Skip to main content
NCBI home page
International Journal of Molecular Sciences logoLink to International Journal of Molecular Sciences
. 2019 Mar 29;20(7):1577. doi: 10.3390/ijms20071577

Roles of the GA-mediated SPL Gene Family and miR156 in the Floral Development of Chinese Chestnut (Castanea mollissima)

Guosong Chen 1,†, Jingtong Li 1,†, Yang Liu 1, Qing Zhang 2, Yuerong Gao 1, Kefeng Fang 3, Qingqin Cao 4, Ling Qin 1,*, Yu Xing 1,*
PMCID: PMC6480588  PMID: 30934840

Abstract

Chestnut (Castanea mollissima) is a deciduous tree species with major economic and ecological value that is widely used in the study of floral development in woody plants due its monoecious and out-of-proportion characteristics. Squamosa promoter-binding protein-like (SPL) is a plant-specific transcription factor that plays an important role in floral development. In this study, a total of 18 SPL genes were identified in the chestnut genome, of which 10 SPL genes have complementary regions of CmmiR156. An analysis of the phylogenetic tree of the squamosa promoter-binding protein (SBP) domains of the SPL genes of Arabidopsis thaliana, Populus trichocarpa, and C. mollissima divided these SPL genes into eight groups. The evolutionary relationship between poplar and chestnut in the same group was similar. A structural analysis of the protein-coding regions (CDSs) showed that the domains have the main function of SBP domains and that other domains also play an important role in determining gene function. The expression patterns of CmmiR156 and CmSPLs in different floral organs of chestnut were analyzed by real-time quantitative PCR. Some CmSPLs with similar structural patterns showed similar expression patterns, indicating that the gene structures determine the synergy of the gene functions. The application of gibberellin (GA) and its inhibitor (Paclobutrazol, PP333) to chestnut trees revealed that these exert a significant effect on the number and length of the male and female chestnut flowers. GA treatment significantly increased CmmiR156 expression and thus significantly decreased the expression of its target gene, CmSPL6/CmSPL9/CmSPL16, during floral bud development. This finding indicates that GA might indirectly affect the expression of some of the SPL target genes through miR156. In addition, RNA ligase-mediated rapid amplification of the 5′ cDNA ends (RLM-RACE) experiments revealed that CmmiR156 cleaves CmSPL9 and CmSPL16 at the 10th and 12th bases of the complementary region. These results laid an important foundation for further study of the biological function of CmSPLs in the floral development of C. mollissima.

Keywords: Castanea mollissima, miR156, SPL gene family, GA, floral development, expression patterns

1. Introduction

Chinese chestnut (Castanea mollissima BL.) is rich in nutrients, resistant to disease, and barren, and these features make Chinese chestnut an important ecological and economic tree species. As a monoecious plant, the proportion of female and male flowers in Chinese chestnut can reach 1:2400–4000. A large number of male flowers consume too much tree nutrition, which is one of the important reasons for the low yield of chestnut [1,2]. Therefore, exploration of the mechanism of floral development is important for regulating the ratio of female to male flowers, which might provide valuable information for solving the problem of the low chestnut yield. Floral development is mainly influenced by genetic factors and environmental conditions [3], and phytohormones have been reported to play an important role in floral development [4]. For example, in floral regulatory networks, gibberellins (GAs) are critical for the development of reproductive organs, especially for floral sex determination [5,6]. Auxin determines whether the primordium of the flower is formed during the initial process of the organ and the specificity of the flower organ formed during organogenesis [7]. Cytokinins (CKs) contribute to the sex control of Jatropha curcas [8] and have been used for many years in horticultural production practices [9]. Genes related to phytohormone biosynthesis and signaling have been identified and are reportedly involved in floral development in several species [10]. A naturally occurring male inflorescence mutation was found on a branch of a Chinese chestnut tree in the mountains near Beijing, China, with a male inflorescence length reduced from 1/6 to 1/8 of the wild-type male inflorescence on the same tree, and the application of exogenous GA3 partially restored the sck1 phenotype to the wild-type phenotype [2]. Therefore, it is very important to investigate the effect of GA on floral development in chestnut by spraying the whole tree with GA and its biosynthesis antagonist, PP333.

Transcription factors (TFs) precisely coordinate gene expression by activating or inhibiting transcription in response to various endogenous and environmental signals and are usually divided into different families based on the sequences of the DNA-binding domain and other conserved motifs [11]. Plants have thousands of TF families, such as MYB, NAC (NAM, ATAF1/2, and CUC2), auxin response factors (ARFs), Squamosa promoter-binding protein-like (SPL), and bHLH, which play crucial roles in the regulation of the gene networks involved in many important developmental processes and defense responses in plants [12,13,14,15,16]. Among these TF families, the SPL family members are important TFs in plant floral development and have been identified in Arabidopsis [17], Populus trichocarpa [18], Betula luminifera [19], Brassica napus [20], Petunia hybrida [21], and other flowering species. SPLs are plant-specific TFs that contain a highly conserved SBP binding domain of approximately 80 amino acids, which contains two zinc finger structures and a nuclear localization signal [22,23]. Based on the important role of the SPL gene family in plant floral development, ranging from vegetative to reproductive growth [24], male sterility [25], GA synthesis [26], and floral morphogenesis [27], researchers have identified SPL genes in a growing number of species: 16 SPL genes in Arabidopsis [17], 28 SPL genes in P. trichocarpa [18], 21 SPL genes in P. hybrida [21], and 18 SPL genes in B. luminifera [19].

MicroRNAs (miRNAs) are approximately 21–23 nucleotides (nt) long, small single-strand noncoding RNAs which are encoded by endogenous genes. miRNA plays a key role in regulating gene activity at post-transcriptional levels by binding to complementary sites in target genes, causing degradation and/or translational repression of the target mRNAs [28]. miRNA functions broadly to regulate many aspects of plant development. For instance, miR160 or miR167 targets ARFs, which are involved in auxin or defense responses or play roles at many stages of development [14,29]; MYB TFs are antagonized by miR159 in the control of floral development and heat response or in conjunction with miR828 to modulate fiber development [12,30]; and NAC TFs, which are encoded by miR164 target genes, play roles in lateral root development, boundary specification, drought tolerance, or the immune response [13,31,32]. The majority of SPL genes in many species have complementary regions of miR156, and the miR156/SPL mode of action has been shown to play a key regulatory role in many growth and development processes [33,34,35,36]. For instance, either the overexpression of csi-miR156a or the individual knockdown of one of its two target genes, CsSPL3 and CsSPL14, significantly enhances the somatic embryogenesis competence of citrus callus [37]. PvSPL4 is the target gene of the microRNA pvi-miR156 and controls the initiation of aerial axillary buds of switchgrass [38]. miR156 regulates Arabidopsis pollen production, fertility, and elongation of floral organs (including petals, sepals, and wafers) by inhibiting the expression of the target gene SPL2 [27].

