Skip to main content
NCBI home page
CNS Neuroscience & Therapeutics logoLink to CNS Neuroscience & Therapeutics
. 2015 Oct 28;21(12):943–952. doi: 10.1111/cns.12470

Bakkenolide‐IIIa Protects Against Cerebral Damage Via Inhibiting NF‐κB Activation

Qian Jiang 1, Run‐Ping Li 2, Ying Tang 1, Ye‐Qing Wang 1, Chong Liu 3,✉, Mei‐Li Guo 1,✉
PMCID: PMC6493129  PMID: 26511680

Summary

Aims

This study was designed to examine the neuroprotective effects of bakkenolide‐IIIa, a major novel compound extracted from the rhizome of P. trichinous.

Methods

Transient focal cerebral damage model in rats and oxygen–glucose deprivation (OGD) in cultured hippocampal neurons were performed. The amount of apoptotic neurons was determined using TUNEL assay. The expressions of Bcl‐2, Bax, Akt, ERK1/2, IKK β, IκBα were measured using Western blot. The nuclear translocation and activation of NF‐κB was measured using a fluorescence microscope and electrophoretic mobility shift assay (EMSA).

Results

Bakkenolide‐IIIa (4, 8, 16 mg/kg; i.g.) was administered immediately after reperfusion could reduce the brain infarct volume, and the neurological deficit, as well as a high dose of bakkenolide‐IIIa, increases the 72 h survival rate in cerebrally damaged rats. In vitro data demonstrated that bakkenolide‐IIIa could increase cell viability and decrease the amount of apoptotic cells in cultured primary hippocampal neurons exposed to OGD. Bakkenolide‐IIIa also dose‐dependently increased the ratio of Bcl‐2 to Bax. These results indicated that inhibition of apoptosis partly mediated the neuroprotection of bakkenolide‐IIIa. Furthermore, bakkenolide‐IIIa inhibited the phosphorylation of Akt, ERK1/2, IKK β, IκBα, and p65 in cultured hippocampal neurons exposed to OGD. Bakkenolide‐IIIa not only inhibited the nuclear translocation of NF‐κB in cultured neurons exposed to OGD, but also inhibited the activation of NF‐κB in peri‐infarct area in cerebrally damaged rats.

Conclusion

Collectively, our findings indicated that bakkenolide‐IIIa protects against cerebral damage by inhibiting AKT and ERK1/2 activation and inactivated NF‐κB signaling.

Keywords: Bakkenolide‐IIIa, Cerebral damage, Neuroprotection, NF‐κB

Introduction

Ischemic stroke is the main type of stroke, which is the second most common cause of death and major cause of disability worldwide 1, 2. It occurs when there is an acute blockage of arterial blood flow to the brain tissue. It is a major challenge to develop consistently effective therapy for ischemic stroke. Nowadays, despite advances in intravascular and thrombolytic interventions, there is still much to be performed 3, 4. Thus, effective prevention and control of cerebral damage is of significant clinical value.

So far, it has been largely reported that various kinds of plants including Nigella sativa, Ginkgo biloba, and garlic have demonstrated protective effects against ischemic brain damage in experimental animals 5, 6, 7, 8. In our previous study, we reported the novel structures of bakkenolides and the neuroprotective activity of the bakkenolides, extracted from Chinese folk medicine of Petasites trichinous French 9, 10, 11, 12. However, the underlying mechanisms of protection mediated by bakkenolides from cerebral damage remain unclear.

Bakkenolide‐IIIa, extracted from the rhizome of P. tricholobus, is a novel and major compound of bakkenolides found in our laboratory 9. In this study, we investigated the effects of bakkenolide‐IIIa on ischemia injury in vivo and in vitro and tried to uncover the possible mechanisms of bakkenolide‐IIIa against cerebral damage modulated by the nuclear factor kappa‐B (NF‐κB) signaling pathway.

Materials and Method

Animal Care and Use

Male Sprague–Dawley (SD) rats weighing 260–280 g were purchased from Shanghai Super‐B&K Laboratory Animal Corp., Ltd. (Shanghai, China) and kept at 22°C under a 12 h light/dark cycle with unlimited access to water and standard rodent diet. All experiments were approved and conducted in accordance with the guidelines of the Animal Care Committee of Second Military Medical University.

Preparation and Determination of Bakkenolide‐IIIa

Bakkenolide‐IIIa was extracted from the rhizome of Petasites trichinous French. In brief, the dry rhizome was ground and permeating extracted with 95% ethanol. The percolating liquid was concentrated under vacuum, loaded on the chromatography packed with D101 macroporous resin and gradiently eluted with 30%, 70% and 95% ethanol in turn. The 70% ethanol extract (90 g) was concentrated and loaded on a silica gel column and gradiently eluted with mixed petroleum ether and ethyl acetate (20:1), monitoring by thin layer chromatography (TLC). The fraction containing bakkenolide‐IIIa was collected, concentrated, and recrystallized with methanol to yield colorless needles (923 mg). The structure of this compound was further identified as bakkenolide‐IIIa with the aid of extensive NMR spectroscopic studies and mass spectrometry data, as previously reported by our laboratory 10. The purity of bakkenolide‐IIIa was determined to be 99.7% by normalization of the peak areas detected by HPLC (Figure 1).

Figure 1.

