondrial genome of a large-footed bat, Myotis macrodactylus (Vespertilionidae) Mitochondrial DNA. 2015;26:661–662. doi: 10.3109/19401736.2013.840596. [DOI] [PubMed] [Google Scholar]
  • 6.Kim Y.M., Choi E.H., Kim S.K., Jang K.H., Ryu S.H., Hwang U.W. Complete mitochondrial genome of the hodgson's bat Myotis formosus (mammalia, chiroptera, vespertilionidae) Mitochondrial DNA. 2011;22:71–73. doi: 10.3109/19401736.2011.624598. [DOI] [PubMed] [Google Scholar]
  • 7.Larizza A., Pesole G., Reyes A., Sbisa` E., Saccone C. Lineage specificity of the evolutionary dynamics of the mtDNA D- loop region in rodents. J. Mol. Evol. 2002;54:145–155. doi: 10.1007/s00239-001-0063-4. [DOI] [PubMed] [Google Scholar]
  • 8.Reyes A., Nevo E., Saccone C. DNA sequence variation in the mitochondrial control region of subterranean mole rats, Spalax ehrenbergi superspecies. Mol. Biol. Evol. 2003;20:622–632. doi: 10.1093/molbev/msg061. [DOI] [PubMed] [Google Scholar]
  • 9.Liu F., Song Y., Yan S., Luo J., Jiang F. Structure and sequence variation of the mitochondrial DNA control region in Myotis macrodactylus. Chin. J. Zool. 2009;44:19–27. [Google Scholar]
  • 10.Sun K., Feng J., Jin L., Liu Y., Shi L., Jiang T. Structure, DNA sequence variation and phylogenetic implications of the mitochondrial control region in horseshoe bats. Mamm. Biol. 2009;74:130–144. [Google Scholar]
  • 11.Sun K., Luo L., Zhang Z., Feng J. Molecular characteristics and evolution of the mitochondrial control region in three genera (Hipposideridae: hipposideros, Aselliscus, and Coelops) of leaf-nosed bats. Mitochondrial DNA. 2013;24:451–461. doi: 10.3109/19401736.2013.766176. [DOI] [PubMed] [Google Scholar]
  • 12.Md- Zain B.M., Abdul-Aziz A., Rahman N.A., Mohd-Yusof N.S., Japning J.R.R., Rosli N., Yaakop S. Sequence Variation Data of the Mitochondrial DNA D-Loop Region of the Captive Malayan Gaur (Bos Gaurus hubbacki) Data in Brief. 2018 doi: 10.1016/j.dib.2018.11.117. in press. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Matson C.W., Baker R.J. DNA sequence variation in the mitochondrial control region of red-backed voles (Clethrionomys) Mol. Biol. Evol. 2001;18:1494–1501. doi: 10.1093/oxfordjournals.molbev.a003935. [DOI] [PubMed] [Google Scholar]
  • 14.Iyengar A., Diniz F.M., Gilbert T., Woodfine T., Knowles J., Maclean N. Structure and evolution of the mitochondrial control region in oryx. Mol. Phylogenet. Evol. 2006;40:305–314. doi: 10.1016/j.ympev.2006.02.015. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Multimedia component 1
mmc1.doc (31.5KB, doc)

Articles from Data in Brief are provided here courtesy of Elsevier

RESOURCES