Skip to main content
NCBI home page
CNS Neuroscience & Therapeutics logoLink to CNS Neuroscience & Therapeutics
. 2018 Mar 25;24(10):957–966. doi: 10.1111/cns.12850

Long noncoding RNA LINC00152 is a potential prognostic biomarker in patients with high‐grade glioma

Wen Wang 1,2,3,4, Fan Wu 3,5, Zheng Zhao 3,5, Kuan‐Yu Wang 3,5, Ruo‐Yu Huang 3,5, Hao‐Yuan Wang 3,6, Qing Lan 1, Jiang‐Fei Wang 2,3, Ji‐Zong Zhao 1,2,4,✉
PMCID: PMC6489806  PMID: 29577647

Summary

Aims

To investigate the role of LINC00152 in high‐grade glioma (HGG).

Methods

We collected data from the Chinese Glioma Genome Atlas (CGGA) microarray, CGGA RNA sequencing, and GSE16011 datasets to evaluate the expression and prognostic relationship of LINC00152 in patients with HGGs. A knockdown assay was performed to determine the function of LINC00152 in glioma development and progression in vitro and in vivo.

Results

The expression of LINC00152 was increased with glioma grade, especially in the mesenchymal TCGA subtype. LINC00152 was independently associated with poor prognosis, and the overall survival (OS) of the high expression group was shorter than the low expression group (median OS 14.77 vs 9.65 months; P = 0.0216) in the CGGA microarray dataset. The results were validated in the other 2 datasets. Based on the expression of LINC00152, 4288 (2519 positively; 1769 negatively) probes were extracted to perform a biological process analysis using the Database for Annotation, Visualization, and Integrated Discovery. Positively regulated genes were enriched in immune response, apoptotic process, cell adhesion, and regulation of cell proliferation. The clinical and molecular features of HGG patients indicated that patients in the LINC00152 high expression group tended to display the mesenchymal type, older (≥46 years), isocitrate dehydrogenase1 wild‐type, O(6)‐methylguanine DNA methyltransferase unmethylated, nonchemotherapy, and low karnofsky performance status. Functionally, knockdown of LINC00152 inhibited cell proliferation, migration, and invasion and increased the sensitivity of chemotherapy in vitro.

Conclusion

Our results indicate that knockdown of LINC00152 could inhibit tumor growth in vivo. LINC00152 could serve as a potential prognostic biomarker in patients with HGG.

Keywords: glioma, LINC00152, long noncoding RNA, microarray, RNA sequencing

1. INTRODUCTION

Gliomas are one of the most common primary brain tumors.1, 2 Gliomas are categorized as low‐grade (World Health Organization [WHO] Grade II) and high‐grade gliomas (HGGs, WHO Grades III and IV). The median overall survival (OS) of Grade III gliomas is 37.6 months,3 while the OS of Grade IV gliomas is approximately 14 months.3, 4 The infiltrative growth occurring during chemo‐ and radiotherapy resistance has hampered the progress of glioma treatments. Identifying the underlying mechanism of progression and formulating effective treatments for glioma are imperative. Therefore, it is crucial to identify new biomarkers and therapeutic targets.

Long noncoding RNAs (lncRNAs), which are a class of transcripts longer than 200 nucleotides, have no protein‐coding ability.5 LncRNAs have multiple functions, including chromatin remodeling, transcriptional control, and post‐transcriptional processing.6, 7, 8, 9 Expression abnormalities of lncRNAs are associated with the progression of gliomas.10, 11, 12 Upregulation of lncRNA HOXA‐AS3 promotes tumor progression and predicts poor prognosis in glioma.13 A novel lncRNA ECONEXIN is a potential oncogene that regulates TOP2A by sponging miR‐411‐5p in glioma.14 LncRNA H19 regulates glioma angiogenesis and the biological behavior of glioma‐associated endothelial cells by inhibiting miR‐29a.15 LINC00152 lies on human chromosome 2p and has a length of 828 nucleotides. LINC00152 could promote proliferation through the epidermal growth factor receptor pathway and was also involved in apoptosis, epithelial to mesenchymal transition, cell migration, and invasion in gastric cancer.16, 17, 18, 19 LINC00152 can also promote proliferation via the mechanistic target of rapamycin signaling pathway, so as to promote oncogenesis of hepatocellular carcinoma.20

However, the role of LINC00152 in HGGs remains unclear. We selected the Chinese Glioma Genome Atlas (CGGA) microarray (Grade II 122, Grade III 51, and Grade IV 128), CGGA RNA sequencing (Grade II 109, Grade III 71, and Grade IV 141), and GSE16011 (Grade II 24, Grade III 85, and Grade IV 159) datasets to investigate the potential role in HGGs. The high expression of LINC00152 was associated with tumor grade and poor prognosis in glioma patients. A knockdown assay was performed to determine the function of LINC00152 in glioma development and progression in vitro and in vivo. The findings highlight the important role of LINC00152 in gliomas and may provide a potential therapeutic target for gliomas.

