Skip to main content
NCBI home page
3 Biotech logoLink to 3 Biotech
. 2019 Apr 26;9(5):189. doi: 10.1007/s13205-019-1618-7

Antiasthmatic activity of quercetin glycosides in neonatal asthmatic rats

Suyue Zhu 1,#, Haijun Wang 2,#, Jun Zhang 3, Chunlin Yu 3, Chengquan Liu 4, Haiping Sun 3, Yunduo Wu 3, Yumei Wang 5,✉, Xiaofei Lin 3,✉
PMCID: PMC6485267  PMID: 31065489

Abstract

The present study investigated the anti-asthmatic activity of quercetin glycosides in neonatal asthmatic rats. Rats were divided into four groups: sham (non-asthmatic), asthmatic control, quercetin (25 mg/kg), and quercetin (50 mg/kg). Inflammatory cells in bronchoalveolar lavage fluid (BALF), inflammatory markers, apoptosis, fibrinogen level, prothrombin time, thrombin time, activated partial thromboplastin time, coagulation factor activity, and histopathology were monitored. Quercetin significantly reduced total leukocytes, eosinophils, tumor necrosis factor-α (TNF-α), interleukin (IL-6), nitric oxide (NO), and apoptosis. It also considerably reduced blood coagulation time and coagulation factor activity compared to the controls. The mRNA expression levels of TNF-α, IL-6, and inducible nitric oxide synthase (iNOS) were elevated in asthmatic rats by 1.3-, 1.04-, and 1.1-fold, respectively. However, treatment with 50 mg/kg quercetin glycosides significantly reduced the mRNA expression of TNF-α, IL-6, and iNOS by more than 40%. Quercetin considerably reduced the protein expression of iNOS. Airway and blood vessel narrowing, as well as the accumulation of eosinophils in the lungs were observed in neonatal asthmatic rats. However, treatment with quercetin glycosides significantly reduced inflammation and eosinophil infiltration. In summary, quercetin glycosides significantly attenuated levels of inflammatory markers, demonstrating its protective effects against neonatal asthma in rats.

Keywords: Asthma, Inflammation, Neonatal, Quercetin, Rats

Introduction

Asthma is a well known chronic disease affecting the airways (Martinez 2007). The primary symptoms of asthma include bronchospasm, airflow obstruction, chest tightness, coughing, wheezing, and shortness of breath (Han et al. 2017). Asthma cannot be cured, although symptoms can be addressed with medication (Han et al. 2017). Avoiding smoking, aspirin, and pets are the most effective steps to improve the symptoms of this condition, and drugs are recommended based on the severity of symptoms (Kelly et al. 1988). For temporary relief, bronchodilators are widely recommended (Shichinohe et al. 1996). There are no permanent therapeutic approaches available for the treatment of asthma.

Quercetin is a well known flavonoid that is abundant in vegetables, fruits, grains, leaves, and red onions (Yeh et al. 2016). It is the most abundant flavonoid found in plants (Herrmann 1988; Ross and Kasum 2002). Quercetin is an ingredient in some dietary supplements and has a bitter flavor (Chuang et al. 2016). Several researchers have reported the use of quercetin in respiratory tract diseases (Di Carlo et al. 1999; Capasso et al. 2003). Many studies have reported various pharmacological and biological activities of quercetin including inhibition of histamine release, angiogenesis, Na+/K+ ATPase, angiotensin-converting enzyme II, tyrosine kinase, intestinal peristalsis, and protein kinase C. In addition, quercetin has cell-cycle modulating, antioxidant, antihypertensive, hepatoprotective, anticarcinogenic, and pro-apoptotic effects (Formica and Regelson 1995; Kuo 1997; Duarte et al. 2002; Murota and Terao 2003; Fusi et al. 2003; Gharzouli and Holzer 2004; Janbaz et al. 2004). Helms and Miller (2006) reported the protective effects of quercetin against chronic rhinosinusitis. Therefore, this study investigated the anti-asthmatic activity of quercetin glycosides in neonatal asthmatic rats.