The floral development of chestnut shows differences from those of Arabidopsis and P. trichocarpa, which are characterized by monoecism (with unisexual flowers) and large differences between male and female flowers. Therefore, it is important to study the genes related to floral development in chestnut. In this study, to systematically analyze the characteristics of the SPL genes in chestnut, the molecular structures and expression patterns of SPL genes in C. mollissima were compared with those of Arabidopsis and P. trichocarpa, and the relationship between SPL genes among different species and the role of CmSPL genes in expression regulation were examined. In addition, the effects of GA on both male and female flowers of C. mollissima were investigated by treating chestnut trees with GA, and the expression patterns of CmSPL and CmmiR156 during floral bud development and the GA-mediated induction of the expression of these genes were explored.

2. Results

2.1. Effects of GA and Its Inhibitor on the Number of Male and Female Inflorescences

To analyze the effects of GA on floral development, GA and its inhibitor were applied to 18-year-old trees. Because the chestnut female flower undergoes differentiation outside of the bud and floral morphogenesis occurs after germination, GA and PP333 were first sprayed before the floral buds germinated in late March. The first sampling was performed once the buds turned green, and both GA and PP333 spraying and sampling were performed at 1-week intervals until the male inflorescence appeared, at which time sampling was stopped. During this period, a total of four samples, denoted Floral Bud 1 (FB1)–FB4, were obtained, and the floral bud morphology was observed, as shown in Figure 1A. The number and lengths of male and female flowers were investigated at the flowering stage, and the results are shown in Table 1. Treatment with 100 mg/L of GA increased the number of male inflorescences on each branch and significantly reduced the ratio of female flower clusters to male inflorescences, the male inflorescence length, and the mixed inflorescence length. The GA treatment also decreased, albeit not significantly, the number of female flowers. In contrast, treatment with the GA inhibitor PP333 at a concentration of 1000 mg/L significantly increased the number of female flowers and insignificantly increased the mixed inflorescence length.

Figure 1.

Figure 1

Open in a new tab

(A) Internal and external forms of floral buds at four time periods. The external morphology was imaged using an ordinary camera with a scale of 5 mm. The internal morphology was photographed using a stereomicroscope with a scale of 500 m. The Floral Bud 1 (FB1)–FB4 samples (corresponding to the four different time periods) were collected on 4, 10, 17, and 24 April 2017, respectively. (B) Expression profiles of key genes in gibberellin (GA) synthesis and signaling pathways at different floral bud stages under the three treatments. The ent-kaurene synthase (KS), ent-kaurene oxidase (KO), and ent-kaurenoic acid oxidase (KAO) genes are involved in the GA synthesis pathway, and the DELLA and GA-insensitive drawf1 (GID1) genes are involved in the GA signaling pathway. The gray column represents the blank control, the white column represents the GA treatment, and the black column represents the PP333 treatment.

Table 1.

Multiple test (LRS) results of the effects of various growth regulators on the number of male and female flowers.

Species Concentration (mg·L−1) Female Flower Cluster /Branch Number of Mixed Inflorescences /Branch Mixed Inflorescence Length (cm) Number of Male Inflorescence /Branch Ratio of Female Flower Clusters to Mixed Inflorescence Number The Ratio of the Number of Female Flowers to the Number of Male Inflorescences Ratio of Mixed Inflorescence Number to Male Inflorescence Number
C 0 2.71 ± 1.62b 2.11 ± 0.93a 16.33 ± 2.61a 8.44 ± 3.43b 1.5 ± 0.40a 0.47 ± 0.27a 0.34 ± 0.15a
GA 100 mg/L 2.36 ± 0.50b 2.14 ± 0.53a 12.65 ± 2.34b 11.14 ± 2.98a 1.14 ± 0.31b 0.22 ± 0.06b 0.21 ± 0.07a
PP333 1000 mg/L 3.70 ± 1.42a 2.40 ± 0.84a 17.40 ± 2.94a 8.80 ± 1.87b 1.58 ± 0.34a 0.46 ± 0.25a 0.30 ± 0.15a
Open in a new tab

Different lowercase letters (a and b) in each column indicate significantly differences between samples at 5% level.

To analyze the effects of the exogenous addition of the hormone GA and the GA inhibitor PP333 on endogenous hormones, the expression levels of key genes in the GA synthesis and signaling pathways were determined (Figure 1B). Three key genes in in the GA synthetic pathway, namely, ent-kaurene synthase (KS), ent-kaurene oxidase (KO), and ent-kaurenoic acid oxidase (KAO), and two typical genes in the GA signaling pathway, namely, DELLA and GA-insensitive drawf1 (GID1), were selected [39]. Their analysis revealed that KS and GID1 gene expression showed a decreasing trend during floral bud differentiation, and no significant difference was obtained after the treatments. During PP333 treatment, KO, KAO, and DELLA expression was significantly decreased during the first floral bud stage, and the overall trend was downward. No significant differences were found between the control and GA treatments.

Some genes play important roles in flower development [15,40,41], and six of these (SPL9, SPL16, SOC1, AP1, FUL, and LEY) were selected. The gene expression levels in floral buds at different developmental stages were determined by fluorescence quantitative RT-PCR analysis, and the expression trends of the six genes were different. Specifically, SPL9, SPL16, and AP1 showed an upward trend during floral bud development, and the SOC1, FUL, and LEY genes showed a downward trend. After GA treatment, the expression levels of SPL9 and SPL16 were significantly decreased, whereas no significant differences in the gene expression levels of AP1, FUL, and LEY were found between the GA-treated and control floral buds (Figure 2). These results suggested that SPL9 and SPL16 might be involved in not only flower development but also the GA signaling pathway in chestnut.

Figure 2.

Figure 2

Open in a new tab

Expression patterns of SPL9, SPL16, SOC1, AP1, FUL, and LEY in floral buds at different stages under GA treatment. The black column represents the blank control, and the gray column represents the GA treatment. Asterisks indicate significant differences according to a Student’s t-test (* p ≤ 0.05; ** p ≤ 0.01).

2.2. Identification of CmSPL Genes

To further explore the important role of the SPL genes in flower development, we analyzed the cDNA sequence of the SPL gene family in chestnut and included the deduced protein length, molecular weight, isoelectric point, and aliphatic index. The deduced length of the CmSPL proteins ranged from 151 (CmSPL15) to 1091 (CmSPL14) amino acids, they had a predicted molecular mass of 17.3 (CmSPL15) to 120.6 (CmSPL14) KDa, the pI values ranged from 5.72 (CmSPL7) to 9.39 (CmSPL2), and the Ai varied from 29.74 (CmSPL15) to 84.41 (CmSPL1). In addition, 10 of the 18 genes belonging to the SPL family have a target site for CmmiR156, and two types of complementary regions of CmmiR156 are found in these CmSPLs, most of which are located in the coding region and a few are located in the 3’ UTR region of CmSPL (Table 2). These results indicated the diversity in the features of the CmSPLs in C. mollissima.