2. MATERIALS AND METHODS

2.1. Datasets and cell lines

A total of 301 glioma patients from the CGGA microarray dataset were included in our study. Meanwhile, 321 patients from CGGA RNA sequencing dataset and 268 patients from GSE16011 were treated as validation sets. All samples were histologically diagnosed according to the 2007 WHO classification guidelines. The study was approved by the ethics committee of Beijing Tiantan Hospital. Written informed consents were obtained from all participants in this study. Human glioma cell lines LN229 and SNB19 were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA), and the cell lines were cultured in Dulbecco's modified Eagle's medium (DMEM) F12 supplemented with 10% fetal bovine serum (FBS).

2.2. Quantitative real‐time polymerase chain reaction (qRT‐PCR)

Total RNA was extracted and reverse‐transcribed using Trizol reagent (Life Technologies, Carlsbad, CA, USA) and RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific, Waltham, MA, USA) according to the manufacturer's protocol. qRT‐PCR was performed to detect the expression level of LINC00152 using the standard protocol from the SYBR Select Master Mix kit. Glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH) was used as the internal standard. The primers used were as follows:

  • LINC00152‐F 5′‐AAAATCACGACTCAGCCCCC‐3′

  • LINC00152‐R 5′‐AATGGGAAACCGACCAGACC‐3′

  • GAPDH‐F 5′‐AGGGCTGCTTTTAACTCTGGT‐3′

  • GAPDH‐R 5′‐CCCCACTTGATTTTGGAGGGA‐3′

2.3. Cell proliferation, migration, and invasion assays

Cells were plated in 96‐well plates at a density of 2000 cells per well. After LINC00152 small interfering RNA (siRNA) and negative control (NC) transfection for 72 hours, the medium in each well was replaced with 120 μL of complete medium containing 20 μL of MTS solution. Cells were evaluated by measuring the absorbance at 490 nm. For colony formation assay, cells were transfected with siRNAs targeting LINC00152 for 24 hours and then, 100 cells were plated in each well of the 12‐well plate to form a colony.

Cell migration assay was performed using Transwell chambers (8 μm pore size, Corning, Corning, NY, USA). Approximately 1 × 105 cells were seeded into the upper chamber in serum‐free medium in triplicate. Medium (500 μL) containing 20% FBS was added to the lower chamber. After incubation for 4 hours, cells migrating to the lower surface of the membrane were fixed and stained with 0.5% crystal violet. For the invasion assay, Matrigel Invasion Chambers in the 24‐well plates were used, and cells were fixed and stained after 48 hours. The siRNAs used were as follows:

  • si‐1 sense: 5′‐GGGAAAUAAAUGACUGGAUdTdT‐3′

  • si‐3 sense: 5′‐UCUAUGUGUCUUAAUCCCUUGUCCU‐3′

2.4. In vivo assay

LN229 cells were stably infected with pLKO.1 or pLKO.1‐sh1 lentivirus. Four‐ or six‐week‐old female BALB/c nude mice were used as the subcutaneous model. A total of 5 × 105 cells were suspended in 100 μL PBS and then subcutaneously injected in the right flank of each mouse. After 30 days, tumor growth and tumor volume were evaluated. All protocols were approved by the Institutional Animal Care and Use Committee at Beijing Neurosurgical Institute, Capital Medical University. The short hairpin RNAs (shRNAs) used were as follows:

  • sh1 sense: 5′‐CCGGGTCTTAATCCCTTGTCCTTCTCGAGAAGGACAAGGGATTAAGACTTTTTG‐3′

  • sh1 antisense: 5′‐AATTCAAAAAGTCTTAATCCCTTGTCCTTCTCGAGAAGGACAAGGGATTAAGAC‐3′

2.5. Statistical analyses

Cases were divided into 2 groups (low and high expression) based on the median expression of LINC00152. Univariate and multivariate Cox regression analyses were performed using SPSS version 22 software (SPSS Inc., Chicago, IL, USA). The Kaplan‐Meier curve was performed using GraphPad Prism 6 software (GraphPad Software Inc., La Jolla, CA, USA). A two‐sided P‐value of <0.05 was regarded as statistically significant. Biological process analysis was performed using The Database for Annotation, Visualization, and Integrated Discovery (DAVID; http://david.abcc.ncifcrf.gov/).21, 22

3. RESULTS

3.1. Expression of LINC00152 is dysregulated in gliomas

To confirm whether LINC00152 is associated with glioma progression, we first examined the expressions of LINC00152 in the 3 datasets. LINC00152 expression was increased with glioma grade (Figure 1A) in the CGGA microarray dataset. The results were similar in 2 additional datasets (CGGA RNA sequencing dataset and GSE16011). After that, we further validated the expression of LINC00152 using qRT‐PCR in an independent group (Grade II 10, Grade III 10, Grade IV 12). Consistent with the above analysis, the level of LINC00152 increased with the histological grade (Figure 1A). In addition, we analyzed the LINC00152 expression in 4 subtypes according to TCGA molecular classification. Interestingly, LINC00152 showed higher expression in the mesenchymal subtype (Figure 1B). We also detected the level of LINC00152 in isocitrate dehydrogenase1 wild‐type (IDH1‐WT) and mutant samples. The results indicated that LINC00152 expression was upregulated in IDH1‐WT samples relative to mutant samples (Figure 1C) and that LINC00152 expression was increased in HGGs and was associated with TCGA subtypes and IDH1 mutation status.

Figure 1.

Figure 1

Open in a new tab

Expression of LINC00152 in different tumor grades, TCGA subtypes, and IDH1 mutation status. (A) Expression of LINC00152 in different tumor grades; (B) Expression of LINC00152 in different TCGA subtypes. (C) Expression of LINC00152 in different IDH1 mutation statues. P proneural, N neural, C classical, M mesenchymal. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001

3.2. LINC00152 is associated with clinical prognosis of HGG patients

In order to investigate the correlation between LINC00152 and OS of glioma patients, the HGGs were divided into low and high groups based on the median expression of LINC00152 (cutoff value 1.32). The OS of the high expression group was shorter than the low expression group (median OS 14.77 vs 9.65 months; P = 0.0216). We further evaluated the prognosis of LINC00152 in the stratified groups (GIII and GIV). Similar results were obtained (GIII median OS 25.97 vs 14.53 months, P = 0.0883; GIV median OS 10.5 vs 9.03 months, P = 0.0639; Figure 2A). The results were validated in CGGA RNA sequencing and GSE16011 datasets (Figure 2B,C). The diagnostic value of LINC00152 was calculated by a receiver operating characteristic (ROC) curve, and the area under the curve (AUC) was 0.658 in the CGGA microarray dataset.

Figure 2.

Figure 2

Open in a new tab

Kaplan‐Meier curves of OS among HGG patients from different groups stratified by the expression of LINC00152 in the 3 datasets. (A) Kaplan‐Meier curves of OS in the CGGA microarray dataset; (B) Kaplan‐Meier curves of OS in the CGGA RNA sequencing dataset; (C) Kaplan‐Meier curves of OS in the GSE16011 dataset

We also assessed the independence of LINC00152 in 3 datasets using univariate and multivariate Cox regression analyses. LINC00152 was a potential independent prognosis factor in gliomas (P = 0.013; P = 0.002; P = 0.095, respectively; Table 1).

Table 1.

Clinicopathologic factors associated with OS for HGGs from CGGA microarray, CGGA RNA sequencing and GSE16011 microarray datasets