Materials and methods

Materials

Quercetin was obtained from Sigma-Aldrich (Q4951; St. Louis, MO, USA). Anti-iNOS antibody was purchased from Abcam (ab3523; Cambridge, MA, USA). Primers were purchased from Macrogen (Seoul, Korea). Male neonatal Sprague Dawley rats were obtained from the animal house of Huai’an Maternity and Child Health Care Hospital, Huaian, Jiangsu, China. Rats (6–10 g) were divided into four homogeneous groups and were allowed standard access to food and water with a standard light period (12 h of light/dark). Animals were allowed for adaptive feeding 7 days before the experiments. All experimental procedures involving rats were monitored and approved by the Huai’an Maternity and Child Health Care Hospital, Huaian, Jiangsu, China.

Induction of asthma and experimental groups

Experimental asthma was induced in neonatal rats according to a previously described method (Zemmouri et al. 2017). Briefly, rats were sensitized with ovalbumin (1 mg) intraperitoneally adsorbed on Al(OH)3 gelatinous (20 mg) on 0, 7 and 14 days. Then, rats were challenged with ovalbumin (1.1%) in normal saline (100 µl) through intratracheal instillation on the 21st day. The following groups were used in this study: Group I: sham (normal rats), Group II: control (asthmatic rats), Group III: quercetin (25 mg/kg), and Group IV: quercetin (50 mg/kg). Quercetin was dissolved in dimethyl sulfoxide and administered orally to the neonatal rats for 15 consecutive weeks.

Collection of blood

At the end of treatments, rats were anesthetized by intraperitoneal administration of ketamine (100 mg/kg)/xylazine (10 mg/kg) and sacrificed by decapitation; blood was collected.

Preparation of lung tissue homogenate

After the mice were sacrificed, their lungs were surgically removed, and the tissues were cut into small pieces and homogenized in Tris–HCl buffer (50 mM, pH 7.4) at 10,000 rpm for 10 min. Tissue homogenate was centrifuged, and the supernatant was collected for further experiments (Upreti et al. 1991). All homogenate and supernatant preparations were performed at 4 °C.

Measurement of inflammatory cell numbers

Inflammatory cell counts were determined in bronchoalveolar lavage fluid (BALF) according to a previously described method (Feng et al. 2014).

Determination of serum inflammatory markers

Nitrate and nitrite are final products of NO metabolism and these levels are used for the quantification of NO. Sum of nitrate and nitrite accounts for the total NO concentration. Griess’s reaction was used for the determination of NO level in serum based on the nitrite concentration. In the serum, nitrate was reduced to nitrite in the presence of cadmium (Sigma-Aldrich Inc., Shangai, China). Then, nitrite was converted to nitric acid that reacts with Griess’s reagent (Sigma-Aldrich Inc., Shangai, China) to produce color. Serum level of nitrite was determined by measuring absorbance at 540 nm in a spectrophotometer (Shaheen et al. 2016). Serum levels of tumor necrosis factor-α (TNF-α) and interleukin-6 (IL-6) were determined according to a previously described method (Tavakkol Afshari et al. 2005).

Determination of blood coagulation time and coagulation factor activity

Fibrinogen level (FIB), prothrombin time (PT), thrombin time (TT), activated partial thromboplastin time (APTT), and the activity of coagulation factors were determined according to previously described methods (Feng et al. 2014).

Determination of apoptosis

Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) and staining were performed in lung sections as previously described (Sheikh-Hamad et al. 2004). Briefly, lung tissues were excised and perfused in normal saline, and then fixed in 10% neutral formalin (10%) for 24 h. Next, the lung sections were dehydrated with a graded series of alcohol and embedded in paraffin film. Finally, the sections were cut (4–5 µm thick) with a rotary microtome, and TUNEL staining was performed as previously described (Fayzullina and Martin 2014).

