Skip to main content
Proceedings of the National Academy of Sciences of the United States of America logoLink to Proceedings of the National Academy of Sciences of the United States of America
. 2019 Apr 9;116(17):8403–8408. doi: 10.1073/pnas.1817496116

Untangling posterior growth and segmentation by analyzing mechanisms of axis elongation in hemichordates

Jens H Fritzenwanker a,b,1, Kevin R Uhlinger a, John Gerhart c, Elena Silva b, Christopher J Lowe a
PMCID: PMC6486776  PMID: 30967509

Significance

Comparative developmental studies from the segmented phyla, arthropods and chordates, has led to speculation that mechanistic coupling of posterior growth and segmentation is an ancient character of bilaterian trunk development. However, many phyla are characterized by animals with long unsegmented trunks. Currently, there are no functional studies that have investigated the mechanistic basis of trunk elongation in these phyla, which is crucial for making firm conclusions about the relationship of conserved regulatory networks and ancestral trunk morphological organization. Our results, together with results from protostomes, challenge hypotheses suggesting that the ancestral bilaterian trunk must have been segmented and highlight the flexibility of developmental programs in organismal evolution.

Keywords: posterior axis elongation, posterior growth, hemichordates, Wnt signaling, Notch signaling

Abstract

The trunk is a key feature of the bilaterian body plan. Despite spectacular morphological diversity in bilaterian trunk anatomies, most insights into trunk development are from segmented taxa, namely arthropods and chordates. Mechanisms of posterior axis elongation (PAE) and segmentation are tightly coupled in arthropods and vertebrates, making it challenging to differentiate between the underlying developmental mechanisms specific to each process. Investigating trunk elongation in unsegmented animals facilitates examination of mechanisms specific to PAE and provides a different perspective for testing hypotheses of bilaterian trunk evolution. Here we investigate the developmental roles of canonical Wnt and Notch signaling in the hemichordate Saccoglossus kowalevskii and reveal that both pathways play key roles in PAE immediately following the completion of gastrulation. Furthermore, our functional analysis of the role of Brachyury is supportive of a Wnt-Brachyury feedback loop during PAE in S. kowalevskii, establishing this key regulatory interaction as an ancestral feature of deuterostomes. Together, our results provide valuable data for testing hypotheses of bilaterian trunk evolution.


The trunk is a conserved feature of the bilaterian body plan (Fig. 1) and was one of the key innovations that led to spectacular morphological diversification along the anteroposterior axis. Our understanding of trunk evolution and the ancestral mechanisms of posterior axis elongation (PAE) are derived mainly from vertebrates, arthropods, and annelids (15). These studies have revealed patterning similarities in PAE and segmentation between protostomes and deuterostomes (610) and have led to hypotheses of homology of bilaterian segmentation (6, 9, 1113). However, mechanisms of PAE and segmentation are intimately coupled in these taxa, making it difficult to untangle hypotheses relating to either process, which limits our ability to reconstruct ancestral developmental characters of early bilaterian trunks. To approach this problem and identify the core mechanisms specific to PAE, we analyzed the role of key conserved regulators of PAE (reviewed in ref. 1) and segmentation during the early development of Saccoglossus kowalevskii, an enteropneust hemichordate that grows a long, unsegmented trunk by PAE (Fig. 1) (14). We focus on Wnt signaling, the transcription factor brachyury, and Delta-Notch signaling (6, 9, 13, 15).

Fig. 1.

Fig. 1.

S. kowalevskii trunk development and evolution. (AG) Schematic of trunk development. Telotroch, turquoise; Territory of posterior trunk extension, blue. Times given are for embryos raised at 20 °C. (HL) EdU staining of developing embryos during PAE. (H) Groove stage, lateral view, inlay posterior view. (I) Kink stage, ventral view. (J) Kink stage, lateral view. (K) Late kink stage, ventral view. (L) Late kink stage, lateral view. Embryos were incubated in 10 µM EdU (green) for 50 min (HJ) or 30 min (K and L) and counterstained with Hoechst (L) (blue). Turquoise arrowheads mark telotroch. White arrowheads mark the high-proliferation zone directly adjacent to the telotroch. Gray arrowheads mark dorsal the midline high-proliferation zone. For more details, see SI Appendix, Fig. S1. (M) Comparison of PAE across phyla.

Canonical Wnt (cWnt) signaling is a central player in PAE in bilaterians. It is an upstream regulator of posterior Hox genes, mediated by the gene caudal (1). Knockdown of posterior cWnts—wnt3a or wnt8 in vertebrates (16) and wnt8 or wnt1 in arthropods (6, 17)—results in severe body truncations. In vertebrates, cWnt forms a positive regulatory loop with Brachyury (bra) regulating PAE, making it a key component of the vertebrate PAE network (Fig. 1M) (1, 16). A blastoporal Wnt/Brachyury interaction predates the evolution of the trunk and has been described in cnidarians (18). However, it is unclear when this feedback loop became a central player in PAE, since functional studies in ecdysozoans currently do not support a role for Brachyury in PAE (19, 20), and, while blastoporal expression of brachyury in representative lophotrochozoans is suggestive (21), currently no functional work has been carried out. Notch signaling is another key PAE player in both protostomes and deuterostomes. Knockdown of Notch signaling in representatives of both lineages leads to strong posterior truncation that is due to either a failure to properly form the PAE network (6, 7, 10, 22) or a failure of segmentation (4, 6, 9, 10, 13, 22, 23). However, since these two mechanisms are tightly coupled in segmented phyla, it is difficult to determine whether the ancestral role of posterior Notch signaling in bilaterians was in posterior growth and/or segmentation (4, 5, 23). Examining the role of Notch during PAE in unsegmented taxa like enteropneusts is essential for testing between these alternatives.

