Skip to main content
CNS Neuroscience & Therapeutics logoLink to CNS Neuroscience & Therapeutics
. 2018 Mar 25;24(10):947–956. doi: 10.1111/cns.12845

Upregulation of CXCR4 through promoter demethylation contributes to inflammatory hyperalgesia in rats

Feng Li 1, Zhou‐Ya Xue 1, Yuan Yuan 2, Sai‐Sai Huang 3, Yi‐Hui Fan 4, Xiang Zhu 3,✉, Lei Wei 5,✉
PMCID: PMC6489799  PMID: 29577638

Summary

Aim and methods

Chronic pain associated with inflammation is a common clinical problem, and the underlying mechanisms yet are incompletely defined. DNA methylation has been implicated in the pathogenesis of chronic pain. However, the specific genes regulated by DNA methylation under inflammatory pain condition remain largely unknown. Here, we investigated how chemokine receptor CXCR4 expression is regulated by DNA methylation and how it contributes to inflammatory pain induced by complete Freund's adjuvant (CFA) in rats.

Results

Intraplantar injection of CFA could not only induce significant hyperalgesia in rats, but also significantly increase the expression of CXCR4 mRNA and protein in the dorsal root ganglion (DRG). Intrathecal injection of CXCR4 antagonist AMD3100 significantly relieved hyperalgesia in inflammatory rats in a time‐ and dose‐dependent manner. Bisulfite sequencing and methylation‐specific PCR demonstrate that CFA injection led to a significant demethylation of CpG island at CXCR4 gene promoter. Consistently, the expression of DNMT3b was significantly downregulated after CFA injection. Online software prediction reveals three binding sites of p65 in the CpG island of CXCR4 gene promoter, which has confirmed by the chromatin immunoprecipitation assay, CFA treatment significantly increases the recruitment of p65 to CXCR4 gene promoter. Inhibition of NF‐kB signaling using p65 inhibitor pyrrolidine dithiocarbamate significantly prevented the increases of the CXCR4 expression.

Conclusion

Upregulation of CXCR4 expression due to promoter demethylation followed by increased recruitment of p65 to promoter of CXCR4 gene contributes to inflammatory hyperalgesia. These findings provide a theoretical basis for the treatment of chronic pain from an epigenetic perspective.

Keywords: CXCR4, DNA methylation, dorsal root ganglion, epigenetics, inflammatory pain

1. INTRODUCTION

Chronic pain is a common clinical disease, which is usually accompanied by tissue damage, inflammation, external symptoms of redness fever, pain abnormalities, or hyperalgesia. At present, it is generally believed that that tissue damage or inflammation leading to release of inflammatory factors is an important factor in the formation and development of chronic pain.1, 2, 3, 4 Statistical results show that America has currently about 100 million patients with chronic pain.5 Due to the unclear pathogenesis of chronic pain and lack of effective treatment, the patients have suffered great physical and psychological pain. Thus, further studies regarding the pathogenesis of chronic pain and the development of effective therapeutic method are imperative.

Chemokines are a class of low molecular weight (mostly 8‐10KD) of chemotactic cytokines (such as IL‐8, MCP‐1), which play an important role in the inflammatory response. Currently, they are divided into four families: C, CC, CXC, and CX3C.6The CXC chemokine ligand 12 (CXCL12), also known as SDF‐1, belongs to the CXC family, which is widely expressed in various cell types of central nervous system. The primary function of CXCL12 is to activate immune cells (such as monocytes and macrophages) and attract them to inflammatory lesions, mainly through the interaction with transmembrane G protein‐coupled receptors, such as chemokine receptor (CXCR4). More and more evidence suggests that CXCL12/CXCR4 is upregulated in inflammatory or damaged tissues and can attract immune cells to inflammatory tissue to participate in inflammatory responses, thereby promoting glial cell expression of various inflammatory factors such as TNF‐α and IL‐6, leading to hyperalgesia.7, 8, 9 These results suggest that upregulation of CXCL12/CXCR4 may mediate the activation of microglia and astrocytes, and subsequently participate in the development of inflammatory pain. Therefore, investigating the role of CXCL12/CXCR4 in inflammatory chronic pain will help us not only to further understand the pathophysiology of chronic pain but also to develop better treatment to chronic pain.10 Due to the central role of CXCL12/CXCR4 axis in chronic pain, we intend to explore the mechanism of CXCR4 upregulation from the perspective of epigenetics.

Epigenetic inheritance is a genetic change in gene expression while DNA sequence unchanged. Epigenetic regulation can be carried out at a variety of levels, such as DNA methylation and histone modification,11 in which DNA methylation is particularly common. Several studies have suggested that epigenetic especially DNA methylation is involved in pain modulation.12, 13, 14 Recently, some studies have reported that complete Freund's adjuvant (CFA) injection significantly upregulates histone deacetylase HDACs expression, whereas administration of HDACs blockers significantly relieves CFA‐induced inflammatory pain.15, 16, 17 Geranton et al recently reported that MeCP2 (methylated binding protein 2) also plays a role in the development of CFA‐induced inflammatory pain,18 but its specific molecular mechanism is unclear. Therefore, it is of great clinical significance to study the epigenetic changes of related genes in chronic pain and modulation of epigenetic pathways to treat inflammatory pain, especially chronic pain.

Through analysis using online software, we found the CXCR4 gene promoter region has high confident CpG islands. The proportion of methylation and demethylation at such CpG island was significantly altered in the dorsal root ganglion (DRG) at the rat inflammatory pain model. The above results suggested that epigenetics, especially DNA methylation, may be involved in regulating the occurrence and development of inflammatory pain. Therefore, the aim of this study was to investigate the role of CXCR4 in CFA‐induced inflammatory pain as well as the regulatory mechanism of CXCR4 expression.