Determination of mRNA expression

Total RNA was isolated from neonatal lung tissues using TRIzol reagent, and 20 µl total RNA was converted into cDNA using oligo(dT)18. Quantitative PCR (qPCR) was conducted with cDNA samples using SYBR Green (Sigma). The mRNA expression levels of TNF-α, IL-6, and inducible nitric oxide synthase (iNOS) were determined according to a previously described method (Alfonso et al. 2002). The primers used in this study are shown in Table 1. GAPDH was used as an internal expression control.

Table 1.

List of RT-PCR primers used for the amplification of TNF-α, IL-6 and iNOS

S. no. Gene name Forward Reverse
1 TNF-α 5′-CCCAGACCCTCACACTCAGAT-3′ 5′-TTG TCC CTTGAA GAG AAC CTG-3′
2 IL-6 5′-AAGTTTCTCTCCGCAAGATAC TTCCAGCCA-3′ 5′-AGG CAAATTTCCTGGTTATATCCA GTTT-3′
3 iNOS 5′-CTCCATGACTCTCAGCACAGAG-3′ 5′-GCACCGAAGATATCCTCATGAT-3′
4 GAPDH 5′-TCCCTCAAGATTGTCAGCAA-3′ 5′-AGATCCACAACGGATACATT-3′
Open in a new tab

Immunohistochemistry

Lung tissues were excised and perfused in normal saline, and then, lung tissues were fixed in 10% neutral formalin (10%) for 24 h. Lung sections were dehydrated by graded alcohol and embedded in paraffin film. Paraffin-embedded lung sections were dewaxed, washed with deionized water and rinsed with PBS. Lung sections were incubated with goat serum (0.5% bovine serum albumin and 0.1% Tween) for 30 min. Then, sections were incubated with the anti-iNOS primary antibody (ab3523; Abcam) at 4 °C for 12 h, followed by the goat anti-mouse secondary antibody (ab205719; Abcam). Then, sections were counterstained with hematoxylin for 60 s. Finally, sections were imaged, and expressions were quantified (Rehg et al. 2012).

Histopathological analyses

Lung tissues were fixed in neutral formalin (10%), and sections 4–5-µm thick were stained with hematoxylin and eosin (H&E) for microscopic analyses (Althnaian et al. 2013).

Statistical analyses

Values are given as means with standard deviations. One-way ANOVA (SPSS 17, IBM SPSS Statistics, Hong Kong) was applied for statistical analyses of data, and Tukey’s post hoc tests were used for multiple comparisons. P values < 0.05 were considered statistically significant.

Results

This study evaluated the anti-asthmatic activity of quercetin glycosides in neonatal asthmatic rats. Total leukocyte content was substantially increased in neonatal asthmatic rats (Group II) compared to non-asthmatic controls (Group I). Total leukocyte content was increased by 477.1% in asthmatic rats, while quercetin glycoside treatment significantly reduced leukocyte contents by 36.6% and 67.3% in Groups III and IV, respectively (Fig. 1a, P < 0.05). Eosinophil content was also substantially increased in asthmatic rats, and quercetin glycosides significantly reduced eosinophils by 33.3% and 70.6% in Groups III and IV, respectively (Fig. 1a, P < 0.05). TNF-α and IL-6 levels, as pg/mg protein, were increased by more than 100% in the neonatal asthmatic rats. Treatment of rats with quercetin glycosides significantly reduced TNF-α levels by 32.5% and 73.7% in Groups III and IV, respectively (Fig. 1b, P < 0.05), and also reduced IL-6 (Fig. 1b, P < 0.05). NO concentration was increased by more than 100% in the neonatal asthmatic rats, and quercetin glycosides significantly reduced levels by 34.7% and 71.7% in Groups III and IV, respectively (Fig. 2a, P < 0.05).

Fig. 1.