Variable CGGA microarray dataset CGGA RNA sequencing dataset GSE16011 microarray dataset
Univariate Cox Multivariate Cox Univariate Cox Multivariate Cox Univariate Cox Multivariate Cox
P‐value HR P‐value HR P‐value HR P‐value HR P‐value HR P‐value HR
Gender 0.836 0.964 0.589 0.903 0.716 0.949
Age 0.005 1.021 0.375 1.014 0.037 1.016 0.405 1.028 0.000 1.039 0.000 1.030
Grade 0.000 2.377 0.004 6.676 0.000 2.246 0.304 1.908 0.000 3.118 0.000 2.523
IDH1 0.000 0.457 0.412 0.550 0.000 0.389 0.043 0.179 0.000 0.507 0.009 0.566
MGMT 0.011 0.585 0.067 2.452 0.003 0.566 0.045 3.214
Radiotherapy 0.000 0.391 0.016 0.275 0.001 0.519 0.082 0.277
Chemotherapy 0.000 0.359 0.000 0.188 0.000 0.435 0.001 0.094 0.036 0.618 0.391 0.777
KPS 0.049 0.982 0.016 0.968 0.009 0.969 0.012 0.951 0.000 0.990 0.031 0.991
LINC00152 0.000 1.230 0.013 1.652 0.000 1.121 0.002 1.785 0.000 3.961 0.095 2.127
Open in a new tab

Gender, male 1, female 2; Grade, G2 2, G3 3; IDH1 mutation status, mutated 1, wild‐type 0; radiotherapy, Yes 1, No 0; chemotherapy, Yes 1, No 0.

3.3. Functional exploration of LINC00152 in HGG patients

Based on the expression of LINC00152, we extracted 4288 (2519 positively; 1769 negatively) probes using Pearson correlation analysis (Correlation Value 0.4; P < 0.001) in the CGGA microarray dataset. Biological process analysis performed using DAVID showed that positively regulated genes were enriched in aspects including the immune response, apoptotic process, cell adhesion, and regulation of cell proliferation. The negatively related genes were enriched in aspects including the chemical synaptic transmission, nervous system development, neuron migration, and positive regulation of GTPase activity (Figure 3A). The heatmap of 4288 related probes is presented in Figure 3C. The clinical and molecular features of HGG patients indicated that patients in the LINC00152 high expression group tended to display the mesenchymal type, older (≥46 years), IHD1‐WT, O(6)‐methylguanine DNA methyltransferase (MGMT) unmethylated, nonchemotherapy, and low karnofsky performance status (KPS) (Figure 3B). These data suggest that LINC00152 may serve as an important modulator in glioma progression.

Figure 3.

Figure 3

Open in a new tab

Functional exploration of LINC00152 in HGG patients. (A) Positively and negatively related biological processes; (B)Clinicopathologic features in the different grades. Rows represent corresponding items (TCGA subtype, gender, age, IDH1, MGMT, radiotherapy, chemotherapy, and KPS); (C) Heatmap of the expression of 4288 probes related to LINC00152. Rows represent corresponding genes, while columns indicate corresponding patients

3.4. LINC00152 promotes cell proliferation, migration, and invasion in vitro

To validate the functional role of LINC00152 in glioma, we assessed the effects of siRNA‐mediated knockdown of LINC00152 on cell proliferation, migration, and invasion. Evaluation of the knockdown efficiency of siRNAs in LN229 and SNB19 indicated that si‐1 and si‐3 could significantly knockdown the expression of LINC00152 (Figure 4A). MTS assay data revealed that knockdown of LINC00152 inhibited cell proliferation in LN229 and SNB19 (Figure 4B). Colony formation assays also showed that the clonogenic ability was decreased following knockdown of LINC00152 (Figure 4C). Moreover, Transwell assay data demonstrated that the downregulation of LINC00152 inhibited cell migration and invasion (Figures 5A and S1). The wound‐healing assay was also performed to detect the cell migration ability. The healing rate was slow in the si‐1 and si‐3 groups (Figure 5B). Taken together, these results demonstrate that LINC00152 plays an important role in glioma malignant phenotypes.

Figure 4.

Figure 4

Open in a new tab

Knockdown of LINC00152 inhibits cell proliferation in vitro. MTS assay and colony formation were performed to evaluate the proliferative ability between control and siRNAs. (A) qRT‐PCR analysis of the knockdown efficiency of si‐1 and si‐3 in LN229 and SNB19 cells; (B) MTS assay was performed to determine the cell proliferation after transfection with si‐1 or si‐3. (C) Colony formation assay was conducted to determine the effect of LINC00152 knockdown on cloning ability in LN229 and SNB19 cells

Figure 5.

Figure 5

Open in a new tab

Knockdown of LINC00152 inhibits cell migration in vitro. (A) Transwell assays were conducted to assess the effect of LINC00152 knockdown on cell migration; (B) The wound‐healing assays were conducted to assess the effect of LINC00152 knockdown on cell migration

3.5. Knockdown of LINC00152 inhibits glioma cell tumorigenesis in vivo

LN229 cells were stably infected with pLKO.1 or pLKO.1‐sh1 lentivirus to evaluate the effect of LINC00152 on glioma cells growth in vivo. The expression of LINC00152 was significantly knocked down in the pLKO.1‐sh1 group (Figure 6A). Cells were subcutaneously injected in the right flank of nude mice. Tumor size in the pLKO.1‐sh1 group was obviously smaller than that in the control group after 30 days (Figure 6B,C). The tumor weight in the pLKO.1‐sh1 group was also significantly lower than that in the control group (Figure 6D). These results indicate that knockdown of LINC00152 could inhibit tumor growth in vivo.

Figure 6.

Figure 6

Open in a new tab

Knockdown of LINC00152 inhibits tumor growth in vivo. (A) qRT‐PCR analysis of the knockdown efficiency of pLKO.1‐sh1 in LN229; (B) Tumors formed in nude mice of pLKO.1 and pLKO.1‐sh1 groups after 30 d. (C) and (D) Tumor size and weight of each tumor sample from 2 groups are represented

3.6. Knockdown of LINC00152 increases sensitivity to chemotherapy

To examine whether LINC00152 is involved in the chemoresistance of glioma cells, we evaluated the relationship between LINC00152 expression and MGMT methylation. Based on the MGMT promoter methylation status and LINC00152 expression levels, the HGGs were stratified into 4 subgroups. Patients with methylated MGMT promoter and low expression of LINC00152 had longer OS than that of the other 3 subgroups (Figure 7A). The OS of HGGs with chemotherapy in patients with high expression of LINC00152 was shorter than in patients in the low expression group in the CGGA microarray dataset (median OS 27.05 vs 18.20 months; P = 0.0279). The results were validated in the other 2 datasets (Figure 7B). We further verified these findings in LN229 and SNB19 cells using the MTS assay. The assay results showed that the sensitivity of the cells to temozolomide (TMZ) was increased when LINC00152 was knocked down, especially in the TMZ 400 and 800 μmol/L groups (Figure 7C).

Figure 7.

Figure 7

Open in a new tab

Knockdown of LINC00152 increases the sensitivity of chemotherapy. (A) Kaplan‐Meier curves of OS among HGGs with methylated MGMT promoter from different groups stratified by the expression of LINC00152; (B) Kaplan‐Meier curves of OS among HGGs with chemotherapy from different groups stratified by the expression of LINC00152; (C) Knockdown of LINC00152 increased the sensitivity of chemotherapy in TMZ‐resistant LN229 and SNB19 cells

4. DISCUSSION

Dysregulation of lncRNAs may contribute to glioma pathogenesis, such as cellular proliferation and apoptosis.10, 12, 23, 24 We aimed to assess whether LINC00152 could function as an oncogene and promote tumor malignancy. To ascertain the role of LINC00152 in glioma, we collected data from 3 datasets to explore the clinical and molecular features of LINC00152 in HGGs. LINC00152 was increased with glioma grades and was significantly associated with the clinical prognosis of HGG patients. Patients with high expression of LINC00152 tended to displayed the mesenchymal type, older (≥46 years), IDH1‐WT, MGMT unmethylated, nonchemotherapy and low KPS. Moreover, knockdown of LINC00152 could inhibit cell proliferation and migration in vitro, and increase the sensitivity of chemotherapy.

The data indicate that the LINC00152 expression level is a determinant of patients' prognoses, with a high LINC00152 expression level associated with reduced survival in HGG. Taking into consideration several critical clinical features, such as age, grade, IDH1, MGMT, radiotherapy, and chemotherapy, multivariate Cox regression analysis was conducted to verify the prognostic role of LINC00152. These results indicated that LINC00152 is an independent prognostic factor in patients with HGG.

In routine clinical management, patients treated with chemotherapy, such as TMZ, have better prognoses than those not receiving chemotherapy.25, 26 The methylated prompter of MGMT impairs the ability for cells to recover from damage induced by chemotherapeutic agents.27, 28, 29 In this study, patients with HGG were stratified into 4 subgroups according to MGMT promoter methylation status and LINC00152 expression levels (Figure 7A,B). Patients with methylated MGMT promoter and low LINC00152 expression level displayed longer OS than the other subgroups.