2. MATERIALS AND METHODS

2.1. Animals and models

Adult male SD rats in a SPF grade weighing about 220 g were purchased from Experimental Animal Center of Suzhou University. The SD rats maintained at standardized feeding environment including 12‐hours shift light‐dark cycle and ambient temperature of 24 ± 1°C. Establishment of CFA‐induced chronic inflammatory pain model was established by unilateral subcutaneous injection of CFA 0.1 mL at sterile foot skin. All experiments were approved by the Animal Research Ethics Committee from The First People's Hospital of Yancheng, Suzhou Municipal Hospital Affiliated to Nanjing Medical University and Nantong University.

2.2. Drug application

To investigate the role of CXCR4, AMD3100 was used in this study. AMD3100 is a selective CXCR4 antagonist. After 48 hours of CFA injection, twenty‐eight of rats were divided into 4 groups and received an intrathecal injection of saline, AMD3100 at the doses of 5 μg/kg, 25 μg/kg, and 50 μg/kg, respectively. The injection was performed once a day for consecutive 3 days. Paw withdrawal threshold (PWT) and paw withdrawal latency (PWL) were recorded at 0.5, 1, 2, and 4 hours after AMD3100 treatment. To further determine whether NF‐κB p65 participates in the regulation of the expression of CXCR4, NF‐κB inhibitor, pyrrolidine dithiocarbamate (PDTC) was used in this study. After CFA injection, twenty of rats were divided into 4 groups and received an i.p. injection of saline, or PDTC 5 mg/kg, PDTC 25 mg/kg, PDTC 50 mg/kg, respectively. The administration of PDTC was performed once a day for consecutive 3 days.

2.3. Mechanical pain threshold measurement

The paw withdrawal threshold (PWT) was measured by von Frey filament needle (0.4 g‐15.0 g) to evaluate the mechanical attack of rats. The rats were placed in a self‐made plexiglass box at size of 22 cm×12 cm×22 cm at duration of 1 hours per day for 3 days. The adaptation process mimics the normal living environment of rats. Pain threshold was measured while keeping surrounding environment quiet.

2.4. Thermal pain thresholds measurement

The paw withdrawal latency (PWL) was measured by heat radiation method to determine the thermal hyperalgesia of rats. The plexiglass box was placed on a glass plate with a thickness of 3 mm. First, the rats were placed in this glass box for 30 minutes, then their feet were irradiated with a heat stimulator according to the Hargreaves method. The time from the beginning of the irradiation to the emergence of leg lift to avoid the heat shrinkage was defined as PWL. To prevent tissue damage, the automatic cut‐off time was set to 20 seconds. Each rat was repeatedly tested 5 times with intervals of more than 3 minutes. All behavioral experiments were performed under double‐blind conditions.

2.5. Cell retrograde labeling

The origin of the primary afferent innervation of the hind paw's plantar was determined by retrograde tracing using 1,1′‐Dioctadecyl‐3,3,3′,3′‐tetramethylindocarbocyanine perchlorate (DiI; Invitrogen, Carlsbad, CA). Experiments were performed using adult male SD rats (about 220 g). Animals were anesthetized with chloral hydrate (360 mg/kg) at first. Then, 10 μL of DiI (25 mg dissolved in 0.5 mL methanol) was slowly subcutaneously injected into the hind paw's planta using a 10 μL microinjection syringe. One week later, lumbar L4‐L6 DRGs were dissected for immunostaining.

2.6. Immunofluorescence assay

Immunofluorescence was performed as the following steps: Frozen sections were incubated with 10% sheep serum plus 0.3% Triton X‐100 for 1 hour, then incubated overnight at 4°C with anti‐CXCR4 antibody (1: 200,ab124824, Abcam), anti‐β‐tubulin antibody (1: 1000,ab6046,Abcam). The samples were washed with PBS buffer for 10 minutes × 3 times. The corresponding fluorescent‐labeled secondary antibody was further incubated at 4°C overnight, then washed with PBS buffer for 10 minutes ×3 times. After adding anti‐fluorescence quenching agent seal, the samples were observed with the fluorescence microscopy (Leica DMR 3000; Leica Microsystem, Bensheim, Germany).

2.7. Western blotting

Rats from different groups were killed at different time points after CFA injection, the L4‐6 DRGs were removed rapidly and frozen on liquid nitrogen. The tissues were homogenated with 200 μL tissue protein lysate with 2 μL protease inhibitors (Promega, Madison, WI). After the homogenate have been centrifuged at 10 800 g for 20 minutes at 4°C, the supernatant was collected and assayed for protein concentration by the BCA protein assay (Bio‐Rad, Hercules, CA). The supernatant was mixed with 5× loading buffer and boiling for 5 minutes following centrifuge of 11 700 g at 4°C for 1 minutes. Protein samples containing 30 μg of total protein were separated by SDS‐PAGE gel and transferred to polyvinylidene fluoride (PVDF) membranes. The membranes were blocked with 5% skimmed milk at room temperature for 1 hour, then incubated overnight at 4°C with rabbit anti‐CXCR4 antibody (1:1000, ab124824,Abcam)) or mouse anti β‐actin(1:5000, ab6276, Abcam). The membranes were further incubated with secondary antibodies (1:10 000, donkey anti‐rabbit IgG (H + L) or goat anti‐mouse IgG (H + L) labeled with IRDye 800CW) at room temperature for 2 hours. The blots were scanned by Odyssey (Li‐COR, USA) and taken the gray scale value for statistics.

