Skip to main content
CNS Neuroscience & Therapeutics logoLink to CNS Neuroscience & Therapeutics
. 2013 Dec 2;20(3):209–217. doi: 10.1111/cns.12186

Valproic Acid Reduces Neuritic Plaque Formation and Improves Learning Deficits in APP Swe/PS1A246E Transgenic Mice via Preventing the Prenatal Hypoxia‐Induced Down‐Regulation of Neprilysin

Zheng Wang 1,2, Xiao‐Jie Zhang 1, Ting Li 3, Jia Li 3, Yu Tang 3, Weidong Le 1,3,4,✉
PMCID: PMC6493036  PMID: 24289518

Summary

Aims

Previously, we have documented that prenatal hypoxia can aggravate the cognitive impairment and Alzheimer's disease (AD) neuropathology in APP Swe/PS1A246E (APP/PS1) transgenic mice, and valproic acid (VPA) can prevent hypoxia‐induced down‐regulation of β‐amyloid (Aβ) degradation enzyme neprilysin (NEP) in primary neurons. In this study, we have investigated the molecular mechanisms of VPA's anti‐AD effects and found that VPA can reduce the prenatal hypoxia‐induced neuritic plaque formation and improve the learning deficits in the AD mouse model.

Methods

The pregnant APP/PS1 transgenic mice were exposed in a hypobaric chamber. Neuritic plaque staining, Morris water maze, and enzyme‐linked immunosorbent assay (ELISA) were used to detect the effects of VPA on Aβ neuropathology, learning, and memory. Chromatin immunoprecipitation (ChIP) assays and real‐time PCR (RT‐PCR) were used to determine the effect of VPA on the histone3 acetylation (H3‐Ace).

Results

We found that VPA can inhibit neuritic plaque formation and improve the learning and memory in the prenatal hypoxic APP/PS1 transgenic mice. In addition, VPA treatment can decrease the soluble and insoluble Aβ42 levels and increase the NEP expression via up‐regulation of H3‐Ace in the APP/PS1 transgenic mice.

Conclusion

Valproic acid is able to attenuate the prenatal hypoxia‐induced Aβ neuropathology and learning and memory deficits via inhibiting the activation of histone deacetylase 1 (HDAC1), preventing the decrease in H3‐Ace in the NEP promoter regions and reducing the down‐regulation of NEP.

Keywords: Alzheimer's Disease, Neprilysin, Prenatal Hypoxia, Valproic Acid

Introduction

Alzheimer's disease (AD) is the most common neurodegenerative disorder of dementia. Neuritic plaques, neurofibrillary tangles, and neuronal loss represent the main histological hallmarks observed in AD brains 1. The major component of Neuritic plaques is Aβ, whose accumulation triggers a cascade of neurodegenerative steps ending in the formation of senile plaques and intraneuronal fibrillary tangles with subsequent neuronal loss in susceptible brain regions 2, 3. Aβ is produced from sequential endoproteolytic cleavages of the type 1 transmembrane glycoprotein APP by β‐secretase (β‐site APP cleaving enzyme [BACE]) and γ‐secretase (including presenilin, nicastrin, APH‐1, and PEN‐2) 4, 5. Aβ can be cleared from the brain by Aβ degradation enzymes including neprilysin (NEP) 6.

The major risk factors for AD include age, gender, gene polymorphism, high cholesterol, diabetes mellitus, stroke, and brain trauma 7, 8, 9. Several studies have shown that the incidence of AD is greatly increased by hypoxia injury resulting from cerebral ischemia 10, 11, 12. Previously, we have documented that hypoxia is a risk factor for Aβ generation in vivo and in vitro through increasing Aβ generation 13, down‐regulating NEP 14, 15, and causing tau phosphorylation 16. NEP is a synaptic enzyme which is found to play a major role in the clearance of Aβ from the brain 6. The expression of NEP is decreased with aging and hypoxic condition, two of the high risk factors for AD 15, 16, 17, 18. The decreased NEP expression has been found to link to Aβ clearance impairment and Aβ accumulation, which is considered to be an important event contributing to the development and progression of AD 19.

Hypoxia is one of the major common pathophysiology risk factors for diabetes, stroke, hypertension, atherosclerosis, AD, and other diseases 20. Patients suffering from cerebral ischemia and stroke in which hypoxic conditions occur are much more susceptible to AD 21. Hypoxia‐inducible factor (HIF) is one of the early response molecules to hypoxic condition. HIF pathways participate in many pathological processes of diseases including AD 16, 22, and over 300 genes are regulated by HIF 23. Several studies including ours have demonstrated that hypoxia increases the production of Aβ 16, 22, decreases the clearance of Aβ from the brain 24, and increases tau phosphorylation 25.