In S. kowalevskii, knockdown of any of these components during early development results in body truncations due to failed elongation. Our data suggest that, similar to vertebrates, a Wnt-Brachyury feedback loop may regulate PAE, which would establish this key regulatory interaction as an ancestral feature of deuterostomes. We further show that Notch signaling interacts with Wnt/Brachyury during PAE of S. kowalevskii, supporting the idea that Notch signaling was an ancestral component of the bilaterian PAE network (7, 10, 22, 23) and that the role of Notch in segmentation may have evolved later independently in different lineages. Alternatively, hemichordates may have secondarily lost segmentation, but ultimately it is only through broader phylogenetic sampling, representing a wider range of trunk morphologies, that we will be able to test hypotheses of trunk evolution more rigorously.

Results

Enteropneust hemichordates are marine worms with a characteristic long, unsegmented trunk that is formed postembryonically by an extended period of posterior growth (14). After an initial period of broad cellular proliferation, the postgastrula embryo starts to elongate by posterior tissue addition (Fig. 1 AL and SI Appendix, Fig. S1). The most posterior embryonic territory, caudal to the ciliary band/telotroch (a ring of densely packed compound cilia in the posterior larvae used for locomotion), undergoes the most significant growth (Fig. 1 CF, light-blue area). Two regions of higher proliferation can be detected in this area, one directly posterior to the telotroch and a second along the dorsal midline (Fig. 1 IL). After the initial posterior body extension, when the juvenile morphology is readily apparent (late kink stage), a ventral tail posterior to the anus begins to form and is later lost late in juvenile development as the extension of the posterior trunk continues. We investigated the function of key conserved regulators of posterior growth during the initial phase of PAE post gastrulation [24 hours post fertilization (hpf) at 20 °C to late kink stage (84 hpf at 20 °C)] in S. kowalevskii.

The Role of cWnt Signaling During PAE in S. kowalevskii.

In S. kowalevskii multiple Wnt ligands are expressed posteriorly in broad territories and multiple germ layers (24). To test whether cWnt signaling plays a role in regulating PAE in S. kowalevskii, we injected RNA of the Wnt-signaling inhibitor, secreted frizzled receptor protein (sfrp1/5), to broadly down-regulate frizzled-mediated Wnt signaling in the embryo (24). The phenotype of these embryos manifests through broad effects on the A/P axis: along with an expansion of the anterior territory and reduction in the size of the trunk territory (24), the posterior trunk fails to extend (Fig. 2A and Movies S1–S4). Overexpression of the cWnt inhibitor Dkk1/2/4 showed a similar phenotype (24).

Fig. 2.

Fig. 2.

Posterior gene regulation via Wnt signaling. (A) sfrp RNA injections. Phenotype images show movie stills of an uninjected control embryo and a sfrp RNA-injected embryo at kink stage (∼72 hpf at 20 °C). Posterior expression of brachyury and hox9/10 is lost in sfrp RNA-injected embryo compared with uninjected controls. (B) wnt1,3 double knockdown. Embryos were coinjected with wnt1 and wnt3 siRNA and assayed at late kink stage. Anterior and posterior trunk mesoderm (yellow and red arrowheads, respectively) (see also SI Appendix, Fig. S3B), proboscis, collar, mouth (blue arrowhead), and gill slits (asterisk) seem to form normally. (C) wnt1,3 knockdown and up-regulation of Wnt signaling. Light-blue bars show qPCR analysis of wnt1,3 double knockdown via siRNA injection analyzed at groove stage. Dark-blue bars show Wnt signaling overactivation using 15 µM 1-azakenpaullone treated from midgastrula to groove stage. One of three biological replicas is shown. Error bars (SEM) for three technical replicas are shown in black. Schematics of normal expression for each analyzed gene at groove stage are on top of each bar. For additional data, see SI Appendix, Fig. S3 A, D, and G. Red labels indicate siRNA targets; gray labels indicate Wnt-signaling pathway components. (D) Expression analysis. At late kink stage is brachyury expression not detected via in situ hybridization in wnt1,3 siRNA-injected embryos. For additional in situs, see SI Appendix, Fig. S3C. All embryos except embryos shown for the sfrp phenotype are optically cleared. White/black bars in A, B, and D indicate the telotroch.

We analyzed expression of brachyury and hox9/10 in these embryos and found that posterior expression of both genes is down-regulated (Fig. 2A), indicating that frizzled-mediated Wnt signaling is a regulator of PAE in S. kowalevskii. While the expansion of the anterior territory in these embryos is due to the early patterning role of cWnt signaling in repression of anterior fates (24), the posterior truncation that we describe here is due specifically to disruption of PAE since the posterior territory is set up during gastrulation in a Wnt-independent manner (24).

