Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2020 Jun 1.
Published in final edited form as: J Psychiatr Res. 2019 Jan 29;113:34–38. doi: 10.1016/j.jpsychires.2019.01.021

Microduplications at the 15q11.2 BP1–BP2 locus are enriched in patients with anorexia nervosa

Xiao Chang 1,#, Huiqi qu 1,#, Yichuan Liu 1, Joseph Glessner 1, Cuiping Hou 1, Fengxiang Wang 1, Jin Li 1, Patrick Sleiman 1,3,4, Hakon Hakonarson 1,3,4,†
PMCID: PMC6486445  NIHMSID: NIHMS1524030  PMID: 30878790

Abstract

Microduplication at 15q11.2 have been reported in genetic association studies of schizophrenia and autism. Given the potential overlap in psychiatric symptoms of schizophrenia and autism with anorexia nervosa (AN), we were inspired to test the association of this CNV locus with the genetic susceptibility of AN using ParseCNV, a highly quality controlled CNV pipeline developed by our group. The CNV analysis was performed in 1,017 AN cases and 7,250 controls using the Illumina HumanHap610 SNP arrays data. We uncovered association of the 15q11.2 microduplication with AN with P=0.00023, while no genetic association between the microdeletion of this region and AN was identified. Among four genes in this region that are not imprinted, NIPA1 has the highest expression in brain and encodes a magnesium transporter protein on early endosomes and the cell surface in neurons. Targeting at Mg2+ uptake mediated by NIPA1 presents an interesting research topic for the explorations of novel therapy for AN and other neurobehavioral diseases, such as schizophrenia and autism.

Keywords: Anorexia nervosa, copy number variation, CYFIP1, NIPA1, NIPA2

Introduction

Rearrangements of human chromosome 15q11-q14 region have attracted extensive attention due to the critical implications of this locus in human diseases, with six breakpoint regions (BP1-BP6) being described(Pujana et al., 2002). Two extensively studied diseases attributed to genetic variation at this locus are Prader-Willi syndrome (PWS; [MIM 176270]) and Angelman syndrome (AS; [MIM 105830]).

Deletions involving 15q11.2

PWS was named after two pediatricians, Andrea Prader and Heinrich Willi, who first described this disease.(Prader and Willi, 1963), which is characterized by hypotonia and feeding difficulties in early infancy, and excessive eating and gradual development of morbid obesity in later infancy or early childhood (Driscoll et al., 1993). It is caused by the deletion of the paternal copy of the imprinted gene region 15q11-q13, while the genes in this region on the maternal copy are virtually inactive through imprinting (Horsthemke and Wagstaff, 2008). The typical deletion is either a larger deletion of BP1-BP3 or a smaller deletion of BP2-BP3(Driscoll et al., 1993). AS was named after the British Pediatrician, Harry Angelman, who first described the disease (Angelman, 1965), which is characterized by developmental delay, intellectual disability, speech impairment, gait ataxia, and a unique inappropriate happy demeanor of frequent laughing and smiling (Dagli et al., 1993). In contrast to PWS, it is commonly caused by a 5-to 7-Mb deletion or imprinting defect of the maternal copy of the gene region 15q11-q13. Like PWS, the deletion is either a larger deletion of BP1-BP3 or a smaller deletion of BP2-BP3(Dagli et al., 1993).

In addition to PWS and AS, a heterozygous microdeletion of approximately 300 to 500 kb between BP1 and BP2 causes the chromosome 15q11.2 deletion syndrome (MIM 615656), which is associated with developmental and language delay and neurobehavioral disturbances, including autism, attention deficit-hyperactivity disorder (ADHD), obsessive-compulsive disorder (OCD), seizures, schizophrenia, intellectual impairment such as dyslexia and dyscalculia, and mild dysmorphic features (Burnside et al., 2011; Butler, 2017; Cox and Butler, 2015; Doornbos et al., 2009; Ulfarsson et al., 2017). Four genes are mapped to the microdeletion, tubulin gamma complex associated protein 5(TUBGCP5), NIPA magnesium transporter 1(NIPA1), NIPA magnesium transporter 2(NIPA2), and cytoplasmic FMR1 interacting protein 1(CYFIP1). Unlike the deletions in PWS and AS, these genes are not imprinted(Chai et al., 2003).

Duplications involving 15q11.2

Proximal chromosomal 15q are enriched with segmental duplications (Bailey et al., 2002; Zody et al., 2006). Maternal duplications of the Prader-Willi/Angelman Critical Region (PWACR) within Chr15q11.2-q13.1 causes 15q Duplication Syndrome, characterized by hypotonia, ataxia, intellectual disability, autism spectrum disorder (ASD), and epilepsy(Finucane et al., 1993) (Bundey et al., 1994) (Coppola et al., 2013). Paternal duplications of the PWACR may have less deleterious effect on development, but are associated with variable phenotypes, such as parasomnia or ASD(Finucane et al., 1993) (Urraca et al., 2013). Compared to microdeletion of BP1-BP2, microduplication of BP1-BP2 may have milder phenotypes including cognitive impairment, speech delay and developmental delay(Benitez-Burraco et al., 2017; Burnside et al., 2011; Menten et al., 2006), as well as high inter-individual variability of neurodevelopmental disorders(Picinelli et al., 2016).