Figure 1

Open in a new tab

Chemical structure and HPLC chromatogram of bakkenolide‐IIIa. (A) Chemical structure of bakkenolide‐IIIa. (B) HPLC chromatogram of bakkenolide‐IIIa.

Transient Middle Cerebral Artery Occlusion

SD rats were anesthetized with 10% hydrated chlorine aldehyde. Middle cerebral artery occlusion (MCAO) was performed as described previously 13, 14. Briefly, the core temperature (rectum) was maintained at 36.5°C to 37.5°C by use of a homeothermic heating pad (CWE Inc., Ardmore, PA, USA) throughout the surgery. Cerebral focal ischemia was produced by intraluminal occlusion of the left MCA using a silicone rubber‐coated nylon monofilament. Cortical blood flow was measured with a laser Doppler flow meter (VMS‐LDF1; Moor Instruments, Axminster, UK). The laser Doppler probe was placed over the cortical area supplied by the MCA to ensure that cerebral blood flow was reduced by more than 85%. Two hours after MCAO, the occluding filament was withdrawn to allow reperfusion. The physiological parameters, including systolic blood pressure, diastolic blood pressure, arterial pH, arterial partial pressure of carbon dioxide (pCO2), arterial partial pressure of oxygen (pO2), heart rate, and temperature, were monitored in mice before MCAO, during MCAO, and after reperfusion using a blood pressure instrument (ALCBIO, Shanghai, China), a blood gas analyzer (Instrumentation Laboratory, Lexington, MA, USA), and an animal digital thermometer. SD rats were randomly divided into five groups: vehicle, edaravone (5 mg/kg, i.v.), or bakkenolide‐IIIa (4, 8, and 16 mg/kg; i.g.) were administrated immediately after reperfusion.

Evaluation of Cerebral Infarction

Twenty‐four hours after reperfusion, the rats were deeply anesthetized with isoflurane (5% in O2), and the brain was perfused with heparinized saline (10 U/mL) in situ for approximately 90 second. Each brain was sliced into 2‐mm‐thick coronal sections using a brain matrix (BSR 001.1; Zivic‐Miller, Pittsburgh, PA, USA). Brain sections (except the third section, located at 4–6 mm) were stained with 0.5% 2,3,5‐triphenyltetrazolium chloride (TTC) for 20 min at 37°C, followed by fixation in 4% formaldehyde at 4°C for 24 h. The infarct volumes were analyzed using Image‐Pro Plus 6.0 (Media Cybernetics Inc., Bethesda, MD, USA) by the indirect method in a double‐blinded manner, which corrects for edema. The percentage of the corrected infarct volume was calculated by dividing the infarct volume by the total contralateral hemispheric volume, and this ratio was then multiplied by 100 15, 16, 17.

Analysis of Neurological Function

The neurological dysfunction in rats was assessed using a modified Bederson score 18 in a double‐blinded manner with the following definitions: Score 0: no detectable neurological deficits; Score 1: failure to extend the right forepaw fully; Score 2: circling to the left; Score 3: falling to the left; Score 4: did not walk spontaneously and had a depressed level of consciousness; Score 5: death before scheduled termination.

Rat Primary Hippocampal Neuron Isolation and Culture

Hippocampal neurons were cultured as previously described 19. Briefly, rats were decapitated, and the hippocampus was isolated and treated with 0.125% trypsin and 0.01% deoxyribonuclease at 37°C for 20 min. Cells were suspended in Dulbecco's modified Eagle's medium (DMEM, Gibco, Grand Island, NY, USA) supplemented with 10% FCS (Gibco), 10% horse serum (Gibco), and 33.3 mM D‐glucose, and plated on poly‐D‐lysine‐coated culture plates for 12 h, and then, the medium was replaced with serum‐free Neurobasal medium (Gibco), supplemented with 2% B‐27 (Gibco). Cells were cultured at 37°C in humidified 5% CO2/95% air for 7–10 days prior to experimentation.

Oxygen–Glucose Deprivation (OGD)

Ten‐day‐old hippocampal neurons were exposed to OGD for establishing an in vitro model of cerebral ischemia. Before exposure, cultured neurons were pretreated with vehicle or bakkenolide‐IIIa (20, 200, and 2000 ng/mL) and then incubated with glucose‐free DMEM at 37°C in humidified 5% CO2/95% air for 1 h. Then, the neurons were subjected to an environment with 1% O2 using a hypoxic chamber at 37°C for 1 h.

