Skip to main content
CNS Neuroscience & Therapeutics logoLink to CNS Neuroscience & Therapeutics
. 2012 May 28;18(8):647–651. doi: 10.1111/j.1755-5949.2012.00336.x

ABCC2 Polymorphisms and Haplotype are Associated with Drug Resistance in Chinese Epileptic Patients

Jian Qu 1, Bo‐Ting Zhou 1,2, Ji‐Ye Yin 1, Xiao‐Jing Xu 1, Ying‐Chun Zhao 3, Guang‐Hua Lei 4, Qiang Tang 5, Hong‐Hao Zhou 1, Zhao‐Qian Liu 1
PMCID: PMC6493375  PMID: 22630058

SUMMARY 

Aims: Some study found that ATP‐binding cassette (ABC) efflux transporters play an important role in antiepileptic drug resistance, especially ABCB1 and ABCC2. The aims of this study were to evaluate the relationship between the genetic polymorphisms of ABCC2 and ABCB1 and the therapeutic efficacy of antiepileptic drugs (AEDs) in Chinese epileptic patients. Methods: ABCB1 rs1045642 (3435C>T) and ABCC2 rs717620 (−24C>T), rs3740066 (3972C>T), and rs2273697 (1249G>A) polymorphisms loci in 537 Chinese epilepsy patients (217 drug resistant patients and 320 drug responders) were genotyped by polymerase chain reaction‐restriction fragment length polymorphism (PCR‐RFLP). Results: ABCC2 rs717620 −24TT genotype was significantly associated with drug resistant epilepsy (odds ratio [OR]= 4.06 [1.79–9.20], P= 0.001). The OR values of ABCC2 rs717620 −24 CT+TT genotypes and ABCC2 rs3740066 (3972C>T) CT+TT genotypes were markedly higher in drug resistant patients (OR = 1.57 [1.08–2.29], P= 0.018; OR = 1.49 [1.02–2.18], P= 0.038, respectively) compared with responsive patients. ABCC2 rs2273697 (1249G>A) and ABCB1 rs1045642 (3435C>T) polymorphisms were not associated with drug resistant epilepsy. Linkage disequilibrium (LD) test showed that the ABCC2 rs717620 were in strong LD with rs2273697 (D’= 0.694) and rs3740066 (D’= 0.699). The frequencies of haplotypes TGT (ABCC2 −24C>T/ABCC2 1249G>A/ABCC2 3972C>T) in resistant patients was significantly higher than those in responsive patients (21.0% vs. 14.2%, P < 0.05). Conclusion: ABCC2−24C>T, 3972C>T polymorphisms and one ABCC2 haplotype is associated with AED resistance; ABCC2 1249G>A and ABCB1 3435C>T polymorphisms are not associated with AED resistance in our study. These data suggest that ABCC2 polymorphisms and haplotype may affect the response of antiepileptic drugs.

Keywords: ABCB1 polymorphism, ABCC2 polymorphism, Epilepsy, Haplotypes

Introduction

Epilepsy is a chronic neurological illness, in which abnormal electrical activity in the brain causes involuntary changes in body movement, function, sensation, or behavior [1]. The World Health Organization estimates that epilepsy affects approximately 50 million people worldwide. Now‐a‐days, we recognize that genetic factors play an even more important role in the pathogenesis of epilepsy and drug efficacy than previously appreciated [1, 2]. Approximately, every second epileptic patient became resistant to the initial drugs [3]. Why so many epileptic patients show resistance against the antiepileptic drugs (AEDs) is not well‐understood. Some potential mechanisms have been suggested with regard to the targets and transporters of the drugs. The voltage‐gated ion channels are targets of some AEDs; alternations in the composition and functionality of them may lead to resistance in epileptic patients [4, 5]. The overexpression of ATP‐binding cassette (ABC) efflux transporters in the blood‐brain barrier (BBB), causing low‐drug concentration at their target, may be a potential mechanism [6]. Seizures, exposure to some AEDs such as carbamazepine, and genetic factors may influence the expression of transporters [7, 8, 9]. Some ABC transporters such as multidrug resistance 1 (MDR1, p‐glycoprotein, ABCB1), and a group of multidrug resistance proteins (MRPs, ABCCs), have been shown to mediate AEDs in brain [7, 9, 10]. These transporters are expressed in endothelial cells, astrocytes, and neurons of human brain tissues [11]. Therefore, these transporters may influence the efficacy of AEDs.

Initial observation of the relationship between ABCB1 3435C>T and drug resistant epilepsy was followed by a number of studies to evaluate the single nucleotide polymorphism (SNP) as a predictor of AED resistance [12, 13]. However, some studies have conversely suggested no association between ABCB1 polymorphisms and the response to AEDs [14, 15]. Leschziner et al. studied a cohort of 503 epilepsy patients and found no evidence to support that ABCB1 common variation influences drug withdrawal outcomes [16]. ABCC2 is one of the ABC efflux transporters, whose role in human brain tissues is not fully understood due to its low expression in normal brain tissues [17]. But some studies found that the expression of ABCC2 was upregulated in the brain tissues of epileptic patients [18, 19]. Moreover, in the ABCC2‐deficient rat model, it is found that ABCC2 is involved in carbamazepine efficacy [20]. Recently, a study found a significant association between ABCC2 V417I polymorphism and reduced oral bioavailability of talinolol [21]. Kin et al. found that the ABCC2 1249G>A, and ABCB1 3435C>T, 1236C>T, 2677G>T/A polymorphisms were not associated with AED resistance in Japanese epileptic patients [22]. The study of Ufer et al. showed that a higher risk of AED failure in ABCC2−24T allele carriers is possible due to upregulation of ABCB1, but the mechanism is unknown [23].

Overall, whether the polymorphisms of these genes are associated with AED resistance is still not clear. To clarify whether ABCC2 and ABCB1 genes are involved in drug resistance epilepsy, we investigated the effects of ABCB1 rs1045642 and ABCC2 rs717620, rs3740066, and rs2273697 polymorphisms on AED resistance in Chinese epileptic patients.

Methods and Materials

Subjects

A total of 537 Chinese epileptic patients treated with AEDs (326 males, 211 female, mean age: 16.7 ± 11.7 years) from Xiangya hospital, the Second Xiangya Hospital of Central South University, and Hunan Provincial People's Hospital, were recruited in this study. The patients were diagnosed and classified according to guidelines of the International League against Epilepsy. Exclusion criteria included severe adverse drug reactions, unreliable record of seizure frequency, poor compliance with AEDs, history of alcohol or drug abuse, presence of progressive or degenerative neurological or systemic disorders, and hepatic or renal failure. A standardized questionnaire was administered to collect demographic details and clinical data such as seizure types and frequency, past medical history, AED history, concomitant drug history, and relevant family history. All patients or their parents gave their written consent to participate in the study. The study protocol was approved by the ethics committee of Xiangya School of Medicine and ethics committee of Institute of Clinical Pharmacology of Central South University. A clinical study admission (the registration number: ChiCTR‐TCH‐0000813) was approved by Chinese Clinical Trail Register. The patients were considered to be drug‐responsive if they had not experienced any type of seizures for a minimum of 1 year after receiving AEDs. Drug resistance was defined as having at least four seizures during the previous year while trying at least three antiepileptic medications at maximal tolerated doses [16, 22].

Genotyping

Blood samples (5 mL) for genotyping were obtained with EDTA through the venipuncture used for pharmacokinetic monitoring and frozen at −80% for 24 h. DNA was isolated using phenol‐chloroform extraction method. Genotyping was performed using the polymerase chain reaction‐restriction fragment length polymorphism (PCR‐RFLP) assay. The designed primer pairs for ABCB1 rs1045642 and ABCC2 rs717620, rs3740066, and rs2273697 loci were summarized in Table 1. Each genotyping was performed in a blinded manner. Automatic sequencing was performed for randomly selected DNA samples from patients.

Table 1.

PCR‐RFLP assays for genotyping of ABCC2 and ABCB1 polymorhisms

Gene SNPs Primer sequence Restriction enzyme
ABCC2 rs 717620 5′‐taaatggttgggatgaaagg‐3′ Bpi I
(−24C>T) 5′‐gctttagaccaattgcacatc‐3′
rs2273697 5′‐gggcaaagaagtgtgtggat‐3′ Nco I
(1249G>A) 5′‐acatcaggttcactgtttctccca‐3′
rs 3740066 5′‐atccttggctttgtccttgg‐3′ BsiE I
(3972C>T) 5′‐aataatcaggttcactgtttctcccac‐3′
ABCB1 rs1045642 5′‐tgttttcagctgcttfatgg‐3′ Bsp143 I
(3435C>T) 5′‐aaggcatgtatgttggcctc‐3′

Statistical Analysis

The SPSS software package (version 13.0 for Windows; SPSS, Chicago, IL, USA) was used for statistical analysis. Hardy–Weinberg equilibrium was analyzed with χ2 test or Fisher's Exact test as applicable in the studied sample. Age was compared between responsive and nonresponsive patients with the Student's t‐test. Sex and other characteristics about patients are compared with χ2 test. The relationship between various genotypes and responsiveness was examined by binary logistic regression, after adjustment for age, sex, and seizure type. Linkage disequilibrium and haplotypes were analyzed using SHEsis (http://analysis.bio‐x.cn/myAnalysis.php) [24, 25]. Statistical significance was accepted when P < 0.05.

Results

The study population consisted of 320 AED responders (16.4 ± 12.3 years) and 217 resistant patients (17.0 ± 10.7 years). The most commonly used AED is carbamazepine (65.4%), followed by valproic acid (64.6%), oxcarbazepine (27.7%), phenobarbital (20.9%), lamotrigine (17.7%), phenytoinum natricum (15.8%), topiramate (14.0%), and levetiracetam (11.0%; Table 2).

Table 2.

Demographic and clinical characteristics of patients

Parameters Drug‐responsive (320) Drug‐resistant (217) Total (537)
Sex (%)
 Male 187 (58.4%) 139 (64.1%) 326 (60.7%)
 Female 133 (41.6%) 78 (35.9%) 211 (39.3%)
Age (years) 16.4 ± 12.3 17.0 ± 10.7 16.7 ± 11.7
AEDs used in patients (%)
 Carbamazepine 215 (68.1%) 136 (62.7%) 351 (65.4%)
 Valproic acid 168 (52.5%) 159 (73.3%) 347 (64.6%)
 Phenytoinum 46 (14.4%) 39 (18.0%) 85 (15.8%)
 Phenobarbital 54 (16.8%) 68 (31.3%) 112 (20.9%)
 Lamotrigine 39 (12.2%) 56 (25.8%) 95 (17.7%)
 Levetiracetam 23 (7.20%) 36 (16.6%) 59 (11.0%)
 Topiramate 43 (13.4%) 32 (14.7%) 75 (14.0%)
 Oxcarbazepine 70 (21.9%) 78 (36%) 148 (27.7%)
Seizure type (%)
 Partial 125 (39.0%) 79 (36.4%) 204 (38.0%)
 Generalized 155 (48.4%) 115 (53.0%) 270 (50.3%)
 Nonclassifiable 40 (12.6%) 23 (10.6%) 63 (11.7%)
Etiology (%)
 Idiopathic 121 (37.8%) 75 (34.6%) 196 (35.1%)
 Symptomatic 85 (26.6%) 64 (29.5%) 149 (31.0%)
 Cryptogenetic 114 (35.6%) 78 (35.9%) 192 (33.9%)

We determined three SNPs in ABCC2 in 217 drug resistant patients and 320 drug responders (Table 3). The investigated SNPs were all in Hardy–Weinberg equilibrium. The OR values in patients with ABCC2−24TT genotype or CT+TT genotypes were significantly higher in drug‐resistant patients than those in drug responders (OR = 4.06 [1.79–9.20], P= 0.001; OR = 1.57 [1.08–2.29], P < 0.01). The ABCC2 rs2273697 (1249G>A) polymorphism was not significantly associated with drug resistance after subjects were adjusted for sex, age, and seizure type. The OR value in patients with ABCC2 3972 CT+TT genotypes were also higher in drug‐resistant patients than that in drug responders (OR = 1.49 [1.02–2.18], P= 0.038). In an independent cohort of young responders and nonresponders, the CT or TT genotypes were overrepresented in nonresponders group (OR = 1.95 [1.11–3.43], P= 0.020; OR = 3.30 [1.29–8.40], P= 0.013; data not shown). We did not observe any significant differences in ABCB1 rs1045642 (3435C>T) SNP between drug resistant patients and responders. After adjusted with age, sex, seizure types, the OR values in ABCB1 3435TT homozygous and 3435 CT+TT genotypes are 1.04 (0.587–1.85, P= 0.888) and 1.02 (0.696–1.48, P= 0.936), respectively.

Table 3.

Genotype frequencies of four SNPs in ABCC2 and ABCB1 genes in responsive (n = 302) and resistant patients (n = 217)

Gene SNP rs# Drug‐resistant (n = 217) Drug‐responder (n = 320) Odds ratio (95%CI) P‐value
ABCC2 rs717620 CC 118 (54.4%) CC 207 (64.5%) – –
(−24C>T) CT 77 (35.5%) CT 103 (32.2%) 1.32 (0.889–1.97) 0.167
TT 22 (10.1%) TT 10 (3.10%) 4.06 (1.79–9.20) 0.001
CT+TT 99 (45.6%) CT+TT 113 (35.3%) 1.57 (1.08–2.29) 0.018
rs227369 GG 181 (83.4%) GG 262 (81.9%) – –
(1249G>A) GA 35 (16.1%) GA 56 (17.5%) 0.915 (0. 559–1.50) 0.725
AA 1 (0.500%) AA 2 (0.600%) 1.68 (0.147–19.0) 0.679
GA+AA 36 (16.7%) GA+AA 62 (18.1%) 0.932 (0.573–1.52) 0.777
rs3740066 CC 123(56.7%) CC 200 (62.5%) – –
(3972C>T) CT 75 (34.6%) CT 102 (31.9%) 1.41 (0.943–2.10) 0.094
TT 19 (8.70%) TT 18 (5.60%) 1.94 (0.939–4.00) 0.073
CT+TT 94 (43.3%) CT+TT 120 (37.5%) 1.49 (1.02–2.18) 0.038
ABCB1 rs1045642 CC 81 (37.3%) CC 116 (36.3%) – –
(3435C>T) CT 105 (48.4%) CT 161(50.3%) 1.01 (0.683–1.50) 0.967
TT 31 (14.3%) TT 43 (13.4%) 1.04 (0.587–1.85) 0.888
CT+TT 136 (62.7%) CT+TT 204 (63.9%) 1.02 (0.696–1.48) 0.936

Data has been adjusted for age, sex, and seizure type. Homozygous wild‐type patients served as the reference group. OR, odds ratio; CI, confidence interval.

The linkage disequilibrium test of three SNPs in ABCC2 was shown in Figure 1. Rs717620 and rs2273697 were in strong linkage disequilibrium (D‐prime = 0.694) and rs717620 and rs3740066 were also in strong linkage disequilibrium (D‐prime = 0.699). The haplotypes (ABCC2−24C>T/ABCC2 1249G>A/ABCC2 3972C>T) test showed that one haplotype frequency in drug resistant group was different from those in drug responsive group (Table 4). The frequency of haplotype TGT (ABCC2−24C>T/ABCC2 1249G>A/ABCC2 3972C>T) in resistant patients was significantly higher than those in responsive patients (21.0% vs. 14.2%, P < 0.05).

Figure 1.

Figure 1

The linkage disequilibrium of three SNPs in ABCC2 in all patients. Linkage disequilibrium between pairs of polymorphisms is shown in diamonds (D‐prime), with darker shading indicating greater D‐prime.

Table 4.

Frequencies of haplotypes (>1%) containing all polymorphisms in ABCC2 in responsive (n = 320) and resistant epileptic patients (n = 217)

Haplotype Frequency P‐value
ABCC2 resistant responsive Fisher's P value Pearson's P value
CGC 0.600 0.657 0.055 0.055
CGT 0.040 0.065 0.086 0.086
CAC 0.074 0.083 0.591 0.591
TGC 0.064 0.042 0.111 0.111
TGT 0.210 0.142 0.003* 0.003*

Polymorphisms are in the same order as in Table 3. All those frequencies <0.01 will be ignored in analysis.

*P < 0.05.

Discussion

Despite more and more research on AED resistance, we still know little about the mechanism. One possible reason lays on overexpression of multidrug transporter proteins [26]. As described in one review [27], ABC transporters are considered as one of the hottest topics in epileptology. ABCB1 was regarded as the first factor influencing AEDs in BBB. Similar to ABCB1, ABCC2 expression was also increased in brain‐derived endothelial cells from patients with AED resistance [28].

So in the present study, we investigated three SNPs in ABCC2 and one SNP in ABCB1 in 537 responsive or resistant epilepsy patients and found that ABCC2−24C>T and 3972C>T polymorphisms are associated with AED resistance (Table 3). But we found no association between polymorphisms of ABCC2 1249G>A, ABCB1 3435C>T and AED resistance. These data may have some conflicts due to reduced activity of ABCC2−24T gene product ABCC2 protein. In one study, the ABCC2−24T construct showed an 18.7% reduced activity in vitro because of its lower mRNA levels in normal tissues [29]. Ufer et al. also found the association between −24T allele carriers and AED failure in Caucasian. Moreover, they further found that −24C>T genotype did not affect hippocampal ABCC2 expression but increased ABCB1 expression [23]. Despite the expression and functional relevance of ABCC2 in kidney tissue and other cell lines, its condition in BBB or brain tissue still remains controversial. Increased ABCC2 mRNA and ABCC2 protein expression in brain‐derived endothelial cells from AED resistant patients have been reported [30, 31]. Therefore, it is possible that tissue dependent differential regulation of ABCC2 expression induces different conditions in hepatic, BBB, or brain tissue [23].

We also find that ABCC2 3972 CT+TT genotypes are associated with drug resistance. In another study, it is found that the silent SNP 3972C>T is strongly linked to −24C>T, which is associated with a decreased function of the transporter [32]. In our study, we also investigated the linkage disequilibrium and found strong link between 3972C>T and −24C>T (D’= 0.699, Figure 1). Although 3972C>T is a synonymous SNP, we think that it might still have significant function to affect the absorption or excretion of its substrates. One study reported the in vivo association of c.3972C> T variant with increased area under the concentration‐time curve of irinotecan and its metabolites [33], revealed the functional relevance of this variant for bioavailability of drugs and toxins.

Haenisch et al. observed a significant association of the 1249G>A polymorphism with reduced oral bioavailability of talinolol, presumably as a result of increased ABCC2 activity [21]. But another study showed that 417I‐ABCC2 (c.1249A) variant indicated reduced carbamazepine transporter activity compared with 417V‐ABCC2 (c.1249G). Interestingly, they found that the 1249G>A showed an association with adverse drug reaction but not with drug efficacy in central nervous system [34]. In this study, we found that there is no association between ABCC2 1249G>A polymorphism and AED resistance.

Currently, there are various studies focusing on the relationship between ABCB1 3435C>T polymorphism and AED efficacy, but the results have been inconclusive. In some studies, the results were positive [12, 13], but in others, results were negative [15, 16]. Moreover, in some meta‐analyses about ABCB1 3435C>T, the results were also negative [15, 35]. In a meta‐analysis of 23 studies (7,067 patients), no significant association of ABCB1 alleles, genotypes or haplotypes with the response to treatment was found in the overall population or in each ethnicity subgroup [35]. In a functional study on the polymorphism in the cortex and hippocampus of drug‐resistant patients, no association was detected between 3435C>T and 2677G>T/A polymorphisms and ABCB1 mRNA expression levels [36]. In our study, we did not find any association between 3435C>T polymorphism and AED efficacy either (Table 3).

Now‐a‐days, more and more studies focused not only on the simple one SNP but also on the haplotypes. We therefore analyzed the haplotypes of the three SNPs. For the first time, we found that there were five haplotypes (>1%), and one haplotype was associated with AED resistance (Table 4). ABCC2 TGT haplotype frequency is higher in resistant group than in responsive group. Think about of three SNPs’ function, 417I‐ABCC2 (c.1249A) variant indicated reduced carbamazepine transporter activity compared with 417V‐ABCC2 (c.1249G); the silent SNP 3972C>T is strongly linked to −24C>T, which is associated with a decreased function of the transporter. We can see that the TGT haplotype really further reduce the transporters activity.

As far as we know, this is the first report about some association between ABCC2 haplotype and AED efficacy. Patrick Kwan et al. studied a total of 25 tagging SNPs from ABCC2, ABCC5, and ABCG2 genes. However, no haplotypes were over 1% frequency, which included all SNPs of the genes associated with drug resistance [37]. Haerian et al. studied ABCB1 haplotypes on five loci and there were no positive results either [38]. Although so many studies have been launched on the relationship between ABC transporters and AED resistance, the overall results are inconsistent.

Epilepsy is a complicated disease and most patients were treated with AEDs of varying doses and kinds, making the drug‐resistance mechanism extremely complex. Moreover, there is no precise phenotype or definition of drug resistance. Another unfavorable factor for our study is that the study population is limited and modest effects of other SNPs on drug resistance can not be excluded. All these factors contributed to the limitation of our results. Further studies with larger sample size on more related SNPs in different candidate genes are needed to confirm the positive results.

In conclusion, our data revealed that ABCC2−24TT or CT+TT genotypes, ABCC2 3972 CT+TT genotypes, and one ABCC2 haplotype is obviously associated with drug resistance in epileptic patients. However, the ABCC2 1249G>A polymorphism and ABCB1 3435C>T polymorphism are not associated with this process.

Conflict of Interest

The authors declare no conflict of interest.

Acknowledgments

We thank the study participants. This work was supported by the National High‐Tech R&D Program of China (863 Program; 2009AA022704), National Natural Science Foundation of China (81173129), Program for Changjiang Scholars and Innovative Research Team in University of Ministry of Education of China (IRT0946), and the Open Foundation of Innovative Platform in University of Hunan Province of China (10K078).

The first three authors contributed equally to this work.

References

  • 1. Valerio N. Recent patents on epilepsy genetics. Recent PatDNA Gene Seq. 2009;3:183–192. [DOI] [PubMed] [Google Scholar]
  • 2. Ortrud KS. Gene polymorphisms and their role in epilepsy treatment and prognosis. Naunyn-Schmied Arch Pharmacol 2010;382:109–118. [DOI] [PubMed] [Google Scholar]
  • 3. Kwan P, Brodie MJ. Eearly identification of refactory epilepsy. N Engl J Med 2000;342:314–319. [DOI] [PubMed] [Google Scholar]
  • 4. Abe T, Seo T, Ishitsu T, Nakagawa T, Hori M, Nakagawa K. Association between SCN1A polymorphism and carbamazepine‐resistant epilepsy. Br J Clin Pharmacol 2008;66:304–307. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Lakhan R, Kumari R, Misra UK, Kalita J, Pradhan S, Mittal B. Differential role of sodium channels SCN1A and SCN2A gene polymorphisms with epilepsy and multiple drug resistance in the north Indian population. Br J Clin Pharmacol 2009;68:214–200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Sisodiya SM. Mechanisms of antiepileptic drug resistance. Curr Opin Neurol 2003;16:197–201. [DOI] [PubMed] [Google Scholar]
  • 7. Sisodiya SM, Thom M. Widespread upregulation of drug‐resistance proteins in fatal human status epilepticus. Epilepsia 2003;44:261–264. [DOI] [PubMed] [Google Scholar]
  • 8. Giessmann T, May K, Modess C, et al Carbamazepine regulates intestinal P‐glycoprotein and multidrug resistance protein MRP2 and influences disposition of talinolol in humans. Clin Pharmacol Ther 2004;76:192–200. [DOI] [PubMed] [Google Scholar]
  • 9. Soranzo N, Goldstein DB, Sisodiya SM. The role of common variation in drug transporter genes in refractory epilepsy. Expert Opin Pharmacother 2005;6:1305–1312. [DOI] [PubMed] [Google Scholar]
  • 10. Begleg DJ. ABC transporters and the blood‐brain barrier. Curr Pharm Des 2004;10:1295–1312. [DOI] [PubMed] [Google Scholar]
  • 11. Dallas S, Miller DS, Bendayan R. Multidrug resistance‐associated proteins: Expression and function in the central nervous system. Pharmacol Rev 2006;58:140–161. [DOI] [PubMed] [Google Scholar]
  • 12. Kwan P, Wong V, Ng PW, et al Gene‐wide tagging study of association between ABCB1 polymorphisms and multidrug resistance in epilepsy in Han Chinese. Pharmacogenomics 2009;10:723–732. [DOI] [PubMed] [Google Scholar]
  • 13. Hung CC, Chen CC, Lin CJ, Liou HH. Functional evaluation of polymorphisms in the human ABCB1 gene and the impact on clinical responses of antiepileptic drugs. Pharmacogenet Genomics 2008;18:390–402. [DOI] [PubMed] [Google Scholar]
  • 14. Seo T, Ishitsu T, Ueda N, et al ABCB1 polymorphisms influence the response to antiepileptic drugs in Japanese epilepsy patients. Pharmacogenomics 2006;7:551–561. [DOI] [PubMed] [Google Scholar]
  • 15. Bournissen FG, Moretti ME, Juurlink DN, Koren G, Walker M, Finkelstein Y. Polymorphism of the MDR1/ABCB1 C3435T drug‐transporter and resistance to anticonvulsant drugs: A meta‐analysis. Epilepsia 2009;50:898–903. [DOI] [PubMed] [Google Scholar]
  • 16. Leschziner GD, Andrew T, Leach JP, et al Common ABCB1 polymorphisms are not associated with multidrug resistance in epilepsy using a gene‐wide tagging approach. Pharmacogenet Genomics 2007;17:217–220. [DOI] [PubMed] [Google Scholar]
  • 17. Nies AT, Jedlitschky G, König J, et al Expression and immunolocalization of the multidrug resistance proteins, MRP1‐MRP6 (ABCC1‐ABCC6), in human brain. Neuroscience 2004;129:349–360. [DOI] [PubMed] [Google Scholar]
  • 18. Dombrowski SM, Desai SY, Marroni M, et al Overexpression of multiple drug resistance genes in endothelial cells from patients with refractory epilepsy. Epilepsia 2001;42:1501–1506. [DOI] [PubMed] [Google Scholar]
  • 19. Van Vliet EA, Aronica E, Redeker S, Gorter JA. Expression and cellular distribution of major vault protein: A putative marker for pharmacoresistance in a rat model for temporal lobe epilepsy. Epilepsia 2004;45:1506–1516. [DOI] [PubMed] [Google Scholar]
  • 20. Potschka H, Fedrowitz M, Löscher W. Brain access and anticonvulsant efficacy of carbamazepine, lamotrigine, and felbamate in ABCC2/MRP2‐deficient TR‐ rats. Epilepsia 2003;44:1479–1486. [DOI] [PubMed] [Google Scholar]
  • 21. Haenisch S, May K, Wegner D, Caliebe A, Cascorbi I, Siegmund W. Influence of genetic polymorphisms on intestinal expression and rifampicin‐type induction of ABCC2 and on bioavailability of talinolol. Pharmacogenet Genomics 2008;18:357–365. [DOI] [PubMed] [Google Scholar]
  • 22. Kim DW, Lee SK, Chu K, Jang IJ, Yu KS, Cho JY, Kim SJ. Lack of association between ABCB1, ABCG2, and ABCC2 genetic polymorphisms and multidrug resistance in partial epilepsy. Epilepsy Res 2009;84:86–90. [DOI] [PubMed] [Google Scholar]
  • 23. Ufer M, Mosyagin I, Muhle H, et al Non‐response to antiepileptic pharmacotherapy is associated with the ABCC2 – 24C>T polymorphism in young and adult. Pharmacogenet Genomics 2009;19:353–362. [DOI] [PubMed] [Google Scholar]
  • 24. Shi YY, He L. SHEsis, a powerful software platform for analyses of linkage disequilibrium, haplotype construction, and genetic association at polymorphism loci. Cell Res 2005;15:97–98. [DOI] [PubMed] [Google Scholar]
  • 25. Li Z, Zhang Z, He Z, Tang W, et al A partition‐ligation‐combination‐subdivision EM algorithm for haplotype inference with multiallelic markers: Update of the SHEsis (http://analysis.bio‐x.cn). Cell Res 2009;19:519–523. [DOI] [PubMed] [Google Scholar]
  • 26. Loscher W, Klotz U, Zimprich F, Schmidt D. The clinical impact of pharmacogenetics on the treatment of epilepsy. Epilepsia 2009;50:1–23. [DOI] [PubMed] [Google Scholar]
  • 27. Hughes JR. One of the hottest topics in epileptology: ABC proteins. Their inhibition may be the future for patients with intractable seizures. Neurol Res 2008;30:920–925. [DOI] [PubMed] [Google Scholar]
  • 28. Dombrowski SM, Desai SY, Marroni M, et al Overexpression of multiple drug resistance genes in endothelial cells from patients with refractory epilepsy. Epilepsia 2001;42:1501–1506. [DOI] [PubMed] [Google Scholar]
  • 29. Haenisch S, Zimmermann U, Dazert E, et al Influence of polymorphisms of ABCB1 and ABCC2 on mRNA and protein expression in normal and cancerous kidney cortex. Pharmacogenomics J 2007;7:56–65. [DOI] [PubMed] [Google Scholar]
  • 30. Dombrowski SM, Desai SY, Marroni M, et al Overexpression of multiple drug resistance genes in endothelial cells from patients with refractory epilepsy. Epilepsia 2001;42:1501–1506. [DOI] [PubMed] [Google Scholar]
  • 31. Kubota H, Ishihara H, Langmann T, et al Distribution and functional activity of P‐glycoprotein and multidrug resistance‐associated proteins in human brain microvascular endothelial cells in hippocampal sclerosis. Epilepsy Res 2006;26:213–228. [DOI] [PubMed] [Google Scholar]
  • 32. Naesens M, Kuypers DR, Verbeke K, Vanrenterghem Y. Multidrug resistance protein 2 genetic polymorphisms influence mycophenolic acid exposure in renal allograft recipients. Transplantation 2006;82:1074–1084. [DOI] [PubMed] [Google Scholar]
  • 33. Rosner GL, Panetta JC, Innocenti F, Ratain MJ. Pharmacogenetic pathway analysis of irinotecan. Clin Pharmacol Ther 2008;84:393–402. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Kim WJ, Lee JH, Yi J, et al A nonsynonymous variation in MRP2/ABCC2 is associated with neurological adverse drug reactions of carbamazepine in patients with epilepsy. Pharmacogenet Genomics 2010;20:249–256. [DOI] [PubMed] [Google Scholar]
  • 35. Haerian BS, Lim KS, Tan CT, Raymond AA, Mohamed Z. Association of ABCB1 gene polymorphisms and their haplotypes with response to antiepileptic drugs: A systematic review and meta‐analysis. Pharmacogenomics 2011;12:713–725. [DOI] [PubMed] [Google Scholar]
  • 36. Mosyagin I, Runge U, Schroeder HW, et al Association of ABCB1 genetic variants 3435C>T and 2677G>T to ABCB1 mRNA and protein expression in brain tissue from refractory epilepsy patients. Epilepsia 2008;49:1555–1561. [DOI] [PubMed] [Google Scholar]
  • 37. Kwan P, Wong V, Ng PW, et al Gene‐wide tagging study of the association between ABCC2, ABCC5 and ABCG2 genetic polymorphisms and multidrug resistance in epilepsy. Pharmacogenomics 2011;12:319–325. [DOI] [PubMed] [Google Scholar]
  • 38. Haerian BS, Lim KS, Mohamed EH, et al Lack of association of ABCB1 haplotypes on five loci with response to treatment in epilepsy. Seizure 2011;20:546–553. [DOI] [PubMed] [Google Scholar]

Articles from CNS Neuroscience & Therapeutics are provided here courtesy of Wiley

RESOURCES