Summary
Aim
To characterize clinical features and mutation spectrum in Chinese patients with CADASIL.
Methods
We collected 261 clinically suspected Chinese CADASIL patients from three hospitals located in different regions of China. Sanger sequencing is performed to screen the exons 2 to 24 of NOTCH3 gene. Clinical and genetic data were retrospectively studied. Haplotype analyses were performed in patients carrying p.Arg544Cys and p.Arg607Cys, respectively.
Results
A total of 214 patients were finally genetically diagnosed as CADASIL, with 45 known NOTCH3 mutations and a novel c.1817G>T mutation. We found that patients carrying p.Arg607Cys or p.Arg544Cys mutation located in exon 11 occupied nearly 35% in our mutation spectrum. In retrospectively study of clinical data, we found a higher number of patients having cognitive impairment and a lower number of patients having migraine with aura. Furthermore, we identified that patients carrying mutations in exon 11 seemed to experience a later disease onset (p=6.8×10 −5). Additionally, a common haplotype was found in patients from eastern China carrying p.Arg607Cys, and the patients from Fujian carrying p.Arg544Cys shared the same haplotype with patients from Taiwan carrying p.Arg544Cys.
Conclusions
These findings broaden the mutational and clinical spectrum of CADASIL and provide additional evidences for the existence of founder effect in CADASIL patients.
Keywords: CADASIL, genotype, NOTCH3, phenotype
1. INTRODUCTION
Cerebral autosomal‐dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL; OMIM #125310) is a progressive dominant inherited disorder of the small arterial vessels characterized by adult‐onset recurrent subcortical infarctions, cognitive decline, episodic headache, and psychiatric symptoms.1 It is caused by mutations in NOTCH3 gene (OMIM #600276), which encodes a single‐pass transmembrane Notch3 receptor containing 34 epidermal growth factor repeats (EGFR).2 Each EGFR in extracellular domain of Notch3 includes six cysteine residues. Mutations leading to an odd number of cysteine residues may result in pathognomonic deposits of granular osmiophilic material (GOM) and progressive degeneration of vascular smooth muscle cells.3
To date, over 270 mutations have been reported, and more than 95% of them occur in exons 2 to 24 when considered a fact that there are 33 exons in NOTCH3 gene. Previous reports indicated that exon 3 and exon 4 were supposed to be “hot regions” of NOTCH3 mutations, followed by exons 8, 5, 6, and 11, especially in Caucasian populations.4, 5, 6 Studies in northern Chinese population were consistent with these findings.7, 8 Nevertheless, studies conducted in another Han Chinese population revealed that mutations located in exon 11 might be more frequent in southeast China and p.Arg544Cys mutation might be a “hot spot.”9, 10 Additionally, founder effect has been described in several studies of CADASIL,9, 11 which might be one of the reasons leading to different mutation spectrum.
However, nearly all the mutation spectrum analyses in Chinese CADASIL patients were confined by relatively small cohort. To identify more specific clinical and genetic features of CADASIL in mainland China, we collected a consecutive cohort of 214 genetically confirmed patients from three hospitals located in different regions of China. Herein, we report our observations on the population‐specific clinical features and mutation spectrum in this cohort.
2. MATERIALS AND METHODS
2.1. Participants
A total of 261 clinically suspected Han Chinese CADASIL patients, distributed in fourteen provinces, were consecutively collected between May 4, 2009, and March 6, 2016. Among them, 214 patients from 168 pedigrees were finally genetically diagnosed. Clinical and genetic data were retrospectively analyzed. The study was approved by the ethics committees of Second Affiliated Hospital of Zhejiang University School of Medicine, Huashan Hospital of Fudan University, and First Affiliated Hospital of Fujian Medical University, respectively. A written informed consent was signed by each participant.