Table 2.

Gene feature and classification of Squamosa promoter-binding protein-like (SPL) in Castanea mollissima.

Gene Name CDS (bp) Peptide (aa) Mw (Da) pI Ai miR156 Target
CmSPL1 3000 999 110899.70 5.77 84.41 No
CmSPL2 582 193 21864.54 9.39 51.50 Yes
CmSPL3 549 182 20368.72 8.73 51.43 No
CmSPL4 1314 437 48311.02 7.05 57.41 Yes
CmSPL5 1722 573 62793.15 6.66 57.87 Yes
CmSPL6 1623 540 60015.14 6.15 68.24 Yes
CmSPL7 2358 785 87807.21 5.72 76.28 No
CmSPL8 1026 341 37999.46 8.98 44.75 No
CmSPL9 1119 372 39809.28 9.37 47.55 Yes
CmSPL10 1410 469 52259.35 8.65 52.47 Yes
CmSPL11 1398 465 51284.57 8.03 58.11 Yes
CmSPL12 3108 1035 114576.19 7.32 84.38 No
CmSPL13 1176 391 42863.75 8.80 62.58 Yes
CmSPL14 3276 1091 120636.02 7.86 74.28 No
CmSPL15 456 151 17311.85 6.71 29.74 No
CmSPL16 960 319 34804.61 9.15 60.19 Yes
CmSPL17 1173 390 43054.10 8.47 69.00 Yes
CmSPL18 624 207 23511.61 9.32 53.24 No
Open in a new tab

2.3. Phylogenetic Analysis of SPL Genes

The SPL gene function has been almost fully clarified in Arabidopsis due to its importance as a model plant. To further study the evolutionary relationship among C. mollissima, Arabidopsis, and P. trichocarpa, the sequences of 18 CmSPLs from chestnut, 13 AtSPLs from Arabidopsis, and 28 PtSPLs from P. trichocarpa were analyzed through a phylogenetic tree analysis. All 59 SPL genes were divided into eight groups, and seven of the groups (all except IV) contained at least one SPL gene from three species (Figure 3). V includes the smallest SPL gene, which contains less than 210 amino acids, and VII encodes a large set of SPL genes with approximately 1000 amino acids (Figure 3 and Table 2). Therefore, although the construction of the phylogenetic tree was based on the SBP domain, the tree also reflected the evolution and classification of the full-length SPL genes, which also indicated that the SBP domain is a relatively conserved sequence among all SPL genes of different species. In addition, with the exception of CmSPL17 in I, the homologous relationship between other chestnut SPL genes and the poplar SPL gene is closer than that of chestnut genes with Arabidopsis, which indicates that the conservation of the SPL gene family among woody plants is higher than that among woody and herbaceous plants.

Figure 3.

Figure 3

Open in a new tab

Phylogenetic tree of 59 SPLs in C. mollissima, Arabidopsis thaliana, and Populus trichocarpa. The phylogenetic tree was constructed based on the SBP domain using the neighbor-joining (NJ) method with MEGA 7. The number on the branch indicates the bootstrap value, and the SPL genes in the same species are represented with the same colors: purple, C. mollissima; red, A. thaliana; and green, P. trichocarpa.

2.4. Identification of Conserved Motifs in CmSPLs

The detailed domain structure of CmSPL was analyzed by NCBI database alignment, and the results showed that the SBP domain is the only conserved domain shared by all CmSPLs. As shown in Figure 4A, all SBP domains in CmSPLs also contain two zinc finger structures (Zn-1/2) and a conserved nuclear localization signal (NLS). The Zn-1 motif is a CCCH (C3H) type in all CmSPL proteins except that the His residue in CmSPL7 is substituted with a Cys residue. Unlike Zn-1, the characteristic sequence of Zn-2 (C2HC) is highly conserved in all CmSPLs, which partially overlap NLS.

Figure 4.

Figure 4

Open in a new tab

Conserved motif analysis. (A) Sequence logo of the SBP domain of CmSPLs. The overall height of each stack represents the degree of conservation at this position, whereas the height of the letters within each stack indicates the relative frequency of the corresponding amino acids. (B) Distribution of conserved motifs in CmSPLs. The motifs represented with boxes were identified using the MEME online tool. The numbers in boxes 1–10 represents motifs 1–10, respectively. The position and length of each colored box represents the actual motif size.

In addition to the SBP domain, other conserved domains also play an important role in protein function. For example, ANK domains involved in protein–protein interactions were relatively conserved in most of the investigated proteins. An analysis of 10 conserved domains in 18 CmSPLs was performed using the MEME web server (Figure 4B). Consistent with the phylogenetic tree analysis, we also divided the structures of these 31 SPL proteins into eight groups. Most of the domains were relatively conserved between Arabidopsis and chestnut and were also relatively conserved in poplar trees. The number of motif(s) in each CmSPL varied from 1 to 9, and most CmSPLs within the same group shared similar motif profiles (Figure 4B). Among these motifs, motif 1 is the SBP domain, which exists in all CmSPLs analyzed, and motif 2 consists of a sequence containing a region complementary to miR156.

2.5. Expression Profiles of the SPL Genes and miR156 in Organs of C. mollissima

Both the evolutionary relationship and gene structure analyses showed the conservation and diversity of SPL genes. We also aimed to explore the role of these SPL genes in the development of Chinese chestnut flowers and thus analyzed the expression patterns of 18 genes in different organ samples (female flowers, male flowers, leaves, ovary, stigma, and stamen) by qRT-PCR. In general, the CmSPL genes were classified into two types based on their expression profiles (Figure 5B,C). A minority of the CmSPL genes, namely, CmSPL1, CmSPL12, and CmSPL14, showed relatively high expression in all the examined organs (Figure 5B). All of these genes are devoid of miR156 complementary regions and are therefore referred to as the CmmiR156-nontargeted CmSPL genes. The remaining CmSPL genes, most of which are CmSPL genes with complementary regions of CmmiR156, are therefore known as CmmiR156-targeted CmSPL genes, showing more differentiated expression patterns in different organs (Figure 5). This difference implies that CmmiR156-targeted and -nontargeted CmSPL genes play distinct roles in flower development in C. mollissima. It is worth noting that similar expression patterns were observed in genes belonging to the same group, such as CmSPL5/13/17 in group I, CmSPL1/12/14 in group VII, and CmSPL2/15 in group V (Figure 5). This suggests that the same group of CmSPLs plays a similar function in flower development due to their identical motifs. Furthermore, we also studied CmmiR156 transcript levels in different organs of C. mollissima by qRT-PCR. According to its expression pattern, CmmiR156 was mainly expressed in the male floral cluster and stamen, and the level of CmmiR156 in these organs was approximately twofold higher than that found in the female flower, which presented the third highest expression of this gene (Figure 5A). In contrast, most of the CmmiR156-targeted CmSPL genes showed higher expression in male flowers than in male floral clusters and stamen.