It is the first study to report that LINC00152 plays an important role in HGGs. We identified LINC00152 as a prognostic gene for anaplastic gliomas from Cox regression analysis in our previous study.30 However, there were some limitations. These findings were based on bioinformatics analysis. When incorporated with MGMT promoter methylation status, LINC00152 could be introduced for accurate prediction of prognosis. Future study is needed to clarify the mechanism of LINC00152 and to further validate the clinical application in patients with glioma.

In conclusion, LINC00152 has prognosis value for patients with HGG. The expression level of LINC00152 is upregulated with tumor grades. Knockdown of LINC00152 can inhibit cell proliferation and cell migration, and increase therapeutic sensitization in vitro. Knockdown of LINC00152 can inhibit tumor growth in vivo. Therefore, LINC00152 could serve as a potential prognostic biomarker in patients with HGG.

CONFLICTS OF INTEREST

The authors declare no conflict of interest.

Supporting information

 

Click here for additional data file. (1.6MB, tif)

ACKNOWLEDGMENTS

This work was supported by grants from Ministry of Science and Technology of China grant (2012CB825505, 2011BAI08B08); Beijing Municipal Administration of Hospitals' Mission Plan (SML20150501); “13th Five‐Year Plan” National Science and Technology supporting plan (2015BAI09B04).

Wang W, Wu F, Zhao Z, et al. Long noncoding RNA LINC00152 is a potential prognostic biomarker in patients with high‐grade glioma. CNS Neurosci Ther. 2018;24:957–966. 10.1111/cns.12850

Funding information

This work was supported by grants from Ministry of Science and Technology of China grant (2012CB825505, 2011BAI08B08); Beijing Municipal Administration of Hospitals' Mission Plan (SML20150501); “13th Five‐Year Plan” National Science and Technology supporting plan (2015BAI09B04).