2.2. Molecular genetics
Genomic DNA was extracted from peripheral blood using a QIAamp DNA Blood Minikit (QIAGEN, Hilden, Germany). Fragments containing exons 2 to 24 and corresponding intron–exon boundaries in NOTCH3 gene were amplified using in‐house primers (Table S1). PCR products were Sanger‐sequenced for both sense and antisense strands using ABI 3730xl automated sequencer (Applied Biosystems, Foster City, CA, USA). The sequence of each patient was compared with published human NOTCH3 DNA sequence (Ensembl, available at http://asia.ensembl.org). Mutations were identified via The Human Gene Mutation Database (HGMD, available at http://www.hgmd.cf.ac.uk/ac/index.php). Sorting Intolerant From Tolerant (SIFT, http://sift.jcvi.org) and the Polyphen version 2.2.2 (http://genetics.bwh.harvard. edu/pph2) were used to predict the pathogenicity of novel variants.12, 13
To evaluate the pathogenic role of the splice variant c.198‐1G>A, we performed a minigene experiment.14 A minigene plasmid was constructed using the pcDNA3.1(−) vector (Invitrogen, Carlsbad, CA, USA) containing exons 2, 3, and 4 of NOTCH3 gene and 200 bp of flanking intronic sequences. In addition, the splicing site was modified by site‐directed mutagenesis. HEK293T cells were grown to 70% confluence on six‐well plates and transfected in duplicate with 4 μg per well wild‐type and mutant minigene plasmids using Lipofectamine 2000 reagent (Invitrogen). Total RNAs were extracted from transfected cells after 24 hours. First‐strand cDNAs were synthesized using PrimeScript™ 1st Strand cDNA Synthesis Kit (Takara, Japan). A pair of primers (F: 5’‐TGTGCAAATGGAGGTCGTTG‐3’, R: 5’‐CACAGTCGTAAGTGAGGTCG‐3’) were used to amplify exon 2 to exon 4 of NOTCH3 gene from cDNA obtained. Splicing patterns were further determined by electrophoresis of PCR products on 2.5% agarose gels. Bands of interest were sequenced using ABI 3730xl automated sequencer (Applied Biosystems).
2.3. Haplotype analyses of the patients carrying p.Arg544Cys or p.Arg607Cys
Haplotypes of the patients with c.1630C>T (p.Arg544Cys) or c.1819C>T (p.Arg607Cys) mutations were analyzed using six previously reported microsatellite markers flanking the NOTCH3 gene.9, 11 The exact numbers of dinucleotide repeats were further determined by Sanger sequencing. Genotyping primers were listed in Table S2. Haplotypes were assessed by segregation in the families. PHASE software version 2.1.1 (http://stephenslab.uchicago.edu/software.html#phase) was used for index patients to reconstruct haplotypes from genotypic data when which could not be inferred directly by the families. But only haplotype pairs with a probability greater than 0.6 were taken into account.
2.4. Data analyses
Statistical analyses were performed with SPSS version 11.0 (SPSS Inc., Chicago, IL, USA). Quantitative measures for the CADASIL patients were summarized with descriptive statistics. Unpaired Student's t test and one‐way ANOVA were performed to compare age at onset among patients carrying different mutations or exons, while chi‐square or Fisher's exact test was performed to compare difference between qualitative variables. P‐values were two‐tailed with a significant level of .05.
3. RESULTS
3.1. Identified novel NOTCH3 variants in Chinese CADASIL patients
Among the 170 probands, we detected 45 known mutations and three novel variants (Table 1). The chromatogram of identified novel variants, c.198‐1G>A, c.945delC (p.Ile315Metfs*57), and c.1817G>T (p.Cys606Phe), was present in Figure S1. All 3 novel variants were absent in 1000 Genomes Project (1000g) database, Exome Aggregation Consortium (ExAC) database, and our 200 control individuals. To evaluate the pathogenicity of the splice variant c.198‐1G>A, we performed a minigene experiment. As was shown in Figure S2, when the splicing site altered, the exon 3 of NOTCH3 gene is skipped, which results in a frameshift at the beginning of exon 4. According to the American College of Medical Genetics and Genomics (ACMG) standards and guidelines15 and the interpretation of NOTCH3 mutations in the diagnosis of CADASIL,6 the frameshift variant (c.945delC) should be defined as “likely benign,” the missense variant (c.1817G>T) can be defined as “pathogenic,” the splice site variant (c.198‐1G>A) can be defined “likely pathogenic.”
Table 1.
Three novel variants identified in the patients with CADASIL
| Patients/Gender | AAO | Manifestations | Family History | Nucleotide alteration | Protein alteration | SIFT | Polyphen | 1000 g | ExAC | Variants classification6, 15 |
|---|---|---|---|---|---|---|---|---|---|---|
| 1/F | 56 | Ischemic stroke, cognitive impairment, mood disturbance | Yes | c.198‐1G>A | ‐ | ‐ | ‐ | 0 | 0 | Likely Pathogenic |
| 2/F | 43 | Headache, dizziness, cognitive impairment | Yes | c.945delC | p. (Ile315Metfs*57) | ‐ | ‐ | 0 | 0 | Likely benign |
| 3/F | 40 | Migraine, ischemic stroke, cognitive impairment | Yes | c.1817G>T | p.Cys606Phe | Damaging | Probably damaging | 0 | 0 | Pathogenic |
AAO, Age at onset; AA, Amino acid; 1000 g, 1000 Genomes Project database; ExAC, Exome Aggregation Consortium database; ICH, Intracranial hemorrhage.