2.8. Real‐Time PCR

The total RNA was extracted using Trizol reagent (Invitrogen), and cDNA was synthesized from total RNA using an Omniscript RT kit (Qiagen, Valencia, CA) according to the supplier's instructions. The detailed primer sequences for each gene (CXCL12, CXCR4, DNMT3a, DNMT3b, and β‐actin) are listed in Table 1. The real‐time PCR amplifications were performed as below: 95°C for 15 minutes, 95°C for 15 seconds, and then 60°C for 45 seconds, with 40 cycles (Collect Fluorescence at 60°C). After PCR reaction was completed, the Ct (cycle threshold) values that corresponding to the amplification curve can be acquired. The thresholds of the samples at each time point and the internal β‐actin gene were analyzed by the 2−ΔΔCt method.

Table 1.

Primers used in qPCR

Gene Primer sequence
CXCL12‐F 5′‐CGATTCTTTGAGAGCCATGTC ‐3′
CXCL12‐R 5′‐ TTAAGGCTTTGTCCAGGTACTCT ‐3′
CXCR4‐F: 5′‐ CTCTGAGGCGTTTGGTGCT ‐3′
CXCR4‐R: 5′‐ TGCCCACTATGCCAGTCAAG ‐3′
β‐actin‐F: 5′‐ GATGGAAAGTGACCCGCA ‐ 3′
β‐actin‐R: 5′‐ GAGGAAGACGCAGAGGTTTG ‐ 3′
DNMT3a‐F: 5′‐ GAGGGAACTGAGACCCCAC ‐ 3′
DNMT3a‐R: 5′‐ CTGGAAGGTGAGTCTTGGCA ‐ 3′
DNMT3b‐F: 5′‐ CATAAGTCGAAGGTGCGTCGT‐ 3′
DNMT3b‐R: 5′‐ ACTTTTGTTCTCGCGTCTCCT‐ 3′

2.9. Methylation‐specific PCR (MSP) and Bisulfite Sequencing PCR (BSP)

The methylation status of CpG island of all samples was initially screened at CXCR4 gene promoter region by methylation‐specific PCR(MSP).When the CpG sites in the region analyzed by MSP are methylated, the methylated (M) band shows up. The demethylated (U) band is present when the sites are demethylated. Occasionally, both bands could be present if the sites are partially methylated. The methylation statuses were further validated by bisulfite sequencing PCR (BSP). Genomic DNA extracted from DRG was modified with bisulfite reagents following the manufacturer's instructions(Zymo Research, Orange, CA). This modification resulted in a conversion of demethylated cytosine to thymine, whereas the methylated cytosine remained unchanged. A total of 20 ng of bisulfite‐modified DNA was subjected to PCR amplification and directly sequenced with the ABI 3700 automated sequencing system (Applied Biosystems, Carlsbad, CA). The primers designed for CXCR4 were listed in Table 2.

Table 2.

Primers used in Methylation‐specific PCR and bisulfite sequencing

Gene Primer sequence
MSP
CXCR4‐MSP‐M‐F1: 5′‐GGGGATTATAAATTGCGGTAGTC‐3′
CXCR4‐MSP‐M‐R1: 5′‐AAACTAAAACCTCGAAAAACTCGTA‐3′
CXCR4‐MSP‐U‐F1: 5′‐GGGGATTATAAATTGTGGTAGTTGT‐3′
CXCR4‐MSP‐U‐R1: 5′‐AAACTAAAACCTCAAAAAACTCATA‐ 3′
BSP
CXCR4‐BSP‐F: 5′‐GGGAAAATTGAGTTAGTTTGTAGTAT‐3′
CXCR4‐BSP‐R: 5′‐AAACTTAAAACCCTTTCTCATAAAC‐3′

2.10. Chromatin immunoprecipitation (ChIP)

ChIP assays were performed using the Simple ChIP Enzymatic Chromatin IP kit (Magnetic beads, Cell Signaling, Danvers, MA) according to the manufacturer's instructions. The tissues were crossed with 1% formaldehyde, terminated with 0.125 M glycine, then SDS Lysis Buffer was added. Ultrasonic crushing: VCX750, 25% power, 5 seconds shocking, 10 seconds sonication with a total of 10 times. After that, the insoluble material was removed by centrifugation. Take the 210 μL solution to do the experiment, of which the 10 μL for the detection of sonication effect. Another 200 μL of sample from the experimental and control groups was used for assays. Twenty μL of above sample was taken as input control. Then, 10 μL of antibody was added to remaining samples at 4°C overnight. After incubation of the antibody, the immune complex was precipitated and washed. DNA from immune complex was extracted with phenol/chloroform and precipitated with ethanol. Pellets were resuspended in TE buffer for PCR analysis. ChIP primer sequences were listed in table 3.

Table 3.

Primers used in ChIP sequencing

Gene Primer sequence
CXCR4/NF‐κB ‐301‐F CAAACGTGCGAACTTAGAGC
CXCR4/NF‐κB ‐301‐R GAGGCTGAGGGCAAACC
CXCR4/NF‐κB ‐462‐F AGGGTTTGCCCTCAGCC
CXCR4/NF‐κB ‐462‐R CCCAGGATGTTGTGCCTAC
CXCR4/NF‐κB ‐591‐F AACATCCTGGGTTAGCTTCG
CXCR4/NF‐κB ‐591‐R GCTGCTACTCCATCCCAAA

2.11. Data analysis

All data were expressed as mean ±SEM. The behavioral data were analyzed by two‐way repeated measures ANOVA followed by Bonferroni test as the post hoc multiple comparison analysis. For Western blot, the density of specific bands was measured with Image J. the levels of CXCR4, DNMT3a, DNMT3b, and NF‐κB were normalized to loading control β‐actin. Differences between groups were compared using one‐way ANOVA followed by Bonferroni test. Student's t test was applied if only 2 groups to be compared. The criterion for statistical significance was P < 0.05.