Microduplication of BP1-BP2 and anorexia nervosa

Using the Illumina HumanHap610 single nucleotide polymorphism (SNP) arrays with ~610,000 markers, our group performed a copy number variation (CNV) analysis in a population sample of anorexia nervosa (AN), including 1,033 cases and 3,773 controls(Wang et al., 2011). The CNV calls were generated using the PennCNV software, which is based on an integrated hidden Markov model and incorporates signal intensity of each SNP, the distance between neighboring SNPs, and the allele frequency(Wang et al., 2007). A microduplication locus at 15q11.2 was suggested of genetic association with AN with nominal significance (P=0.036), whereas it did not pass correction for multiple testings(Wang et al., 2011). However, a recent case-only study including 1983 cases of AN did not identify this microduplication locus, while genotyping data of the Illumina 660W-Quad SNP arrays(Boraska et al., 2014) and PennCNV were used for the CNV analysis (Yilmaz et al., 2017).

Previously, microduplication of BP1-BP2 at 15q11.2 has been reported to be associated with both schizophrenia(Kirov et al., 2012) and autism(Burnside et al., 2011; van der Zwaag et al., 2010). Schizophrenia and AN are two related diseases. There is a high prevalence of comorbidity of the two diseases and AN has been reported to coexist in 1%~4% of schizophrenia patients(Kouidrat et al., 2014). The symptoms of AN may precede the onset of schizophrenia, whereas psychotic symptoms may also occur in the process of AN(Morylowska-Topolska et al., 2017). GWA studies have suggested the two diseases may share common genetic factors. For example, the A-kinase anchoring protein 6 gene (AKAP6), highly expressed in brain(Fagerberg et al., 2014), was identified in genetic association studies of both AN and schizophrenia (Goes et al., 2015; Li et al., 2017; Wang et al., 2011). The SOX2 overlapping transcript gene (SOX2-OT), producing alternatively spliced long non-coding RNAs with tissue-specific expression in brain(Fagerberg et al., 2014), was identified in genetic association studies of both AN and schizophrenia(2014; Boraska et al., 2014; Goes et al., 2015; Li et al., 2017). Autism spectrum disorder and AN are also closely related(Westwood and Tchanturia, 2017). Previous studies have shown over-representation of autism spectrum disorder in AN(Huke et al., 2013; Westwood et al., 2016). The family with FAM155Asignal of tissue-specific expression in brain(Fagerberg et al., 2014) was identified in genetic association of both AN and autism(2013; Wang et al., 2011).

Based on the above evidence, the microduplication of BP1-BP2 presents an interesting candidate for impacting the genetic susceptibility of AN. Further understanding of this locus may help to understand the molecular mechanism of AN, as well as its overlap and genetic sharing with other mental disorders. Here, we used our optimized CNV algorithm (ParseCNV) and focused on the CNV analysis of the BP1-BP2 locus. ParseCNV was developed by our group as a robust CNV analytical tool (Glessner et al., 2013), uncovering an interesting association signal at the microduplication locus, BP1-BP2, at 15q11.2.

Methods

CNV analysis

The CNV analysis was done in 1,033 AN cases (1009 females and 24 males) and 7,529 controls based on the Illumina HumanHap610 SNP arrays data. The AN samples were collected in North America and Europe by an international, multisite group with experienced academic collaborators in assessing eating-disordered individuals, while consistent behavioral assessment procedures across sites were established (Kaye et al., 2000; Wang et al., 2011). All cases met an unequivocal lifetime core diagnosis of AN by DSM-IV criteria, waiving the single criterion of amenorrhea because some cases were treated with exogenous hormone replacement, thus without amenorrhea(Kaye et al., 2000). All cases were diagnosed of AN by age 25 and for at least 3 years(Kaye et al., 2000). Structured interview of anorexia nervosa and bulimic syndromes (SIAB) was used for an assessment of eating disorder symptoms and course of illness(Fichter et al., 1998). The inclusion criteria for the research subjects and the genotyping method were described elsewhere(Wang et al., 2011). Population stratification was examined using the principal component analysis (PCA) analysis (supplementary Fig.1), and outliers were removed. There were 1,017 AN cases and 7,250 controls after the quality control process. The CNV was called and tested for genetic association by the software, ParseCNV(Glessner et al., 2013). The latter software presents a major improvement in the CNV calling pipeline given the built-in comprehensive QC analysis component which scrutinizes CNV calls with multiple lines of evidence, including CNV call overlap profiles, genomic context, number of probes supporting the CNV call and single probe intensities(Glessner et al., 2013).

Validation of the CNV locus by quantitative polymerase chain reaction

Five available DNA samples from AN were used for the validation of the CNV locus using quantitative polymerase chain reaction (qPCR). Probes and primer sequences were selected using the ProbeFinder v2.49 software (Roche, Indianapolis, IN) from the Universal Probe Library (UPL, Roche, Indianapolis, IN). The probe and primers used in this study are: the probe #27, cat.no. 04687582001; the left primer sequence 5’-ctcaatcgagcacaactactgc-3’; the right primer Sequence 5’-gagtcgagagtttccattcca-3’; Amplicon Sequence 5’-ctcaatcgagcacaactactgcttcgacaggcagcttactggaatggaaactctcgactc-3’. The probe is in the NIPA2 gene. The qPCR was performed on an ABI Prism™ 7900HT Sequence Detection System (Applied Biosystems, Foster City, CA). Each sample reaction was done in triplicate, in 10 ul of reaction mixture containing 10 ng genomic DNA, 100 nM of the UPL probe, 400 nM of each PCR primer, and 1× TaqMan Gene Expression Master Mix containing UDG and ROX (Life Technologies, Carlsbad, CA). Two samples of reference genomic DNA with normal copy number (Promega, Madison, WI) were included in the assay as normal controls. Data were collected using the Sequence Detection Software v2.4 (Applied Biosystems, Foster City, CA), and analyzed by the ∆∆CT method.