3.2. Mutation spectrum of Chinese patients with CADASIL
In our cohort of CADASIL patients, we finally detected 46 NOTCH3 mutations among the 168 probands (Table 2). These identified mutations were clustered in exons 3, 4, 5, and 11. Among these patients, 41.07% of cases carried mutations in exon 11, followed by 33.33% in exon 4 and 13.69% in exon 3. These suggested that exon 11, exon 4, and exon 3 might be “hot regions” in our cohort of CADASIL cases. In addition, the c.1819C>T (p.Arg607Cys) mutation and c.1630C >T (p.Arg544Cys) mutation had a higher frequency than other mutations, accounting for 19.05% and 15.48%, respectively. Other well‐known mutations, such as c.268C>T (p.Arg90Cys), c.457C>T (p.Arg153Cys), and c.505C>T (p.Arg169Cys), were not rare in our cohort (Figure 1).
Table 2.
Mutations identified in CADASIL patients in the current study
| Exon | Nucleotide alteration | Protein alteration | EGF repeat | Number of pedigrees | Frequency of mutations (%) |
|---|---|---|---|---|---|
| Exon 2 | c.128G>A | p.Cys43Tyr | 1 | 1 | 0.60 |
| Exon 3 | c.213G>T | p.Trp71Cys | 1 | 1 | 0.60 |
| c.268C>T | p.Arg90Cys | 2 | 15 | 8.93 | |
| c.322T>G | p.Cys108Gly | 2 | 1 | 0.60 | |
| c.328C>T | p.Arg110Cys | 2 | 6 | 3.57 | |
| Exon 4 | c.351C>T | p.Cys117Trp | 2 | 1 | 0.60 |
| c.397C>T | p.Arg133Cys | 3 | 3 | 1.79 | |
| c.401G>A | p.Cys134Tyr | 3 | 1 | 0.60 | |
| c.421C>T | p.Arg141Cys | 3 | 8 | 4.76 | |
| c.430T>A | p.Cys144Ser | 3 | 1 | 0.60 | |
| c.457C>T | p.Arg153Cys | 3 | 11 | 6.55 | |
| c.465C>G | p.Cys155Trp | 3 | 1 | 0.60 | |
| c.505C>T | p.Arg169Cys | 4 | 14 | 8.33 | |
| c.511G>T | p.Gly171Cys | 4 | 1 | 0.60 | |
| c.544C>T | p.Arg182Cys | 4 | 6 | 3.57 | |
| c.566A>G | p.Tyr189Cys | 4 | 1 | 0.60 | |
| c.580T>A | p.Cys194Ser | 4 | 1 | 0.60 | |
| c.580T>C | p.Cys194Arg | 4 | 1 | 0.60 | |
| c.581G>A | p.Cys194Tyr | 4 | 3 | 1.79 | |
| c.602G>C | p.Cys201Ser | 5 | 1 | 0.60 | |
| c.636C>G | p.Cys212Trp | 5 | 1 | 0.60 | |
| c.665G>T | p.Cys222Phe | 5 | 1 | 0.60 | |
| Exon 5 | c.697T>C | p.Cys233Arg | 5 | 1 | 0.60 |
| c.719G>A | p.Cys240Ser | 6 | 1 | 0.60 | |
| c.751T>C | p.Cys251Arg | 6 | 1 | 0.60 | |
| c.752G>A | p.Cys251Tyr | 6 | 1 | 0.60 | |
| c.773A>G | p.Tyr258Cys | 6 | 1 | 0.60 | |
| c.779G>T | p.Cys260Phe | 6 | 1 | 0.60 | |
| Exon 6 | c.994C>T | p.Arg332Cys | 8 | 4 | 2.38 |
| c.1010A>G | p.Tyr337Cys | 8 | 1 | 0.60 | |
| Exon 8 | c.1339C>T | p.Arg421Cys | 10 | 1 | 0.60 |
| Exon 11 | c.1625G>A | p.Cys542Tyr | 13 | 1 | 0.60 |
| c.1630C>T | p.Arg544Cys | 13/14 | 26 | 15.48 | |
| c.1646G>C | p.Cys549Ser | 14 | 1 | 0.60 | |
| c.1672C>T | p.Arg558Cys | 14 | 1 | 0.60 | |
| c.1677C>G | p.Cys559Trp | 14 | 1 | 0.60 | |
| c.1759C>T | p.Arg587Cys | 15 | 5 | 2.98 | |
| c.1817G>T | p.Cys606Phe | 15 | 2 | 1.19 | |
| c.1819C>T | p.Arg607Cys | 15 | 32 | 19.05 | |
| Exon 12 | c.1918C>T | p.Arg640Cys | 16 | 1 | 0.60 |
| c.2038C>T | p.Arg680Cys | 17 | 1 | 0.60 | |
| Exon 17 | c.2656C>T | p.Arg886Cys | 22/23 | 1 | 0.60 |
| Exon 18 | c.2929T>A | p.Cys977Ser | 25 | 1 | 0.60 |
| c.2951T>G | p.Phe984Cys | 25 | 1 | 0.60 | |
| c.2963G>A | p.Cys988Tyr | 25 | 1 | 0.60 | |
| Exon 19 | c.3091C>T | p.Arg1031Cys | 26 | 1 | 0.60 |
EGF, Epidermal growth factor.