Figure 5.

Figure 5

Open in a new tab

Expression profiles of the Chinese chestnut CmSPL genes in female flower, male floral cluster, leaf, ovary, stigma, and stamen. The heat map was generated based on the mean values from the qRT-PCR data obtained from the different samples. The red and blue colors represent higher and lower expression, respectively.

2.6. Expression Pattern of miR156 and Its Target Genes in Floral Buds at Different Stages under GA Treatment

GA is an important hormone in plant growth and development and plays an important role in floral transition. In our study, CmmiR156 was downregulated in the development of floral buds and increased significantly after GA treatment (Figure 6A). Thus, the expression patterns of 18 CmSPL genes during floral bud development were also analyzed. Most of the CmmiR156-targeted CmSPL genes, particularly CmSPL6, CmSPL9, CmSPL10, CmSPL13, and CmSPL16, were substantially upregulated during floral bud development (Figure 6B). In addition, CmSPL6, CmSPL9, and CmSPL16 expression was significantly decreased during GA treatment and showed the opposite expression patterns from that of CmmiR156. In addition, the CmmiR156-nontargeted CmSPL genes exhibited a constitutive expression pattern during floral bud development, and the expression level did not significantly differ under GA treatment (Figure 6C). These results demonstrate that CmmiR156-targeted and -nontargeted CmSPLs play an important role in the floral bud development of C. mollissima, and there is a functional difference between them.

Figure 6.

Figure 6

Open in a new tab

Expression profiles of mature CmmiR156 and CmSPLs in floral buds of C. mollissima at different stages under GA treatment. (A) Expression patterns of CmmiR156. (B) Expression patterns of CmmiR156-targeted CmSPLs. (C) Expression patterns of CmmiR156-nontargeted CmSPLs. Floral Bud 1 (FB1)–FB4 represent the floral buds at four different periods (4, 10, 17, and 24 April 2017, respectively).

2.7. Validation of CmmiR156-Targeted CmSPLs Cleavage Sites by RNA Ligase-Mediated Rapid Amplification of the 5′ cDNA Ends (RLM-RACE)

In our study, 10 CmSPL genes with complementary regions for CmmiR156 were identified. Most of the CRs were highly paired with only one base mismatch located at the eighth base (Figure 7A). The CmSPL9 and CmSPL16 target genes were selected for section analysis using the RLM-RACE technique. Cloning and sequencing of the PCR amplicons of remnant mRNAs enabled the determination of the nucleotide position in which a slicing event occurred. CmmiR156 sliced its CmSPL9 and CmSPL6 target genes at different sites with different efficiencies. Specifically, the CmSPL9 and CmSPL16 slicing events occurred at the 12th/10th nucleotide in the CR, and the efficiencies of these splicing reactions were 10/10 and 8/10, respectively (Figure 7B).

Figure 7.

Figure 7

Open in a new tab

Identification of CmmiR156-guided cleavage products of target genes. (A) Sequence of the miR156 complementary region in CmSPL genes. (B) Sites for the cleavage of CmSPL9 and CmSPL16 by CmmiR156. The black arrow indicates the cutting site.

3. Discussion

SPLs are plant-specific transcription factors that contain a highly conserved SBP domain and have a large family in plants. Due to the important function of SPL genes in plant development, more and more species of SPLs have been identified. Chestnut is an important ecological and economic crop, and its SPL genes have not been systematically studied. Because of the different proportions of male and female flowers in chestnut and the important function of SPL genes in floral development, we believe that the identification and analysis of chestnut SPL genes is of great significance. In this study, we identified 18 SPL genes in the C. mollissima genome, and expression analysis showed that most of them had relatively high expression in floral organs (Figure 5). Compared with Arabidopsis thaliana [17], Vitis vinifera [42], P. hybrida [21], P. trichocarpa [18], and B. luminifera [19], the number of chestnut SPL genes is similar to that of Arabidopsis (16), B. luminifera (18) and V. vinifera (18), but notably lower that of P. trichocarpa (28), and P. hybrida (21). This finding means that the SPL genes of different plants evolve in a species-specific manner, which may be affected by different genetic repeat events.

According to the phylogenetic tree analysis, we divided 18 CmSPL genes into eight groups (I–VIII) (Figure 3). The tight integration of the CmSPL genes with the AtSPL and PtSPL genes suggests that the first origins of these SPL genes may be identical and may have a common ancestor. By conservative motif analysis, it was found that all CmSPL genes from the same phylogenetic group had the same motif (Figure 4B), indicating that the genes of the same phylogenetic group may have similar functions in C. mollissima. To investigate the potential role of CmSPLs in the floral development of chestnut, the expression profiles of CmSPL genes in six different organs of chestnut were analyzed. In addition, due to the correlation between CmSPLs and CmmiR156, we also analyzed the expression profile of CmmiR156. The expression pattern of the CmSPL genes in different organs of chestnut are shown in Figure 5. Some CmSPLs (CmSPL1, CmSPL12, and CmSPL14) exhibited a constitutive expression pattern in the examined organs, and the remaining genes exhibited development- and organ-dependent expression patterns. Notably, the constitutive expression patterns were typically observed in the CmmiR156-nontargeted CmSPL genes, whereas more than half of the CmmiR156-targeted CmSPLs tended to exhibit different expression patterns. The miR156-targeted and -nontargeted SPL genes also have similar expression differences in P. trichocarpa, B. luminifera, B. napus, and P. hybrida [18,19,20,21]. This finding suggests that miR156-targeted and -nontargeted SPLs undergo different evolutionary patterns of differentiation expression, suggesting that they play distinct roles in the development and growth of plants.

The DELLA protein has been found to interact with the SPL protein as a central transcriptional repressor of the GA response and to inhibit SPL protein activity. The physical interaction between SPL and DELLA is considered to be an integrator of age and GA-related pathways at flowering [43]. This experiment revealed no significant difference in the level of DELLA expression under GA treatment compared with the control treatment, which might indicate that DELLA is not sensitive to GA. The first spraying treatment with PP333 significantly reduced the expression of DELLA (Figure 1B). This protein is also involved in the transmission of various plant hormones and environmental signals, such as abscisic acid (ABA) [44], jasmonic acid (JA) [45], sugar signal [46], and light signal [47,48]. The reduced DELLA expression level might be due to the fact that the tree just started to come into contact with PP333, resulting in an imbalance in other internal hormones, which in turn affects the expression level of DELLA protein. The extensive interaction between DELLA protein and miR156-targeted SPLs has been demonstrated in several species by yeast two-hybrid assays. For example, in B. luminifera, BlRGA can interact with BlSPL1, BlSPL6, BlSPL8, BlSPL13, and BlSPL18, and BlRGL can interact with BlSPL1, BlSPL8, BlSPL13, BlSPL16, and BlSPL18 [19]. In this study, we found that the expression patterns of CmSPLs and CmmiR156 were also affected by GA treatment. During floral bud development, GA treatment significantly increased the expression level of CmmiR156 and decreased the expression of the target gene CmSPL6/CmSPL9/CmSPL16. Some nontarget genes, such as CmSPL7/CmSPL14/CmSPL18, showed increased expression levels during some stages of floral bud development. The similar expression pattern was also found in Phyllostachys edulis and upland cotton [49,50], suggesting that the expression of the SPL genes may be regulated by GA and indicates that GA can indirectly affect the expression of SPL genes by regulating miR156 or directly regulate the expression level of SPLs by affecting the interaction between DELLA and SPL proteins.