To investigate individual Wnt ligands with more specific roles in PAE, we focused our analysis on wnt1 and wnt3, since they have the most specific expression in the posterior ectoderm of S. kowalevskii in both embryonic and post embryonic stages (24). siRNA injection targeting both ligands leads to compromised trunk elongation posterior to the telotroch (Fig. 2B). Based on morphology, posterior endoderm forms normally in wnt1,3 double-knockdown embryos (Fig. 2B and SI Appendix, Fig. S3B), but compartmentalization of that tissue is disrupted (Fig. 2B). Posterior trunk mesoderm seems to form normally (Fig. 2B and SI Appendix, Fig. S3B). Landmark anatomies anterior to the telotroch, such as anterior trunk mesoderm, mouth, and gill slits, also seem to form normally (Fig. 2B). qPCR analysis of the wnt1,3 double knockdown shows down-regulation of genes with posterior expression domains including brachyury and the posterior Hox genes hox11/13a,b,c (Fig. 2C, light-blue bars; SI Appendix, Fig. S3A). This can also be seen in in situ analysis as shown for brachyury in Fig. 2D and SI Appendix, Fig. S3C. wnt1 and wnt3 single knockdowns demonstrate that the main player responsible for this phenotype is wnt1, since a wnt3 single knockdown has a less significant effect on posterior genes (SI Appendix, Fig. S3 D and E). Our data demonstrate that, as in segmented protostomes and deuterostomes, Wnt signaling is required for PAE in S. kowalevskii.

In a complementary approach, we treated embryos with a GSK-3β inhibitor (1-azakenpaullone) (25) to constitutively activate cWnt signaling from blastula to groove stage (SI Appendix, Fig. S3 F and H) and from midgastrula to groove stage (Fig. 2C, dark-blue bars; SI Appendix, Fig. S3 G and H). The overactivation of cWnt signaling starting at the blastula stage leads to up-regulation of posterior gene expression (Fig. 2C and SI Appendix, Fig. S3H) and the conversion of anterior structures into posterior structures (24). Proboscis and collar are transformed into trunk tissues. The remaining trunk, however, seems normal in its morphology (see also ref. 24).

In conclusion, our data establish experimental support by a variety of approaches that posterior genes, including brachyury, are positively regulated by cWnt signaling during PAE in S. kowalevskii.

The Role of Brachyury During PAE in S. kowalevskii.

In S. kowalevskii, bra is expressed around the blastopore at blastula stage, and the posterior ventral ecto- and endoderm from gumedo to kink stage with additional expression in the forming mouth at groove stage. (Fig. 3A and SI Appendix, Fig. S4 AN). bra expression has also been reported from an indirect developing hemichordate, Ptychodera flava (26). bra siRNA knockdown in S. kowalevskii embryos shows compromised trunk expansion at the kink stage posterior to the telotroch and disrupted posterior endoderm compartmentalization (Fig. 3B and Movies S5–S10). At groove stage, the gut lumen seems to be expanded (Fig. 4D) and ∼20% of the embryos show a blastopore closure defect (SI Appendix, Fig. S4P). Structures anterior to the telotroch, including the proboscis, collar, and gill slits, form normally (Fig. 3B).

Fig. 3.

Fig. 3.

Posterior gene regulation via Bra. (A) bra expression. Normal expression of brachyury in S. kowalevskii (see also SI Appendix, Fig. S4 AN). (B) bra knockdown. Anterior and posterior trunk mesoderm (yellow and red arrowheads, respectively), the proboscis, collar, and gill slits (asterisk) seem to form normally. (C) bra knockdown and up-regulation of Wnt signaling. Light-blue bars show qPCR analysis of brachyury siRNA-injected animals analyzed at groove stage. One of three biological replicas (SI Appendix, Fig. S4O) is shown. Gray bars show qPCR analysis of brachyury siRNA knockdown in combination with up-regulation of cWnt signaling using 15 µM 1-azakenpaullone from midgastrula to groove stage, assayed at groove stage. Dark-blue bars show cWnt-signaling overactivation using 15 µM 1-azakenpaullone treated from midgastrula to groove stage (as seen in Fig. 2C). Red labels indicate siRNA targets, gray labels indicate Wnt-signaling pathway components. Error bars (SEM) for three technical replicas are shown in black. (D) Expression analysis of bra knockdown. Posterior expression of wnt1, wnt3, hox9/10, and hox11/13b is not detected via in situ hybridization in brachyury siRNA-injected embryos. Yellow and red arrowheads mark anterior and posterior trunk mesoderm, respectively. For discussion, see text. Black bars mark the telotroch.

Fig. 4.

Fig. 4.