3. RESULTS

3.1. Establishment of CFA‐induced inflammatory pain in rats

Male SD rats (about 220 g of body weight) were injected with 0.1 mL CFA on the plantar skin of the right hind paw. After 12 hours of CFA injection, rat hind paw withdrawal threshold (PWT) of the rats in the model group appeared significant decline (Figure 1A). The thermal pain threshold was also significantly reduced after 12 hours of CFA injection compared with the corresponding saline‐treated group (Figure 1B). The mechanical and thermal hyperalgesia started at 12 hours and persisted for 72 hours.

Figure 1.

Figure 1

Dynamic changes of paw withdrawal threshold (PWT) and paw withdrawal latency (PWL) after injection of CFA. (A) After 12 h of CFA injection, the rats in the model group present significant mechanical hyperalgesia, and the PWT was significantly reduced (**P < 0.01 compared with the corresponding saline control group (Saline), n = 7). (B) After injection of CFA for 12 h, the PWL was significantly decreased in the model group compared with the corresponding saline‐treated control group (*P < 0.05, **P < 0.01, n = 7)

3.2. CXCR4 and β‐tubulin III co‐expressed on the plantar‐specific neurons by immunofluorescence assay

To detect whether CXCR4 protein was expressed and located in DRG neurons innervating the hind paw's plantar, triple‐labeling techniques were used in this study. The hind paw's plantar projecting DRG cells were retrogradely labeled with DiI. DRG sections containing DiI labeled neurons were chosen for staining with CXCR4 and β‐tubulin III antibodies. Most of the hind paw's plantar surface‐innervating DRG neurons that were immunoreactive for CXCR4 and were also positive for β‐tubulin III (Figure 3). Similarly, all hind paw's plantar‐specific DRG neurons that were immunoreactive for β‐tubulin III and also were positive for CXCR4 (Figure 2).

Figure 2.

Figure 2

Coexpression of CXCR4 with β‐tubulin III in the hind paw's plantar projecting DRG neurons. CXCR4‐positive cells are shown in green (top left), β‐tubulin III‐positive cells are shown in blue (top middle), the hind paw's plantar surface projecting DRG cells were labeled with DiI (red, top right) injected into the plantar surface of hind paw. Merge of β‐tubulin III‐positive staining and CXCR4 labeling (bottom left). Merge of double labeling of DiI and CXCR4 (bottom middle). Merge of β‐tubulin III‐positive staining and DiI labeling (bottom right). Scale bar, 50 μm

3.3. CXCR4 expression is upregulated in L4‐6 DRGs from CFA‐induced inflammatory rats

To determine whether CXCR4 was involved in inflammatory pain, we then detected the expression of CXCR4 during the formation and development of inflammatory pain at both mRNA and protein levels by real‐time PCR and Western blot, respectively. The results showed that post 12 hours of CFA injection, the expression of CXCR4 at both mRNA and protein levels in the L4‐6 DRGs was all significantly increased (Figure 3).

Figure 3.

Figure 3

The changes of CXCR4 expression after injection of CFA. The expression of CXCR4 mRNA and protein in the L4‐6 DRGs of the inflamed rats was significantly increased. Compared with the saline‐treated group (CON), CXCR4 mRNA (A) and protein (B) expression were significantly increased after 12 h of CFA injection (*P < 0.05, **P < 0.01 compared with CON group, n = 4)

3.4. CXCR4 specific antagonist AMD3100 limits allergic inflammatory pain

To further determine whether the inflammatory hyperalgesia in rats was mediated by receptor CXCR4, we used a CXCR4‐specific antagonist AMD3100 to determine whether CXCR4 was involved in the development of CFA‐induced hyperalgesia. Intrathecal injection of AMD3100 dramatically increased the PWT and PWL in CFA‐injected rats in a dose‐ and time‐dependent manner (Figure 4, *P < 0.05,**P < 0.01 compared to the corresponding saline‐treated group, n = 7 for each group). The maximal inhibitory effect was observed at the dose of 50 μg/kg for AMD3100. The inhibitory effect started at 0.5 hours and lasted for 2‐8 hours after injection of AMD3100.

Figure 4.

Figure 4

Inflammatory pain can be significantly relieved by CXCR4 inhibitor AMD3100 in rats. (A) The effects of different doses of AMD3100 (5, 25 and 50 μg/kg) on the mechanical pain in rats were observed. The optimal dose of 25 μg/kg could significantly relieve inflammatory pain in rats, which can be sustained for 8 hours (*P < 0.05,**P < 0.01 compared to the corresponding saline group, n = 7). (B) The effect of different doses of AMD3100 (5, 25 and 50 μg/kg) on the thermal pain in rats was observed. The optimal dose of 25 μg/kg could significantly reverse the pain behavior of rats, which can be sustained for 8 hours (*P < 0.05,**P < 0.01 compared with the corresponding saline group, n = 7)

3.5. CFA leads to demethylation of CpG island in the CXCR4 gene promoter

To further investigate the role of CXCR4 in inflammatory pain, we continued to explore the mechanism of CXCR4 upregulation in CFA‐induced inflammatory rats. By prediction of online software (http://www.urogene.org/cgi-bin/methprimer/methprimer.cgi), the genomic structure of rat CXCR4 gene contains some potential CpG islands in the promoter region (Figure 5A). Here, we mainly selected a longer CpG island that located in downstream of the transcription initiation site to study whether it has methylation change. Methylation‐specific PCR demonstrated significant demethylation occurred in the above‐mentioned area (Figure 5B). In addition, using the bisulfite‐specific PCR method, we also found that after occurrence of CFA‐induced inflammatory pain in rats, the CpG islands in the CXCR4 gene promoter region were low methylated (Figure 6A and 6B). These results suggested the CpG islands that located in the CXCR4 gene promoter region appeared significant hypomethylation in CFA inflammatory pain in rats. At the same time, using real‐time quantitative PCR detection, we found the expression of DNMT3b mRNA in the inflammatory group was significantly decreased after injection of CFA for 3 days, compared with the control group. However, there was no remarkable decrease in expression of DNMT3a after injection of CFA (Figure 6C and 6D).