Epigenetic changes play a key role in hypoxia‐mediated gene expression at transcriptional level 26. The methylation of CpG islands in the promoter regions of genes can result in the silenced expression 27. The methylation and acetylation of lysine residues in histones have been implicated in the alterations of chromatin structure and gene regulation 28, 29, 30. Histone deacetylase (HDACs), removing the acetyl group from lysine, have been associated with condensed chromatin and the silencing of genes 29, 30. Valproic acid (VPA) is one of four‐first‐line antiepileptic drugs being increasingly used in the treatment for bipolar disorder. It has been reported that VPA may enhance γ‐aminobutyric acid transmission 31 and inhibit the activity of glycogen synthase kinase (GSK‐3) and HDAC 32. Recent studies have shown that acetylcholinesterase inhibitors may have beneficial effects on aggressive behavior in AD, similar to that seen with the use of VPA and antipsychotics 33. VPA may protect AD mice via suppression of upstream factors of apoptosis, namely inhibition of both mitochondrial and endoplasmic reticulum pathway of apoptosis 34. In APP and presenilin 1 double transgenic mice, VPA treatment can significantly reduce the level of tau phosphorylation and the activities of cyclin‐dependent kinase 5 (CDK5) and GSK3β 35. Furthermore, VPA may be able to prevent Aβ aggregation in human astrocytes via increasing clusterin expression 36. In addition, VPA can increase the clearance of Aβ through enhanced microglial phagocytosis 37. It is known that increased histone acetylation by HDAC inhibitors facilitates synaptogenesis and improves learning and memory, suggesting that inhibition of HDAC may be a suitable therapeutic avenue for neurodegenerative diseases 38.

In this study, we have shown that VPA can decrease the prenatal hypoxia‐induced Aβ neuropathology and improve memory deficits via inhibiting the activity of HDACs, preventing the H3 acetylation (H3‐Ace) reduction in the NEP promoter regions and the down‐regulation of NEP in the APP/PS1 transgenic mice.

Materials and methods

Transgenic Mice and Hypoxia Treatment

Animal care and procedures were performed in accordance with the Laboratory Animal Care Guidelines approved by Shanghai Institutes for Biological Sciences of Chinese Academy of Sciences (Permit numbers: SCXK [HU] 2007‐0005; SYXK [HU] 2008‐0049). This study was approved by Science and Technology Commission of Shanghai Municipality.

Time‐mated female transgenic mice (The Jackson Lab, No. 003378, APP/PS1) were assigned randomly to normoxic group, hypoxia group, saline group, VPA group. Hypoxia group, saline group, and VPA group were exposed in a hypobaric chamber mimicking (oxygen, O2: 11.1%) 2 hours per day for 7‐20 days of gestation of APP/PS1 transgenic mice and then returned to normal housing conditions. VPA group mice were treated with VPA (30 mg/kg, intraperitoneal injection) 30 min before hypoxia. Normoxic mice were maintained in normal housing conditions constantly. The pups were all delivered under normobaric conditions. We analyzed the genotype APP/PS1 by PCR using DNA from tail tissues 39.

Neuritic Plaques Staining

The procedure of neuritic plaque staining was performed as previously described 13. The right hemisphere was fixed in 4% paraformaldehyde overnight. After fixation, the brain tissue was cryoprotected in 15% sucrose for 24 h and in 30% sucrose for another 36 h before sectioned with a Leica cryostat to 15 or 30 μm thickness. Every sixth slice with the same reference position of the brain was mounted onto the slides for staining. The 15‐μm slices were immunostained with monoclonal 6E10 antibody (Chemicon, Billerica, MA, USA) at 1:300 and then with tetramethylrhodamine isothiocyanate (TRITC)‐conjugated secondary antibody (Santa Cruz Biotech.). The 30‐μm slices were used for modified Bielschowsky's silver staining 40. Approximately 10 slices were stained for each mouse. All the slices were visualized and photographed by inverted microscope (Olympus IX81,Olympus Co., Tokyo, Japan) equipped with DP70 CCD digital camera (Olympus Co.). Five microscopic fields (0.1 mm2) were randomly selected in each slice with the same reference position. Plaque number was determined on 10 slices and presented as the average plaque number per field. Plaque area was measured by Image‐Pro Plus software (Media Cybernetics, Rockville, MD, USA) and recorded as the average plaque area per field.

Western Blot Assay

For Western blot assay, the collected mouse brain tissues were sonicated in ice‐cold lysis buffer (50 mM Tris, pH 7.4, 150 mM NaCl, 1 mM EDTA, 1% (v/v) Triton X‐100, 0.1% SDS, supplemented with a protease inhibitor mixture) for 3 min. Extracts were spun at 12,000 × g for 20 min at 4°C. The protein concentrations were determined by the method of BAC. Equal amounts of protein (60 μg/lane) were separated on polyacrylamide gels and then electrotransferred onto a nitrocellulose membrane (Amersham, Pittsburgh, PA, USA). After blocking for 3 h in Tris‐buffered saline with 0.1% Tween‐20 (TBST) and 3% bovine serum albumin (BSA), membranes were incubated overnight at 4°C with primary antibodies: HIF‐1α 1:500 (Cell Signaling, Danvers, MA, USA), NEP at 1:500 (Santa Cruz Biotech.), HDAC1 1:500 (Santa Cruz Biotech.), and H3‐Ace at 1:500 (Santa Cruz Biotech.). Membranes were then washed and incubated with alkaline phosphatase‐conjugated secondary antibodies in TBST for 2 h and developed using NBT/BCIP substrate (Promega, Madison, WI,USA). The densities of the bands on the membrane were scanned and analyzed with an image analyzer (Lab Works Software; Bio‐Rad, Hercules, CA, USA).