Posterior gene regulation via Notch signaling. (A) notch and delta expression. Normal expression of S. kowalevskii notch and delta. Black arrowhead marks initial delta expression and a forming gill slit at blastula and kink stage, respectively. (B) Notch inhibition phenotype. Embryos treated from four-cell stage to late groove stage with 60 µM of the γ-secretase inhibitor IX, DAPT (Calbiochem #565770) or DMSO as control. Black bars indicate the telotroch (Movies S11 and S12). (C) Expression analysis of Notch-signaling inhibition. Embryos treated from four-cell stage to gumedo/early groove stage show strong down-regulation of posterior expression for wnt1, wnt3, brachyury, hox9/10, and hox11/13c. Black bars mark the telotroch. (D) Notch-signaling inhibition. Light-blue bars show qPCR analysis of posterior genes in embryos treated with DAPT (60 µM) from four-cell stage to gumedo stage (∼36 hpf at 20 °C). Gray bars show qPCR analysis of notch siRNA-injected embryos assayed at gumedo stage. Dark-blue bars show qPCR analysis of embryos treated with DAPT (60 µM) from four-cell stage to early groove stage (∼42 hpf at 20 °C, as seen in C for hox9/10 and wnt1 expression and before ectodermal cells start sloughing off). All analyzed genes of the posterior axis elongation network with the exception of hox11/13a, a gene expressed predominantly in the telotroch at this stage, are down-regulated from gumedo stage onward if Notch signaling is inhibited. The expression levels of wntA are too low before groove stage to be measured reliably (SI Appendix, Fig. S5). Schematics of normal expression at groove stage for each analyzed gene are shown on top of each bar. (E) Notch inhibition and up-regulation of Wnt signaling. Light-blue bars: qPCR analysis of embryos treated with DAPT (60 µM) from midgastrula (∼24 hpf at 20 °C) to groove stage. Gray bars: qPCR analysis of embryos treated with DAPT (60 µM) and 15 µM 1-azakenpaullone from midgastrula to groove stage. Dark-blue bars: Wnt-signaling overactivation using 15 µM 1-azakenpaullone treated from gastrula to groove stage (as seen in Fig. 2C). Gray labels in D and E indicate components of the Wnt-signaling pathway. Error bars (SEM) in D and E for three technical replicas are shown in black.

qPCR analysis of groove-stage embryos injected with brachyury siRNA (Fig. 3C, light-blue bars; SI Appendix, Fig. S4O) shows a significant down-regulation of Wnt genes as well as other posterior marker genes with the exception of hox11/13a, which at this stage is expressed only in the telotroch.

In situ hybridization of wnt1, wnt3, hox9/10, and hox11/13b (Fig. 3D and SI Appendix, Fig. S4Q) all exhibit loss of expression posterior to the telotroch. Loss of the hox9/10 expression domain posterior to the telotroch but not anterior to it demonstrates that the effect of the brachyury knockdown is limited to only the most posterior territory of the embryo (Fig. 3D). This is supported by more modest down-regulation of genes like hox9/10 in the qPCR analysis.

The results demonstrate that brachyury is an essential regulator of PAE in S. kowalevskii, regulating posterior Wnt signaling and posterior Hox gene expression, and is supportive of a Wnt-Brachyury feedback interaction.

We next tested whether posterior Hox genes require posterior brachyury expression or are downstream of cWnt signaling as in vertebrates (1). We combined the brachyury knockdown experiment with up-regulation of the cWnt-signaling pathway using 1-azakenpaullone starting at midgastrulation (Fig. 3C, gray bars) and compared it to the individual 1-azakenpaullone treatment (Fig. 3C, dark-blue bars, also seen in Fig. 2C). We show that posterior Hox genes, wnt9 and the Wnt-signaling modifier notum, respond positively to increased Wnt signaling and do not require brachyury transcription for their expression. This suggests that, as in vertebrates, posterior Hox genes are downstream targets of cWnt signaling. These data from post embryonic treatments contrast with earlier treatments before gastrulation when posterior Hox expression is not responsive to modulation of Wnt signaling (24). Conversely, wnt1, wnt3, and wntA expression all require posterior brachyury expression as they are not rescued by overactivation of Wnt signaling following brachyury knockdown. These data are supportive of a Wnt-Brachyury interaction in the posterior of S. kowalevskii.

In a striking contrast to other bilaterians, caudal, a conserved effector of Wnt-mediated regulation of PAE in other bilaterians (1), is not expressed in the posterior ectoderm during S. kowalevskii PAE (SI Appendix, Fig. S2 AN), and its expression is unaffected by knockdown of bra, wnt3, and wnt1 (SI Appendix, Figs. S3 A and DE and S4O). It is, however, up-regulated in Wnt overactivation experiments, potentially due to indirect effects (SI Appendix, Fig. S3 F and G). From these data we conclude that caudal likely plays no direct role during S. kowalevskii PAE, which is a departure from other bilaterians.

The Role of Delta-Notch Signaling During PAE in S. kowalevskii.

At blastula stage, notch is expressed in the animal half of the S. kowalevskii embryo. delta expression is detected in individual cells at this stage (Fig. 4A). From gastrulation onward both genes are expressed throughout the embryo with the exception of the telotroch; notch is ubiquitously expressed in the ectoderm whereas delta is expressed in a punctate pattern in individual cells. At kink stage, delta expression is detected in the forming gill slits. Embryos injected with notch siRNA (SI Appendix, Fig. S5C) or treated with the γ-secretase inhibitor DAPT (Fig. 4B) from the four-cell stage onward show a posterior truncation compared with the control and an ectodermal phenotype at the late groove/early kink stage due to the sloughing of epithelial cells, likely due to a later role in cell-fate specification. This tissue loss seems to be restricted to the ectoderm (SI Appendix, Fig. S5D). Some deformation of the posterior endoderm is also observed (Fig. 4B and SI Appendix, Fig. S5D). To ensure that the posterior truncation is due to disruption of PAE rather than to tissue loss, we analyzed gene expression changes in earlier stages, before tissue sloughing following an early DAPT treatment initiated at early cleavage stages, sampled at gumedo stage (36 hpf at 20 °C) (Fig. 4C and SI Appendix, Fig. S5B; Fig. 4D and SI Appendix, Fig. S5A, light-blue bars) and early groove stage (42 hpf at 20 °C) (Fig. 4 C and D and SI Appendix, Fig. S5A, dark-blue bars), and notch siRNA injection, sampled at gumedo stage (Fig. 4D, gray bars). Additionally, animals were treated from gastrulation to groove stage with DAPT (Fig. 4E, light-blue bars), after early AP patterning is complete (24) to ensure that the phenotype observed is specific to PAE and not due to an earlier role of Notch signaling during embryogenesis.

All treatments resulted in the down-regulation of posterior genes that was comparable to the effects of brachyury knockdowns, indicating that not only Wnt/Brachyury, but also Notch signaling, is an important upstream regulator of PAE in S. kowalevskii. In situ hybridization of hox9/10 demonstrates that treatment effects are limited to only the most posterior expression domain, caudal to the telotroch (Fig. 4C and SI Appendix, Fig. S5B).

To test whether posterior Notch signaling is also needed for posterior Wnt signaling in S. kowalevskii, as shown for some protostomes and vertebrates (6, 7, 10, 22, 23), we combined treatments of DAPT and 1-azakenpaullone (Fig. 4E, gray bars) and compared them to individual treatments of DAPT (Fig. 4E, light-blue bars) and 1-azakenpaullone (Fig. 4E, dark-blue bars, also seen in Fig. 2C). The gene response can be divided into three distinct categories. In the first category, both 1-azakenpaullone treatment and the combined treatment (1-azakenpaullone/DAPT) positively regulate genes to similar levels. This is true for hox9/10; hox11/13a,b,c; notum; and brachyury and demonstrates that these genes are not directly regulated by Notch signaling, but rather regulated via Wnt signaling. In the second category, expression levels are partially rescued in the combined treatment, but not to the same level as in the individual 1-azakenpaullone treatment. This is true for wnt3, wnt9, and wntA and suggests a more complex regulatory relationship requiring inputs from both Notch- and Wnt-signaling pathways for proper expression. In the third category, the reduction of gene expression cannot be rescued by constitutive activation of cWnt signaling. This is true for wnt1 and demonstrates that wnt1 requires posterior Notch signaling for its expression.

From our experiments we conclude that posterior Notch signaling in S. kowalevskii is required for proper posterior Wnt signaling. Our data support the hypothesis of a general function for Notch signaling during PAE (6, 7, 10, 22, 23) even in the absence of segmentation.

Discussion

In bilaterians, PAE is governed by a complex GRN with posterior cWnt signaling at its center, activating the expression of posterior Hox genes via the gene caudal and maintaining posterior transcription during PAE. In vertebrates, posterior cWnt is maintained by a posterior Wnt-Brachyury feedback loop (1, 19, 20).

In S. kowalevskii, up-regulation of Wnt signaling after gastrulation leads to up-regulation of posterior genes including brachyury. Knockdown of brachyury leads to down-regulation of genes in the posterior including posterior Wnts. When both experiments are combined, most posterior genes can be rescued with the exception of posterior Wnt genes. Our functional data in hemichordates therefore support a general role of posterior cWnt signaling in PAE similar to that in vertebrates, potentially via a regulatory feedback loop with Brachyury (Fig. 5A). This would extend the origin of a Wnt-Brachyury regulatory loop governing PAE from vertebrates (19, 20) to the base of the deuterostomes, thus adding to the conserved regulatory features that unite the deuterostomes (27) (Fig. 5B). Work in the anemone Nematostella vectensis suggests that a blastoporal Wnt/Bra interaction may even predate the evolution of trunk and be an ancient feature of eumetazoans (18).

Fig. 5.

Fig. 5.

Summary. (A) Our data support the presence of a Wnt-Brachyury feedback loop downstream of Notch signaling mediating posterior axis elongation in S. kowalevskii. Blue area indicates trunk tissue gained through PAE. (B) A dashed line represents our hypothesis of a Wnt-Brachyury feedback loop governing posterior axis elongation at the deuterostome base. Posterior Notch signaling was likely a core member of PAE already present at the bilaterian base independent of its role in segmentation.

One surprising difference between S. kowalevskii and other bilaterians is that caudal, which is not expressed in the posterior ectoderm during PAE in S. kowalevskii, likely does not play an effector role downstream of Wnt in ectodermal PAE in S. kowalevskii based on its expression profile and response to manipulation of cWnt signaling (SI Appendix, Figs. S2, S3, and S4O). This would likely represent a secondary modification in hemichordates. However, a more detailed functional analysis including caudal knockdown will be required to fully validate this finding.

Reconstruction of the ancestral role of Notch signaling in trunk patterning is challenging (28), largely due to the difficulties in untangling mechanisms of PAE and segmentation, which are tightly coupled in segmented taxa. Much attention has been given to a proposed ancestral role of Notch signaling in segmentation (5, 29, 30), but there is also support for a conserved role in PAE. Within protostomes, Notch plays a role in PAE and segmentation in different combinations; in arthropods it can be involved in both PAE and segmentation (6, 7, 13, 22) or uniquely in segmentation (10). Furthermore, in onycophorans, the sister group to arthropods, expression data suggest that Notch signaling likely plays a role only in posterior growth but not in segmentation (23). Broader bilaterian comparisons between protostomes and chordates have led to contrasting conclusions: either Notch played a role in both PAE and segmentation in a segmented bilaterian ancestor or its role was exclusively in PAE, acting in posterior growth of an unsegmented ancestor. In the latter scenario, Notch would have been coopted independently into a role in segmentation in annelids, vertebrates, and arthropods. Data from hemichordates provide an essential additional bilaterian lineage to help differentiate between these hypotheses. Not only are both Wnt and Notch involved in posterior growth, but also our experimental evidence shows that Notch regulates posterior Wnt signaling, similar to findings in vertebrates and in some arthropods (6, 3133).

While we cannot eliminate the possibility of loss of segmentation in hemichordates, our data support the hypothesis of the independent recruitment of Notch in its regulatory role in segmented taxa.

Conclusion

A trunk characterized by collinear expression of Hox genes evolved in stem bilaterians. However, how this trunk evolved and how it was patterned at the base of the bilaterians is still debated (5, 11, 12, 28). Our data support a general role for posterior cWnt signaling during PAE as shown for other bilaterians and imply that Brachyury was also ancestrally involved, possibly through a Wnt/Brachyury regulatory loop in the deuterostome ancestor. We further demonstrate functional evidence of a role for Notch in posterior growth in an unsegmented bilaterian group, which supports a general role of Notch signaling in bilaterian PAE.

Materials and Methods

Embryo Collection.

Gravid S. kowalevskii were collected at Waquoit Bay National Estuarine Research Reserve near Woods Hole, MA, and maintained at the Marine Biological Laboratory, Woods Hole, MA. Ovulation and fertilization of oocytes were carried out by the methods of Colwin and Colwin (34) with several modifications (35). Embryos were staged by the normal tables of Bateson (36, 37) and Colwin and Colwin (14). Embryos were cultured at 20 °C.

Gene Expression Analysis.

In situ hybridization was carried out as described in Lowe et al. (35) with slight modifications (SI Appendix, Supporting Materials and Methods).

Embryo Manipulation.

siRNA microinjections were performed as described previously (38) with slight modifications (SI Appendix, Supporting Materials and Methods). The following siRNAs were used: brachyury siRNA1—5′–GUUCAGCAGUAUAGGUUUAtt–3, 5′–UAAACCUAUACUGCUGAACtg–3′ (Ambion); wnt1—5′–AGAGAUCUGCGAUACUACAUGAAUA–3′, 5′–UAUUCAUGUAGUAUCGCAGAUCUCU–3′ (Stealth siRNA; Life Technologies); wnt3—5′–UAGAAAGAUGCGAAUGUCAGUUCAU–3′, 5′–AUGAACUGACAUUCGCAUCUUUCUA–3′ (Stealth siRNA; Life Technologies); and Notch siRNA1—5′–GUAGAAUCAACAACGACUUUGCUta–3′, 5′–UAAGCAAAGUCGUUGUUGAUUCUACAU–3′ (IDT). sfrp RNA was injected at a concentration of 1 µg/µL diluted in injection buffer (see above and SI Appendix, Supporting Materials and Methods).

Drug Treatments.

The cWnt pathway was activated using the GSK-3β inhibitor 1-azakenpaullone (191500; Calbiochem). A 10-mM stock of 1-azakenpaullone was prepared in DMSO and stored at −20 °C. Embryos were incubated in 5, 10, and 15 μM 1-azakenpaullone in filtered seawater. To inhibit the Notch signaling pathway, we used the γ-secretase inhibitor IX, DAPT (Calbiochem #565770). A stock solution of 60 mM was prepared in DMSO and stored at −20 °C. Embryos were incubated in 60 μM DAPT in filtered seawater.

Control embryos for the respective treatments were incubated in comparable dilutions of DMSO in seawater.

qPCR.

qPCR was carried out as described in ref. 24. All primer sets (SI Appendix, Table S1) were initially optimized for efficiency at 55 °C annealing and low probability of primer-dimer product in no-template controls (SI Appendix, Supporting Materials and Methods).

Supplementary Material

Supplementary File
Supplementary File
Download video file (2.1MB, mov)
Supplementary File
Download video file (2MB, mov)
Supplementary File
Download video file (1.9MB, mov)
Supplementary File
Download video file (5.7MB, mov)
Supplementary File
Download video file (4.1MB, mov)
Supplementary File
Download video file (2.5MB, mov)
Supplementary File
Download video file (1.7MB, mp4)
Supplementary File
Download video file (2.5MB, mp4)
Supplementary File
Download video file (17.1MB, mp4)
Supplementary File
Download video file (6.5MB, mp4)
Supplementary File
Download video file (5.6MB, mov)
Supplementary File
Download video file (3.5MB, mov)

Acknowledgments

We thank Paul Gonzales, Nat Clark, and Paul Minor for feedback on the manuscript and Bob Freeman for initial experimental support. This work was supported by a European Molecular Biology Organization long-term postdoctoral fellowship (to J.H.F.); by the Marine Biological Laboratory in the form of awards through The Robert Day Allen Fellowship Fund and The Baxter Postdoctoral Fellowship Fund (to J.H.F.); and by National Science Foundation Grants 1258169 and 1656628 (to C.J.L.).