4. Materials and Methods

4.1. Plant Materials

The Chinese chestnut cultivar “Yanshanhongli” was used in this study. Samples of different organs, including mixed floral bud, female flower, stigma, ovary, staminate catkin, male floral cluster, stamen, and leaf, were collected from 18-year-old Yanshanhongli plants in the Chestnut Experiment Station in the Huairou District of Beijing, China. The stigma and ovary samples were collected from unpollinated female flowers by removing the catkins and isolating the female flowers via bagging. All samples were cleaned after collection and immediately frozen in liquid nitrogen and stored at −80 °C until RNA extraction.

4.2. Exogenous Hormone Application

A stock solution containing 1 g of GA3 and 10 g of PP333 dissolved in 50 mL of 95% alcohol was diluted with distilled water to a final volume of 10 L. The final concentrations of GA3 and PP333 were 100 mg/L and 1000 mg/L, respectively. The control treatment involved the spraying of distilled water containing an equal amount of ethanol. Ten chestnut trees of similar growth were used for each treatment. The first spraying was performed prior to floral bud sprouting on 20 March 2017, and the trees were then sprayed three more times at 1-week intervals. In the middle of June, 40 branches at different positions were randomly selected from 10 chestnut trees in each treatment, and the total number and length of catkins of mixed inflorescences, male inflorescence, and female flowers in each sub-branch were investigated. SPSS 22.0 software was used for statistical analysis.

4.3. Identification of CmSPL Genes

Chinese chestnut gene and protein sequences were obtained from the Chinese chestnut genome project (https://www.ncbi.nlm.nih.gov/bioproject/527178), and two methods were used to identify SPL genes in Chinese chestnut. First, the hidden Markov model (HMM) profile of the SBP domain (pfam03110) was obtained from the Pfam website (http://pfam. xfam.org/) [51] and was employed as the query for the identification of all possible SPL genes in Chinese chestnut. Additionally, the Arabidopsis information resource database (http://www.arabidopsis.org/) was used to search the amino acid sequence of AtSPLs, and the sequence of PtSPLs was obtained from previous studies [18]. Then, the AtSPL and PtSPL sequences were used as queries for BLASTP searches against the Chinese chestnut genome database. All of the candidate SPL genes identified using the two methods were downloaded from the Chinese chestnut genome website. The reliability of these candidate sequences was verified using the Pfam (http://Pfam.sanger.ac.uk/) and NCBI databases (http://www.ncbi.nlm.nih.gov/), and the sequences lacking SBP domains were rejected.

4.4. Bioinformatic Analyses of CmSPL Genes

The amino acid sequence length, molecular weight, and isoelectric point of the candidate protein were calculated using the ExPASy website tool (http://web.expasy.org/protparam/). Conservative motifs were identified using the online tool MEME (http://meme-suite.org/tools/meme) with parameter settings referenced to previous studies [18], using the psRNATarget tool (http://plantgrn.noble.org/v1_psRNATarget/) to predict miiR156-targeted SPL genes.

4.5. Phylogenetic Analysis

The SBP domain sequences were obtained from SPL protein sequence alignment analysis using NCBI. A phylogenetic analysis was performed with reference to the MEGA 7.0 tool used by Kumar et al. [52].

4.6. RNA Isolation

The total RNA from tissues or organs of C. mollissima was extracted using the Plant RNA Kit (OMEGA, Norcross, GA, USA) according to the manufacturer’s instructions. The quality and quantity of total RNA were evaluated by agarose gel electrophoresis and using a Nanodrop One spectrophotometer (Thermo Scientific, Madison, NY, USA), respectively, and the elimination of genomic DNA through treatment with RapidOut DNA Removal Kit (Thermo Scientific, Vilnius, Lithuania).

4.7. Expression Analysis of CmSPL Genes

The cDNA was synthesized using M-MLV reverse transcriptase (Takara, Dalian, China). qRT-PCR analysis was performed by the Light Cycler96 Real Time PCR System (Roche Diagnostics GmbH, Mannheim, Germany) with SYBR Green (Takara, Dalian, China). The gene-specific primers were designed using Beacon designer software and are listed in Table A1. Each reaction system and procedure of qRT-PCR was based on the study of Lu et al. [53]. All qRT-PCR experiments were performed in three biological replicates. The relative expression levels were calculated using the 2−ΔCt method and CmActin was employed as the reference gene.

4.8. Expression Analysis of CmmiR156

Briefly, 2 μg of total RNA treated with DNase was used for first-strand cDNA synthesis using the TransScript® miRNA First-Strand cDNA Synthesis SuperMix Kit (TransGen Biotech, Beijing, China). In the qRT-PCR analysis of miR156, U6 was used as the reference gene. The program parameters were set as mentioned above, and the primers are listed in Table A1.

4.9. RLM-RACE

To identify the CmmiR156 cleavage sites of the CmSPL transcripts, a modified 5’RLM-RACE program was used with the First Choice RLM-RACE kit (Invitrogen, Vilnius, Lithuania) following the method used by Li et al. [19]. Specific primers were designed based on predicted cleavage sites (Table A1), then the 5′ RACE PCR product was gel-purified and cloned into the pMD-19 T vector (Takara, Dalian, China), and 10 clones were randomly selected and sequenced.

5. Conclusions

In this study, we identified 18 SPL genes in the C. mollissima genome and analyzed their evolutionary relationships, gene structures, expression patterns, and potential functions. The development of male and female flowers in chestnut and the expression of some SPL genes were affected by GA treatment. The present work provides an important foundation for the future elucidation of the biological functions of CmSPL genes.

Appendix A

Table A1.

Primers used for this study.