Morris Water Maze

The water maze test was performed in a 1.5‐m‐diam pool. A 10‐cm‐diam platform was placed in the southeastern quadrant in the hidden trials. The procedure consisted of 1 day of visible platform tests and 4 days of hidden platform tests, plus a probe trial 24 h after the last hidden platform test. In the visible platform test, mice were tested for five contiguous trials, with an interval of 30 min. In the hidden platform tests, mice were trained for six trials, with an interval of 1 h. Tracking of animal movement was achieved with an HVS 2020 Plus image analyzer (HVS Image, Mountain View, CA, USA).

Chromatin Immunoprecipitation Assay and RT‐PCR Analysis

A ChIP assay was performed using a ChIP assay kit (Upstate, Lake Placid, NY, USA) according to the manufacturer's protocol with slight modifications. Briefly, brain tissues were cross‐linked with 1% formaldehyde (Sigma, St. Louis, MA, USA) at RT for 10 min. Brain tissues were then suspended in SDS lysis buffer (1% SDS, 10 mM EDTA, 50 mM Tris pH 8.1, and 1× protease inhibitor) and sonicated on ice. Next, the chromatin solution was precleared and incubated with anti‐H3‐Ace antibodies (Santa Cruz Biotech.), and immune complexes were eluted. DNA recovered from the immunoprecipitated complex was subjected to RT‐PCR with 38 cycles 36. The primers for the NEP gene promoters were promoter‐1: forward, 5′‐TTCCCTGAAGTCAGGAGGTG‐3′, reverse 5′‐CCTCCCTCC TTCGTTTTCTT‐3′ (177 bp); promoter‐2 forward, 5′‐AGATGTGCAAGTGGCGGAAG‐ 3′, reverse, 5′‐CGCACCCACAGAGACTCAC‐3′ (150 bp); RT‐PCR data are represented as the fold of enrichment of DNA pulled down with the specific antibody over that immunoprecipitated with IgG. Antibodies used in ChIP experiments were as follows: anti‐H3‐Ace antibodies (Santa Cruz Biotech.). RT‐PCR PCR was performed by Chromo 4 Sequence Detection System (Bio‐Rad) utilizing a SYBR Green PCR premix reagent (Toyobo, Japan). The RT‐PCR was set up as follows: initial denaturation at 95°C for 10 min, followed by 40 cycles of 15 seconds at 95°C, 15 seconds at 58°C, and 30 seconds at 72°C.

Aβ42 Sandwich ELISA

Soluble Aβ42 was directly detected in cultured cell lysates or brain homogenates prepared with ice‐cold lysis buffer described as previously described 13. To detect insoluble cerebral Aβ42 in brain, insoluble pellets were further extracted in 70% formic acid by sonication and spun at 13,000 × g for 20 min. Samples were neutralized in 1 M Tris buffer. The level of Aβ42 was quantified using the Signal Select TM B Amyloid ELISA Kit for human (Bio Source, Camarillo, CA, USA) according to the manufacturer's protocol.

Statistical Analysis

Significant differences between experimental groups were determined using one‐way or two‐way analysis of variance (anova) with Sigma Stat (Systat Software, Inc., Chicago, IL, USA). P value of <0.05 was considered to have significant difference. The quantitative data were obtained from 6 to 10 independent assays with duplication in each assay.

Results

VPA Inhibits Prenatal Hypoxia‐Induced Neuritic Plaque Formation in APP/PS1 Transgenic Mice

In this study, we exposed the pregnant APP/PS1 transgenic mice to simulated high‐altitude hypoxia in a hypobaric chamber 2 h/day during days 7–20 of gestation. One group of pregnant APP/PS1 transgenic mice were treated with VPA (30 mg/kg) before hypoxia, second group of pregnant mice received saline and hypoxia treatment, third group received only hypoxia treatment and the fourth group received only normoxia treatment used as sham controls. At the age of 9 months, the four groups of APP/PS1 transgenic mice were sacrificed to examine the neuropathology and biochemistry changes in the brains after the last behavioral tests. Silver staining results showed that VPA obviously inhibited prenatal hypoxia‐induced neuritic plaque formation in APP/PS1 transgenic mice (Figure 1A), as compared to hypoxia group and saline group. Quantitative analysis showed that there were significantly fewer plague number (Figure 1B) and plague area (Figure 1C) in the VPA treatment mice than the mice from the hypoxia and saline groups. Furthermore, the immune‐fluorescent staining with 6E10 illustrated that VPA significantly inhibited the prenatal hypoxia‐induced neuritic plaque formation in APP/PS1 transgenic mice, as compared to the mice from saline and hypoxia groups (Figure 1D). Figure 1E and F showed the qualitative analysis of 6E10 immune‐staining for the plaque number and area, the results of which were similar as that with silver staining.

Figure 1.

Figure 1

Valproic acid (VPA) inhibits prenatal hypoxia‐induced neuritic plaque formation. (A) Silver staining was used to detect the neuritic plaques in the brains of four group mice (a: sham; b: hypoxia; c: saline; d:VPA). The plaque number (B) and plague area (C) were qualified. The results showed that VPA treatment significantly reduced the number and area of plagues as compared to hypoxia and saline groups (A, B, C). (D) 6E10 immunostaining was used to detect the neuritic plaques in the brains of mice from four groups (a: sam, b: hypoxia, c: saline, and d:VPA). The plaque number (E) and plague area (F) were qualified. The results showed that VPA treatment significantly reduced the number and area of plagues as compared to hypoxia and saline groups (D, E, F). Data are expressed as mean ± SD from six separate experiments.*P < 0.05, **P < 0.05, ***P < 0.05 as compared to sham group; # P < 0.05, ## P < 0.01 as compared to hypoxia group. Scale bar = 100 μm.