REFERENCES

  • 1. Nikiforova MN, Hamilton RL. Molecular diagnostics of gliomas. Arch Pathol Lab Med. 2011;135:558‐568. [DOI] [PubMed] [Google Scholar]
  • 2. Yan W, Zhang W, You G, et al. Molecular classification of gliomas based on whole genome gene expression: a systematic report of 225 samples from the Chinese Glioma Cooperative Group. Neuro Oncol. 2012;14:1432‐1440. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Yang P, Wang Y, Peng X, et al. Management and survival rates in patients with glioma in China (2004‐2010): a retrospective study from a single‐institution. J Neurooncol. 2013;113:259‐266. [DOI] [PubMed] [Google Scholar]
  • 4. Stupp R, Mason WP, van den Bent MJ, et al. Radiotherapy plus concomitant and adjuvant temozolomide for glioblastoma. N Engl J Med. 2005;352:987‐996. [DOI] [PubMed] [Google Scholar]
  • 5. Lavorgna G, Vago R, Sarmini M, et al. Long non‐coding RNAs as novel therapeutic targets in cancer. Pharmacol Res. 2016;110:131‐138. [DOI] [PubMed] [Google Scholar]
  • 6. Wang Y, Wu P, Lin R, et al. LncRNA NALT interaction with NOTCH1 promoted cell proliferation in pediatric T cell acute lymphoblastic leukemia. Sci Rep. 2015;5:13749. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Zhuo H, Tang J, Lin Z, et al. The aberrant expression of MEG3 regulated by UHRF1 predicts the prognosis of hepatocellular carcinoma. Mol Carcinog. 2016;55:209‐219. [DOI] [PubMed] [Google Scholar]
  • 8. Mercer TR, Dinger ME, Mattick JS. Long non‐coding RNAs: insights into functions. Nat Rev Genet. 2009;10:155‐159. [DOI] [PubMed] [Google Scholar]
  • 9. Fang Y, Fullwood MJ. Roles, functions, and mechanisms of long non‐coding RNAs in cancer. Genomics Proteomics Bioinformatics. 2016;14:42‐54. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Sun Y, Wang Z, Zhou D. Long non‐coding RNAs as potential biomarkers and therapeutic targets for gliomas. Med Hypotheses. 2013;81:319‐321. [DOI] [PubMed] [Google Scholar]
  • 11. Zhu Y, Zhang X, Qi L, et al. HULC long noncoding RNA silencing suppresses angiogenesis by regulating ESM‐1 via the PI3K/Akt/mTOR signaling pathway in human gliomas. Oncotarget. 2016;7:14429‐14440. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Bian EB, Li J, Xie YS, et al. LncRNAs: new players in gliomas, with special emphasis on the interaction of lncRNAs With EZH2. J Cell Physiol. 2015;230:496‐503. [DOI] [PubMed] [Google Scholar]
  • 13. Wu F, Zhang C, Cai J, et al. Upregulation of long noncoding RNA HOXA‐AS3 promotes tumor progression and predicts poor prognosis in glioma. Oncotarget. 2017;8:53110‐53123. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Deguchi S, Katsushima K, Hatanaka A, et al. Oncogenic effects of evolutionarily conserved noncoding RNA ECONEXIN on gliomagenesis. Oncogene. 2017;36:4629‐4640. [DOI] [PubMed] [Google Scholar]
  • 15. Jia P, Cai H, Liu X, et al. Long non‐coding RNA H19 regulates glioma angiogenesis and the biological behavior of glioma‐associated endothelial cells by inhibiting microRNA‐29a. Cancer Lett. 2016;381:359‐369. [DOI] [PubMed] [Google Scholar]
  • 16. Zhou J, Zhi X, Wang L, et al. Linc00152 promotes proliferation in gastric cancer through the EGFR‐dependent pathway. J Exp Clin Cancer Res. 2015;34:135. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Zhao J, Liu Y, Zhang W, et al. Long non‐coding RNA Linc00152 is involved in cell cycle arrest, apoptosis, epithelial to mesenchymal transition, cell migration and invasion in gastric cancer. Cell Cycle. 2015;14:3112‐3123. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Xia T, Liao Q, Jiang X, et al. Long noncoding RNA associated‐competing endogenous RNAs in gastric cancer. Sci Rep. 2014;4:6088. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Pang Q, Ge J, Shao Y, et al. Increased expression of long intergenic non‐coding RNA LINC00152 in gastric cancer and its clinical significance. Tumour Biol. 2014;35:5441‐5447. [DOI] [PubMed] [Google Scholar]
  • 20. Ji J, Tang J, Deng L, et al. LINC00152 promotes proliferation in hepatocellular carcinoma by targeting EpCAM via the mTOR signaling pathway. Oncotarget. 2015;6:42813‐42824. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. da Huang W, Sherman BT, Lempicki RA. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat Protoc. 2009;4:44‐57. [DOI] [PubMed] [Google Scholar]
  • 22. Wang W, Zhang L, Wang Z, et al. A three‐gene signature for prognosis in patients with MGMT promoter‐methylated glioblastoma. Oncotarget. 2016;7:69991‐69999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Zhang XQ, Leung GK. Long non‐coding RNAs in glioma: functional roles and clinical perspectives. Neurochem Int. 2014;77:78‐85. [DOI] [PubMed] [Google Scholar]
  • 24. Wang P, Ren Z, Sun P. Overexpression of the long non‐coding RNA MEG3 impairs in vitro glioma cell proliferation. J Cell Biochem. 2012;113:1868‐1874. [DOI] [PubMed] [Google Scholar]
  • 25. Glioma Meta‐Analysis Trialists Group . Chemotherapy for high‐grade glioma. Cochrane Database Syst Rev. 2002:CD003913. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Cheng W, Li M, Cai J, et al. HDAC4, a prognostic and chromosomal instability marker, refines the predictive value of MGMT promoter methylation. J Neurooncol. 2015;122:303‐312. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Esteller M, Garcia‐Foncillas J, Andion E, et al. Inactivation of the DNA‐repair gene MGMT and the clinical response of gliomas to alkylating agents. N Engl J Med. 2000;343:1350‐1354. [DOI] [PubMed] [Google Scholar]
  • 28. Hegi ME, Diserens AC, Gorlia T, et al. MGMT gene silencing and benefit from temozolomide in glioblastoma. N Engl J Med. 2005;352:997‐1003. [DOI] [PubMed] [Google Scholar]
  • 29. Karsy M, Neil JA, Guan J, et al. A practical review of prognostic correlations of molecular biomarkers in glioblastoma. Neurosurg Focus. 2015;38:E4. [DOI] [PubMed] [Google Scholar]
  • 30. Wang W, Yang F, Zhang L, et al. LncRNA profile study reveals four‐lncRNA signature associated with the prognosis of patients with anaplastic gliomas. Oncotarget. 2016;7:77225‐77236. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

 

Click here for additional data file. (1.6MB, tif)

Articles from CNS Neuroscience & Therapeutics are provided here courtesy of Wiley

RESOURCES