Western Blotting Analysis

Proteins were lysated using a standard extraction reagent supplemented with protease inhibitors (Kangchen, Shanghai, China). Protein concentration was determined using a bicinchoninic acid method (Beyotime, Shanghai, China). The proteins were separated using SDS‐PAGE and electrotransferred to nitrocellulose membranes and then incubated with rabbit anti‐Bcl2 polyclonal antibody (1:500; NovusBiologicals, Littleton, CO, USA, NB100‐2220), anti‐Bax monoclonal antibody (1:400; Cell Signaling Technology, Boston, MA, USA), anti‐total‐AKT (1:200; Cell Signaling Technology), anti‐phospho‐AKT (1:200; Cell Signaling Technology), anti‐total‐ERK1/2 (1:200; Cell Signaling Technology), anti‐phospho‐ERK1/2 (1:200; Cell Signaling Technology), anti‐total‐IKKβ (1:200; Cell Signaling Technology), anti‐phospho‐IKKβ (1:200; Cell Signaling Technology), anti‐total‐IκBα (1:200; Cell Signaling Technology), anti‐phospho‐IκBα (1:200; Cell Signaling Technology), anti‐total‐P65 (1:200; Cell Signaling Technology), and anti‐phospho‐P65 (1:200; Cell Signaling Technology) overnight. Then, the membranes were incubated with HRP‐conjugated secondary antibodies (1:200; Cell Signaling Technology), and the signals were revealed using the enhanced chemiluminescence detection system kit (General Bioscience Corporation, Brisbane, CA, USA) 6, 20 and were exposed to film. Digital images were quantified using densitometric measurements by Quantity‐One software (Bio‐Rad, Hercules, CA, USA). The Western blot analysis was repeated three times, and qualitatively similar results were obtained.

Hoechst and PI Double Staining

Cell apoptosis was determined by PI and Hoechst 33258 double fluorescent staining as described elsewhere 21. The hippocampal neurons were pretreated with vehicle or bakkenolide‐IIIa (20, 200, and 2000 ng/mL) for 2 h, and then subjected to 100 μM H2O2 for 30 min. The cells were stained with PI (10 μg/mL) and Hoechst33258 (10 μg/mL) for 15 min, and then, the cells were fixed by 4% paraformaldehyde for 10 min. The cells were observed under a fluorescence microscope (Olympus BX61, Tokyo, Japan). The Hoechst and PI dyes were excited at 340 and 620 nm, respectively. Hoechst 33258, a type of blue fluorescence dye, stains the condensed chromatin in apoptotic cells more brightly than normal chromatin. PI, a red fluorescence dye, is used to discriminate late apoptotic, necrotic, or dead cells that have lost membrane integrity from early apoptotic cells by dye exclusion. The double staining pattern makes it possible to distinguish normal, apoptotic, and dead cell populations by fluorescence microscopy. Thirty random fields (total 800–1000 cells/culture) of stained cells were manually counted using a × 20 objective.

TUNEL Assay

Apoptotic cells were determined using terminal deoxynucleotidyl transferase biotin‐d UTP nick end labeling (TUNEL) assay with an in situ cell death detection kit (Roche, Waterville, OH, USA) according to the manufacturer's instructions. Briefly, the 3′‐OH ends of fragmented nucleosomal DNA were specifically labeled in situ in the presence of exogenously added terminal transferase biotin‐labeled dUTP and detected with alkaline peroxidase conjugated antifluorescein antibody. Cells were fixed on coverslips with ice‐cold 4% paraformaldehyde for 30 min and exposed for an appropriate time to a permeabilization solution (0.1% Triton X‐100, 0.1% sodium citrate). Fifty microliters of TUNEL reaction mixture was placed on the cells and incubated in a humidified atmosphere for 60 min at 37°C, and then, Hoechst 33342 (5 mM) was added to the medium at 37°C for 10 min. Finally, the coverslips were washed with phosphate‐buffered saline and mounted with a sealing tablet 22. The cells were observed under a fluorescence microscope (Olympus BX61). The number of apoptotic cells was counted in randomly selected fields to calculate the ratio of apoptotic to total cells.

Immunofluorescence Observation

Primary cultured neurons were incubated overnight at 37°C on glass coverslips, and then, the cells were fixed in 200 μL of 4% paraformaldehyde for 15 min, washed with PBS before blocking with 5% bovine serum albumin in PBST, and incubated with anti‐total‐P65 (1:200; Cell Signaling Technology) overnight at 4°C. Double immunofluorescent staining was completed by Alexa‐488 or Alexa‐647‐labeled secondary antibody (1:200; Invitrogen, Grand Island, NY, USA) incubation for 1 h at room temperature. After being washed, slides were mounted with Vectashield mounting medium containing DAPI (Vector Laboratories, Burlingame, CA, USA), and colocalization was observed using a fluorescence microscope 23.

Electrophoretic Mobility Shift Assay (EMSA)

The tissue extract was prepared using a nuclear protein extraction kit (Pierce, Rockford, IL, USA). Samples containing equal amounts of nuclear extract protein (10 μg) were incubated with 1.0 μg/μL poly (dI‐dC) and 500 fmol biotin‐labeled double‐stranded NF‐κB binding consensus oligonucleotide 5′‐AGTTGAGGGGACTTTCCAGGC‐3′ using an EMSA kit (Roche). The binding reaction proceeded for 15 min at 25°C. The DNA‐protein complexes were electrophoresed on a 6.5% nondenaturing polyacrylamide gel and electrotransferred for detection.

Statistical Analysis

All values are expressed as means ± SD The significance of the difference between the groups was tested using one‐way analysis of variance (ANOVA) followed by post hoc Dunnett's multiple comparison test. For survival time analysis, Kaplan–Meier analysis was used. All data were analyzed using SPSS 17.0 (International Business Machines Corp., Almond, NY, USA). P values of <0.05 were considered to be statistically significant.

Results

Effects of Bakkenolide‐IIIa On Cell Viability in Cultured Neurons Exposed to OGD

PI and Hoechst double staining was conducted to test cell viability (Figure 2A). PI‐positive neurons were counted and analyzed manually (Figure 2B). As illustrated, primary cultured neurons under normal condition displayed normal morphology with few PI‐stained nuclei. However, neurons upon exposure to OGD for 1 h demonstrated numerous PI‐stained nuclei, which were considered as apoptotic or necrotic cells, with the cell viability significantly decreasing to 45.36%. Nevertheless, pretreatment with 2000 ng/mL bakkenolide‐IIIa before OGD markedly reduced the number of PI‐staining neurons, with a significant elevation of cell viability to 75.34%.

Figure 2.

Figure 2

Open in a new tab

The effect of bakkenolide‐IIIa on the cell viability in cultured neurons exposed to OGD. (A) Representative photomicrographs of the primary cultured neurons in normal, OGD, or treatment with bakkenolide‐IIIa (2000 ng/mL) which were stained using Hoechst and PI double staining method. (B) Cell survival (%) was detected by manual counting of the cell number in B. n = 8 per group. **P < 0.01 versus normal; ##P < 0.01 versus vehicle.

Effect of Bakkenolide‐IIIa on Cerebral Infarct Volume and Neurological Scores and 72‐h Survival Rate in Rats Subjected to MACO

After MACO, rats began to show symptoms of stroke, including lethargy, poor grooming, and convulsive repetitive forearm movement. In the vehicle group and low‐dose (4 mg/kg) group, there was 1 rat that was excluded from the experiment due to hypotension. In comparison with the vehicle‐treated group, bakkenolide‐IIIa at a dose of 4, 8, and 16 mg/kg dose‐dependently reduced the cerebral infarct volume and improved the neurological deficit 24 h after MACO (Figure 3A–C). Moreover, we also observed the effect of bakkenolide‐IIIa (16 mg/kg) on cerebral ischemia 72 h after MCAO. The results showed that a high dose of bakkenolide‐IIIa not only significantly decreased the infarct volume and the neurological score 72 h after MACO but also increased the 72‐h survival rate (Figure 3D–F). These results indicated that bakkenolide‐IIIa has a protective effect on cerebral ischemia, even 72 h after ischemia.

Figure 3.

Figure 3

Open in a new tab

The effect of bakkenolide‐IIIa on infarct size and neurological scores in rat subjected to MCAO. (A) Histological evidence for bakkenolide‐IIIa mediated reduction in infarct size after MCAO. (B) Bakkenolide‐IIIa (4, 8, and 16 mg/kg) dose‐dependently decreased the infarct volume after MCAO for 24 h. n = 7–8 per group. **P < 0.01 versus vehicle. (C) Bakkenolide‐IIIa significantly decreased the neurological deficits after MCAO for 24 h. n = 7–8 per group. *P < 0.05 versus vehicle. **P < 0.01 versus vehicle. (D) Bakkenolide‐IIIa (16 mg/kg) significantly decreased the infarct volume after MCAO for 72 h. n = 8 per group. *P < 0.05 versus vehicle. **P < 0.01 versus vehicle. (E) Bakkenolide‐IIIa (16 mg/kg) significantly decreased the neurological deficits after MCAO for 72 h. n = 8 per group. **P < 0.01 versus vehicle. (F) Bakkenolide‐IIIa (16 mg/kg) significantly increased the 72 h survival rate in rats subjected to MCAO. n = 15 per group. **P < 0.01 versus vehicle.

Effects of Bakkenolide‐IIIa on the Apoptosis and Apoptosis‐Related Protein in Cultured Neurons Exposed to OGD

The ratio of apoptotic cells and total cells treated with OGD for 1 h increased to 51.67%, while pretreatment with 2000 ng/mL bakkenolide‐IIIa decreased the ratio of apoptotic cells to 36.67% (Figure 4A). In addition, the expressions of Bcl‐2 and Bax all increased in cultured neurons exposed to OGD. However, the ratio of Bcl‐2 to Bax significantly decreased compared with that in control cells. Pretreatment with 20–2000 ng/mL bakkenolide‐IIIa significantly reversed Bax expression and substantially increased the ratio of Bcl‐2 to Bax (Figure 4B).

Figure 4.

Figure 4

Open in a new tab

Effects of bakkenolide‐IIIa on the apoptosis and apoptosis‐related protein in cultured neurons exposed to OGD. (A) Representative photographs of Hoechst/PI‐stained cells (×100). (B) The bar graph shows the percentage of apoptotic cells in A. The results were obtained from three independent experiments. **P < 0.01 versus normal; ## P < 0.01 versus vehicle. (C) Bakkenolide‐IIIa significantly decreased the expression of Bcl‐2/Bax in cultured neurons exposed to OGD. n = 6 per group. *P < 0.05 versus normal; ## P < 0.01 versus OGD.

Effects of Bakkenolide‐IIIa on the Phosphorylation of Akt and ERK1/2 in Cultured Neurons Exposed to OGD

Western blot results showed that exposure to OGD for 1 h enhanced the phosphorylation of Akt and ERK1/2. Pretreatment with 20–2000 ng/mL bakkenolide‐IIIa significantly inhibited the phosphorylation of Akt and ERK1/2 (Figure 5A and B).

Figure 5.

Figure 5

Open in a new tab

Effects of bakkenolide‐IIIa on the phosphorylation of Akt and ERK1/2in cultured neurons exposed to OGD. (A) Bakkenolide‐IIIa (4, 8, and 16 mg/kg) dose‐dependently inhibited the phosphorylation of Akt in cultured neurons exposed to OGD. Data were obtained from three independent experiments. **P < 0.01 versus normal; ## P < 0.01 versus OGD. (B) Bakkenolide‐IIIa (4, 8, and 16 mg/kg) dose‐dependently inhibited the phosphorylation of ERK1/2 in cultured neurons exposed to OGD. Data were obtained from three independent experiments. **P < 0.01 versus normal; # P < 0.05 versus OGD; ## P < 0.01 versus OGD.

Effects of Bakkenolide‐IIIa on the Expression of IKKβ, Phospho‐IKKβ, IκBα, and Phospho‐IκBα in Cultured Neurons Exposed to OGD

OGD markedly increased both protein expression and the phosphorylation of IKKβ. In contrast, pretreatment with 20–2000 ng/mL bakkenolide‐IIIa inhibited the upregulation of IKKβ and phospho‐IKKβ (Figure 6A). In addition, OGD induced degradation and phosphorylation of IκBα. Treatment with 20–2000 ng/mL bakkenolide‐IIIa significantly increased the downregulation of IκBα and reduced the upregulation of phospho‐IκBα (Figure 6B).

Figure 6.

Figure 6

Open in a new tab

Effects of bakkenolide‐IIIa on the expression of IKK β, IκBα, and phosphorylation of IKK β, IκBα in cultured neurons exposed to OGD. (A) Bakkenolide‐IIIa (4, 8, and 16 mg/kg) dose‐dependently inhibited the expression of IKK β and phospho‐IKK β in cultured neurons exposed to OGD. Data were obtained from three independent experiments. **P < 0.01 versus normal; # P < 0.05 versus OGD; ## P < 0.01 versus OGD. (B) Bakkenolide‐IIIa (4, 8, and 16 mg/kg) dose‐dependently inhibited the expression of IκBα and increased the expression of phospho‐IκBα in cultured neurons exposed to OGD. Data were obtained from three independent experiments. **P < 0.01 versus normal; # P < 0.05 versus OGD; ## P < 0.01 versus OGD.

Effects of Bakkenolide‐IIIa on the Activation and the Nuclear Translocation of NF‐κB/p65 in Cultured Neurons Exposed to OGD

The expression of total p65 and phospho‐NF‐κB/p65 was upregulated after 1 h of exposure to OGD. Pretreatment with 20–2000 ng/mL bakkenolide‐IIIa significantly inhibited the expression of total p65 and phosphorylation of NF‐κB/p65 (Figure 7A and B). In addition, OGD also induced nuclear translocation of NF‐κB/p65 in cultured neurons. Pretreatment with 2000 ng/mL bakkenolide‐IIIa ameliorated the irritable cell localization changes demonstrated in microphotographs (Figure 7C).

Figure 7.

Figure 7

Open in a new tab

Effects of bakkenolide‐IIIa on activation and nuclear translocation of NF‐κB/p65 in cultured neurons exposed to OGD. (A and B) Bakkenolide‐IIIa (4, 8, and 16 mg/kg) dose‐dependently inhibited the expression of P65 and phospho‐P65 in cultured neurons exposed to OGD. Data were obtained from three independent experiments. **P < 0.01 versus normal; ## P < 0.01 versus OGD. (C) FITC‐conjugate anti‐NF‐kB/p65 (a, d, and g), Hoechst 33342 (b, e, and h) and merged immunofluorescences (c, f, and i) were visualized by microscopy (×100). Scale bar, 100 μm.

Effects of Bakkenolide‐IIIa on the DNA‐Binding Activity of NF‐κB in Peri‐Infract Area in rats Subjected to MCAO

MACO increased NF‐κB binding activity in the peri‐infract area, as reflected by EMSA. The treatment with bakkenolide‐IIIa significantly attenuated the effect induced by MACO (Figure 8).

Figure 8.

Figure 8

Open in a new tab

Effects of bakkenolide‐IIIa on DNA‐binding activity of NF‐κB in peri‐infract area in rats subjected to MCAO. Nuclear extracts from these tissues were obtained, and NF‐κB activation was determined by EMSA. Lanes 1, control; lanes 2, MCAO; lanes 3–5, treatment with bakkenolide‐IIIa (4, 8, 16 mg/kg) before MCAO.

Discussion

In this study, we have demonstrated the neuroprotective effect of bakkenolide‐IIIa on transient focal cerebral ischemia injury in rats as well as on primary cultured neurons exposed to OGD in vitro. The outcomes of the morphologic observation, the cell viability determination, and the apoptotic analysis obtained in our current study showed that bakkenolide‐IIIa had a significant and direct effect of protection in primary cultured neurons when suffering from OGD damage.

The pathogenesis of neuronal injury after cerebral damage is complicated and remains unclear so far. It is now becoming commonplace that reactive oxygen species (ROS), cytokines, complement activation, and the activity of pro‐apoptotic signaling cascades play crucial roles in these processes, which are considered to be controlled at least partly through the activity of a family of transcription factors known as NF‐κB 24, 25, 26.

NF‐κB widely exists in the central nervous system. After an ischemia injury, it is activated and subsequently increases the expression of a large number of genes, especially those related to inflammatory reaction by forming active dimers in different ways 27, 28, 29. Studies have shown that dimer P65/P50 is dramatically effective in cerebral damage, which leads to the detrimental effect of NF‐κB 29. These indicate that the inhibition of the NF‐κB signaling pathway may be a potential treatment strategy for stroke 29. Our present study was designed to explore the regulatory effects of bakkenolide‐IIIa on the NF‐κB signaling pathway and uncover new lights on the neuroprotective mechanism of bakkenolide‐IIIa.

In normal conditions, NF‐κB (p50/p65) is kept latent in cytoplasm through binding to inhibitory IκB proteins typified by IκBα. Upon OGD, IKK is phosphorylated and activated, which in turn phosphorylate IκBα 27, 30. With the degradation of IκBα, NF‐κB/p65 is released and translocates from the cytosol to the nucleus, thus facilitating the transcription of target genes 31, 32, 33. That is to say, IKKβ, IκBα, and p65 are key molecules in the NF‐κB signaling pathway and are closely connected with each other.

In the present study, we demonstrated that single treatment of OGD could increase the expressions of IKKβ and phosphorylated IKKβ (p‐IKKβ) and lead to the decrease of IκBα and the increase of phosphorylated IκBα (p‐IκBα). All these responses are beneficial for the activation and translocation of NF‐κB. Accordingly, the expressions of both p65 and p‐p65 were observed to increase after OGD treatment in Western blot analysis and immunofluorescence observation, verifying the detrimental effect of p65 in the process of hypoxia insults. However, pretreatment with bakkenolide‐IIIa totally reversed the changes of these signaling molecules in a dose‐dependent manner. Taken together, these data suggest that bakkenolide‐IIIa is observed to have a protective effect against cerebral ischemic damage, with molecular mechanism being involved in the classical pathway of NF‐κB activation.

The phosphoinositide 3‐kinase/Akt pathway (PI3K/Akt) and the mitogen‐activated protein kinase/extracellular signal‐regulated kinase pathway (MAPK/ERK 1/2) are referred to as two important intracellular signal transduction pathways. Many reports regard Akt and ERK 1/2 as important upstream activators of NF‐κB 34, 35, 36. In the present study, Akt and ERK1/2 were markedly activated after OGD treatment and inhibited by pretreatment with 20–2000 ng/mL bakkenolide‐IIIa, suggesting that bakkenolide‐IIIa functioned as an inhibitor of two cell survival signaling proteins, Akt and ERK1/2, which in turn modulated the expression of NF‐κB in protecting neurons and helped provide protection from hypoxic injury.

NF‐κB has so far been reported to regulate apoptosis‐related genes, especially members of the Bcl‐2 family, including Bcl‐2 and Bax. The heterodimer formed by Bcl‐2 and Bax is essential for the regulation of cell apoptosis, as a result of which the ratio of Bcl‐2/Bax is widely regarded to play a decisive role in cell survival 28, 37, 38, 39, 40, 41, 42. It was found in this study that the ratio of Bcl‐2/Bax significantly declined upon OGD treatment, while pretreatment with 20–2000 ng/mL bakkenolide‐IIIa markedly raised it, suggesting that bakkenolide‐IIIa could effectively protect neurons from apoptosis. Furthermore, the results also indicate that bakkenolide‐IIIa might affect the regulation of NF‐κB on target genes.

To sum up, our results demonstrated a neuroprotective effect of bakkenolide‐IIIa in cerebral damage model, by inhibiting the activation of the classical NF‐κB pathway and another two important upstream activators, Akt and ERK1/2, which contribute to attenuating hypoxia‐induced injuries. These findings may provide a potential pharmacological basis for the use of bakkenolide‐IIIa and partly elucidate the active substances of P. trichinous in the treatment of stroke.

Conflict of Interest

The authors declare no conflict of interest.

Supporting information

Table S1. Physiological parameters of vehicle group and bakkenolide‐IIIa group (16 mg/kg, i.g.) before MCAO, during MCAO, and after reperfusion.

Click here for additional data file. (24MB, tif)

Figure S1. The levels of glucose in rats treated with vehicle or bakkenolide‐IIIa (16 mg/kg, i.g.) before MCAO. n = 8 per group.

Click here for additional data file. (4.9MB, tif)

Acknowledgment

This study was supported by the “Key National S&T Program” of “Major New Drug Development” (2009ZX09103‐420, 2014ZX09J14102‐07C) from the Chinese Ministry of Science and Technology and Shanghai Natural Science Foundation of China (13ZR1448400).

The first two authors contributed equally to this work.

References

  • 1. Donnan GA, Fisher M, Macleod M, Davis SM. Stroke. Lancet 2008;371:1612–1623. [DOI] [PubMed] [Google Scholar]
  • 2. Giurdanella G, Anfuso CD, Olivieri M, et al. Aflibercept, bevacizumab and ranibizumab prevent glucose‐induced damage in human retinal pericytes in vitro, through a PLA2/COX‐2/VEGF‐A pathway. Biochem Pharmacol 2015;96:278–287. [DOI] [PubMed] [Google Scholar]
  • 3. Dohare P, Hyzinski‐Garcia MC, Vipani A, et al. The neuroprotective properties of the superoxide dismutase mimetic tempol correlate with its ability to reduce pathological glutamate release in a rodent model of stroke. Free Radic Biol Med 2014;77:168–182. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Ntaios G, Faouzi M, Michel P. The effect of thrombolysis on short‐term improvement depends on initial stroke severity. J Neurol 2012;259:524–529. [DOI] [PubMed] [Google Scholar]
  • 5. Benes V, Netuka D, Charvat F, Mohapl M. Recanalization of long‐lasting middle cerebral artery occlusion by a combination of surgical and interventional approaches: Technical case report. Neurosurgery 2005;57:E401; discussion E401. [DOI] [PubMed] [Google Scholar]
  • 6. Li R, Guo M, Zhang G, Xu X, Li Q. Nicotiflorin reduces cerebral ischemic damage and upregulates endothelial nitric oxide synthase in primarily cultured rat cerebral blood vessel endothelial cells. J Ethnopharmacol 2006;107:143–150. [DOI] [PubMed] [Google Scholar]
  • 7. Hosseinzadeh H, Parvardeh S, Asl MN, Sadeghnia HR, Ziaee T. Effect of thymoquinone and Nigella sativa seeds oil on lipid peroxidation level during global cerebral ischemia ‐reperfusion injury in rat hippocampus. Phytomedicine 2007;14:621–627. [DOI] [PubMed] [Google Scholar]
  • 8. Aguilera P, Chanez‐Cardenas ME, Ortiz‐Plata A, et al. Aged garlic extract delays the appearance of infarct area in a cerebral ischemia model, an effect likely conditioned by the cellular antioxidant systems. Phytomedicine 2010;17:241–247. [DOI] [PubMed] [Google Scholar]
  • 9. Tulsulkar J, Shah ZA. Ginkgo biloba prevents transient global ischemia‐induced delayed hippocampal neuronal death through antioxidant and anti‐inflammatory mechanism. Neurochem Int 2013;62:189–197. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Wang Y, Guo M, Zhang G, Xue Q. Chemical constituents in root of Petasites tricholobus Franch. and their anti‐inflammatory activity. Acad J Second Mil Med Univ 2006;27:1210–1213. [Google Scholar]
  • 11. Wang YL, Li RP, Guo ML, et al. Bakkenolides from Petasites tricholobus and their neuroprotective effects related to antioxidant activities. Planta Med 2009;75:230–235. [DOI] [PubMed] [Google Scholar]
  • 12. Sun ZL, Gao GL, Luo JY, et al. A new neuroprotective bakkenolide from the rhizome of Peatasites tatewakianus. Fitoterapia 2011;82:401–404. [DOI] [PubMed] [Google Scholar]
  • 13. Jiang Q, Xia YY, He JM, Guo ML, Li RP. Total bakkenolides protects neurons against cerebral ischemic injury through inhibition of nuclear factor‐kappaB activation. CNS Neurol Disord Drug Targets 2014;13:874–884. [DOI] [PubMed] [Google Scholar]
  • 14. Longa EZ, Weinstein PR, Carlson S, Cummins R. Reversible middle cerebral artery occlusion without craniectomy in rats. Stroke 1989;20:84–91. [DOI] [PubMed] [Google Scholar]
  • 15. Isayama K, Pitts LH, Nishimura MC. Evaluation of 2,3,5‐triphenyltetrazolium chloride staining to delineate rat brain infarcts. Stroke 1991;22:1394–1398. [DOI] [PubMed] [Google Scholar]
  • 16. Zhang X, Yuan Y, Jiang L, et al. Endoplasmic reticulum stress induced by tunicamycin and thapsigargin protects against transient ischemic braininjury: Involvement of PARK2‐dependent mitophagy. Autophagy 2014;10:1801–1813. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Fan YY, Zhang XN, He P, et al. Transient lack of glucose but notO2 is involved in ischemic postconditioning‐induced neuroprotection. CNS Neurosci Ther 2013;19:30–37. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Wei Y, Yemisci M, Kim HH, et al. Fingolimod provides long‐term protection inrodent models of cerebral ischemia. Ann Neurol 2011;69:360–374. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Swanson RA, Morton MT, Tsao‐Wu G, et al. A semiautomated method for measuring brain infarct volume. J Cereb Blood Flow Metab 1990;10:290–293. [DOI] [PubMed] [Google Scholar]
  • 20. Shao BZ, Wei W, Ke P, et al. Activating cannabinoid receptor 2 alleviates pathogenesis of experimental autoimmune encephalomyelitis via activation of autophagy and inhibiting NLRP3 inflammasome. CNS Neurosci Ther 2014;20:1021–1028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Zhou JX, Ke P, Huan G, et al. Combined treatment with anisodamine and neostigmine inhibits joint inflammation in collagen‐induced arthritis mice. CNS Neurosci Ther 2014;20:186–187. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Li YJ, Yang Q, Zhang K, et al. Cytisine confers neuronal protection against excitotoxic injury by down‐regulating GluN2B containing NMDA receptors. Neurotoxicology 2013;34:219–225. [DOI] [PubMed] [Google Scholar]