Figure 1.
Exon distribution of the mutations and top 10 mutations found in our mainland Chinese cohort. (A) Exon distribution of the NOTCH3 mutations. (B) Top 10 NOTCH3 mutations found in our mainland Chinese cohort
3.3. Clinical features of Chinese patients with CADASIL
The features of clinical manifestations were summarized in Table 3. The average age at the first symptom occurs in our CADASIL patients is 45 ± 9 years. About 56.8% reported ascertained family history. Over two‐third of our CADASIL patients presented or had history of TIA or ischemic stroke when they first come to our clinic. More than half of the patients developed impaired cognition. Conscious or unconscious mood disturbances were noted in nearly 30% of the patients. Headache was presented in nearly one‐third patients, and 29 of them (17.2%) were finally diagnosed with migraine with aura. Furthermore, five patients were sent to our clinic with sudden occurred intracranial hemorrhage (3.0%). Among all the patients, only 22.5% carried common risk factors for small vessel disease, such as hypertension and diabetes.
Table 3.
Clinical manifestations of Chinese CADASIL patients
| Total | p.Arg607Cys (N=40) | p.Arg544Cys (N=28) | p.Arg90Cys (N=23) | p.Arg169Cys (N=15) | p.Arg153Cys (N=14) | |
|---|---|---|---|---|---|---|
| Age at onset (Mean±SD; Median) | 45±9; 45 | 49±9; 47 | 52±5; 51 | 41±10; 40 | 39±9; 41 | 41±10; 39 |
| Age at diagnosis (Mean±SD; Median) | 49±9; 49 | 53±9; 50 | 53±5; 52 | 48±9; 47 | 45±8; 45 | 44±10; 43 |
| Mean Interval (Mean±SE; Median) | 4.0±0.4; 2 | 4.3±1.0; 3 | 1.9±0.7; 0.5 | 6±1.5; 5 | 5.7±2.1; 3 | 3.3±1.2; 4 |
| Male/Female | 97/119 | 19/21 | 16/12 | 8/7 | 7/8 | 4/10 |
| Family history (probands only, %) | 83/146 (56.8) | 14/25 (56) | 5/19 (26.3) | 11/15 (73.3) | 7/12 (58.3) | 6/11 (54.5) |
| Clinical symptomsa | ||||||
| TIA or ischemic strokeb (%) | 115/169 (68.0) | 20/31 (64.5) | 13/19 (68.4) | 11/14 (78.6) | 7/12 (58.3) | 6/10 (60.0) |
| Headache (%) | 50/169 (32.2) | 13/31 (41.9) | 5/19 (26.3) | 6/14 (42.9) | 5/12 (41.7) | 7/10 (70.0) |
| • Migraine with aura (%) | 29/169 (17.2) | 3/31 (9.7) | 3/19 (15.8) | 1/14 (7.1) | 4/12 (33.3) | 4/10 (40.0) |
| Cognition impairment (%) | 97/169 (57.4) | 17/31 (54.8) | 12/19 (63.2) | 7/14 (50) | 6/12 (50) | 5/10 (50.0) |
| Mood disturbance (%) | 56/169 (33.1) | 7/31 (22.6) | 5/19 (26.3) | 8/14 (57.1) | 1/12 (8.3) | 2/10 (20.0) |
| ICH (%) | 5/169 (3.0) | 0 (0) | 1/19 (5.3%) | 0 (0%) | 0 (0%) | 0 (0) |
| Vascular risk factorsc | 38/169 (22.5) | 9/31 (29.0) | 5/19 (26.3) | 5/20 (25) | 1/12 (8.3) | 0 (0) |
| WM involvement in MRId | ||||||
| Periventricular WM (%) | 109/123 (88.6) | 15/18 (83.3) | 9/10 (90.0) | 9/10 (90) | 8/8 (100) | 8/8 (100) |
| External capsule (%) | 105/123 (85.4) | 15/18 (83.3) | 10/10 (100) | 8/10 (80) | 7/8 (87.5) | 5/8 (62.5) |
| Anterior temporal lobe (%) | 84/123 (68.3) | 12/18 (66.7) | 3/10 (30.0) | 9/10 (90) | 7/8 (87.5) | 7/8 (87.5) |
| Thalamus (%) | 51/123 (41.5) | 6/18 (33.3) | 5/10 (50.0) | 5/10 (50) | 2/8 (25) | 2/8 (25.0) |
| Corpus Callosum (%) | 50/123 (40.1) | 6/18 (33.3) | 7/10 (70.0) | 7/10 (70) | 5/8 (62.5) | 3/8 (37.5) |
| Brain Stem (%) | 44/123 (35.8) | 5/18 (27.8) | 5/10 (50.0) | 3/10 (30) | 4/8 (50) | 1/8 (12.5) |
ICH, Intracranial hemorrhage; WM, white matter.