Primer Set
Forward and Reverse primer (5′-3′)
For qRT-PCR analysis
miRNA RT Primer GATCGCCCTTCTACGTCGTATCGTCATCTGACCGTTATCGCTGCACGTTTTTTTTTTTTTTTTTTTT
CmmiR156-F TGCACTAGCGTGTGACAGAAGA
CmmiR156-R GATCGCCCTTCTACGTCGTAT
U6-F GATAAAATTGGAACGATACAG
U6-R ATTTGGACCATTTCTCGATTT
CmActin-F ATTCACGAGACCACCTACA
CmActin-R TGCCACAACCTTAATCTTCA
CmSPL1-F CAGTCAAGTCCACCTCAA
CmSPL1-R GCTCTCAATGTCAGTAGGA
CmSPL2-F CATACCATAGGAGGCACAA
CmSPL2-R TCCGTCGCTCATTATGTC
CmSPL3-F TGTAGATGATGACTTGGATGA
CmSPL3-R TTCTCTGCCTGACAACAT
CmSPL4-F CAATGGAGGAACTAGGAGATG
CmSPL4-R GACAATAATCCGAATGCTGAG
CmSPL5-F TCTTCAAGCCATTCATCTG
CmSPL5-R CCAAGGTGATTCTCTTCTG
CmSPL6-F CTGAAGACTATGCTGTTACTG
CmSPL6-R TGACCGACACTATGATGG
CmSPL7-F GAACGCCACAACAATAGA
CmSPL7-R TCAGACTCCAAGAATGCT
CmSPL8-F ATGCTGGACTACGAATGG
CmSPL8-R GATGATGATGTTGATGATGATGA
CmSPL9-F TCCTCCATCTAACCTATATCTG
CmSPL9-R CTTCCGTATTCATCAAGTCTT
CmSPL10-F ACACCACGCTGCCAAGTT
CmSPL10-R GGAACCTGCTACATTGCTGACA
CmSPL11-F TACACCTCAAGTCCTTAGTCA
CmSPL11-R GCTTCACTGCTTCGGTTA
CmSPL12-F TTCTTCACAGTCACCATCT
CmSPL12-R GCTCTCAATGTCAGTAGGA
CmSPL13-F CTAACCAGCAGCAACAATTACAG
CmSPL13-R AGACAGGAGCCTCAAGAGATAA
CmSPL14-F GCAAGAAGTAGTAGCAGTTAC
CmSPL14-R GGAGAAGACGAAGGAGAC
CmSPL15-F TATCACCGCCGCCACAAG
CmSPL15-R TTCCGTCGCCTCTCATTATGTC
CmSPL16-F TTTATGCGACAATTACAAAGGA
CmSPL16-R GTTTAACCCATTAGAGAACACTT
CmSPL17-F TCTATCTTCTGTCATCACCTC
CmSPL17-R TCATTGGCATCAGGAACA
CmSPL18-F CACAAGCGTCACAAGGTT
CmSPL18-R TCTCTGCCTGAAGGTCTG
For modified 5′ RLM-RACE
CmSPL9-outer-R GGGGAGGTGTCATAAGCCCTGGAGT
CmSPL9-inter-R CCCTGGAGTGCTCAAGTCCCATGTA
CmSPL16-outer-R ACAAGAAGGAAAGTGTTTGGTTAGG
CmSPL16-inter-R TGACCCATCACTATCATGAGGCCCA
Open in a new tab

Author Contributions

Conceptualization, G.C., L.Q., and Y.X.; methodology, G.C. and J.L.; software, G.C. and Y.L.; validation, L.Q. and Y.X.; formal analysis, Q.Z., Y.G., and K.F.; investigation, G.C., J.L., and Y.L.; resources, L.Q.; writing—original draft preparation, G.C., J.L., L.Q., and Y.X.; writing—review and editing, G.C., Q.C., and Y.X.; visualization, G.C., J.L., and K.F.; supervision, Y.X.; project administration, L.Q.; funding acquisition, L.Q. and Y.X.

Funding

This work was supported by the National Key Research & Development Program of China (2018YFD1000605), the National Natural Science Foundation of China (Grant nos. 31370679 and 31270719), and the Project of Construction of Innovative Teams and Teacher Career Development for Universities and Colleges under Beijing Municipality (IDHT20180509).

Conflicts of Interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interests.

References

  • 1.Zhao Z.Y., Liu K.Y. Effect of chemical thinning catkins on Chinese chestnut yield and quality. Acta Hortic. 2009;844:457–460. doi: 10.17660/ActaHortic.2009.844.64. [DOI] [Google Scholar]
  • 2.Guo X.P., Li X.L., Duan X.W., Shen Y.Y., Xing Y., Cao Q.Q., Qin L. Characterization of sck1, a novel Castanea mollissima mutant with the extreme short catkins and decreased gibberellin. PLoS ONE. 2012;7:e43181. doi: 10.1371/journal.pone.0043181. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Tanurdzic M., Banks J.A. Sex-determining mechanisms in land plants. Plant Cell. 2004;16:S61–S71. doi: 10.1105/tpc.016667. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Chandler J.W. The Hormonal Regulation of Flower Development. J. Plant Growth Regul. 2011;30:242–254. doi: 10.1007/s00344-010-9180-x. [DOI] [Google Scholar]
  • 5.Song S., Qi T., Huang H., Xie D. Regulation of stamen development by coordinated actions of jasmonate, auxin, and gibberellin in Arabidopsis. Mol. Plant. 2013;6:1065–1073. doi: 10.1093/mp/sst054. [DOI] [PubMed] [Google Scholar]
  • 6.Plackett A.R., Ferguson A.C., Powers S.J., Wanchoo-Kohli A., Phillips A.L., Wilson Z.A., Hedden P., Thomas S.G. DELLA activity is required for successful pollen development in the Columbia eco type of Arabidopsis. New Phytol. 2014;201:825–836. doi: 10.1111/nph.12571. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Cheng Y.F., Zhao Y.D. A Role for Auxin in Flower Development. J. Integr. Plant Biol. 2007;49:99–104. doi: 10.1111/j.1744-7909.2006.00412.x. [DOI] [Google Scholar]
  • 8.Chen M.S., Pan B.Z., Wang G.J., Ni J., Niu L., Xu Z.F. Analysis of the transcriptional responses in inflorescence buds of Jatropha curcas exposed to cytokinin treatment. BMC Plant Biol. 2014;14:318. doi: 10.1186/s12870-014-0318-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Pan B.Z., Xu Z.F. Benzyladenine Treatment Significantly Increases the Seed Yield of the Biofuel Plant Jatropha curcas. J. Plant Growth Regul. 2011;30:166–174. doi: 10.1007/s00344-010-9179-3. [DOI] [Google Scholar]
  • 10.Fan X.M., Yuan D.Y., Tian X.M., Zhu Z.J., Liu M.L., Cao H.P. Comprehensive Transcriptome Analysis of Phytohormone Biosynthesis and Signaling Genes in the Flowers of Chinese Chinquapin (Castanea henryi) J. Agric. Food Chem. 2017;65:10332–10349. doi: 10.1021/acs.jafc.7b03755. [DOI] [PubMed] [Google Scholar]
  • 11.Jin J.P., Tian F., Yang D.C., Meng Y.Q., Kong L., Luo J., Gao G. PlantTFDB 4.0: Toward a central hub for transcription factors and regulatory interactions in plants. Nucleic Acids Res. 2017;45:D1040–D1045. doi: 10.1093/nar/gkw982. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Guan X., Pang M., Nah G., Shi X., Ye W., Stelly D.M., Chen Z.J. miR828 and miR858 regulate homoeologous MYB2 gene functions in Arabidopsis trichome and cotton fibre development. Nat. Commun. 2014;5:3050. doi: 10.1038/ncomms4050. [DOI] [PubMed] [Google Scholar]
  • 13.Fang Y., Xie K., Xiong L. Conserved miR164-targeted NAC genes negatively regulate drought resistance in rice. J. Exp. Bot. 2014;65:2119–2135. doi: 10.1093/jxb/eru072. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Huang J., Li Z.Y., Zhao D.Y. Deregulation of the OsmiR160 target gene OsARF18 causes growth and developmental defects with an alteration of auxin signaling in rice. Sci. Rep. 2016;6:29938. doi: 10.1038/srep29938. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Tian J., Zhao X.Y., Xie L.S., Quan J.Y., Yao L.H., Wang G.D., Zheng Y.Q., Liu X.M. Research advances and molecular mechanism on SPL transcription factors in regulating plant flower development. J. Nanjing For. Univ. (Nat. Sci. Ed.) 2018;42:159–166. doi: 10.3969/j.issn.1000-2006.201708015. [DOI] [Google Scholar]
  • 16.Li X., Zhang H., Ai Q., Liang G., Yu D. Two bHLH Transcription Factors, bHLH34 and bHLH104, Regulate Iron Homeostasis in Arabidopsis thaliana. Plant Physiol. 2016;170:2478–2493. doi: 10.1104/pp.15.01827. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Cardon G., Hohmann S., Klein J., Nettesheim K., Saedler H., Huijser P. Molecular characterisation of the Arabidopsis SBP-box genes. Gene. 1999;237:91–104. doi: 10.1016/S0378-1119(99)00308-X. [DOI] [PubMed] [Google Scholar]
  • 18.Li C.L., Lu S.F. Molecular characterization of the SPL gene family in Populus trichocarpa. Biogeochemistry. 2014;14:131. doi: 10.1186/1471-2229-14-131. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Li X.Y., Lin E.P., Huang H.H., Niu M.Y., Tong Z.K., Zhang J.H. Molecular Characterization of SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) Gene Family in Betula luminifera. Front. Plant Sci. 2018;9:608. doi: 10.3389/fpls.2018.00608. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Cheng H.T., Hao M.Y., Wang W.X., Mei D.S., Tong C.B., Wang H., Liu J., Fu L., Hu Q. Genomic identification, characterization and differential expression analysis of SBP-box gene family in Brassica napus. BMC Plant Biol. 2016;16:196. doi: 10.1186/s12870-016-0852-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Zhou Q., Zhang S.S., Chen F., Liu B.J., Wu L., Li F., Zhang J.P., Bao M.Z., Liu G.F. Genome-wide identification and characterization of the SBP-box gene family in Petunia. BMC Genom. 2018;19:1–18. doi: 10.1186/s12864-018-4537-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Birkenbihl R.P., Jach G., Saedler H., Huijser P. Functional dissection of the plant-specific SBP-domain: Overlap of the DNA-binding and nuclear localization domains. J. Mol. Biol. 2005;352:585–596. doi: 10.1016/j.jmb.2005.07.013. [DOI] [PubMed] [Google Scholar]
  • 23.Yamasaki K., Kigawa T., Inoue M., Tateno M., Yamasaki T., Yabuki T., Aoki M., Seki E., Matsuda T., Nunokawa E., et al. A novel zinc-binding motif revealed by solution structures of DNA-binding domains of Arabidopsis SBP-family transcription factors. J. Mol. Biol. 2004;337:49–63. doi: 10.1016/j.jmb.2004.01.015. [DOI] [PubMed] [Google Scholar]
  • 24.Huijser P., Schmid M. The control of developmental phase transitions in plants. Development. 2011;138:4117–4129. doi: 10.1242/dev.063511. [DOI] [PubMed] [Google Scholar]
  • 25.Xing S.P., Salinas M., Höhmann S., Xing S., Berndtgen R., Huijser P. miR156 Targeted and Nontargeted SBP-Box Transcription Factors Act in Concert to Secure Male Fertility in Arabidopsis. Plant Cell. 2010;22:3935–3950. doi: 10.1105/tpc.110.079343. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Zhang Y., Schwarz S., Saedler H., Huijser P. SPL8, a local regulator in a subset of gibberellin-mediated developmental processes in Arabidopsis. Plant Mol. Biol. 2007;63:429–439. doi: 10.1007/s11103-006-9099-6. [DOI] [PubMed] [Google Scholar]
  • 27.Wang Z., Wang Y., Kohalmi S.E., Amyot L., Hannoufa A. SQUAMOSA PROMOTER BINDING PROTEIN-LIKE 2 controls floral organ development and plant fertility by activating ASYMMETRIC LEAVES 2 in Arabidopsis thaliana. Plant Mol. Biol. 2016;92:661–674. doi: 10.1007/s11103-016-0536-x. [DOI] [PubMed] [Google Scholar]
  • 28.Bartel D.P. MicroRNAs: Genomics, biogenesis, mechanism, and function. Cell. 2014;116:281–297. doi: 10.1016/S0092-8674(04)00045-5. [DOI] [PubMed] [Google Scholar]
  • 29.Liu N., Wu S., Van Houten J., Wang Y., Ding B., Fei Z.J., Clarke T.H., Reed J.W., van der Knaap E. Down-regulation of AUXIN RESPONSE FACTORS 6 and 8 by microRNA 167 leads to floral development defects and female sterility in tomato. J. Exp. Bot. 2014;65:2507–2520. doi: 10.1093/jxb/eru141. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Wang Y., Sun F.L., Cao H., Peng H.R., Ni Z.F., Sun Q.X., Yao Y.Y. TamiR159 directed wheat TaGAMYB cleavage and its involvement in anther development and heat response. PLoS ONE. 2012;7:e48445. doi: 10.1371/journal.pone.0048445. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Li J., Guo G.H., Guo W.W., Guo G.G., Tong D., Ni Z.F., Sun Q.F., Yao Y.Y. miR164-directedcleavage of ZmNAC1 confers lateral root development in maize (Zea mays L.) BMC Plant Biol. 2012;12:220. doi: 10.1186/1471-2229-12-220. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Feng H., Duan X.Y., Zhang Q., Li X.R., Wang B., Huang L.L., Wang X.J., Kang Z.S. The target gene of tae-miR164, a novel NAC transcription factor from the NAM subfamily, negatively regulates resistance of wheat to stripe rust. Mol. Plant Pathol. 2014;15:284–296. doi: 10.1111/mpp.12089. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Silva G.F.F.E., Silva E.M., Da Silva Azevedo M., Guivin M.A.C., Ramiro D.A., Figueiredo C.R., Carrer H., Peres L.E.P., Nogueira F.T.S. microRNA156-targeted SPL/SBP box transcription factors regulate tomato ovary and fruit development. Plant J. 2014;78:604–618. doi: 10.1111/tpj.12493. [DOI] [PubMed] [Google Scholar]
  • 34.Cui L.G., Shan J.X., Shi M., Gao J.P., Lin H.X. The miR156-SPL9-DFR pathway coordinates the relationship between development and abiotic stress tolerance in plants. Plant J. 2014;80:1108–1117. doi: 10.1111/tpj.12712. [DOI] [PubMed] [Google Scholar]
  • 35.Wang H., Wang H. The miR156/SPL module, a regulatory hub and versatile toolbox, gears up crops for enhanced agronomic traits. Mol. Plant. 2015;8:677–688. doi: 10.1016/j.molp.2015.01.008. [DOI] [PubMed] [Google Scholar]
  • 36.Xu M., Hu T., Zhao J., Park M.Y., Earley K.W., Wu G., Yang L., Poethig R.S. Developmental functions of miR156-regulated SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) genes in Arabidopsis thaliana. PLoS Genet. 2016;12:e1006263. doi: 10.1371/journal.pgen.1006263. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Long J.M., Liu C.Y., Feng M.Q., Liu Y., Wu X.M., Guo W.W. miR156-SPLs module regulates somatic embryogenesis induction in citrus callus. J. Exp. Bot. 2018;69:2979–2993. doi: 10.1093/jxb/ery132. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Gou J.Q., Fu C.X., Liu S.J., Tang C.R., Debnath S., Flanagan A., Ge Y.X. The miR156-SPL4 module predominantly regulates aerial axillary bud formation and controls shoot architecture. New Phytol. 2017;216:829. doi: 10.1111/nph.14758. [DOI] [PubMed] [Google Scholar]
  • 39.Shang M.Y., Wang X.T., Zhang J., Qi X.H., Ping A., Hou L.P., Xing G.M., Li G.Z., Li M.L. Genetic Regulation of GA Metabolism during Vernalization, Floral Bud Initiation and Development in Pak Choi (Brassica rapa ssp. chinensis Makino) Front. Plant Sci. 2017;8:1533. doi: 10.3389/fpls.2017.01533. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Zhang N., Wen J., Zimmer E.A. Expression patterns of AP1, FUL, FT and LEAFY orthologs in Vitaceae support the homology of tendrils and inflorescences throughout the grape family. J. Syst. Evol. 2015;53:469–476. doi: 10.1111/jse.12138. [DOI] [Google Scholar]
  • 41.Dong B., Deng Y., Wang H.B., Gao R., Stephen G.K., Chen S.M., Jiang J.F., Chen F.D. Gibberellic Acid Signaling Is Required to Induce Flowering of Chrysanthemums Grown under Both Short and Long Days. Int. J. Mol. Sci. 2017;18:1259. doi: 10.3390/ijms18061259. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Hou H., Li J., Gao M., Singer S.D., Wang H., Mao L., Fei Z., Wang X. Genomic organization, phylogenetic comparison and differential expression of the SBP-box family genes in grape. PLoS ONE. 2013;8:e59358. doi: 10.1371/journal.pone.0059358. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Yu S., Galvão V.C., Zhang Y.C., Horrer D., Zhang T.Q., Hao Y.H., Feng Y.Q., Wang S., Schmid M., Wang J.W. Gibberellin regulates the Arabidopsis floral transition through miR156 targeted SQUAMOSA promoter binding-like transcription factors. Plant Cell. 2012;24:3320–3332. doi: 10.1105/tpc.112.101014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Xi W., Liu C., Hou X., Yu H. MOTHER OF FT AND TFL1 regulates seed germination through a negative feedback loop modulating ABA signaling in Arabidopsis. Plant Cell. 2010;22:1733–1748. doi: 10.1105/tpc.109.073072. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Hou X., Lee L.Y., Xia K., Yan Y., Yu H. DELLAs modulate jasmonate signaling via competitive binding to JAZs. Dev. Cell. 2010;19:884–894. doi: 10.1016/j.devcel.2010.10.024. [DOI] [PubMed] [Google Scholar]
  • 46.Zhang Y.Q., Liu Z.J., Wang L.G., Sheng Z., Xie J.P., Bi Y.R. Sucrose-induced hypocotyl elongation of Arabidopsis seedlings in darkness depends on the presence of gibberellins. J. Plant Physiol. 2010;167:1130–1136. doi: 10.1016/j.jplph.2010.03.007. [DOI] [PubMed] [Google Scholar]
  • 47.Boccaccini A., Santopolo S., Capauto D., Lorrai R., Minutello E., Serino G., Costantino P., Vittorioso P. The DOF protein DAG1 and the DELLA protein GAI cooperate in negatively regulating the AtGA3ox1 gene. Mol. Plant. 2017;7:1486–1489. doi: 10.1093/mp/ssu046. [DOI] [PubMed] [Google Scholar]
  • 48.Zheng Y.Y., Gao Z.P., Zhu Z.Q. DELLA-PIF modules: Old dogs learn new tricks. Trends Plant Sci. 2016;21:813–815. doi: 10.1016/j.tplants.2016.08.006. [DOI] [PubMed] [Google Scholar]
  • 49.Pan F., Wang Y., Liu H.L., Wu M., Chu W.Y., Chen D.M., Xiang Y. Genome-wide identification and expression analysis of SBP-like transcription factor genes in Moso Bamboo (Phyllostachys edulis) BMC Genom. 2017;18:486. doi: 10.1186/s12864-017-3882-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Cai C.P., Guo W.Z., Zhang B.H. Genome-wide identification and characterization of SPL transcription factor family and their evolution and expression profiling analysis in cotton. Sci. Rep. 2018;8:762. doi: 10.1038/s41598-017-18673-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Finn R.D., Bateman A., Clements J., Coggill P., Eberhardt R.Y., Eddy S.R., Heger A., Hetherington K., Holm L., Mistry J., et al. Pfam: The protein families database. Nucleic Acids Res. 2014;42:222–230. doi: 10.1093/nar/gkt1223. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Kumar S., Stecher G., Tamura K. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 2016;33:1870–1874. doi: 10.1093/molbev/msw054. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Lu D., Wei W., Zhou W., McGuigan L.D., Ji F.Y., Li X., Xing Y., Zhang Q., Fang K.F., Cao Q.Q. Establishment of a somatic embryo regeneration system and expression analysis of somatic embryogenesis-related genes in Chinese chestnut (Castanea mollissima Blume) Plant Cell Tissue Organ Cult. 2017;130:601–616. doi: 10.1007/s11240-017-1250-3. [DOI] [Google Scholar]

Articles from International Journal of Molecular Sciences are provided here courtesy of Multidisciplinary Digital Publishing Institute (MDPI)

RESOURCES