  • 23. Lee ST, Lee JY, Han CR, et al. Dependency of 2‐methoxyestradiol‐induced mitochondrial apoptosis on mitotic spindle network impairment and prometaphase arrest in human Jurkat T cells. Biochem Pharmacol 2015;94:257–269. [DOI] [PubMed] [Google Scholar]
  • 24. Sun Y, Zhao Y, Yao J, et al. Wogonoside protects against dextran sulfate sodium‐induced experimental colitis in mice by inhibiting NF‐κB and NLRP3 inflammasome activation. Biochem Pharmacol 2015;94:142–154. [DOI] [PubMed] [Google Scholar]
  • 25. Latanich CA, Toledo‐Pereyra LH. Searching for NF‐kappaB‐based treatments of ischemia reperfusion injury. J Invest Surg 2009;22:301–315. [DOI] [PubMed] [Google Scholar]
  • 26. Harari OA, Liao JK. NF‐kappaB and innate immunity in ischemic stroke. Ann N Y Acad Sci 2010;1207:32–40. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Pizzi M, Sarnico I, Lanzillotta A, Battistin L, Spano P. Post‐ischemic brain damage: NF‐kappaB dimer heterogeneity as a molecular determinant of neuron vulnerability. FEBS J 2009;276:27–35. [DOI] [PubMed] [Google Scholar]
  • 28. Ridder DA, Schwaninger M. NF‐kappaB signaling in cerebral ischemia. Neuroscience 2009;158:995–1006. [DOI] [PubMed] [Google Scholar]
  • 29. Liu C, Zhang X, Zhou JX, et al. The protective action of ketanserin against lipopolysaccharide‐induced shock in mice is mediated by inhibiting inducible NO synthase expression via the MEK/ERK pathway. Free Radic Biol Med 2013;65:658–666. [DOI] [PubMed] [Google Scholar]
  • 30. Baeuerle PA, Baltimore D. NF‐kappa B: Ten years after. Cell 1996;87:13–20. [DOI] [PubMed] [Google Scholar]
  • 31. Krappmann D, Hatada EN, Tegethoff S, et al. The I kappa B kinase (IKK) complex is tripartite and contains IKK gamma but not IKAP as a regular component. J Biol Chem 2000;275:29779–29787. [DOI] [PubMed] [Google Scholar]
  • 32. Oliveira‐Marques V, Marinho HS, Cyrne L, Antunes F. Modulation of NF‐kappaB‐dependent gene expression by H2O2: A major role for a simple chemical process in a complex biological response. Antioxid Redox Signal 2009;11:2043–2053. [DOI] [PubMed] [Google Scholar]
  • 33. Oliveira‐Marques V, Marinho HS, Cyrne L, Antunes F. Role of hydrogen peroxide in NF‐kappaB activation: From inducer to modulator. Antioxid Redox Signal 2009;11:2223–2243. [DOI] [PubMed] [Google Scholar]
  • 34. Crack PJ, Taylor JM. Reactive oxygen species and the modulation of stroke. Free Radic Biol Med 2005;38:1433–1444. [DOI] [PubMed] [Google Scholar]
  • 35. Song YS, Narasimhan P, Kim GS, et al. The role of Akt signaling in oxidative stress mediates NF‐kappaB activation in mild transient focal cerebral ischemia. J Cereb Blood Flow Metab 2008;28:1917–1926. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Lopez‐Neblina F, Toledo AH, Toledo‐Pereyra LH. Molecular biology of apoptosis in ischemia and reperfusion. J Invest Surg 2005;18:335–350. [DOI] [PubMed] [Google Scholar]
  • 37. Liu C, Zhang GF, Song SW, et al. Effects of ketanserin on endotoxic shock and baroreflex function in rodents. J Infect Dis 2011;204:1605–1612. [DOI] [PubMed] [Google Scholar]
  • 38. Sun L, Zhang GF, Zhang X, et al. Combined administration of anisodamine and neostigmine produces anti‐shock effects: Involvement of α7 nicotinic acetylcholine receptors. Acta Pharmacol Sin 2012;33:761–766. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Liu C, Shen FM, Le YY, et al. Antishock effect of anisodamine involves a novel pathway for activating alpha7 nicotinic acetylcholine receptor. Crit Care Med 2009;37:634–641. [DOI] [PubMed] [Google Scholar]
  • 40. Won SJ, Kim DY, Gwag BJ. Cellular and molecular pathways of ischemic neuronal death. J Biochem Mol Biol 2002;35:67–86. [DOI] [PubMed] [Google Scholar]
  • 41. Sun LD, Wang F, Dai F, Wang YH, Lin D, Zhou B. Development and mechanism investigation of a new piperlongumine derivative as a potent anti‐inflammatory agent. Biochem Pharmacol 2015;95:156–169. [DOI] [PubMed] [Google Scholar]
  • 42. Huang CS, Lin AH, Yang TC, Liu KL, Chen HW, Lii CK. Shikonin inhibits oxidized LDL‐induced monocyte adhesion by suppressing NFκB activation via up‐regulation of PI3K/Akt/Nrf2‐dependent antioxidation in EA.hy926 endothelial cells. Biochem Pharmacol 2015;93:352–361. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Table S1. Physiological parameters of vehicle group and bakkenolide‐IIIa group (16 mg/kg, i.g.) before MCAO, during MCAO, and after reperfusion.

Click here for additional data file. (24MB, tif)

Figure S1. The levels of glucose in rats treated with vehicle or bakkenolide‐IIIa (16 mg/kg, i.g.) before MCAO. n = 8 per group.

Click here for additional data file. (4.9MB, tif)

Articles from CNS Neuroscience & Therapeutics are provided here courtesy of Wiley

RESOURCES