VPA Significantly Improves Prenatal Hypoxia‐Induced Learning and Memory Deficits in APP/PS1 Transgenic Mice

To investigate whether VPA treatment affected learning and memory in APP/PS1 transgenic mice, behavioral tests were performed after 9 months of the mice born. The Morris water maze was used to detect the learning and memory of APP/PS1 transgenic mice. In the visible platform tests, mice from sham, hypoxia, saline, and VPA groups had similar escape latency and path length, indicating that VPA and the prenatal hypoxia treatment did not affect mouse motility or vision. In the hidden platform‐swimming test, the VPA‐treated mice showed significant improvements compared with the mice from hypoxia and saline groups. The escape latency (Figure 2C) and path length (Figure 2D) on the fourth day of the hidden platform tests were statistically different between the four groups. In the probe trial on the sixth day of testing, the platform was removed. The number of times the mice travelled into the third quadrant (Figure 2E), where the hidden platform was previously placed, was statistically different between the sham, hypoxia, saline, and VPA groups.

Figure 2.

Figure 2

Valproic acid (VPA) improves the prenatal hypoxia‐induced learning and memory deficits. A Morris water maze test consists of 1 day of visible platform tests and 4 days of hidden platform tests, plus a probe trial 24 h after the last hidden platform test. (A, B) During the first day of visible platform tests, the sham group, hypoxia group, saline group, and VPA group exhibited a similar latency and similar swimming distances to escape onto the visible platform. Data are expressed as mean ± SD from 10 mice. P > 0.05. (C, D) In hidden platform tests, the experimental mice were trained with six trials per day for 4 days. VPA‐treated mice showed a shorter latency and a shorter swimming length to escape onto the hidden platform on the fourth day. Data are expressed as mean ± SD from 10 mice. *P < 0.05; **P < 0.01 as compared to the first day; (E) In the sixth day, the VPA‐treated mice travelled into the third quadrant, where the hidden platform was previously placed, significantly more times than the mice from the hypoxia and saline groups. *P < 0.05, **P < 0.05, ***P < 0.05 as compared to sham group; # P < 0.05 as compared to hypoxia group.

VPA Significantly Decreases the Soluble and Insoluble Aβ42 Levels in the APP/PS1 Transgenic Mice

We performed ELISA analysis to examine the level of Aβ42 on 0‐, 30‐, 90‐, and 270‐day‐old APP/PS1 transgenic mice, respectively. The level of detergent‐soluble Aβ42 was statistically different (Figure 3A), showing that the prenatal hypoxia up‐regulated the soluble Aβ42 level in 30‐, 90‐, and 270‐day‐old APP/PS1 transgenic mice, and VPA treatment significantly attenuated the prenatal hypoxia‐induced up‐regulation of the soluble Aβ42 level on the mice.

Figure 3.

Figure 3

Valproic acid (VPA) decreases the prenatal hypoxia‐induced soluble and insoluble Aβ42 up‐regulation. ELISA analysis to examine the levels of Aβ42 in 0‐, 30‐, 90‐, and 270‐day‐old APP/PS1 transgenic mice, respectively. (A) Prenatal hypoxia up‐regulated the soluble Aβ42 level in 30‐, 90‐, and 270‐day‐old APP/PS1 transgenic mice; and VPA significantly decreased the prenatal hypoxia‐induced soluble Aβ 42 level. (B) Prenatal hypoxia up‐regulated the insoluble Aβ42 level in 30‐, 90‐, and 270‐day‐old APP/PS1 transgenic mice; and VPA significantly decreased the prenatal hypoxia‐induced up‐regulation of the insoluble Aβ42 level. Data are expressed as mean ± SD from six separate experiments. *P < 0.05; **P < 0.01, ***P < 0.001 as compared to the mice from sham group, # P < 0.05 as compared to the mice from hypoxia group.

We also detected the level of insoluble Aβ42. As shown in Figure 3B, the prenatal hypoxia up‐regulated the insoluble Aβ42 level in 30‐, 90‐, and 270‐day‐old APP/PS1 transgenic mice. VPA treatment significantly reduced the insoluble Aβ42 level induced by the prenatal hypoxia on the APP/PS1 transgenic mice.

Prenatal Hypoxia Decreases NEP Expression via Down‐Regulation of H3‐Ace in APP/PS1 Transgenic Mice

To investigate whether prenatal hypoxia can down‐regulate the expression of NEP through histone deacetylation by HDAC1, one group of pregnant APP/PS1 transgenic mice were treated with the HDAC1 inhibitor VPA (30 mg/kg) before hypoxia. At the age of 0, 30, 90, and 270 days, these mice were examined by Western blot analysis in the brain tissues for the changes in HIF‐1α, NEP, HDAC1, and H3‐Ace, which were early response molecules to hypoxic condition 15, 16. As shown in Figure 4A–H, the prenatal hypoxia significantly up‐regulated the levels of HIF‐1α and HDAC1 in 0‐day‐old APP/PS1 transgenic mice. And VPA treatment could inhibit the prenatal hypoxia‐induced HDAC1 expression. However, the HIF‐1α and HDAC1 expression in the pregnant hypoxic APP/PS1 transgenic mice returned to the level of sham group at days 30, 90, and 270 after born. Furthermore, the prenatal hypoxia significantly down‐regulated the expression of NEP and H3‐Ace in the APP/PS1 transgenic mice at days 0, 30, 90, and 270, respectively, after born (Figure 4A–H). Most importantly, VPA treatment could prevent the prenatal hypoxia‐induced down‐regulation of NEP.

Figure 4.

Figure 4

Valproic acid (VPA) attenuates the prenatal hypoxia‐induced reduction of neprilysin (NEP) expression. (A–H) The protein levels of hypoxia‐inducible factor (HIF)‐1α, histone deacetylase 1 (HDAC1), NEP, and H3‐Ace were determined by Western blot, respectively. Prenatal hypoxia significantly up‐regulated the expression of HIF‐1α and HDAC1 in 0‐day‐old APP/PS1 transgenic mice. The HIF‐1α and HDAC1 returned to sham control levels in 30‐, 90‐, and 270‐day‐old APP/PS1 transgenic mice. The prenatal hypoxia significantly down‐regulated the expression of neprilysin and H3‐Ace, in 0‐, 30‐, 90‐, and 270‐day‐old APP/PS1 transgenic mice. The proteins β‐actin and α‐tubulin were blotted as internal control. Data are expressed as mean ± SD from six separate experiments. *P < 0.05, **P < 0.01 as compared to the mice from sham group; # P < 0.05 as compared to the mice from hypoxia group. O.D., optical density.

To verify whether histone acetylation under prenatal hypoxia condition can result in NEP down‐regulation, we performed ChIP assay and RT‐PCR. As NEP expression could be regulated through two distinct promoters called NEP promoter‐1 and promoter‐2 41, 42, we measured the interactivity of H3‐Ace with the two promoters in the brain tissues of prenatal hypoxia‐treated APP/PS1 transgenic mice at days 0, 30, 90, and 270 after born. As shown in Figure 5A,B, the prenatal hypoxia decreased the binding of H3‐Ace to the NEP promoters, and VPA treatment prevented the prenatal hypoxia‐induced down‐regulation of H3‐Ace. These results indicate that prenatal hypoxia could induce histone deacetylation through NEP promoter regions, leading to down‐regulation of NEP expression, and impairment in Aβ clearance, which is considered to be an important event contributing to the Aβ neuropathology in the APP/PS1 transgenic mice (Figure 5A,B). Again VPA treatment could inhibit the prenatal hypoxia‐induced HDAC1 and prevent the down‐regulation of histone deacetylation through NEP promoter regions, and in turn to reverse the down‐regulation of NEP expression.

Figure 5.

Figure 5

Prenatal hypoxia decreases neprilysin (NEP) expression via down‐regulation of H3‐Ace. (A, B) ChIP and RT‐PCR analysis were performed with an anti‐H3‐Ace antibody and primers amplifying the NEP promoter‐1 and promoter‐2 regions. Prenatal hypoxia decreased the binding of H3‐Ace to the NEP promoters, and valproic acid treatment prevented prenatal hypoxia‐induced down‐regulation of H3‐Ace. Data are expressed as mean ± SD from four separate experiments. *P < 0.05, **P < 0.01 as compared to the mice from sham group; # P < 0.05 as compared to the mice from hypoxia group.

Discussion

Late‐onset AD, the most common form of dementia among the elderly, might be primarily attributed to deficiency in the clearance of Aβ rather than its formation 1. NEP could play a major role in the clearance of Aβ from the brain 6, 43 increasing lines of evidence suggest that NEP level in the brain is declined with aging and chronic hypoxia, and the decreased NEP level could lead to the reduction in Aβ clearance which could contribute to the development and progression of AD 24, 44. Previously, we documented that hypoxia could increase Aβ generation and neuritic plaques formation in adult APP/PS1 transgenic mice 13, and the HDACs inhibitor VPA prevents hypoxia‐induced down‐regulation of Aβ degradation enzyme NEP in mouse primary cortical and hippocampal neurons 15. In the present study, we showed that prenatal hypoxia can up‐regulate the soluble Aβ42 level in 30‐day‐old and the insoluble Aβ42 level in 90‐day‐old APP/PS1 transgenic mice. The HDACs inhibitor VPA could decrease the prenatal hypoxia‐induced up‐regulation of the soluble and insoluble Aβ42 level, then reduce neuritic plaque formation, and improve learning and memory deficits via inhibiting the activation of HDACs, preventing the decrease of H3‐Ace in the NEP promoter regions, and preventing the prenatal hypoxia‐induced down‐regulation of NEP.

Aβ is produced from APP by β‐secretase and γ‐secretase 4, 5. Aβ can be cleared from the brain by Aβ degradation enzymes including NEP. Several studies have demonstrated that hypoxia could alter the APP processing 22, 45 via influencing the APP secretases activity through HIF‐1a‐regulated pathway 46, 47. Our studies demonstrated that prenatal hypoxia could significantly up‐regulate the expression of HIF‐1α, in 0‐day‐old APP/PS1 transgenic mice. The level of NEP is declined with aging and hypoxic condition 17, 18, and the decrease in NEP expression is considered to be an important event contributing to the development and progression of AD 19. Our results demonstrate that the prenatal hypoxia significantly down‐regulates the expression of NEP and H3‐Ace in the APP/PS1 transgenic mice.

Increasing lines of evidence suggest that epigenetic phenomena may be a crucial component in the development of complex brain disorders 48. Recently, several studies have demonstrated that epigenetic mechanisms play an important role in neurodegenerative diseases 49, 50. Posttranslational modification of the N‐terminal group of histone lysine residues by acetylation or deacetylation could regulate gene activity 29. HDACs especially HDAC1 play a critical role in sustained histone deacetylation in the gene promoters 30. VPA, one of the first‐line antiepileptic drugs, may enhance γ‐aminobutyric acid transmission 31 and inhibit the activity of GSK‐3 and HDACs 32. Several studies have documented that VPA could enhance the clearance of Aβ from brain 51 by inducing the expression of plasmin 24, inhibit the Aβ production and neuritic plaque formation 41, reverse the contextual memory deficits in a mouse model of AD 52, and prevent the down‐regulation of NEP via augmenting H3 acetylation by inhibiting HDACs 49. It has been reported that VPA protects AD mice via suppression of upstream factors of apoptosis. Inhibition of both mitochondrial and endoplasmic reticulum pathway of apoptosis 34 significantly reduced the levels of tau phosphorylation and inhibited the activities of CDK5 and GSK3β 35. VPA may be able to prevent Aβ aggregation in AD by increasing clusterin expression 36 and enhance the clearance of Aβ through elevated microglial phagocytosis 37. In this study, we demonstrated that VPA can prevent the decrease of H3‐Ace in the NEP promoter regions and prevent the prenatal hypoxia‐induced down‐regulation of NEP via inhibiting the activation of HDAC1.

In summary, we have demonstrated that the prenatal hypoxia up‐regulates the soluble Aβ42 level and the insoluble Aβ42 level in APP/PS1 transgenic mice. The HDACs inhibitor VPA could decrease the prenatal hypoxia‐induced the increase of the soluble and insoluble Aβ42 level, reduce neuritic plaque formation, and improve learning and memory deficits, prevent the decrease in H3‐Ace in the NEP promoter regions and down‐regulation of NEP via inhibiting the activation of HDAC1.

Conflict of Interest

The authors declare no conflict of interest.

Acknowledgments

This work was supported by the National Basic Research Program of China (2010CB945200 and 2011CB510003), Chinese National Nature Science Foundation (No. 81171201 and 81370470). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the article. The authors would like to thank Professor Charlie Degui Chen (The Shanghai Institute of Biochemistry and Cell Biology) for technical assistance.

References

  • 1. Hama E, Saido TC. Etiology of sporadic Alzheimer's disease: somatostatin, neprilysin, and amyloid beta peptide. Med Hypotheses 2005;65:498–500. [DOI] [PubMed] [Google Scholar]
  • 2. Selkoe DJ. The cell biology of beta‐amyloid precursor protein and presenilin in Alzheimer's disease. Trends Cell Biol 1998;8:447–453. [DOI] [PubMed] [Google Scholar]
  • 3. Zhang YW, Xu H. Molecular and cellular mechanisms for Alzheimer's disease: understanding APP metabolism. Curr Mol Med 2007;7:687–696. [DOI] [PubMed] [Google Scholar]
  • 4. Glenner GG, Wong CW. Alzheimer's disease: initial report of the purification and characterization of a novel cerebrovascular amyloid protein. Biochem Biophys Res Commun 1984;120:885–890. [DOI] [PubMed] [Google Scholar]
  • 5. Zheng H, Koo EH. The amyloid precursor protein: beyond amyloid. Mol Neurodegener 2006;1:5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Marr RA, Guan H, Rockenstein E, et al. Neprilysin regulates amyloid Beta peptide levels. J Mol Neurosci 2004;22:5–11. [DOI] [PubMed] [Google Scholar]
  • 7. Martins IJ, Hone E, Foster JK, et al. Apolipoprotein E, cholesterol metabolism, diabetes, and the convergence of risk factors for Alzheimer's disease and cardiovascular disease. Mol Psychiatry 2006;11:721–736. [DOI] [PubMed] [Google Scholar]
  • 8. Lahiri DK, Maloney B, Basha MR, Ge YW, Zawia NH. How and when environmental agents and dietary factors affect the course of Alzheimer's disease: the “LEARn” model (latent early‐life associated regulation) may explain the triggering of AD. Curr Alzheimer Res 2007;4:219–228. [DOI] [PubMed] [Google Scholar]
  • 9. Visootsak J, Sherman S. Neuropsychiatric and behavioral aspects of trisomy 21. Curr Psychiatry Rep 2007;9:135–140. [DOI] [PubMed] [Google Scholar]
  • 10. Bazan NG, Palacios‐Pelaez R, Lukiw WJ. Hypoxia signaling to genes: significance in Alzheimer's disease. Mol Neurobiol 2002;26:283–298. [DOI] [PubMed] [Google Scholar]
  • 11. Ballabh P, Braun A, Nedergaard M. The blood‐brain barrier: an overview: structure, regulation, and clinical implications. Neurobiol Dis 2004;16:1–13. [DOI] [PubMed] [Google Scholar]
  • 12. Skoog I, Gustafson D. Update on hypertension and Alzheimer's disease. Neurol Res 2006;28:605–611. [DOI] [PubMed] [Google Scholar]
  • 13. Li L, Zhang X, Yang D, Luo G, Chen S, Le W. Hypoxia increases Abeta generation by altering beta ‐ and gamma‐cleavage of APP. Neurobiol Aging 2009;30:1091–1098. [DOI] [PubMed] [Google Scholar]
  • 14. Zhang X, Li L, Xie W, et al. Prenatal hypoxia may aggravate the cognitive impairment and Alzheimer's disease neuropathology in APPSwe/PS1A246E transgenic mice. Neurobiol Aging 2013;34:663–678. [DOI] [PubMed] [Google Scholar]
  • 15. Wang Z, Yang D, Zhang X, et al. Hypoxia‐induced down‐regulation of neprilysin by histone modification in mouse primary cortical and hippocampal neurons. PLoS ONE 2011;6:e19229. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Zhang X, Le W. Pathological role of hypoxia in Alzheimer's disease. Exp Neurol 2010;223:299–303. [DOI] [PubMed] [Google Scholar]
  • 17. Carson JA, Turner AJ. Beta‐amyloid catabolism: roles for neprilysin (NEP) and other metallopeptidases? J Neurochem 2002;81:1–8. [DOI] [PubMed] [Google Scholar]
  • 18. Fisk L, Nalivaeva NN, Boyle JP, Peers CS, Turner AJ. Effects of hypoxia and oxidative stress on expression of neprilysin in human neuroblastoma cells and rat cortical neurones and astrocytes. Neurochem Res 2007;32:1741–1748. [DOI] [PubMed] [Google Scholar]
  • 19. Miners JS, Van Helmond Z, Chalmers K, Wilcock G, Love S, Kehoe PG. Decreased expression and activity of neprilysin in Alzheimer disease are associated with cerebral amyloid angiopathy. J Neuropathol Exp Neurol 2006;65:1012–1021. [DOI] [PubMed] [Google Scholar]
  • 20. Honig LS, Kukull W, Mayeux R. Atherosclerosis and AD: analysis of data from the US National Alzheimer's Coordinating Center. Neurology 2005;64:494–500. [DOI] [PubMed] [Google Scholar]
  • 21. Schneider JA, Wilson RS, Cochran EJ, et al. Relation of cerebral infarctions to dementia and cognitive function in older persons. Neurology 2003;60:1082–1088. [DOI] [PubMed] [Google Scholar]
  • 22. Zhang X, Zhou K, Wang R, et al. Hypoxia‐inducible factor 1alpha (HIF‐1alpha)‐mediated hypoxia increases BACE1 expression and beta‐amyloid generation. J Biol Chem 2007;282:10873–10880. [DOI] [PubMed] [Google Scholar]
  • 23. Anderson CJ, Hoare SF, Ashcroft M, Bilsland AE, Keith WN. Hypoxic regulation of telomerase gene expression by transcriptional and post‐transcriptional mechanisms. Oncogene 2006;25:61–69. [DOI] [PubMed] [Google Scholar]
  • 24. Nalivaeva NN, Fisk LR, Belyaev ND, Turner AJ. Amyloid‐degrading enzymes as therapeutic targets in Alzheimer's disease. Curr Alzheimer Res 2008;5:212–224. [DOI] [PubMed] [Google Scholar]
  • 25. Plattner F, Angelo M, Giese KP. The roles of cyclin‐dependent kinase 5 and glycogen synthase kinase 3 in tau hyperphosphorylation. J Biol Chem 2006;281:25457–25465. [DOI] [PubMed] [Google Scholar]
  • 26. Yoder JA, Soman NS, Verdine GL, Bestor TH. DNA (cytosine‐5)‐methyltransferases in mouse cells and tissues. Studies with a mechanism‐based probe. J Mol Biol 1997;270:385–395. [DOI] [PubMed] [Google Scholar]
  • 27. Okano M, Bell DW, Haber DA, Li E. DNA methyltransferases Dnmt3a and Dnmt3b are essential for de novo methylation and mammalian development. Cell 1999;99:247–257. [DOI] [PubMed] [Google Scholar]
  • 28. Nguyen CT, Weisenberger DJ, Velicescu M, et al. Histone H3‐lysine 9 methylation is associated with aberrant gene silencing in cancer cells and is rapidly reversed by 5‐aza‐2'‐deoxycytidine. Cancer Res 2002;62:6456–6461. [PubMed] [Google Scholar]
  • 29. Nan X, Ng HH, Johnson CA, et al. Transcriptional repression by the methyl‐CpG‐binding protein MeCP2 involves a histone deacetylase complex. Nature 1998;393:386–389. [DOI] [PubMed] [Google Scholar]
  • 30. Fahrner JA, Eguchi S, Herman JG, Baylin SB. Dependence of histone modifications and gene expression on DNA hypermethylation in cancer. Cancer Res 2002;62:7213–7218. [PubMed] [Google Scholar]
  • 31. Czuczwar SJ, Patsalos PN. The new generation of GABA enhancers. Potential in the treatment of epilepsy. CNS Drugs 2001;15:339–350. [DOI] [PubMed] [Google Scholar]
  • 32. Yuan PX, Huang LD, Jiang YM, Gutkind JS, Manji HK, Chen G. The mood stabilizer valproic acid activates mitogen‐activated protein kinases and promotes neurite growth. J Biol Chem 2001;276:31674–31683. [DOI] [PubMed] [Google Scholar]
  • 33. Bidzan L, Grabowski J, Dutczak B, Bidzan M. Impact of treatment with acetylcholinesterase inhibitors, valproic acid and antipsychotics on aggressive behaviour in Alzheimer's type dementia. Psychiatr Pol 2012;46:361–372. [PubMed] [Google Scholar]
  • 34. Long Z, Zheng M, Zhao L, et al. Valproic acid attenuates neuronal loss in the brain of APP/PS1 double transgenic Alzheimer's disease mice model. Curr Alzheimer Res 2013;10:261–269. [DOI] [PubMed] [Google Scholar]
  • 35. Hu JP, Xie JW, Wang CY, et al. Valproate reduces tau phosphorylation via cyclin‐dependent kinase 5 and glycogen synthase kinase 3 signaling pathways. Brain Res Bull 2011;85:194–200. [DOI] [PubMed] [Google Scholar]
  • 36. Nuutinen T, Suuronen T, Kauppinen A, Salminen A. Valproic acid stimulates clusterin expression in human astrocytes: Implications for Alzheimer's disease. Neurosci Lett 2010;475:64–68. [DOI] [PubMed] [Google Scholar]
  • 37. Smith AM, Gibbons HM, Dragunow M. Valproic acid enhances microglial phagocytosis of amyloid‐beta(1‐42). Neuroscience 2010;169:505–515. [DOI] [PubMed] [Google Scholar]
  • 38. Fischer A, Sananbenesi F, Wang X, Dobbin M, Tsai LH. Recovery of learning and memory is associated with chromatin remodelling. Nature 2007;447:178–182. [DOI] [PubMed] [Google Scholar]
  • 39. Borchelt DR, Ratovitski T, van Lare J, et al. Accelerated amyloid deposition in the brains of transgenic mice coexpressing mutant presenilin 1 and amyloid precursor proteins. Neuron 1997;19:939–945. [DOI] [PubMed] [Google Scholar]
  • 40. Yamamoto T, Hirano A. A comparative study of modified Bielschowsky, Bodian and thioflavin S stains on Alzheimer's neurofibrillary tangles. Neuropathol Appl Neurobiol 1986;12:3–9. [DOI] [PubMed] [Google Scholar]
  • 41. Ishimaru F, Shipp MA. Analysis of the human CD10/neutral endopeptidase 24.11 promoter region: two separate regulatory elements. Blood 1995;85:3199–3207. [PubMed] [Google Scholar]
  • 42. Li C, Booze RM, Hersh LB. Tissue‐specific expression of rat neutral endopeptidase (neprilysin) mRNAs. J Biol Chem 1995;270:5723–5728. [DOI] [PubMed] [Google Scholar]
  • 43. Maruyama M, Higuchi M, Takaki Y, et al. Cerebrospinal fluid neprilysin is reduced in prodromal Alzheimer's disease. Ann Neurol 2005;57:832–842. [DOI] [PubMed] [Google Scholar]
  • 44. Hersh LB, Rodgers DW. Neprilysin and amyloid beta peptide degradation. Curr Alzheimer Res 2008;5:225–231. [DOI] [PubMed] [Google Scholar]
  • 45. Wang R, Zhang YW, Zhang X, et al. Transcriptional regulation of APH‐1A and increased gamma‐secretase cleavage of APP and Notch by HIF‐1 and hypoxia. FASEB J 2006;20:1275–1277. [DOI] [PubMed] [Google Scholar]
  • 46. Lee PH, Hwang EM, Hong HS, Boo JH, Mook‐Jung I, Huh K. Effect of ischemic neuronal insults on amyloid precursor protein processing. Neurochem Res 2006;31:821–827. [DOI] [PubMed] [Google Scholar]
  • 47. Sun X, He G, Qing H, et al. Hypoxia facilitates Alzheimer's disease pathogenesis by up‐regulating BACE1 gene expression. Proc Natl Acad Sci USA 2006;103:18727–18732. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48. Abdolmaleky HM, Cheng KH, Faraone SV, et al. Hypomethylation of MB‐COMT promoter is a major risk factor for schizophrenia and bipolar disorder. Hum Mol Genet 2006;15:3132–3145. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49. Morrison BE, Majdzadeh N, D'Mello SR. Histone deacetylases: focus on the nervous system. Cell Mol Life Sci 2007;64:2258–2269. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50. Scarpa S, Fuso A, D'Anselmi F, Cavallaro RA. Presenilin 1 gene silencing by S‐adenosylmethionine: a treatment for Alzheimer disease. FEBS Lett 2003;541:145–148. [DOI] [PubMed] [Google Scholar]
  • 51. Jacobsen JS, Comery TA, Martone RL, et al. Enhanced clearance of Abeta in brain by sustaining the plasmin proteolysis cascade. Proc Natl Acad Sci USA 2008;105:8754–8759. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52. Qing H, He G, Ly PT, et al. Valproic acid inhibits Abeta production, neuritic plaque formation, and behavioral deficits in Alzheimer's disease mouse models. J Exp Med 2008;205:2781–2789. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from CNS Neuroscience & Therapeutics are provided here courtesy of Wiley

RESOURCES