Figure 5.

Figure 5

MSP results showed DNA methylation of CpG islands in the CXCR4 gene promoter region of L4‐6 DRGs. (A) Online software prediction of CpG island around the CXCR4 gene promoter region. The light blue areas on the map indicate the potential CpG islands. (B) The MSP results showed that the DNA methylation and demethylation ratio of the CpG island in the CXCR4 gene promoter region of L4‐6 DRGs was significantly decreased after 3 days of CFA injection (*P < 0.05, compared with the control group, n = 4)

Figure 6.

Figure 6

BSP results showed DNA methylation of CpG islands in the CXCR4 gene promoter region of L4‐6 DRGs. (A) CpG island position diagram of CXCR4 gene promoter region, and BSP DNA sequencing sequence. (B) BSP sequencing, CFA injection resulted in a significant decrease in CpG island methylation in the CXCR4 gene promoter region (*P < 0.05, compared with the control group, n = 4). (C) Expression levels of DNMT3a and 3b in L4 ‐6 DRGs by qPCR. The expression of DNA methylase DNMT3b in DRGs was significantly decreased after CFA induction (3 d after CFA injection) (*P < 0.05, compared with the control group, n = 4), while DNMT3a level did not change significantly

3.6. CFA injection promotes NF‐κB p65 to CXCR4 gene promoter

CFA‐induced inflammation is associated with the production of some inflammation‐related factors. NF‐κB is one of the important inflammatory‐related transcription factors, which widely participated in the regulation of many inflammatory diseases, thus we investigated whether NF‐κB is also involved in the regulation of CXCR4 expression. Using online software prediction, we found three potential binding sites of NF‐κB p65 in the CpG island of CXCR4 gene promoter region, and we then detected the specific binding of NF‐κB p65 to CXCR4 gene promoter region in lumber L4‐6 DRGs by chromatin immunoprecipitation (ChIP). The results showed that all three potential binding sites can bind to NF‐κB p65, but only at the second and third binding sites, the recruitment of NF‐κB p65 to CXCR4 gene promoter in L4‐6 DRGs was significantly enriched after injection of CFA for 3 days (Figure 7A‐C).

Figure 7.

Figure 7

Enriched recruitment of p65 to CXCR 4 gene promoter in DRGs of CFA‐induced inflammatory rats. (A‐C) Chromatin immunoprecipitation assays indicated a significant increase in binding activity of p65 with the second and third binding sites of promoter of CXCR4 gene in CFA‐induced inflammatory rats compared with age‐matched CON (*P < 0.05, compared with the control group, n = 4 for each group). However, there is no significant change in binding activity of p65 with the first binding site of promoter of CXCR4 gene in CFA‐induced inflammatory rats compared with age‐matched CON rats (n = 4 for each group). (D) Reversed upregulation of CXCR4 expression by PDTC. Intraperitoneal injection of NF‐kB inhibitor PDTC once daily for consecutive 3 days markedly reversed the upregulation of CXCR4 in CFA‐induced inflammatory rats (*P < 0.05, **P < 0.01 compared to the corresponding saline‐treated group, n = 5)

3.7. Treatment of NF‐κB inhibitor PDTC reverses upregulation of CXCR4

To further investigate whether there is a correlation between p65 and CXCR4, we then detected whether the injection of pyrrolidine dithiocarbamate (PDTC), an inhibitor of NF‐κB, reverses CXCR4 expression. PDTC was injected intraperitoneally at different doses once a day for consecutive 3 days in CFA‐induced inflammatory rats from day 0 to day 3 after CFA injection. The same volume of saline was used as control. PDTC treatment markedly suppressed CXCR4 expression in CFA‐induced inflammatory rats at 3 days after CFA injection (Figure 7D, *P < 0.05, **P < 0.01 compared to the corresponding saline‐treated group, n = 5).

4. DISCUSSION

Inflammatory pain is a chronic pathological pain.19 Currently, there are two commonly used inflammatory pain models: One is CFA inflammatory pain model, which can be maintained for a long time and relatively stable.20, 21, 22 The other is the BV inflammatory pain model by injection of bee venom to plantar subcutaneous site, which is applied to study the pathophysiological mechanism of persistent inflammatory pain.23 In this study, we chose the classic CFA inflammatory pain model to study the expression characteristics of CXCR4.

Chemokines are a class of small secretory proteins with leukocyte chemotaxis, which play roles by binding chemokine receptors.24 Recently, more and more studies have shown that the chemokine axis acts as an important regulator in the process of chronic pain.25, 26, 27 Our results confirmed that the upregulation of CXCR4 gene expression in DRG of inflammatory pain model was closely related to DNA hypomethylation in its promoter region.