Footnotes

The authors declare no conflict of interest.

This article is a PNAS Direct Submission.

This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10.1073/pnas.1817496116/-/DCSupplemental.

References

  • 1.Martin BL, Kimelman D. Wnt signaling and the evolution of embryonic posterior development. Curr Biol. 2009;19:R215–R219. doi: 10.1016/j.cub.2009.01.052. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Janssen R, et al. Conservation, loss, and redeployment of Wnt ligands in protostomes: Implications for understanding the evolution of segment formation. BMC Evol Biol. 2010;10:374. doi: 10.1186/1471-2148-10-374. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Thamm K, Seaver EC. Notch signaling during larval and juvenile development in the polychaete annelid Capitella sp. I. Dev Biol. 2008;320:304–318. doi: 10.1016/j.ydbio.2008.04.015. [DOI] [PubMed] [Google Scholar]
  • 4.Rivera AS, Weisblat DA. And Lophotrochozoa makes three: Notch/Hes signaling in annelid segmentation. Dev Genes Evol. 2009;219:37–43. doi: 10.1007/s00427-008-0264-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Chipman AD. Parallel evolution of segmentation by co-option of ancestral gene regulatory networks. Bioessays. 2010;32:60–70. doi: 10.1002/bies.200900130. [DOI] [PubMed] [Google Scholar]
  • 6.Chesebro JE, Pueyo JI, Couso JP. Interplay between a Wnt-dependent organiser and the Notch segmentation clock regulates posterior development in Periplaneta americana. Biol Open. 2013;2:227–237. doi: 10.1242/bio.20123699. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Oda H, et al. Progressive activation of Delta-Notch signaling from around the blastopore is required to set up a functional caudal lobe in the spider Achaearanea tepidariorum. Development. 2007;134:2195–2205. doi: 10.1242/dev.004598. [DOI] [PubMed] [Google Scholar]
  • 8.Schoppmeier M, Damen WGM. Suppressor of Hairless and Presenilin phenotypes imply involvement of canonical Notch-signalling in segmentation of the spider Cupiennius salei. Dev Biol. 2005;280:211–224. doi: 10.1016/j.ydbio.2005.01.024. [DOI] [PubMed] [Google Scholar]
  • 9.Stollewerk A, Schoppmeier M, Damen WGM. Involvement of Notch and Delta genes in spider segmentation. Nature. 2003;423:863–865. doi: 10.1038/nature01682. [DOI] [PubMed] [Google Scholar]
  • 10.Williams T, Blachuta B, Hegna TA, Nagy LM. Decoupling elongation and segmentation: Notch involvement in anostracan crustacean segmentation. Evol Dev. 2012;14:372–382. doi: 10.1111/j.1525-142X.2012.00555.x. [DOI] [PubMed] [Google Scholar]
  • 11.De Robertis EM. The molecular ancestry of segmentation mechanisms. Proc Natl Acad Sci USA. 2008;105:16411–16412. doi: 10.1073/pnas.0808774105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Couso JP. Segmentation, metamerism and the Cambrian explosion. Int J Dev Biol. 2009;53:1305–1316. doi: 10.1387/ijdb.072425jc. [DOI] [PubMed] [Google Scholar]
  • 13.Pueyo JI, Lanfear R, Couso JP. Ancestral Notch-mediated segmentation revealed in the cockroach Periplaneta americana. Proc Natl Acad Sci USA. 2008;105:16614–16619. doi: 10.1073/pnas.0804093105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Colwin AL, Colwin LH. The normal embryology of Saccoglossus kowalevskii (enteropneusta) J Morphol. 1953;92:401–453. [Google Scholar]
  • 15.Beck CW, Slack JMW. Notch is required for outgrowth of the Xenopus tail bud. Int J Dev Biol. 2002;46:255–258. doi: 10.1387/ijdb.011489. [DOI] [PubMed] [Google Scholar]
  • 16.Martin BL, Kimelman D. Regulation of canonical Wnt signaling by Brachyury is essential for posterior mesoderm formation. Dev Cell. 2008;15:121–133. doi: 10.1016/j.devcel.2008.04.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.McGregor AP, et al. Wnt8 is required for growth-zone establishment and development of opisthosomal segments in a spider. Curr Biol. 2008;18:1619–1623. doi: 10.1016/j.cub.2008.08.045. [DOI] [PubMed] [Google Scholar]
  • 18.Servetnick MD, et al. Cas9-mediated excision of Nematostella brachyury disrupts endoderm development, pharynx formation and oral-aboral patterning. Development. 2017;144:2951–2960. doi: 10.1242/dev.145839. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Berns N, Kusch T, Schröder R, Reuter R. Expression, function and regulation of Brachyenteron in the short germband insect Tribolium castaneum. Dev Genes Evol. 2008;218:169–179. doi: 10.1007/s00427-008-0210-7. [DOI] [PubMed] [Google Scholar]
  • 20.Shinmyo Y, et al. Brachyenteron is necessary for morphogenesis of the posterior gut but not for anteroposterior axial elongation from the posterior growth zone in the intermediate-germband cricket Gryllus bimaculatus. Development. 2006;133:4539–4547. doi: 10.1242/dev.02646. [DOI] [PubMed] [Google Scholar]
  • 21.Takada N, Goto T, Satoh N. Expression pattern of the Brachyury gene in the arrow worm Paraspadella gotoi (Chaetognatha) Genesis. 2002;32:240–245. doi: 10.1002/gene.10077. [DOI] [PubMed] [Google Scholar]
  • 22.Mito T, et al. Ancestral functions of Delta/Notch signaling in the formation of body and leg segments in the cricket Gryllus bimaculatus. Development. 2011;138:3823–3833. doi: 10.1242/dev.060681. [DOI] [PubMed] [Google Scholar]
  • 23.Janssen R, Budd GE. Gene expression analysis reveals that Delta/Notch signalling is not involved in onychophoran segmentation. Dev Genes Evol. 2016;226:69–77. doi: 10.1007/s00427-016-0529-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Darras S, et al. Anteroposterior axis patterning by early canonical Wnt signaling during hemichordate development. PLoS Biol. 2018;16:e2003698. doi: 10.1371/journal.pbio.2003698. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Kunick C, Lauenroth K, Leost M, Meijer L, Lemcke T. 1-Azakenpaullone is a selective inhibitor of glycogen synthase kinase-3 beta. Bioorg Med Chem Lett. 2004;14:413–416. doi: 10.1016/j.bmcl.2003.10.062. [DOI] [PubMed] [Google Scholar]
  • 26.Peterson KJ, Harada Y, Cameron RA, Davidson EH. Expression pattern of brachyury and not in the sea urchin: Comparative implications for the origins of mesoderm in the basal deuterostomes. Dev Biol. 1999;207:419–431. doi: 10.1006/dbio.1998.9177. [DOI] [PubMed] [Google Scholar]
  • 27.Lowe CJ, Clarke DN, Medeiros DM, Rokhsar DS, Gerhart J. The deuterostome context of chordate origins. Nature. 2015;520:456–465. doi: 10.1038/nature14434. [DOI] [PubMed] [Google Scholar]
  • 28.Kainz F, Ewen-Campen B, Akam M, Extavour CG. Notch/Delta signalling is not required for segment generation in the basally branching insect Gryllus bimaculatus. Development. 2011;138:5015–5026. doi: 10.1242/dev.073395. [DOI] [PubMed] [Google Scholar]
  • 29.McGregor AP, Pechmann M, Schwager EE, Damen WG. An ancestral regulatory network for posterior development in arthropods. Commun Integr Biol. 2009;2:174–176. doi: 10.4161/cib.7710. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Wahi K, Bochter MS, Cole SE. The many roles of Notch signaling during vertebrate somitogenesis. Semin Cell Dev Biol. 2016;49:68–75. doi: 10.1016/j.semcdb.2014.11.010. [DOI] [PubMed] [Google Scholar]
  • 31.Hofmann M, et al. WNT signaling, in synergy with T/TBX6, controls Notch signaling by regulating Dll1 expression in the presomitic mesoderm of mouse embryos. Genes Dev. 2004;18:2712–2717. doi: 10.1101/gad.1248604. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Aulehla A, Herrmann BG. Segmentation in vertebrates: Clock and gradient finally joined. Genes Dev. 2004;18:2060–2067. doi: 10.1101/gad.1217404. [DOI] [PubMed] [Google Scholar]
  • 33.Grainger S, et al. Cdx regulates Dll1 in multiple lineages. Dev Biol. 2012;361:1–11. doi: 10.1016/j.ydbio.2011.09.034. [DOI] [PubMed] [Google Scholar]
  • 34.Colwin AL, Colwin LH. Induction of spawning in Saccoglossus kowalevskii (Enteropneusta) at Woods Hole. Biol Bull. 1962;123:493. [Google Scholar]
  • 35.Lowe CJ, Tagawa K, Humphreys T, Kirschner M, Gerhart J. Hemichordate embryos: Procurement, culture, and basic methods. Methods Cell Biol. 2004;74:171–194. doi: 10.1016/s0091-679x(04)74008-x. [DOI] [PubMed] [Google Scholar]
  • 36.Bateson W. Early stages in the development of Balanoglossus (sp. incert.) Q J Microsc Sci. 1884;24:208–236. [Google Scholar]
  • 37.Bateson W. Later stages in the development of Balanoglossus kowalevskii with a suggestion as to the affinities of the Enteropneusta. Q J Microsc Sci. 1885;25:81–128. [Google Scholar]
  • 38.Lowe CJ, et al. Dorsoventral patterning in hemichordates: Insights into early chordate evolution. PLoS Biol. 2006;4:e291. doi: 10.1371/journal.pbio.0040291. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary File
Supplementary File
Download video file (2.1MB, mov)
Supplementary File
Download video file (2MB, mov)
Supplementary File
Download video file (1.9MB, mov)
Supplementary File
Download video file (5.7MB, mov)
Supplementary File
Download video file (4.1MB, mov)
Supplementary File
Download video file (2.5MB, mov)
Supplementary File
Download video file (1.7MB, mp4)
Supplementary File
Download video file (2.5MB, mp4)
Supplementary File
Download video file (17.1MB, mp4)
Supplementary File
Download video file (6.5MB, mp4)
Supplementary File
Download video file (5.6MB, mov)
Supplementary File
Download video file (3.5MB, mov)

Articles from Proceedings of the National Academy of Sciences of the United States of America are provided here courtesy of National Academy of Sciences

RESOURCES