Only for patients with complete clinical data available.
According to the AHA/ASA TIA and ischemic stroke definitions in 2009 and 2013 (Stroke. 2009; 40:2276‐2293. Stroke. 2013; 44:2064‐2089).
including hypertension, smoking, and diabetes.
Only for patients with complete MRI data available.
Usually, CADASIL patients present identical features in brain magnetic resonance imaging (MRI) including diffuse T2‐weighted high signal intensity of white matter and multiple lacunar infarcts in temporal lobe and external capsule.16 Neuroimaging data in our cohort were available for 123 patients. Scattered multiple small infarcts in periventricular white matter were presented in 88.6% of the patients. Moderate‐to‐severe white matter involvement in bilateral external capsules and anterior temporal lobes was presented in 85.4% and 68.3% of the patients, respectively. White matter hyperintensity (WMH) in T2‐weighted imaging in thalamus, corpus callosum, and brain stem was presented in 41.5%, 40.1%, and 35.8% of the patients, respectively.
3.4. Genotype–phenotype correlations of patients with NOTCH3 mutations
As shown in Figure 2, age at onset among CADASIL patients varied between exon 11 and other exons. Patients carrying mutation located in exon 11 experienced later disease onset (Figure 2A, p=6.8×10 −5). Similarly, patients carrying the mutation p.Arg544Cys and p.Arg607Cys, which consisted of more than one‐third of our subjects, displayed a later disease onset compared to other common mutations (Figure 2B, P=.001). Additionally, the mean interval between the disease onset and examination of the p.Arg544Cys mutation tended to be shorter than other common mutations (Table 3).
Figure 2.
Difference of age at onset among exons and common mutations. (A) Difference of age at onset among exons. (B) Difference of age at onset among common mutations. *: significant difference
Not only the age at onset, but also clinical and neuroimaging manifestations varied among different mutations. As was shown in Table 3, patients with p.Arg607Cys tended to have more headache compared to the patients with p.Arg544Cys though without significance (41.9% vs 26.3%, P=.26). Moreover, the involvement of anterior temporal lobe white matter was less frequent in patients carrying p.Arg544Cys compared to patients carrying other mutations with significance (30% vs 71.8%, P=.011).
3.5. Haplotype analyses
Thirty‐four patients harboring p.Arg607Cys and 29 patients harboring p.Arg544Cys were further having haplotype analyses because we found a tendency of regional‐specific distribution (Figure 3A,B). As was shown in Figure 3C‐E, families harboring p.Arg607Cys shared a common haplotype at loci D19S411 and D19S885 linked to p.Arg607Cys mutation (p.Arg607Cys‐19‐13). According to the haplotype reconstruction by PHASE software, all probands from Shanghai, nine of 11 probands from Zhejiang, and six of 9 probands from Jiangsu shared this haplotype with a probability greater than 0.6. The p.Arg544Cys mutation carriers are basically from Fujian. After comparing to the data from Lee et al and Liao et al.9, 10 we discovered the same haplotype as they previously reported (29‐p.Arg544Cys‐19) (Figure 3F).
Figure 3.
Region‐specific distribution of p.Arg607Cys and p.Arg544Cys mutation carriers and haplotype analysis of six microsatellite markers flanking NOTCH3 in CADASIL pedigrees. (A) The p.Arg607Cys mutation carriers mainly locate in Shanghai, Zhejiang, and Jiangsu. (B) The p.Arg544Cys mutation carriers mainly locate in Fujian and Taiwan (Data from Lee et al. and Liao et al.9, 10). (C‐E) The haplotype analyses among pedigrees harboring the p.Arg607Cys mutation. (F) The haplotype analysis in family of p.Arg544Cys mutation carriers. Alleles with an unknown phase are separated with a slash
4. DISCUSSION
CADASIL is an inherited arteriopathy, with causative gene of NOTCH3. Although the manifestations of CADASIL were well‐established,3 the clinical and genetic heterogeneity remained to be further demonstrated in different population. In addition, the genotype–phenotype correlations of CADASIL need to be investigated in a large cohort. In this multicenter cohort, we collected 261 clinically suspected CADASIL patients of Chinese ancestry and performed genetic sequencing of exons 2 to 24 within NOTCH3 in these cases. Finally, we identified 45 known mutations and three novel variants in 216 patients. Our findings broaden the mutation spectrum of NOTCH3 and suggest that a brute force sequencing of exons 2 to 24 within NOTCH3 shall be considered in patients clinically suspected CADASIL.