Fig. 1

Open in a new tab

Effects of quercetin glycosides on inflammatory cell recruitment in BALF from neonatal asthmatic rats (a). Effects of quercetin glycosides on TNF-α and IL-6 levels in neonatal asthmatic rats expressed as pg/mg protein (b). *P < 0.05 vs. Group I and #P < 0.05 vs. Group II

Fig. 2.

Fig. 2

Open in a new tab

Effects of quercetin glycosides on NO levels (mM) in neonatal asthmatic rats (a). Effects of quercetin glycosides on FIB levels (g/l) in neonatal asthmatic rats (b). *P < 0.05 vs. Group I and #P < 0.05 vs. Group II

FIB was increased by 78.3% in neonatal asthmatic rats. However, treatment of rats with quercetin glycosides significantly reduced FIB by 7.3% and 26.8% in Groups III and IV, respectively (Fig. 2b, P < 0.05). PT, TT, and APTT were significantly increased in neonatal asthmatic rats but were considerably reduced following quercetin glycoside supplementation (Fig. 3, P < 0.05). The blood coagulation factors FII, FV, FVII, and FX were increased in neonatal asthmatic rats and were also reduced following quercetin glycoside supplementation (Fig. 4, P < 0.05).

Fig. 3.

Fig. 3

Open in a new tab

Effects of quercetin glycosides on TT, PT, and APTT in neonatal asthmatic rats; all times are in seconds (s). *P < 0.05 vs. Group I and #P < 0.05 vs. Group II

Fig. 4.

Fig. 4

Open in a new tab

Effects of quercetin glycosides on active blood coagulation factors FII, FV, FVII, and FX in neonatal asthmatic rats. Values indicate time in seconds (s). *P < 0.05 vs. Group I and #P < 0.05 vs. Group II

The percentage of apoptotic cells was elevated in the asthmatic rats. Again, treatment with quercetin glycosides significantly reduced apoptosis by 39.7% and 72.7% in Groups III and IV, respectively (Fig. 5, P < 0.05). The mRNA expression of inflammatory markers, such as TNF-α, IL-6, and iNOS, was quantified and expressed as fold changes. TNF-α, IL-6, and iNOS expression were increased by 1.3-, 1.04- and 1.1-fold, respectively, in the asthmatic group. However, treatment of rats with quercetin glycosides significantly reduced expression of all three markers by more than 0.4-fold in Group IV (Fig. 6, P < 0.05). Immunohistochemistry showed that iNOS protein expression increased by 0.9-fold in the asthmatic rats. Quercetin treatment reduced iNOS protein levels by 15.3% and 35.3% in Groups III and IV, respectively (Fig. 7, P < 0.05). Airway and blood vessel narrowing and the accumulation of eosinophils was observed in the lungs of neonatal asthmatic rats. However, treatment of rats with quercetin glycosides significantly reduced inflammation and eosinophil infiltration of the lung (Fig. 8).

Fig. 5.

Fig. 5

Open in a new tab

Effects of quercetin glycosides on apoptosis in neonatal asthmatic rats. Values represent the percentage of cells in apoptosis. *P < 0.05 vs. Group I and #P < 0.05 vs. Group II

Fig. 6.

Fig. 6

Open in a new tab

Effects of quercetin glycosides on the mRNA expression levels of TNF-α, IL-6, and iNOS in neonatal asthmatic rats. *P < 0.05 vs. Group I and #P < 0.05 vs. Group II

Fig. 7.

Fig. 7

Open in a new tab

Effects of quercetin glycosides on iNOS protein expression in neonatal asthmatic rats. *P < 0.05 vs. Group I and #P < 0.05 vs. Group II; scale bar is 100 µm

Fig. 8.

Fig. 8

Open in a new tab

Effects of quercetin glycosides on the cellular architecture of lungs in neonatal asthmatic rats. Sections were stained with H&E and analyzed by microscopy. Magnification = 100×; n = 6

Discussion

We evaluated the anti-asthmatic activity of quercetin glycosides in neonatal asthmatic rats. Several researchers have reported the wide usage of quercetin for the treatment of respiratory tract diseases (Di Carlo et al. 1999; Capasso et al. 2003). The various pharmacological and biological activities of quercetin such as inhibition of histamine release, and effects on angiogenesis, the Na+/K+ ATPase, angiotensin-converting enzyme II, tyrosine kinase, intestinal peristalsis, and protein kinase C have also been demonstrated (Murota and Terao 2003). In addition, quercetin affects the cell cycle and has antioxidant, antihypertensive, hepatoprotective, anticarcinogenic, and pro-apoptotic effects (Formica and Regelson 1995; Kuo 1997; Duarte et al. 2002; Murota and Terao 2003; Fusi et al. 2003; Gharzouli and Holzer 2004; Janbaz et al. 2004). Helms and Miller (2006) reported the protective effects of quercetin against chronic rhinosinusitis.

NO is a vital messenger that participates in various types of pathophysiology and plays a crucial role in the inhibition of non-adrenergic transmission (Gross et al. 1991; Ellis and Undem 1992; Fischer et al. 1993). Researchers have reported that NO is abundant in airway respiratory epithelia (Folkerts and Nijkamp 1998; Bove and van der Vliet 2006). Researcher have attributed increases in NO generation to the increased production of cytokines, iNOS, and prostaglandins. Increased NO production leads to oxidative stress, DNA damage, and cell injury (Murphy 1999). In our study, NO production was significantly reduced following quercetin supplementation. Our findings are consistent with earlier studies reporting quercetin-induced inhibition of NO (Gharzouli and Holzer 2004; Roghani et al. 2004; Ajay et al. 2003). Jackson and Venema (2006) found that quercetin inhibited NO synthase in endothelial cells of the bovine aorta.

Ko et al. (2002) reported the antispasmodic effects of 3-O-methyl quercetin (a quercetin glycoside) in isolated guinea pig trachea. Asthma involves chronic airway inflammation, and its significant symptoms include coughing, wheezing, and chest tightness. The infiltration of eosinophils, lymphocytes, and mast cells into the airway wall leads to mucus hypersecretion and allergic inflammation. Lung histopathological analyses confirmed the presence of severe inflammation in rats with induced asthma. Boots et al. (2011) reported that quercetin significantly decreased inflammation and oxidative stress in sarcoidosis. Askari et al. (2012) found that supplementation of quercetin with vitamin C also decreased inflammation and oxidative stress. In this study, the treatment of rats with quercetin glycosides significantly attenuated inflammation, which indicates its protective effect against asthma.

Conclusion

In summary, quercetin glycosides significantly reduced inflammatory markers, which suggests that they have protective effects against neonatal asthma in rats.

Funding

The study was supported by the Huai’an science and technology bureau (No: HAS2015010).

Compliance with ethical standards

Conflict of interest

Authors declare that they have no conflict of interest.

Contributor Information

Yumei Wang, Phone: 0086-13861561310, Email: wi85t8@163.com.

Xiaofei Lin, Phone: +86 517 8397 9106, Email: ARedaret@yahoo.com.

References

  1. Ajay M, Gilani AU, Mustafa MR. Effect of flavonoids on the vascular smooth muscle of the isolated rat thoracic aorta. Life Sci. 2003;74:603–612. doi: 10.1016/j.lfs.2003.06.039. [DOI] [PubMed] [Google Scholar]
  2. Alfonso J, Pollevick GD, Castensson A, Jazin E, Frasch AC. Analysis of gene expression in the rat hippocampus using real-time PCR reveals high inter-individual variation in mRNA expression levels. J Neurosci Res. 2002;67(2):225–234. doi: 10.1002/jnr.10105. [DOI] [PubMed] [Google Scholar]
  3. Althnaian T, Albokhadaim I, El-Bahr SM. Biochemical and histopathological study in rats intoxicated with carbon tetrachloride and treated with camel milk. Spring Plus. 2013;2:57. doi: 10.1186/2193-1801-2-57. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Askari G, Ghiasvand R, Feizi A, Ghanadian SM, Karimian J. The effect of quercetin supplementation on selected markers of inflammation and oxidative stress. J Res Med Sci. 2012;17(7):637–641. [PMC free article] [PubMed] [Google Scholar]
  5. Boots AW, Drent M, de Boer VC, Bast A, Haenen GR. Quercetin reduces markers of oxidative stress and inflammation in sarcoidosis. Clin Nutr. 2011;30(4):506–512. doi: 10.1016/j.clnu.2011.01.010. [DOI] [PubMed] [Google Scholar]
  6. Bove PF, van der Vliet A. Nitric oxide and reactive nitrogen species in airway epithelial signaling and inflammation. Free Radic Biol Med. 2006;41:515–527. doi: 10.1016/j.freeradbiomed.2006.05.011. [DOI] [PubMed] [Google Scholar]
  7. Capasso F, Gaginella TS, Grandolini G, Izzo AA. Phytotherapy. A quick reference of herbal medicine. Heidelberg: Springer; 2003. [Google Scholar]
  8. Chuang CH, Yeh CL, Yeh SL, Lin ES, Wang LY, Wang YH. Quercetin metabolites inhibit MMP-2 expression in A549 lung cancer cells by PPAR-γ associated mechanisms. J Nutr Biochem. 2016;33:45–53. doi: 10.1016/j.jnutbio.2016.03.011. [DOI] [PubMed] [Google Scholar]
  9. Di Carlo G, Mascolo N, Izzo AA, Capasso F. Flavonoids: old and new aspects of a class of natural therapeutic drugs. Life Sci. 1999;65:337–353. doi: 10.1016/S0024-3205(99)00120-4. [DOI] [PubMed] [Google Scholar]
  10. Duarte J, Jiménez R, O’Valle F, Galisteo M, Pérez-Palencia R, Vargas F, Pérez-Vizcaíno F, Zarzuelo A, Tamargo J. Protective effects of the flavonoid quercetin in chronic nitric oxide deficient rats. J Hypertens. 2002;20:1843–1854. doi: 10.1097/00004872-200209000-00031. [DOI] [PubMed] [Google Scholar]
  11. Ellis JL, Undem BJ. Inhibition by L-NG-nitro-L-arginine of nonadrenergic-noncholinergic-mediated relaxations of human isolated central and peripheral airway. Am Rev Respir Dis. 1992;146:1543–1547. doi: 10.1164/ajrccm/146.6.1543. [DOI] [PubMed] [Google Scholar]
  12. Fayzullina S, Martin LJ. Detection and analysis of DNA damage in mouse skeletal muscle In Situ using the TUNEL method. JoVE. 2014;94:52211. doi: 10.3791/52211. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Feng D, Chengbin W, Jinyan D, Weiyi Z, Daijun X, Mianyang L. Puerarin attenuates ovalbumin-induced lung inflammation and hemostatic unbalance in rat asthma model. Evidence Based Complement Altern Med. 2014;2014:726740. doi: 10.1155/2014/791841. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Fischer A, Mundel P, Mayer B, Preissler U, Philippin B, Kummer W. Nitric oxide synthase in guinea pig lower airway innervation. Neurosci Lett. 1993;149:157–160. doi: 10.1016/0304-3940(93)90760-I. [DOI] [PubMed] [Google Scholar]
  15. Folkerts G, Nijkamp FP. Airway epithelium: more than just a barrier! Trends Pharmacol Sci. 1998;19:334–341. doi: 10.1016/S0165-6147(98)01232-2. [DOI] [PubMed] [Google Scholar]
  16. Formica JV, Regelson W. Review of the biology of quercetin and related bioflavonoids. Food Chem Toxicol. 1995;33:1061–1080. doi: 10.1016/0278-6915(95)00077-1. [DOI] [PubMed] [Google Scholar]
  17. Fusi F, Saponara S, Pessina F, Gorelli B, Sgaragli G. Effects of quercetin and rutin on vascular preparations: a comparison between mechanical and electrophysiological phenomena. Eur J Nutr. 2003;42:10–17. doi: 10.1007/s00394-003-0395-5. [DOI] [PubMed] [Google Scholar]
  18. Gharzouli K, Holzer P. Inhibition of guinea pig intestinal peristalsis by the flavonoids quercetin, naringenin, apigenin, and genistein. Pharmacology. 2004;70:5–14. doi: 10.1159/000074237. [DOI] [PubMed] [Google Scholar]
  19. Gross SS, Jaffe EA, Levi R, Kilbourn RG. Cytokine-activated endothelial cells express an isotype of nitric oxide synthase which is tetrahydrobiopterin-dependent, calmodulin-independent and inhibited by arginine analogs with a rank-order of potency characteristic of activated macrophages. Biochem Biophys Res Commun. 1991;178:823–829. doi: 10.1016/0006-291X(91)90965-A. [DOI] [PubMed] [Google Scholar]
  20. Han RT, Kim S, Choi K, Lee J, Kim HY, Kim HJ, Kim HR, Back SK, Na HS. Asthma-like airway inflammation and responses in a rat model of atopic dermatitis induced by neonatal capsaicin treatment. J Asthma Allergy. 2017;10:181–189. doi: 10.2147/JAA.S124902. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Helms S, Miller AL. Natural treatment of chronic rhinosinusitis. ltern Med Rev. 2006;11:196–207. [PubMed] [Google Scholar]
  22. Herrmann K. Of the occurrence of flavonol and flavone glycosides in vegetables. Z Lebensm Unters Forsch. 1988;186:1–5. doi: 10.1007/BF01027170. [DOI] [Google Scholar]
  23. Jackson SJ, Venema RC. Quercetin inhibits eNOS, microtubule polymerization, and mitotic progression in bovine aortic endothelial cells. J Nutr. 2006;136:1178–1184. doi: 10.1093/jn/136.5.1178. [DOI] [PubMed] [Google Scholar]
  24. Janbaz KH, Saeed SA, Gilani AH. Studies on the protective effects of caffeic acid and quercetin on chemical-induced hepatotoxicity in rodents. Phytomedicine. 2004;11:424–430. doi: 10.1016/j.phymed.2003.05.002. [DOI] [PubMed] [Google Scholar]
  25. Kelly C, Ward C, Stenton CS, Bird G, Hendrick DJ, Walters EH. Number and activity of inflammatory cells in bronchoalveolar lavage fluid in asthma and their relation to airway responsiveness. Thorax. 1988;43(9):684–692. doi: 10.1136/thx.43.9.684. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Ko WC, Wang HL, Lei CB, Shih CH, Chung MI, Lin CN. Mechanisms of relaxant action of 3-O-methyl quercetin in isolated guinea pig trachea. Planta Med. 2002;68:30–35. doi: 10.1055/s-2002-20059. [DOI] [PubMed] [Google Scholar]
  27. Kuo SM. Dietary flavonoid and cancer prevention: evidence and potential mechanism. Crit Rev Oncog. 1997;8:47–69. doi: 10.1615/CritRevOncog.v8.i1.30. [DOI] [PubMed] [Google Scholar]
  28. Martinez FD. Genes, environments, development, and asthma: a reappraisal. Eur Respir J. 2007;29(1):179–184. doi: 10.1183/09031936.00087906. [DOI] [PubMed] [Google Scholar]
  29. Murota K, Terao J. Antioxidative flavonoid quercetin: implication of its intestinal absorption and metabolism. Arch Biochem Biophys. 2003;417:12–17. doi: 10.1016/S0003-9861(03)00284-4. [DOI] [PubMed] [Google Scholar]
  30. Murphy MP. Nitric oxide and cell death. Biochim Biophys Acta. 1999;1411(2–3):401–414. doi: 10.1016/S0005-2728(99)00029-8. [DOI] [PubMed] [Google Scholar]
  31. Rehg JE, Bush D, Ward JM. The utility of immunohistochemistry for the identification of hematopoietic and lymphoid cells in normal tissues and interpretation of proliferative and inflammatory lesions of mice and rats. Toxicol Pathol. 2012;40(2):345–345. doi: 10.1177/0192623311430695. [DOI] [PubMed] [Google Scholar]
  32. Roghani M, Baluchnejadmojarad T, Vaez-Mahdavi MR, Roghani-Dehkordi F. Mechanisms underlying quercetin-induced vasorelaxation in the aorta of subchronic diabetic rats: an in vitro study. Vascul Pharmacol. 2004;42:31–35. doi: 10.1016/j.vph.2004.12.001. [DOI] [PubMed] [Google Scholar]
  33. Ross JA, Kasum CM. Dietary flavonoids: bioavailability, metabolic effects, and safety. Annu Rev Nutr. 2002;22:19–34. doi: 10.1146/annurev.nutr.22.111401.144957. [DOI] [PubMed] [Google Scholar]
  34. Shaheen TI, El-Naggar MI, Hussein JS, El-Bana M, Emara E, El-Khayat Z, Fouda MMG, Ebaid H, Hebeish A. Antidiabetic assessment; in vivo study of gold and core–shell silver–gold nanoparticles on streptozotocin-induced diabetic rats. Biomed Pharmacother. 2016;83:865–875. doi: 10.1016/j.biopha.2016.07.052. [DOI] [PubMed] [Google Scholar]
  35. Sheik-Hamad D, Cacini W, Buckley AR, Isaac J, Truong LD, Tsao CC, Kishore BK. Cellular and molecular studies on cisplatin-induced apoptotic cell death in rat kidney. Arch Toxicol. 2004;78(3):147–155. doi: 10.1007/s00204-003-0521-4. [DOI] [PubMed] [Google Scholar]
  36. Shichinohe K, Shimizu M, Kurokawa K. Effect of M-711 on experimental asthma in rats. J Vet Med Sci. 1996;58(1):55–59. doi: 10.1292/jvms.58.55. [DOI] [PubMed] [Google Scholar]
  37. Tavakkol Afshari J, Ghomian N, Shameli A, Shakeri MT, Fahmidehkar MA, Mahajer E, Khoshnavaz R, Emadzadeh M. Determination of interleukin-6 and tumor necrosis factor-alpha concentrations in Iranian-Khorasanian patients with preeclampsia. BMC Pregnancy Childbirth. 2005;5:14. doi: 10.1186/1471-2393-5-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Upreti GC, Davis C, Oliver J. Preparation of representative homogenates of biological tissues: effect of salt on protein extraction. Anal Biochem. 1991;198(2):298–301. doi: 10.1016/0003-2697(91)90428-V. [DOI] [PubMed] [Google Scholar]
  39. Yeh SL, Lin YC, Lin YL, Li CC, Chuang CH. Comparing the metabolism of quercetin in rats, mice, and gerbils. Eur J Nutr. 2016;55(1):413–422. doi: 10.1007/s00394-015-0862-9. [DOI] [PubMed] [Google Scholar]
  40. Zemmouri H, Sekiou O, Ammar S, El Feki A, Bouaziz M, Messarah M, Boumendjel A. Urtica dioica attenuates ovalbumin-induced inflammation and lipid peroxidation of lung tissues in rat asthma model. Pharm Biol. 2017;55(1):1561–1568. doi: 10.1080/13880209.2017.1310905. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from 3 Biotech are provided here courtesy of Springer

RESOURCES