Results

Using the ParseCNV pipeline, heterozygous microduplication at the 15q11.2 BP1–BP2 locus was called in 13 out of 1,017 cases and 24 out of 7,250 controls (Table 1). Among the 13 patients, 5 cases are of the binge–purge type, 5 cases are restrictive type, and 3 cases have no subtype information of the AN phenotype. The plots of B-allele frequency (BAF) and Log R Ratio (LRR) in the cases are shown in Supplementary Fig.2. In addition, we confirmed the CNV locus by qPCR (Fig.1) in five individuals with available DNA, i.e., all five individuals with the microduplication showed higher gene dosage than two control individuals, while two control genes with normal copy number showed no difference across different individuals. Thus, we could only do the confirmation in five AN cases with the microduplication as the other eight AN cases with the microduplication did not have DNA available. Shown by our results, the 15q11.2 BP1– BP2 microduplication is significantly enriched in the case group with P=0.00023, OR(95% CI)=3.90 (1.98, 7.68). In contract, the 15q11.2 BP1–BP2 microdeletion has no difference between cases and controls.

Table 1.

The 15q11.2 BP1–BP2 microduplication in anorexia nervosa

CNV total Heterozygote* (n) Normal copy number (n) Fisher’s Exact Test P value
Microduplication Copy number≥3 Copy number=2
Cases† 1017 13 (1.28%) 1004 (98.72%) 0.00023
Controls 7250 24 (0.33%) 7226 (99.67%)
Microdeletion Copy number=1 Copy number=2
Cases‡ 1017 3 (0.29%) 1014 (99.71%) 1
Controls 7250 24 (0.33%) 7226 (99.67%)
Open in a new tab
*

Heterozygous microduplication or hemizygous microdeletion.

†

Among the 13 patients, 5 cases are binge–purge type, 5 cases are restrictive type, and 3 cases have no subtype information of the AN phenotype.

‡

Among these 3 cases, 2 cases are binge–purge type and 1 case has no subtype information of the AN phenotype.

Fig.1.

Fig.1

Open in a new tab

The CNV locus confirmation by qPCR. The probe is in the NIPA2 gene. In details, it is Probe #27 (cat.no. 04687582001, Sigma-Aldrich, St. Louis, MO). For the amplification, Left Primer: ctcaatcgagcacaactactgc; Right Primer: gagtcgagagtttccattcca; the Amplicon Sequence: ctcaatcgagcacaactactgcttcgacaggcagcttactggaatggaaactctcgactc; the Amplicon Length: 60bp; chromosome position: chr15:23033527–23033586 (hg19). Each individual with the microduplication showed higher gene dosage than two control individuals, while two control genes with normal copy number, GAPDH and SNCA, showed no difference across different individuals. Microduplication at 15q11.2 was analyzed in 1,017 AN cases and 7,250 controls; Association of the 15q11.2 microduplication with AN was identified with P=0.00023; NIPA1 at this locus has the highest expression in brain and encodes a magnesium transporter protein.

Discussion

AN is an eating disorder and a complex disease associated with significant morbidity and mortality, and notably more common in females (Diagnostic, 2000). While the etiology of AN remains largely unknown, there is evidence to suggest a strong genetic component in the susceptibility to AN. The relative risk of first-degree female relatives of individuals with AN are >10 times higher than in the reference population(Strober et al., 2000). Twin studies demonstrate heritability of about 56%(Bulik et al., 2006; Wade et al., 2000).

In this study, we used ParseCNV(Glessner et al., 2013), which is a QC-enriched version of PennCNV(Wang et al., 2007) also developed in our laboratory. We uncovered association of the susceptibility of AN for the candidate genetic locus, at 15q11.2 BP1–BP2, harboring a microduplication, which has been previously extensively highlighted for its roles in neurobehavioral disorders (Wang et al., 2011). The association of the 15q11.2 BP1–BP2 microduplication is for the first time shown with AN. The 15q11.2 BP1–BP2 locus contains four genes that are not imprinted, i.e. TUBGCP5, NIPA1, NIPA2, and CYFIP1(Chai et al., 2003). In addition, our results show that it is the duplication, but not deletion, of this region, which is associated with the susceptibility to AN. What have been observed in PWS is that deletion in this region is associated with the phenotype of excessive eating. This is in line with what we have found in the current study, i.e. microdeletion is not associated with anorexia nervosa, but in contrast to deletion causing excessive eating, microduplication in this region is associated with the genetic susceptibility of AN.

The function of these four genes remains unclear. Previous reports indicate that mutations in NIPA2 may result in haploinsufficiency of the gene that are associated with childhood absence epilepsy(Jiang et al., 2012), but controversy remains(Hildebrand et al., 2014). All four genes are ubiquitously expressed in different tissues, however, NIPA1 has the highest expression in brain among different tissues(Fagerberg et al., 2014). As a magnesium transporter, the NIPA1 protein associates with early endosomes and the cell surface in a variety of neuronal and epithelial cells, and mediates Mg2+ uptake(Goytain et al., 2007). Dominant negative mutations of NIPA1 cause spastic paraplegia-6 (APG6)(Chen et al., 2005; Rainier et al., 2003; Reed et al., 2005). As shown by our study, haploinsufficiency from hemideletion of NIPA1 is not associated with AN. However, the 15q11.2 BP1–BP2 microduplication may lead to a gain-of-function of NIPA1, while abnormal intracellular Mg2+ may have inhibitory influence on neurons and decreases neuronal survival(Dribben et al., 2010). Previous studies show that Mg2+ functions to block NMDA receptors(Pittaluga et al., 2000), and NMDA receptors have been suggested to play a role in a female patient with anti-NMDA receptor encephalitis presenting as atypical AN(Perogamvros et al., 2012). Therefore, further study on NIPA1 in AN is needed as this gene may turn out to be a potential drug target for the treatment of AN and other neurobehavioral diseases as it has also shown association with schizophrenia(Kirov et al., 2012) and autism(Burnside et al., 2011; van der Zwaag et al., 2010). In addition, according to a previous microarray study on gene expression in the prefrontal cortex in 15 cases with eating disorders (ED, including 7 bulimia nervosa, 2 anorexia nervosa, binge–purge type, 3 AN, and 3 eating disorder not otherwise specified) and 102 nonpsychiatric controls, the expression of CYFIP1 shows a trend of higher expression in ED cases with P=0.06 (Supplementary Fig. 3, the Gene Expression Omnibus accession GSE60190) (Jaffe et al., 2014). It should be noted that among these patients, only 5 of them have confirmatory evidence of being AN cases. The GSE60190 dataset is lack of phenotype information to enable further analysis of ED subtypes (Jaffe et al., 2014). On the other hand, it is known that different ED subtypes may share same mechanisms(Schulte et al., 2016). Therefore, there might be an association of increased CYFIP1 gene dosage by the 15q11.2 microduplication with AN. The different expression of CYFIP1 could also be a component of a series of changes, regulated by a transcription factor or an epigenetic mechanism. The role of CYFIP1 in AN warrants further study. As a limitation of this study, the in silico results presented in this paper could not be verified in a majority of the cases by wet lab approach because of the unavailability of any more DNA material, thus the new CNV findings should be validated in an independent sample in a future study.

Supplementary Material

1
2
3
4

ACKNOWLEDGMENTS

Conflict of Interest statement. None declared.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  1. 2013. Identification of risk loci with shared effects on five major psychiatric disorders: a genome-wide analysis. Lancet (London, England) 381(9875), 1371–1379. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. 2014. Biological insights from 108 schizophrenia-associated genetic loci. Nature 511(7510), 421–427. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Angelman H, 1965. ‘Puppet’children a report on three cases. Developmental Medicine & Child Neurology 7(6), 681–688. [DOI] [PubMed] [Google Scholar]
  4. Bailey JA, Gu Z, Clark RA, Reinert K, Samonte RV, Schwartz S, Adams MD, Myers EW, Li PW, Eichler EE, 2002. Recent segmental duplications in the human genome. Science (New York, N.Y.) 297(5583), 1003–1007. [DOI] [PubMed] [Google Scholar]
  5. Benitez-Burraco A, Barcos-Martinez M, Espejo-Portero I, Jimenez-Romero S, 2017. Variable Penetrance of the 15q11.2 BP1-BP2 Microduplication in a Family with Cognitive and Language Impairment. Molecular syndromology 8(3), 139–147. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Boraska V, Franklin CS, Floyd JA, Thornton LM, Huckins LM, Southam L, Rayner NW, Tachmazidou I, Klump KL, Treasure J, Lewis CM, Schmidt U, Tozzi F, Kiezebrink K, Hebebrand J, Gorwood P, Adan RA, Kas MJ, Favaro A, Santonastaso P, Fernandez-Aranda F, Gratacos M, Rybakowski F, Dmitrzak-Weglarz M, Kaprio J, Keski-Rahkonen A, Raevuori A, Van Furth EF, Slof-Op ‘t Landt MC, Hudson JI, Reichborn-Kjennerud T, Knudsen GP, Monteleone P, Kaplan AS, Karwautz A, Hakonarson H, Berrettini WH, Guo Y, Li D, Schork NJ, Komaki G, Ando T, Inoko H, Esko T, Fischer K, Mannik K, Metspalu A, Baker JH, Cone RD, Dackor J, DeSocio JE, Hilliard CE, O’Toole JK, Pantel J, Szatkiewicz JP, Taico C, Zerwas S, Trace SE, Davis OS, Helder S, Buhren K, Burghardt R, de Zwaan M, Egberts K, Ehrlich S, Herpertz-Dahlmann B, Herzog W, Imgart H, Scherag A, Scherag S, Zipfel S, Boni C, Ramoz N, Versini A, Brandys MK, Danner UN, de Kovel C, Hendriks J, Koeleman BP, Ophoff RA, Strengman E, van Elburg AA, Bruson A, Clementi M, Degortes D, Forzan M, Tenconi E, Docampo E, Escaramis G, Jimenez-Murcia S, Lissowska J, Rajewski A, Szeszenia-Dabrowska N, Slopien A, Hauser J, Karhunen L, Meulenbelt I, Slagboom PE, Tortorella A, Maj M, Dedoussis G, Dikeos D, Gonidakis F, Tziouvas K, Tsitsika A, Papezova H, Slachtova L, Martaskova D, Kennedy JL, Levitan RD, Yilmaz Z, Huemer J, Koubek D, Merl E, Wagner G, Lichtenstein P, Breen G, Cohen-Woods S, Farmer A, McGuffin P, Cichon S, Giegling I, Herms S, Rujescu D, Schreiber S, Wichmann HE, Dina C, Sladek R, Gambaro G, Soranzo N, Julia A, Marsal S, Rabionet R, Gaborieau V, Dick DM, Palotie A, Ripatti S, Widen E, Andreassen OA, Espeseth T, Lundervold A, Reinvang I, Steen VM, Le Hellard S, Mattingsdal M, Ntalla I, Bencko V, Foretova L, Janout V, Navratilova M, Gallinger S, Pinto D, Scherer SW, Aschauer H, Carlberg L, Schosser A, Alfredsson L, Ding B, Klareskog L, Padyukov L, Courtet P, Guillaume S, Jaussent I, Finan C, Kalsi G, Roberts M, Logan DW, Peltonen L, Ritchie GR, Barrett JC, Estivill X, Hinney A, Sullivan PF, Collier DA, Zeggini E, Bulik CM, 2014. A genome-wide association study of anorexia nervosa. Molecular psychiatry 19(10), 1085–1094. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Bulik CM, Sullivan PF, Tozzi F, Furberg H, Lichtenstein P, Pedersen NL, 2006. Prevalence, heritability, and prospective risk factors for anorexia nervosa. Archives of general psychiatry 63(3), 305–312. [DOI] [PubMed] [Google Scholar]
  8. Bundey S, Hardy C, Vickers S, Kilpatrick MW, Corbett JA, 1994. Duplication of the 15q11–13 region in a patient with autism, epilepsy and ataxia. Dev Med Child Neurol 36(8), 736–742. [DOI] [PubMed] [Google Scholar]
  9. Burnside RD, Pasion R, Mikhail FM, Carroll AJ, Robin NH, Youngs EL, Gadi IK, Keitges E, Jaswaney VL, Papenhausen PR, Potluri VR, Risheg H, Rush B, Smith JL, Schwartz S, Tepperberg JH, Butler MG, 2011. Microdeletion/microduplication of proximal 15q11.2 between BP1 and BP2: a susceptibility region for neurological dysfunction including developmental and language delay. Hum Genet 130(4), 517–528. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Butler MG, 2017. Clinical and genetic aspects of the 15q11.2 BP1-BP2 microdeletion disorder. Journal of intellectual disability research : JIDR 61(6), 568–579. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Chai JH, Locke DP, Greally JM, Knoll JH, Ohta T, Dunai J, Yavor A, Eichler EE, Nicholls RD, 2003. Identification of four highly conserved genes between breakpoint hotspots BP1 and BP2 of the Prader-Willi/Angelman syndromes deletion region that have undergone evolutionary transposition mediated by flanking duplicons. Am J Hum Genet 73(4), 898–925. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Chen S, Song C, Guo H, Xu P, Huang W, Zhou Y, Sun J, Li CX, Du Y, Li X, Liu Z, Geng D, Maxwell PH, Zhang C, Wang Y, 2005. Distinct novel mutations affecting the same base in the NIPA1 gene cause autosomal dominant hereditary spastic paraplegia in two Chinese families. Hum Mutat 25(2), 135–141. [DOI] [PubMed] [Google Scholar]
  13. Coppola A, Ruosi P, Santulli L, Striano S, Zara F, Striano P, Sisodiya SM, 2013. Neurological features and long-term follow-up in 15q11.2–13.1 duplication. Eur J Med Genet 56(11), 614–618. [DOI] [PubMed] [Google Scholar]
  14. Cox DM, Butler MG, 2015. The 15q11. 2 BP1–BP2 microdeletion syndrome: A review. International journal of molecular sciences 16(2), 4068–4082. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Dagli AI, Mueller J, Williams CA, 1993. Angelman Syndrome, in: Adam MP, Ardinger HH, Pagon RA, Wallace SE, Bean LJH, Stephens K, Amemiya A (Eds.), GeneReviews((R)) University of Washington, Seattle: [PubMed] [Google Scholar]
  16. University of Washington, Seattle. GeneReviews is a registered trademark of the University of Washington, Seattle: All rights reserved., Seattle (WA). [Google Scholar]
  17. Diagnostic, A., 2000. statistical manual of mental disorders DSM-IV-TR, American Psychiatric Association Task Force on DSM-IV Washington (DC): American Psychiatric Association. [Google Scholar]
  18. Doornbos M, Sikkema-Raddatz B, Ruijvenkamp CA, Dijkhuizen T, Bijlsma EK, Gijsbers AC, Hilhorst-Hofstee Y, Hordijk R, Verbruggen KT, Kerstjens-Frederikse WS, van Essen T, Kok K, van Silfhout AT, Breuning M, van Ravenswaaij-Arts CM, 2009. Nine patients with a microdeletion 15q11.2 between breakpoints 1 and 2 of the Prader-Willi critical region, possibly associated with behavioural disturbances. European journal of medical genetics 52(2–3), 108–115. [DOI] [PubMed] [Google Scholar]
  19. Dribben W, Eisenman L, Mennerick S, 2010. Magnesium induces neuronal apoptosis by suppressing excitability. Cell death & disease 1(8), e63. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Driscoll DJ, Miller JL, Schwartz S, Cassidy SB, 1993. Prader-Willi Syndrome, in: Adam MP, Ardinger HH, Pagon RA, Wallace SE, Bean LJH, Stephens K, Amemiya A (Eds.), GeneReviews((R)) University of Washington, Seattle University of Washington, Seattle: GeneReviews is a registered trademark of the University of Washington, Seattle. All rights reserved., Seattle (WA). [PubMed] [Google Scholar]
  21. Fagerberg L, Hallstrom BM, Oksvold P, Kampf C, Djureinovic D, Odeberg J, Habuka M, Tahmasebpoor S, Danielsson A, Edlund K, Asplund A, Sjostedt E, Lundberg E, Szigyarto CA, Skogs M, Takanen JO, Berling H, Tegel H, Mulder J, Nilsson P, Schwenk JM, Lindskog C, Danielsson F, Mardinoglu A, Sivertsson A, von Feilitzen K, Forsberg M, Zwahlen M, Olsson I, Navani S, Huss M, Nielsen J, Ponten F, Uhlen M, 2014. Analysis of the human tissue-specific expression by genome-wide integration of transcriptomics and antibody-based proteomics. Molecular & cellular proteomics : MCP 13(2), 397–406. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Fichter MM, Herpertz S, Quadflieg N, Herpertz-Dahlmann B, 1998. Structured Interview for Anorexic and Bulimic disorders for DSM-IV and ICD-10: updated (third) revision. The International journal of eating disorders 24(3), 227–249. [DOI] [PubMed] [Google Scholar]
  23. Finucane BM, Lusk L, Arkilo D, Chamberlain S, Devinsky O, Dindot S, Jeste SS, LaSalle JM, Reiter LT, Schanen NC, Spence SJ, Thibert RL, Calvert G, Luchsinger K, Cook EH, 1993. 15q Duplication Syndrome and Related Disorders, in: Adam MP, Ardinger HH, Pagon RA, Wallace SE, Bean LJH, Stephens K, Amemiya A (Eds.), GeneReviews((R)) University of Washington, Seattle University of Washington, Seattle: GeneReviews is a registered trademark of the University of Washington, Seattle: All rights reserved., Seattle (WA). [Google Scholar]
  24. Glessner JT, Li J, Hakonarson H, 2013. ParseCNV integrative copy number variation association software with quality tracking. Nucleic Acids Res 41(5), e64. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Goes FS, McGrath J, Avramopoulos D, Wolyniec P, Pirooznia M, Ruczinski I, Nestadt G, Kenny EE, Vacic V, Peters I, Lencz T, Darvasi A, Mulle JG, Warren ST, Pulver AE, 2015. Genome-wide association study of schizophrenia in Ashkenazi Jews. American journal of medical genetics. Part B, Neuropsychiatric genetics : the official publication of the International Society of Psychiatric Genetics 168(8), 649–659. [DOI] [PubMed] [Google Scholar]
  26. Goytain A, Hines RM, El-Husseini A, Quamme GA, 2007. NIPA1 (SPG6), the basis for autosomal dominant form of hereditary spastic paraplegia, encodes a functional Mg2+ transporter. Journal of biological chemistry 282(11), 8060–8068. [DOI] [PubMed] [Google Scholar]
  27. Hildebrand MS, Damiano JA, Mullen SA, Bellows ST, Scheffer IE, Berkovic SF, 2014. Does variation in NIPA2 contribute to genetic generalized epilepsy? Hum Genet 133(5), 673–674. [DOI] [PubMed] [Google Scholar]
  28. Horsthemke B, Wagstaff J, 2008. Mechanisms of imprinting of the Prader-Willi/Angelman region. American journal of medical genetics. Part A 146a(16), 2041–2052. [DOI] [PubMed] [Google Scholar]
  29. Huke V, Turk J, Saeidi S, Kent A, Morgan JF, 2013. Autism spectrum disorders in eating disorder populations: a systematic review. European eating disorders review : the journal of the Eating Disorders Association 21(5), 345–351. [DOI] [PubMed] [Google Scholar]
  30. Jaffe AE, Deep-Soboslay A, Tao R, Hauptman DT, Kaye WH, Arango V, Weinberger DR, Hyde TM, Kleinman JE, 2014. Genetic neuropathology of obsessive psychiatric syndromes. Translational psychiatry 4, e432. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Jiang Y, Zhang Y, Zhang P, Sang T, Zhang F, Ji T, Huang Q, Xie H, Du R, Cai B, Zhao H, Wang J, Wu Y, Wu H, Xu K, Liu X, Chan P, Wu X, 2012. NIPA2 located in 15q11.2 is mutated in patients with childhood absence epilepsy. Hum Genet 131(7), 1217–1224. [DOI] [PubMed] [Google Scholar]
  32. Kaye WH, Lilenfeld LR, Berrettini WH, Strober M, Devlin B, Klump KL, Goldman D, Bulik CM, Halmi KA, Fichter MM, Kaplan A, Woodside DB, Treasure J, Plotnicov KH, Pollice C, Rao R, McConaha CW, 2000. A search for susceptibility loci for anorexia nervosa: methods and sample description. Biological psychiatry 47(9), 794–803. [DOI] [PubMed] [Google Scholar]
  33. Kirov G, Pocklington AJ, Holmans P, Ivanov D, Ikeda M, Ruderfer D, Moran J, Chambert K, Toncheva D, Georgieva L, Grozeva D, Fjodorova M, Wollerton R, Rees E, Nikolov I, van de Lagemaat LN, Bayes A, Fernandez E, Olason PI, Bottcher Y, Komiyama NH, Collins MO, Choudhary J, Stefansson K, Stefansson H, Grant SG, Purcell S, Sklar P, O’Donovan MC, Owen MJ, 2012. De novo CNV analysis implicates specific abnormalities of postsynaptic signalling complexes in the pathogenesis of schizophrenia. Molecular psychiatry 17(2), 142–153. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Kouidrat Y, Amad A, Lalau JD, Loas G, 2014. Eating disorders in schizophrenia: implications for research and management. Schizophrenia research and treatment 2014, 791573. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Li Z, Chen J, Yu H, He L, Xu Y, Zhang D, Yi Q, Li C, Li X, Shen J, Song Z, Ji W, Wang M, Zhou J, Chen B, Liu Y, Wang J, Wang P, Yang P, Wang Q, Feng G, Liu B, Sun W, Li B, He G, Li W, Wan C, Xu Q, Li W, Wen Z, Liu K, Huang F, Ji J, Ripke S, Yue W, Sullivan PF, O’Donovan MC, Shi Y, 2017. Genome-wide association analysis identifies 30 new susceptibility loci for schizophrenia. Nat Genet 49(11), 1576–1583. [DOI] [PubMed] [Google Scholar]
  36. Menten B, Maas N, Thienpont B, Buysse K, Vandesompele J, Melotte C, de Ravel T, Van Vooren S, Balikova I, Backx L, 2006. Emerging patterns of cryptic chromosomal imbalance in patients with idiopathic mental retardation and multiple congenital anomalies: a new series of 140 patients and review of published reports. Journal of medical genetics 43(8), 625–633. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Morylowska-Topolska J, Zieminski R, Molas A, Gajewski J, Flis M, Stelmach E, Karakula-Juchnowicz H, 2017. Schizophrenia and anorexia nervosa -reciprocal relationships. A literature review. Psychiatria polska 51(2), 261–270. [DOI] [PubMed] [Google Scholar]
  38. Perogamvros L, Schnider A, Leemann B, 2012. The Role of NMDA Receptors in Human Eating Behavior: Evidence From a Case of Anti-NMDA Receptor Encephalitis. Cognitive and Behavioral Neurology 25(2), 93–97. [DOI] [PubMed] [Google Scholar]
  39. Picinelli C, Lintas C, Piras IS, Gabriele S, Sacco R, Brogna C, Persico AM, 2016. Recurrent 15q11.2 BP1-BP2 microdeletions and microduplications in the etiology of neurodevelopmental disorders. American journal of medical genetics. Part B, Neuropsychiatric genetics : the official publication of the International Society of Psychiatric Genetics 171(8), 1088–1098. [DOI] [PubMed] [Google Scholar]
  40. Pittaluga A, Bonfanti A, Raiteri M, 2000. Somatostatin potentiates NMDA receptor function via activation of InsP(3) receptors and PKC leading to removal of the Mg(2+) block without depolarization. British Journal of Pharmacology 130(3), 557–566. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Prader A, Willi H, 1963. Das Syndrom von Imbezillität, Adipositas, Muskelhypotonie, Hypogenitalismus, Hypogonadismus und Diabetes mellitus mit «Myatonie»-Anamnese, Organic Bases and Biochemical Aspects of Imbecility/Organische Grundlagen und biochemische Aspekte des Schwachsinns/Bases organiques et aspects biochimiques de l’imbécillité. Karger Publishers, pp. 353–357. [Google Scholar]
  42. Pujana MA, Nadal M, Guitart M, Armengol L, Gratacòs M, Estivill X, 2002. Human chromosome 15q11-q14 regions of rearrangements contain clusters of LCR15 duplicons. European Journal of Human Genetics 10(1), 26. [DOI] [PubMed] [Google Scholar]
  43. Rainier S, Chai JH, Tokarz D, Nicholls RD, Fink JK, 2003. NIPA1 gene mutations cause autosomal dominant hereditary spastic paraplegia (SPG6). Am J Hum Genet 73(4), 967–971. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Reed JA, Wilkinson PA, Patel H, Simpson MA, Chatonnet A, Robay D, Patton MA, Crosby AH, Warner TT, 2005. A novel NIPA1 mutation associated with a pure form of autosomal dominant hereditary spastic paraplegia. Neurogenetics 6(2), 79–84. [DOI] [PubMed] [Google Scholar]
  45. Schulte EM, Grilo CM, Gearhardt AN, 2016. Shared and unique mechanisms underlying binge eating disorder and addictive disorders. Clinical psychology review 44, 125–139. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Strober M, Freeman R, Lampert C, Diamond J, Kaye W, 2000. Controlled family study of anorexia nervosa and bulimia nervosa: evidence of shared liability and transmission of partial syndromes. The American journal of psychiatry 157(3), 393–401. [DOI] [PubMed] [Google Scholar]
  47. Ulfarsson MO, Walters GB, Gustafsson O, Steinberg S, Silva A, Doyle OM, Brammer M, Gudbjartsson DF, Arnarsdottir S, Jonsdottir GA, Gisladottir RS, Bjornsdottir G, Helgason H, Ellingsen LM, Halldorsson JG, Saemundsen E, Stefansdottir B, Jonsson L, Eiriksdottir VK, Eiriksdottir GR, Johannesdottir GH, Unnsteinsdottir U, Jonsdottir B, Magnusdottir BB, Sulem P, Thorsteinsdottir U, Sigurdsson E, Brandeis D, Meyer-Lindenberg A, Stefansson H, Stefansson K, 2017. 15q11.2 CNV affects cognitive, structural and functional correlates of dyslexia and dyscalculia. Translational psychiatry 7(4), e1109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Urraca N, Cleary J, Brewer V, Pivnick EK, McVicar K, Thibert RL, Schanen NC, Esmer C, Lamport D, Reiter LT, 2013. The interstitial duplication 15q11.2-q13 syndrome includes autism, mild facial anomalies and a characteristic EEG signature. Autism research : official journal of the International Society for Autism Research 6(4), 268–279. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. van der Zwaag B, Staal WG, Hochstenbach R, Poot M, Spierenburg HA, de Jonge MV, Verbeek NE, van’t Slot R, van Es MA, Staal FJ, 2010. A co‐segregating microduplication of chromosome 15q11. 2 pinpoints two risk genes for autism spectrum disorder. American Journal of Medical Genetics Part B: Neuropsychiatric Genetics 153(4), 960–966. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Wade TD, Bulik CM, Neale M, Kendler KS, 2000. Anorexia nervosa and major depression: shared genetic and environmental risk factors. The American journal of psychiatry 157(3), 469–471. [DOI] [PubMed] [Google Scholar]
  51. Wang K, Li M, Hadley D, Liu R, Glessner J, Grant SF, Hakonarson H, Bucan M, 2007. PennCNV: an integrated hidden Markov model designed for high-resolution copy number variation detection in whole-genome SNP genotyping data. Genome research 17(11), 1665–1674. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Wang K, Zhang H, Bloss CS, Duvvuri V, Kaye W, Schork NJ, Berrettini W, Hakonarson H, 2011. A genome-wide association study on common SNPs and rare CNVs in anorexia nervosa. Molecular psychiatry 16(9), 949–959. [DOI] [PubMed] [Google Scholar]
  53. Westwood H, Eisler I, Mandy W, Leppanen J, Treasure J, Tchanturia K, 2016. Using the Autism-Spectrum Quotient to Measure Autistic Traits in Anorexia Nervosa: A Systematic Review and Meta-Analysis. Journal of autism and developmental disorders 46(3), 964–977. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Westwood H, Tchanturia K, 2017. Autism Spectrum Disorder in Anorexia Nervosa: An Updated Literature Review. Current psychiatry reports 19(7), 41. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Yilmaz Z, Szatkiewicz JP, Crowley JJ, Ancalade N, Brandys MK, van Elburg A, de Kovel CGF, Adan RAH, Hinney A, Hebebrand J, Gratacos M, Fernandez-Aranda F, Escaramis G, Gonzalez JR, Estivill X, Genetic Consortium for Anorexia Nervosa, W.T.C.C.C., Zeggini E, Sullivan PF, Bulik CM, 2017. Exploration of large, rare copy number variants associated with psychiatric and neurodevelopmental disorders in individuals with anorexia nervosa. Psychiatr Genet 27(4), 152–158. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Zody MC, Garber M, Sharpe T, Young SK, Rowen L, O’Neill K, Whittaker CA, Kamal M, Chang JL, Cuomo CA, Dewar K, FitzGerald MG, Kodira CD, Madan A, Qin S, Yang X, Abbasi N, Abouelleil A, Arachchi HM, Baradarani L, Birditt B, Bloom S, Bloom T, Borowsky ML, Burke J, Butler J, Cook A, DeArellano K, DeCaprio D, Dorris L 3rd, Dors M, Eichler EE, Engels R, Fahey J, Fleetwood P, Friedman C, Gearin G, Hall JL, Hensley G, Johnson E, Jones C, Kamat A, Kaur A, Locke DP, Madan A, Munson G, Jaffe DB, Lui A, Macdonald P, Mauceli E, Naylor JW, Nesbitt R, Nicol R, O’Leary SB, Ratcliffe A, Rounsley S, She X, Sneddon KM, Stewart S, Sougnez C, Stone SM, Topham K, Vincent D, Wang S, Zimmer AR, Birren BW, Hood L, Lander ES, Nusbaum C, 2006. Analysis of the DNA sequence and duplication history of human chromosome 15. Nature 440(7084), 671–675. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1
NIHMS1524030-supplement-1.docx (746.2KB, docx)
2
NIHMS1524030-supplement-2.pdf (63.8KB, pdf)
3
NIHMS1524030-supplement-3.pdf (6.1KB, pdf)
4
NIHMS1524030-supplement-4.docx (10.5KB, docx)

RESOURCES