Among the three novel variants identified in this study, the frameshift variant (c.945delC) should be defined as “likely benign,” and the missense variant (c.1817G>T) can be defined as “pathogenic,” according to the interpretation of NOTCH3 mutations in the diagnosis of CADASIL by Rutten et al.6 Another variant c.198‐1G>A was a splice variant. Our minigene experiment revealed that this variant resulted in the skip of the exon 3 of NOTCH3 and a frameshift at the beginning of exon 4. As was reported before, a heterozygous truncating mutation (c.307C>T, p.Arg103X) in exon 3 could result in clinical manifestations of CADASIL (including vascular parkinsonism, cognitive impairment, and an autosomal‐dominant stroke family history).17 Interestingly, their skin biopsies did not show typical granular osmiophilic material deposit, but only nonspecific signs of vascular damage. In our case, the splice variant c.198‐1G>A can also lead to a truncating mutation in the same exon. Despite of no skin biopsy, we still suspect this variant as a pathogenic mutation. Eventually, we defined this variant as “likely pathogenic.”
Moreover, we discovered a variation of mutation spectrum compared with previous reports,4, 11 even in the same race.8 In Caucasian, Japanese, and Northern Chinese populations, the NOTCH3 mutations were previously revealed to cluster in exon 2 to 6, especially in exon 4.8, 18, 19 In an Italian series of 28 families, a higher frequency of mutations in exons 3 and 4 was noted only in north, but in exons 4 and 11 was noted in center characterized by a recurrent mutation p.Arg607Cys.20 In a recent report in 29 Korean mutation carriers, the exon 11 contributed the most and p.Arg544Cys were relatively common, while the ratio of mutations in exon 4 was extremely low.21 In our Han Chinese cohort, which contained patients largely from eastern and southern China, the exon 11 was considered to be a “hot region,” in line with previous reports.9, 10 Interestingly, a recent research based on ExAC database indicated that mutations causing CADASIL revealed an obvious distribution discrepancy and predominately located outside EGFR 1‐6.22 Nevertheless, the mutation p.Arg607Cys, rather than p.Arg544Cys, ranked in the first place of the mutational spectrum in our subjects and occupied a ratio of nearly 20%. This obvious difference among populations leads to an assumption that founder effects might play a critical role. As was demonstrated previously, founder effects were discovered both in Finnish with p.Arg133Cys and in Chinese with p.Arg544Cys.9, 11 Similarly, a common haplotype p.Arg607Cys‐19‐13 was shared in all Shanghai families, as well as most Zhejiang and Jiangsu families. This finding suggests that patients from eastern China carrying p.Arg607Cys may be descendants from a common ancestor. Meanwhile, we found the same haplotype as reported previously in the Han Chinese population in Taiwan (29‐p.Arg544Cys‐19), which suggests that the patients carrying p.Arg544Cys in Taiwan and Fujian may be descendants from a common ancestor.
The Chinese CADASIL patients presented a relatively unique spectrum of clinical manifestations as well. As was reported previously, migraine with aura can presented in 20%‐40% of the Caucasian patients with CADASIL.3 However, this ratio in our cohort was only 17.2%. By contrast, over 30% of the patients developed headache which might not fulfill the diagnostic criteria of migraine with aura.23 Moreover, the ratio of patients complained about impaired cognition was surprisingly high at 57.4% in our cohort. This variation might be owing to lacking of subjective scale evaluation in our cohort when patients were suffering from a higher frequency of mood disturbances which might result in manifestations like memory loss, distraction, and apathy as well. A previous study has demonstrated that CADASIL patients presented with apathy had lower Mini‐Mental State Examination (MMSE) and Mattis Dementia Rating Scale (MDRS) scores.24 Additionally, in line with prior studies, TIA or ischemic stroke occurred in 68% of Chinese CADASIL patients.1, 25, 26, 27
According to Rutten JW et al., individuals with a mutation located in EGFR 1–6 are predisposed to have more severe CADASIL phenotype, whereas individuals with a mutation outside of EGFR 1–6 can remain asymptomatic for a longer time.23 Nonetheless, a recent report in mainland Chinese failed to confirm a significant difference in age at onset between exons.8 Fortunately, our research, together with a previous research by Liao et al.10 suggested a significant difference in age at onset among CADASIL patients carrying mutations between exon 11 and exons 2 to 6. Additionally, the mean interval between disease onset and examination tended to be varied among common mutations though without a significant difference. We assumed that the discrepancy might be due to a much more diverse composition and a larger population in our study. Our finding suggested a potential genotype–phenotype correlation among Chinese CADASIL patients. However, we should not rule out the possibility that the influence of founder effect in the mutations p.Arg607Cys and p.Arg544Cys may create bias.