CXCR4 is a family member of G protein‐coupled receptor, and CXCL12/CXCR4 axis is associated with a range of downstream signaling pathways, such as PI3K, NF‐κB, MAPK pathways.28 In recent years, more and more studies of the CXCL12/CXCR4 axis involved in the field of pain, suggesting it is a new neuromodulator of pathologic pain.7, 8, 9 CXCL12/CXCR4 axis is widely distributed in the peripheral and central nervous system with pain‐sensitive structures, indicating that it is closely related to pain signal transduction. In DRG, CXCL12 and CXCR4 expression patterns are similar, mainly located in the neurons with small or medium diameter. Yang et al29 found that CXCL12 and CXCR4 expressions were significantly upregulated in BV‐induced inflammatory pain models, and double immunofluorescence staining showed that CXCR4 was localized in all sizes (large, medium, and small) of DRG neurons. Our results showed that CXCR4 and β‐tubulin (a neuronal marker) can co‐express on L4‐6 DRGs neurons innervating the plantar skin of rat hind paw, the same as document reported before.29

Extensive studies have shown that epigenetic regulation, including DNA methylation, histone modification, and noncoding RNA, can lead to changes in chromatin structure, DNA conformation, DNA stability, and DNA‐protein interactions, subsequently control the expression of related genes.30 DNA methylation, which is usually associated with gene silencing, is one of the most stable epigenetic modification.31 Recent studies have shown that chronic pain which induced by nerve damage,32 inflammation,33 and diabetes 34 is all related to DNA methylation. From results of in vitro experiments, we further confirmed that the methylation of CXCR4 promoter region downregulated its gene promoter activity. These results indicated that DNA hypomethylation leads to a sustained increase in CXCR4 mRNA expression of DRG in CFA‐induced inflammatory injury model in rat, and the level of DNA demethylation of CpG island in CXCR4 gene promoter region is related to its expression.

The current mechanism for DNA methylation and demethylation is still not very clear, and DNA methylation is mainly performed by DNA methyltransferases. Mammalian DNA methyltransferases can be divided into two categories according to their roles: One is DNMT 1 and the other is DNMT3a, DNMT3b. DNMT 1 is the primary methyltransferase that mediates CpG methylation when the new DNA chain is replicating.35 DNMT3a and DNMT3b are methyltransferases that can methylate the demethylated CpG islands.36, 37 Therefore, analysis of DNMT3a, DNMT3b expression will help to explain the mechanism of demethylation of CXCR4 gene promoter region in DRG induced by CFA inflammation. The expression pattern of these DNMTs in the spinal cord of inflammation, peripheral nerve injury, and others is very inconsistent.38, 39, 40 The reason may be due to different species of animal model and time points used.

We found that DNA demethylation occurred in the CpG islands of CXCR4 gene promoter region at CFA‐induced rat inflammatory pain model. There are two hypotheses about the relationship between gene expression regulation and methylation: One is related factors such as CpG‐binding proteins that are involved in the promotion of DNA methylation can attract transcriptional inhibitors to participate in gene transcription,41 the other is due to the modification of cytosine leads to the change in DNA conformation, which blocking the transcription factor binds its recognized sequence.42 Generally, DNA methylation will eventually inhibit genes expression while DNA demethylation promotes expression of genes. Our experimental results further validate this mechanism: The upregulated expression of CXCR4 in DRG of CFA inflammatory model is closely related to demethylation of CpG islands in its promoter region.

At present, there are two hypotheses about DNA demethylation: “passive” demethylation and “active” demethylation. The hypothesis of so‐called “passive” demethylation includes DNA damage caused by methylation enzyme inactivation, histone modification leads to changes in epigenetic regulation, DNA methyltransferase deficiency, or loss of activity or the lack of S‐adenosylmethionine (methyl donor). In our research, we found that the expression of DNMT3b was significantly decreased, while DNMT3a was also decreased but with no statistically significant difference. Therefore, we believe that demethylation of CXCR4 gene promoter region may be due to abnormal reduction of DNMT3b, but this is certainly not the only mechanism. The so‐called “active” demethylation hypothesis is based on a scholarly study that DNA demethylation is accomplished prior to DNA replication and the significant DNA demethylation has occurred at the early stage of embryogenesis.43, 44 Recently, some studies have reported that some proteins or enzymes have participated in DNA demethylation, such as methyl‐binding proteins (MBDs), deaminase (AID), while their expression level, activity level, or change in position may all regulate the methylation status of DNA. Therefore, our further experiments will continue to study the demethylation mechanism of CXCR4 promoter region.

CFA induces inflammation, then may attract inflammation‐related factors such as NFκB widely participated in transcription regulation of inflammatory factors and pain‐related genes. Recent studies have shown that NF‐κB p65 expression is significantly upregulated in sciatic nerve injury models.45 In addition, the use of NF‐κB p65‐specific inhibitor PDTC can significantly reduce diabetes‐mediated hyperalgesia.46We presumed whether NF‐κB was also involved in the regulation of CXCR4 expression in DRG of CFA‐mediated inflammatory pain. The results showed that there existed potential binding sites of NF‐κB p65 in the CpG island of CXCR4 promoter region. After CFA injection, the recruitment of NF‐κB p65 to the CXCR4 gene promoter region in L4‐6 DRGs was significantly enriched.

In conclusion, our experimental results showed that DNA demethylation of CXCR4 gene promoter region in the DRGs of CFA‐induced inflammatory pain rats promoted the upregulation of CXCR4 gene expression and enhanced the binding ability of the NF‐κB p65. The high expression of CXCR4 may be involved in the modulation of peripheral pain signals and produce inflammatory hyperalgesia ultimately. These findings are expected to provide a theoretical basis for the treatment of chronic pain from the perspective of epigenetic.

CONFLICT OF INTEREST

The authors declare no conflict of interest.

Li F, Xue Z‐Y, Yuan Y, et al. Upregulation of CXCR4 through promoter demethylation contributes to inflammatory hyperalgesia in rats. CNS Neurosci Ther. 2018;24:947–956. 10.1111/cns.12845

Contributor Information

Xiang Zhu, Email: bobofly8850@sina.com.

Lei Wei, Email: weilei_18@163.com.

REFERENCES

  • 1. Gabay E, Wolf G, Shavit Y, Yirmiya R, Tal M. Chronic blockade of interleukin‐1 (IL‐1) prevents and attenuates neuropathic pain behavior and spontaneous ectopic neuronal activity following nerve injury. Eur J Pain. 2011;15:242‐248. [DOI] [PubMed] [Google Scholar]
  • 2. Johnston IN, Milligan ED, Wieseler‐Frank J, et al. A role for proinflammatory cytokines and fractalkine in analgesia, tolerance, and subsequent pain facilitation induced by chronic intrathecal morphine. J Neurosci. 2004;24:7353‐7365. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Sandhir R, Gregory E, He YY, Berman NE. Upregulation of inflammatory mediators in a model of chronic pain after spinal cord injury. Neurochem Res. 2011;36:856‐862. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Wang WJ, Lu J, Niu CS, Huang YR, Ma Q A YG, Hao HW, Li LM, Tu Y. [Effects of electroacupuncture of unilateral and bilateral “zusanli” (ST 36) on serum TNF‐alpha, IL‐1 and IL‐4 levels in rats with chronic inflammatory pain]. Zhen Ci Yan Jiu. 2010;35:429‐432. [PubMed] [Google Scholar]
  • 5. Rolbiecki A, Subramanian R, Crenshaw B, Albright DL, Perreault M, Mehr D. A qualitative exploration of resilience among patients living with chronic pain. Traumatology. 2017;23:89. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Zlotnik A, Yoshie O. Chemokines: a new classification system and their role in immunity. Immunity. 2000;12:121‐127. [DOI] [PubMed] [Google Scholar]
  • 7. Dubovy P, Klusakova I, Svizenska I, Brazda V. Spatio‐temporal changes of SDF1 and its CXCR4 receptor in the dorsal root ganglia following unilateral sciatic nerve injury as a model of neuropathic pain. Histochem Cell Biol. 2010;133:323‐337. [DOI] [PubMed] [Google Scholar]
  • 8. Luo X, Tai WL, Sun L, et al. Central administration of C‐X‐C chemokine receptor type 4 antagonist alleviates the development and maintenance of peripheral neuropathic pain in mice. PLoS ONE. 2014;9:e104860. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Shen W, Hu XM, Liu YN, et al. CXCL12 in astrocytes contributes to bone cancer pain through CXCR4‐mediated neuronal sensitization and glial activation in rat spinal cord. J Neuroinflammation. 2014;11:75. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Matsunami M, Tarui T, Mitani K, et al. Luminal hydrogen sulfide plays a pronociceptive role in mouse colon. Gut. 2009;58:751‐761. [DOI] [PubMed] [Google Scholar]
  • 11. Ho DH, Burggren WW. Epigenetics and transgenerational transfer: a physiological perspective. J Exp Biol. 2010;213:3‐16. [DOI] [PubMed] [Google Scholar]
  • 12. Pan Z, Xue ZY, Li GF, et al. DNA Hydroxymethylation by Ten‐eleven Translocation Methylcytosine Dioxygenase 1 and 3 Regulates Nociceptive Sensitization in a Chronic Inflammatory Pain Model. Anesthesiology. 2017;127:147‐163. [DOI] [PubMed] [Google Scholar]
  • 13. Zhang HH, Hu J, Zhou YL, et al. Promoted interaction of nuclear factor‐kappaB with demethylated cystathionine‐beta‐synthetase gene contributes to gastric hypersensitivity in diabetic rats. J Neurosci. 2013;33:9028‐9038. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Zhou YL, Jiang GQ, Wei J, et al. Enhanced binding capability of nuclear factor‐kappaB with demethylated P2X3 receptor gene contributes to cancer pain in rats. Pain. 2015;156:1892‐1905. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Bai G, Wei D, Zou S, Ren K, Dubner R. Inhibition of class II histone deacetylases in the spinal cord attenuates inflammatory hyperalgesia. Mol Pain. 2010;6:51. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Blanchard F, Chipoy C. Histone deacetylase inhibitors: new drugs for the treatment of inflammatory diseases? Drug Discov Today. 2005;10:197‐204. [DOI] [PubMed] [Google Scholar]
  • 17. Chiechio S, Zammataro M, Morales ME, et al. Epigenetic modulation of mGlu2 receptors by histone deacetylase inhibitors in the treatment of inflammatory pain. Mol Pharmacol. 2009;75:1014‐1020. [DOI] [PubMed] [Google Scholar]
  • 18. Geranton SM, Morenilla‐Palao C, Hunt SP. A role for transcriptional repressor methyl‐CpG‐binding protein 2 and plasticity‐related gene serum‐ and glucocorticoid‐inducible kinase 1 in the induction of inflammatory pain states. J Neurosci. 2007;27:6163‐6173. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Kuner R. Central mechanisms of pathological pain. Nat Med. 2010;16:1258‐1266. [DOI] [PubMed] [Google Scholar]
  • 20. Cao DL, Qian B, Zhang ZJ, Gao YJ, Wu XB. Chemokine receptor CXCR2 in dorsal root ganglion contributes to the maintenance of inflammatory pain. Brain Res Bull. 2016;127:219‐225. [DOI] [PubMed] [Google Scholar]
  • 21. Chen W, Guo S, Wang S. MicroRNA‐16 Alleviates Inflammatory Pain by Targeting Ras‐Related Protein 23 (RAB23) and Inhibiting p38 MAPK Activation. Med Sci Monit. 2016;22:3894‐3901. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Hu C, Cai Z, Lu Y, et al. Nonviral vector plasmid DNA encoding human proenkephalin gene attenuates inflammatory and neuropathic pain‐related behaviors in mice. Neurosci Lett. 2016;634:87‐93. [DOI] [PubMed] [Google Scholar]
  • 23. Chen J, Lariviere WR. The nociceptive and anti‐nociceptive effects of bee venom injection and therapy: a double‐edged sword. Prog Neurobiol. 2010;92:151‐183. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Allen SJ, Crown SE, Handel TM. Chemokine: receptor structure, interactions, and antagonism. Annu Rev Immunol. 2007;25:787‐820. [DOI] [PubMed] [Google Scholar]
  • 25. Gao YJ, Ji RR. c‐Fos and pERK, which is a better marker for neuronal activation and central sensitization after noxious stimulation and tissue injury? Open Pain J. 2009;2:11‐17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Zhang ZJ, Cao DL, Zhang X, Ji RR, Gao YJ. Chemokine contribution to neuropathic pain: respective induction of CXCL1 and CXCR2 in spinal cord astrocytes and neurons. Pain. 2013;154:2185‐2197. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Zhuang ZY, Kawasaki Y, Tan PH, Wen YR, Huang J, Ji RR. Role of the CX3CR1/p38 MAPK pathway in spinal microglia for the development of neuropathic pain following nerve injury‐induced cleavage of fractalkine. Brain Behav Immun. 2007;21:642‐651. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Li M, Ransohoff RM. Multiple roles of chemokine CXCL12 in the central nervous system: a migration from immunology to neurobiology. Prog Neurobiol. 2008;84:116‐131. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Yang F, Sun W, Yang Y, et al. SDF1‐CXCR4 signaling contributes to persistent pain and hypersensitivity via regulating excitability of primary nociceptive neurons: involvement of ERK‐dependent Nav1.8 up‐regulation. J Neuroinflammation. 2015;12:219. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Denk F, McMahon SB. Chronic pain: emerging evidence for the involvement of epigenetics. Neuron. 2012;73:435‐444. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Kass SU, Pruss D, Wolffe AP. How does DNA methylation repress transcription? Trends Genet. 1997;13:444‐449. [DOI] [PubMed] [Google Scholar]
  • 32. Massart R, Dymov S, Millecamps M, et al. Overlapping signatures of chronic pain in the DNA methylation landscape of prefrontal cortex and peripheral T cells. Sci Rep. 2016;6:19615. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Qi F, Zhou Y, Xiao Y, et al. Promoter demethylation of cystathionine‐beta‐synthetase gene contributes to inflammatory pain in rats. Pain. 2013;154:34‐45. [DOI] [PubMed] [Google Scholar]
  • 34. Zhang HH, Hu J, Zhou YL, et al. Promoted Interaction of Nuclear Factor‐kappaB With Demethylated Purinergic P2X3 Receptor Gene Contributes to Neuropathic Pain in Rats With Diabetes. Diabetes. 2015;64:4272‐4284. [DOI] [PubMed] [Google Scholar]
  • 35. Howell CY, Bestor TH, Ding F, et al. Genomic imprinting disrupted by a maternal effect mutation in the Dnmt1 gene. Cell. 2001;104:829‐838. [DOI] [PubMed] [Google Scholar]
  • 36. Klose RJ, Bird AP. Genomic DNA methylation: the mark and its mediators. Trends Biochem Sci. 2006;31:89‐97. [DOI] [PubMed] [Google Scholar]
  • 37. Law JA, Jacobsen SE. Molecular biology. Dynamic DNA methylation. Science. 2009;323:1568‐1569. [DOI] [PubMed] [Google Scholar]
  • 38. Sun Y, Sahbaie P, Liang D, et al. DNA methylation modulates nociceptive sensitization after incision. PLoS ONE. 2015;10:e0142046. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Tochiki KK, Cunningham J, Hunt SP, Geranton SM. The expression of spinal methyl‐CpG‐binding protein 2, DNA methyltransferases and histone deacetylases is modulated in persistent pain states. Mol Pain. 2012;8:14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Wang Y, Lin ZP, Zheng HZ, et al. Abnormal DNA methylation in the lumbar spinal cord following chronic constriction injury in rats. Neurosci Lett. 2016;610:1‐5. [DOI] [PubMed] [Google Scholar]
  • 41. Hendrich B, Bird A. Identification and characterization of a family of mammalian methyl‐CpG binding proteins. Mol Cell Biol. 1998;18:6538‐6547. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42. Xu GY, Winston JH, Shenoy M, Zhou S, Chen JD, Pasricha PJ. The endogenous hydrogen sulfide producing enzyme cystathionine‐beta synthase contributes to visceral hypersensitivity in a rat model of irritable bowel syndrome. Mol Pain. 2009;5:44. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43. Reik W, Dean W. DNA methylation and mammalian epigenetics. Electrophoresis. 2001;22:2838‐2843. [DOI] [PubMed] [Google Scholar]
  • 44. Reik W, Dean W, Walter J. Epigenetic reprogramming in mammalian development. Science. 2001;293:1089‐1093. [DOI] [PubMed] [Google Scholar]
  • 45. Fu ES, Zhang YP, Sagen J, et al. Transgenic inhibition of glial NF‐kappa B reduces pain behavior and inflammation after peripheral nerve injury. Pain. 2010;148:509‐518. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46. Shi L, Zhang HH, Xiao Y, Hu J, Xu GY. Electroacupuncture suppresses mechanical allodynia and nuclear factor kappa B signaling in streptozotocin‐induced diabetic rats. CNS Neurosci Ther. 2013;19:83‐90. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from CNS Neuroscience & Therapeutics are provided here courtesy of Wiley

RESOURCES