It has been reported that patients carrying p.Arg544Cys might develop less white matter involvement of the anterior temporal lobes than the external capsule.9, 10 Our study further confirmed this feature when compared with patients carrying other mutations, even with the p.Arg607Cys mutation located in the same exon. The specific mechanism remains elusive; however, a possible explanation might involve in the present or absent of interfere with signaling activities.28, 29, 30
5. CONCLUSION
Here, we have demonstrated that patients from eastern and southern China have unique clinical manifestations, which might be resulted from a relatively different mutational spectrum. Additionally, a common haplotype was found in patients from eastern China carrying p.Arg607Cys. Meanwhile, we found the patients from Fujian carrying p.Arg544Cys shared the same haplotype with patients from Taiwan carrying p.Arg544Cys. Together with the recent studies, our findings broaden the mutation and clinical spectrum of CADASIL and provided additional evidences for the existence of founder effects in CADASIL patients.
CONFLICTS OF INTEREST
The authors declare no conflicts of interest.
Supporting information
ACKNOWLEDGMENTS
The authors sincerely thank Prof. Lee YC and colleagues for sharing their haplotype data. We also thank the participants for their help and willingness to participate in this study. This work was supported by a grant from the National Natural Science Foundation of China to Zhi‐Ying Wu (81125009) and the research foundation for distinguished scholar of Zhejiang University to Zhi‐Ying Wu (188020‐193810101/089).
Chen S, Ni W, Yin X, et al. Clinical features and mutation spectrum in Chinese patients with CADASIL: A multicenter retrospective study. CNS Neurosci Ther. 2017;23:707–716. 10.1111/cns.12719
The first four authors contributed equally to this work.
Contributor Information
Hong‐Fu Li, Email: hongfuli@zju.edu.cn.
Zhi‐Ying Wu, Email: zhiyingwu@zju.edu.cn.
REFERENCES
- 1. Chabriat H, Vahedi K, Iba‐Zizen MT, et al. Clinical spectrum of CADASIL: a study of 7 families. Cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy. Lancet. 1995;346:934‐939. [DOI] [PubMed] [Google Scholar]
- 2. Joutel A, Corpechot C, Ducros A, et al. Notch3 mutations in CADASIL, a hereditary adult‐onset condition causing stroke and dementia. Nature. 1996;383:707‐710. [DOI] [PubMed] [Google Scholar]
- 3. Chabriat H, Joutel A, Dichgans M, et al. Cadasil. Lancet Neurol. 2009;8:643‐653. [DOI] [PubMed] [Google Scholar]
- 4. Federico A, Bianchi S, Dotti MT. The spectrum of mutations for CADASIL diagnosis. Neurol Sci. 2005;26:117‐124. [DOI] [PubMed] [Google Scholar]
- 5. Bianchi S, Zicari E, Carluccio A, et al. CADASIL in central Italy: a retrospective clinical and genetic study in 229 patients. J Neurol. 2015;262:134‐141. [DOI] [PubMed] [Google Scholar]
- 6. Rutten JW, Haan J, Terwindt GM, et al. Interpretation of NOTCH3 mutations in the diagnosis of CADASIL. Expert Rev Mol Diagn. 2014;14:593‐603. [DOI] [PubMed] [Google Scholar]
- 7. Wang Z, Yuan Y, Zhang W, et al. NOTCH3 mutations and clinical features in 33 mainland Chinese families with CADASIL. J Neurol Neurosurg Psychiatry. 2011;82:534‐539. [DOI] [PubMed] [Google Scholar]
- 8. Liu X, Zuo Y, Sun W, et al. The genetic spectrum and the evaluation of CADASIL screening scale in Chinese patients with NOTCH3 mutations. J Neurol Sci. 2015;354:63‐69. [DOI] [PubMed] [Google Scholar]
- 9. Lee YC, Liu CS, Chang MH, et al. Population‐specific spectrum of NOTCH3 mutations, MRI features and founder effect of CADASIL in Chinese. J Neurol. 2009;256:249‐255. [DOI] [PubMed] [Google Scholar]
- 10. Liao YC, Hsiao CT, Fuh JL, et al. Characterization of CADASIL among the Han Chinese in Taiwan: Distinct Genotypic and Phenotypic Profiles. PLoS ONE. 2015;10:e0136501. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Mykkanen K, Savontaus ML, Juvonen V, et al. Detection of the founder effect in Finnish CADASIL families. Eur J Hum Genet. 2004;12:813‐819. [DOI] [PubMed] [Google Scholar]
- 12. Kumar P, Henikoff S, Ng PC. Predicting the effects of coding non‐synonymous variants on protein function using the SIFT algorithm. Nat Protoc. 2009;4:1073‐1081. [DOI] [PubMed] [Google Scholar]
- 13. Adzhubei IA, Schmidt S, Peshkin L, et al. A method and server for predicting damaging missense mutations. Nat Methods. 2010;7:248‐249. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Vreeswijk MP, van der Klift HM. Analysis and interpretation of RNA splicing alterations in genes involved in genetic disorders. Methods Mol Biol. 2012;867:49‐63. [DOI] [PubMed] [Google Scholar]
- 15. Richards S, Aziz N, Bale S, et al. Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet Med. 2015;17:405‐424. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. O'Sullivan M, Jarosz JM, Martin RJ, et al. MRI hyperintensities of the temporal lobe and external capsule in patients with CADASIL. Neurology. 2001;56:628‐634. [DOI] [PubMed] [Google Scholar]
- 17. Moccia M, Mosca L, Erro R, et al. Hypomorphic NOTCH3 mutation in an Italian family with CADASIL features. Neurobiol Aging. 2015;36:e5‐e11. [DOI] [PubMed] [Google Scholar]
- 18. Joutel A, Vahedi K, Corpechot C, et al. Strong clustering and stereotyped nature of Notch3 mutations in CADASIL patients. Lancet. 1997;350:1511‐1515. [DOI] [PubMed] [Google Scholar]
- 19. Ueda A, Ueda M, Nagatoshi A, et al. Genotypic and phenotypic spectrum of CADASIL in Japan: the experience at a referral center in Kumamoto University from 1997 to 2014. J Neurol. 2015;262:1828‐1836. [DOI] [PubMed] [Google Scholar]
- 20. Dotti MT, Federico A, Mazzei R, et al. The spectrum of Notch3 mutations in 28 Italian CADASIL families. J Neurol Neurosurg Psychiatry. 2005;76:736‐738. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Kim YE, Yoon CW, Seo SW, et al. Spectrum of NOTCH3 mutations in Korean patients with clinically suspicious cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy. Neurobiol Aging. 2014;35:e721‐e726. [DOI] [PubMed] [Google Scholar]
- 22. Rutten JW, Dauwerse HG, Gravesteijn G, et al. Archetypal NOTCH3 mutations frequent in public exome: implications for CADASIL. Ann Clin Transl Neurol. 2016;3:844‐853. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23. Headache Classification Committee of the International Headache S . The International Classification of Headache Disorders, 3rd edition (beta version). Cephalalgia. 2013;33:629‐808. [DOI] [PubMed] [Google Scholar]
- 24. Reyes S, Viswanathan A, Godin O, et al. Apathy: a major symptom in CADASIL. Neurology. 2009;72:905‐910. [DOI] [PubMed] [Google Scholar]
- 25. Dichgans M, Mayer M, Uttner I, et al. The phenotypic spectrum of CADASIL: clinical findings in 102 cases. Ann Neurol. 1998;44:731‐739. [DOI] [PubMed] [Google Scholar]
- 26. Bousser M, Tournier‐Lasserve E. Cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy: from stroke to vessel wall physiology. J Neurol Neurosurg Psychiatry. 2001;70:285‐287. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Peters N, Herzog J, Opherk C, et al. A two‐year clinical follow‐up study in 80 CADASIL subjects: progression patterns and implications for clinical trials. Stroke. 2004;35:1603‐1608. [DOI] [PubMed] [Google Scholar]
- 28. Joutel A, Monet M, Domenga V, et al. Pathogenic mutations associated with cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy differently affect Jagged 1 binding and Notch3 activity via the RBP/JK signaling Pathway. Am J Hum Genet. 2004;74:338‐347. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29. Peters N, Opherk C, Zacherle S, et al. CADASIL‐associated Notch3 mutations have differential effects both on ligand binding and ligand‐induced Notch3 receptor signaling through RBP‐Jk. Exp Cell Res. 2004;299:454‐464. [DOI] [PubMed] [Google Scholar]
- 30. Monet‐Lepretre M, Bardot B, Lemaire B, et al. Distinct phenotypic and functional features of CADASIL mutations in the Notch3 ligand binding domain. Brain. 2009;132:1601‐1612. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials