Skip to main content
CNS Neuroscience & Therapeutics logoLink to CNS Neuroscience & Therapeutics
. 2015 Jun 20;21(8):631–641. doi: 10.1111/cns.12420

Lovastatin Differentially Affects Neuronal Cholesterol and Amyloid‐β Production in vivo and in vitro

Aydé Mendoza‐Oliva 1, Patricia Ferrera 1, Jorge Fragoso‐Medina 2, Clorinda Arias 1,✉
PMCID: PMC6495182  PMID: 26096465

Summary

Background and Aims

Epidemiological and experimental studies indicate that high cholesterol may increase susceptibility to age‐associated neurodegenerative disorders, such as Alzheimer's disease (AD). Thus, it has been suggested that statins, which are inhibitors of the enzyme 3‐hydroxy‐3‐methylglutaryl‐CoA reductase (HMGCR), may be a useful therapeutic tool to diminish the risk of AD. However, several studies that analyzed the therapeutic benefits of statins have yielded conflicting results. Herein, we investigated the role of lovastatin on neuronal cholesterol homeostasis and its effects on amyloid β protein production in vivo and in vitro.

Methods and Results

Lovastatin effects were analyzed in vitro using differentiated human neuroblastoma cells and in vivo in a lovastatin‐fed rat model. We demonstrated that lovastatin can differentially affect the expression of APP and Aβ production in vivo and in vitro. Lovastatin‐induced HMGCR inhibition was detrimental to neuronal survival in vitro via a mechanism unrelated to the reduction of cholesterol. We found that in vivo, dietary cholesterol was associated with increased Aβ production in the cerebral cortex, and lovastatin was not able to reduce cholesterol levels. However, lovastatin induced a remarkable increase in the mature form of the sterol regulatory element‐binding protein‐2 (SREBP‐2) as well as its target gene HMGCR, in both neuronal cells and in the brain.

Conclusions

Lovastatin modifies the mevalonate pathway without affecting cholesterol levels in vivo and is able to reduce Aβ levels only in vitro.

Keywords: APP, Cholesterol, High fat diet, HMGCR, Lovastatin, SREBP‐2

Introduction

Epidemiological and experimental studies have linked changes in cholesterol metabolism to an increased susceptibility to AD 1, 2, 3. In fact, the ε4 allele of ApoE, which is associated with high cholesterol, is a well‐established risk factor for AD 4, 5. Aβ deposition in the brain is considered an important factor in AD progression, as it initiates a cascade of events associated with synaptic damage and neuronal death 6. The majority of APP is constitutively cleaved within the Aβ sequence by α‐secretase enzymes, preventing Aβ production. In the amyloidogenic pathway, APP is proteolyzed by β‐secretase, which is further cleaved by γ‐secretase, leading to Aβ formation 7, 8, 9. High‐cholesterol intake has been linked to the accumulation of Aβ in the brain, suggesting that high cholesterol might increase the amyloidogenic processing of APP and that, in contrast, low cholesterol favors the nonamyloidogenic pathway, decreasing Aβ production and amyloid plaque formation 10, 11, 12. Changes in membrane cholesterol levels or in its distribution in lipid rafts have been suggested to influence the activity and expression of the enzymes involved in the amyloidogenic processing of APP 10, 11, 13, 14. We have previously shown that neuronal exposure to high cholesterol worsens Aβ toxicity by increasing the formation of ROS 15. Thus, cholesterol may increase the brain's vulnerability to Aβ at two levels: by promoting Aβ deposition and by increasing its toxicity. Therefore, it has been suggested that statins, which are pharmacological inhibitors of HMGCR 16, may be useful in diminishing the risk of AD 17, 18, 19. While some reports have proposed the use of statins due to their cholesterol‐lowering properties and their ability to decrease Aβ formation 13, 20, their beneficial effects remain controversial 21, 22, 23. Statins have many positive effects in the CNS, including effects on cell survival 24, 25 and neuronal plasticity 26, 27. Statins also display anti‐amyloidogenic activity 13, 28, 29, 30, 31 and antioxidant 32, 33 and anti‐inflammatory properties 34, 35. In contrast, statin‐mediated neurotoxicity has also been reported 36, 37, 38, 39, 40, 41, 42, including the inhibition of neurite outgrowth 43, 44, 45 and the impairment of neurotransmission 46, 47. In addition to their cholesterol‐lowering properties, statins have pleiotropic actions related to inhibition of the mevalonate pathway, which lowers the concentrations of biologically active isoprenoid intermediates, such as geranylgeranyl pyrophosphate (GGPP) and farnesyl pyrophosphate (FPP).

Circulating cholesterol, however, is regulated differently than cholesterol in the brain (revised by Mendoza‐Oliva et al. 48). Due to existing controversy about the relationship between cholesterol and AD 49, it is important to understand how cholesterol in the brain is regulated and how this process is affected by statins before we can determine their potential and safety for use in treating AD. The aim of this study was to explore the effects of lovastatin, a lipophilic statin able to cross the blood–brain barrier 50, on cholesterol homeostasis and neuronal survival. We also aimed to uncover any links with APP expression and Aβ metabolism using a human neuroblastoma cell model and an in vivo lovastatin‐fed rat model.

Materials and Methods

Cell Culture

Human neuroblastoma cells (MSN) 51 were maintained in RPMI 1640 (Gibco Invitrogen, Grand Island, CA, USA) medium containing nonessential amino acids plus 10% fetal calf serum (Gibco Invitrogen). Cells were grown in petri dishes (100 × 15 mm) or in 24‐well plates at a density of 1 × 106 cells per well in an atmosphere of 5% CO2 /95% O2 at 37°C. After 24 h, MSN cells were differentiated by the addition of retinoic acid (10 μM) and nerve growth factor (NGF) (50 ng/mL), and cells were exposed to different concentrations of lovastatin (2 or 10 μM; Calbiochem, Temecula, CA, USA) or cholesterol (25 μM; Sigma‐Aldrich, St. Louis, MO, USA) dissolved in ethanol (0.1 and 0.16%, respectively) and cultured in normal (10%) or serum‐free media for an additional 2 or 5 days. In some experiments, cholesterol and lovastatin were added simultaneously during 2 or 5 days.

Cell Viability

Cell viability was assessed through the conversion of 3‐[4,5‐ dimethylthiazole‐2‐yl]‐2,5‐diphenyl‐tetrazolium bromide (MTT; Sigma‐Aldrich) to formazan crystals by mitochondrial respiratory chain reactions 52. The reduction of MTT is an indicator of mitochondrial redox capacity that is used as a measure of cell viability. In brief, MTT in phosphate‐buffered saline (PBS) (5 mg/mL) was added to MSN cells for 1 h at 37°C in a 1:10 (v/v) ratio after incubation with lovastatin. The incubation medium was removed, and neurons were solubilized with isopropyl alcohol (0.8 mL). The absorbance of each sample was quantified using a spectrophotometer at 570 nm (Pharmacia Biotech, Piscataway, NJ, USA).

Cholesterol Measurement

The total cholesterol content of MSN cells or brain samples was quantified using the Amplex Red cholesterol assay (Molecular Probes, Eugene, OR, USA). Briefly, cells or tissues were homogenized in lysis buffer containing 50 mM Tris‐HCl pH 7.5, 150 mM NaCl, 1% Nonidet P40, 0.5% desoxicolate and protease inhibitors diluted in reaction buffer. An equivalent volume of Amplex Red working solution (300 μM Amplex Red, 2 U/mL cholesterol oxidase, 2 U/mL cholesterol esterase and 2 U/mL horseradish peroxidase) was added. The samples were incubated at 37°C for 30 min in the dark, and the absorbance was measured at 535 nm using a spectrophotometer (microplate reader, model 550; Bio‐Rad, Hercules, CA, USA). The cholesterol content was calculated by interpolating from a standard curve of cholesterol and then normalized with respect to the protein content from each sample. The concentration of cholesterol in the culture media was approximately 132.33 μM; for this reason, we had to remove the serum from the media to analyze the cholesterol‐lowering effect of lovastatin.

Cholesterol Labeling

MSN cells were grown on coverslips, washed twice in PBS for 5 min, and stained with filipin (Sigma‐Aldrich). This blue fluorescent probe was used to study the distribution of nonesterified cholesterol 53. The filipin stock solution (1 mM) was prepared in methanol. A working solution (20 mg/mL) was prepared by dissolving the stock solution in PBS. The working solution was applied to cells for 45 min at 37°C. MSN cells were then exposed to lovastatin (10 or 2 μM) for 5 days in normal and serum‐free conditions. Next, the cells were washed twice with PBS for 5 min and fixed in 4% paraformaldehyde for 20 min. The fixed cells were permeabilized with PBS/Triton 0.25% for 20 min, washed with PBS and then incubated with 500 μL of the filipin working solution. The cells were then washed three times in PBS and observed at 60× magnification on an inverted fluorescent microscope (Olympus IX71 375) using 360 nm excitation and collecting emissions at 460 nm.

Uptake of BODIPY‐FL‐LDL

To analyze the incorporation of LDL into cells, we used fluorescently labeled LDL. Cells were grown on coverslips in serum‐free medium and treated in the presence or absence of lovastatin (2 μM) for 12 h. Next, cells were incubated in fresh media containing 10 μg/mL of BODIPY‐FL‐LDL (Molecular Probes). After incubation at 37°C for 5 h, cells were washed with PBS and fixed in 1% paraformaldehyde. The uptake of BODIPY‐FL‐LDL (Ab 515 nm, Em 520 nm) was detected using a DSU confocal microscope at 60×. Consecutive z‐stacks (7‐9) were flattened into a single image using the ImageJ software (NIH, Bethesda, MD, USA).

Immunohistochemistry

Cells were grown on coverslips, washed twice with PBS for 5 min, fixed with 4% paraformaldehyde for 20 min and washed again with PBS. Cells were permeabilized with PBS containing 0.1% Triton X‐100 for 10 min at room temperature and left in blocking solution (PBS /BSA 5%) overnight at 4°C. These cells were incubated for 24 h at 4°C with mouse monoclonal anti‐HMGCR (1:100; Santa Cruz Biotechnology, Dallas, TX, USA) and washed three times for 5 min with PBS. Cells were then incubated in the dark with a secondary antibody Alexa Fluor‐546 (1:300; Molecular Probes) for 2 h at room temperature. Cells were also incubated with phalloidin for 20 min after which they were washed three times with PBS. Finally, cells were analyzed at 100× magnification. Images were obtained on an epifluorescence microscope (Zeiss Axioskop 40; Oberkochen, Germany). Negative controls were prepared by omitting the primary antibody.

Quantitative Real‐time Reverse Transcription‐PCR

The real‐time quantitative reverse transcription (qRT‐PCR) was used to quantitate mRNA levels for HMGCR (human), using β‐actin mRNA (human) to normalize the data. From 1 μg of RNA, cDNA was synthesized using the reverse transcriptase enzyme M‐MLV (Invitrogen, Carlsbad, CA, USA). With a few modifications, the cDNA was synthesized according to manufacturer's protocol: 150 ng/μL of random oligonucleotides, 7.5 ng/μL of oligonucleotide dT20, 10 mM of dNTPs, 0.1 M DTT and 100 units of M‐MLV were used in a final volume of 20 μL. The qRT‐PCR amplification was performed on a Rotor‐gene Q (Qiagen, Valencia, CA, USA) using the SYBR Greener qPCR SuperMix kit (Invitrogen). Each primer was at 200 nM in a final volume of 20 μL per reaction. The reaction parameters were as follows: incubation at 50°C for 2 min, activation at 95°C for 10 min, 40 cycles of denaturation at 95°C for 15 s, alignment with oligos for HMGCR and β‐actin at 60°C for 60 s, and a final elongation at 72°C for 2 min. Specificity of the amplified products was checked by analysis of melting curves.

The oligonucleotides used for human HMGCR were as follows: F 5′‐TACCATGTCAGGGGTACGTC‐3′ and 5′‐CAAGCCTAGAGACATAATCATC R‐3′ (247 bp). Oligonucleotides used for human β‐actin were as follows: 5′‐TGAAGGTGACAGCAGTCGGTTG F‐3′ and 5′‐R GGCTTTTAGGATGGCAAGGGAC‐3′ (146 bp). These were all synthesized by Sigma. Samples were run in triplicate, and the data were analyzed using the method described by Pfaffl, 2001 54.

In vivo Model of Lovastatin‐fed Rats

Male Sprague Dawley rats weighing 250 g (Harlan Laboratories, Facultad de Química, UNAM, México) were used in this study. All of the animals were maintained under a reverse light/dark cycle and a controlled room temperature (22°C) with free access to a standard rodent diet (Harlan Laboratories, Indianapolis, IN, USA) and tap water before experimentation. All animals were handled in accordance with local government rules, the Society for Neuroscience Guide for the Care and Use of Laboratory Animals and were approved by the Animal Care Committee of the Instituto de Investigaciones Biomédicas, UNAM. All efforts were made to minimize the suffering of animals and to reduce the number used.

The animals were divided into three groups: a control group, in which rats were fed a standard diet, and 2 experimental groups. In one experimental group, the animals were fed a high‐fat diet (HFD) containing 1% cholesterol (Bio‐Serv, Flemington, NJ, USA). The second experimental group was fed 0.04% lovastatin added to a standard diet per the instructions of Ness et al. 55 Rats were maintained on one of these three diets, with free access to water, for 5 days. After the treatment, all rats were decapitated during 4th hour of the dark cycle. Samples from the liver and the brain (including the cortex, hippocampus, and cerebellum) were quickly dissected. The fresh samples were dipped into PBS with protease inhibitors (Completetm, Roche, Basel SUI) and then stored at −70°C until analysis.

Measurement of Aβ

Aβ [1–42] and Aβ [1–40] levels in MSN cells were determined using an Aβ‐specific ELISA kit (Invitrogen). After being treated as previously described, the MSN cell culture medium was collected and analyzed. The Aβ concentration was determined by measuring optical densities at 450 nm on a spectrophotometer (microplate reader, model 550; Bio‐Rad).

The Aβ concentration in brain samples was determined using the same method as above, once protein was extracted from the tissue according the manufacturer's recommendations (Aβ [1–40] ELISA; Invitrogen). Tissues were weighed and homogenized in an 8× mass of cold 5 M guanidine HCl/50 mM Tris‐HCl buffer and then mixed at room temperature for 3 h. The homogenized samples were diluted (1:10) with cold BSAT‐DPBS buffer (Dulbecco's phosphate‐buffered saline with 5% BSA and 0.03% Tween‐20 supplemented with protease inhibitors) and centrifuged at 16,000 g for 20 min at 4°C. The supernatant was kept on ice and used to quantitate Aβ levels. All results were normalized by tissue mass and expressed as a level relative to the control values.

Immunoblotting

After experimental treatments, MSN cells or tissues were homogenated in lysis buffer. Protein samples were loaded onto a 10% SDS‐PAGE gel. After electrophoresis, the proteins were transferred to a nitrocellulose membrane. The membranes were blocked in PBS with 5% nonfat dry milk and then incubated for 2 h at room temperature. Next, the membranes were incubated overnight at 4°C with the following primary antibodies: mouse monoclonal antibody anti‐HMGCR (1:100, Santa Cruz Biotechnology), mouse monoclonal antibody anti‐SREBP‐2 (1:200; Chemicon, Temecula, CA, USA), mouse monoclonal antibody anti‐Alzheimer precursor protein A4 (22C11) (1:1000; Chemicon), and mouse monoclonal anti‐β‐actin (1:1000; Sigma‐Aldrich). Membranes were washed three times for 5 min each with PBS/0.1% Tween‐20 and then incubated at room temperature for 2 h with a horseradish peroxidase‐conjugated secondary antibody: goat anti‐mouse IgG (1:10,000–50,000; Santa Cruz Biotechnology). Membranes were washed three times (5–10 min each) with PBS/0.1% Tween 20 and the antibody signal was detected by chemiluminescence (ECL kit; EMD Millipore, Temecula, MA, USA) on Kodak film. Densitometric analysis of the immunoblot was carried out using ImageJ software (NIH). The results are expressed as arbitrary optic density units (ODU).

Statistical Analysis

Data are presented as means ± SEM. Statistical significance was determined by Student's t‐test. We used GraphPad Prism 6.0 (GraphPad Software, Bethesda, MD, CA, USA) for graphs and statistical analysis.

Results

Effect of Lovastatin on Cholesterol Levels and Neuronal Survival

To evaluate the effect of lovastatin on neuronal cholesterol levels, differentiated MSN cells were exposed to lovastatin for 24 h (data not shown), 48 h, and 5 days in the presence of 10% serum and in serum‐free conditions to avoid the presence of cholesterol in the media. Only after 5 days in the absence of serum was lovastatin (2 μM) able to reduce cellular cholesterol by approximately 40%, as measured by an enzymatic assay (Figure 1A) and visualized by histochemical filipin staining (Figure 1B). In the presence of 10% serum, lovastatin did not decrease cellular cholesterol levels (Figure 1A, B) because the neurons were able to take lipoproteins from the serum. This can be observed in Figure 1C, where cells were incubated with fluorescently labeled LDL (BODIPY‐FL‐LDL). In the serum‐free condition, lovastatin‐induced cell death was potentiated in a dose‐dependent manner (Figure 1D). However, as shown in Figure 1E, the extent of lovastatin‐dependent neuronal death for 10 μM lovastatin in media with 10% serum was similar to the death for 2 μM lovastatin in the serum‐free condition. To determine whether the neurotoxicity was dependent on lovastatin‐induced lowering of cholesterol, we examined neurotoxicity in the presence of 10% serum and with added cholesterol (25 μM) in the serum‐free condition. However, in any case, cell death was prevented by adding cholesterol (Figure 1E), suggesting that the toxicity might be associated with an additional pleiotropic mechanism mediated by the inhibition of downstream cholesterol metabolites produced as a result of HMGCR inhibition.

Figure 1.

Figure 1

Effects of lovastatin on cholesterol levels and cell viability. (A) Cholesterol content in MSN cells quantified by the Amplex Red cholesterol assay in whole‐cell lysates of neurons treated with 10 μM lovastatin (Lov) in medium with 10% serum (dark column) or 2 μM Lov in serum‐free conditions (gray column) for 5 days. Changes in cholesterol levels are expressed as the percent change compared to control cells incubated with 10% serum or serum free in the absence of Lov (dotted lines). Each bar represents the mean ± SEM of triplicate determinations of five to six experiments. (B) Fluorescent images and fluorescence intensity (arbitrary units) of filipin staining in differentiated MSN cells exposed to Lov (10 or 2 μM) for 5 days in medium with 10% serum (left panel) and without serum (right panel) show the reduced cholesterol contents when Lov was added in serum free condition at 2 μM. Images (60×) were analyzed using the ImageJ software. (C) The effect of Lov on LDL uptake in serum‐free medium. MSN cells were treated in the absence (Ctrl) or presence of Lov (2 μM) for 12 hours and incubated for an additional 5 hours at 37°C in the absence (Ctrl) or presence of Lov (2 μM) in media containing 10 μg/mL BODIPY‐FL‐LDL. LDL uptake was detected by confocal fluorescence microscopy at 60× magnification. Consecutive z‐stacks (7‐9) were flattened into a single image with bright field using the ImageJ software. (D) Cell viability at different concentrations of Lov. Cells were treated for 5 days with different concentrations (0.5–10 μM) of Lov (gray circles) in serum‐free conditions. Each point represents the mean ± SEM of three experiments performed in triplicate and is expressed as percent change with respect to control (dotted line). (E) The effects of Lov (10 or 2 μM) on mitochondrial redox activity in the absence or presence of cholesterol (25 μM) in medium with 10% serum (dark columns) and serum free (gray columns) at 2 or 5 days. The data were expressed as the percent of Ctrl values of each condition (dotted line). The mean ± SEM of three to four different experiments performed in triplicate is plotted. * P < 0.05 vs. Ctrl, ** P < 0.01 vs. Ctrl, a, b, c P < 0.05 vs. Lov (2 or 10 μM).

Lovastatin Induces Upregulation of HMGCR in MSN Cells

Next, we determined whether lovastatin affects the expression of neuronal HMGCR, the enzyme target of its inhibition, as has been observed in liver 55. Two HMGCR bands were identified in MSN cells, which correspond to the monomeric (~97 kDa) and the degraded (~55 kDa) forms. The degradation of HMGCR is a long‐term regulatory mechanism that is influenced not only by the concentration of sterols but also by the oligomeric state of the enzyme 56. Control MSN cells express HMGCR at very low levels, but lovastatin exposure resulted in a more than 3‐fold increase of HMGCR protein after 2 and 5 days of treatment. This increase corresponded to the degraded form in particular (Figure 2A, B). A 2‐fold increase in HMGCR mRNA was also observed (Figure 2C). The effects of lovastatin were also accompanied by an increase of the mature form (~50–68 kDa) of the transcription factor SREBP‐2 (Figure 2A). These results, which are similar to those reported in studies of the liver after statin exposure 55, suggest that HMGCR is a target of lovastatin‐mediated inhibition in neurons. Furthermore, its regulation may depend on nonsterol products derived from the cholesterol pathway because an increase in HMGCR was also observed in the presence of cholesterol in the culture media (data not shown).

Figure 2.

Figure 2

Lovastatin induces upregulation of HMGCR and SREBP‐2 activation in MSN cells. (A) Western blot for HMGCR and the mature form of SREBP‐2 in MSN cells after Lov (2 μM) treatment in serum‐free conditions during 2 days. For HMGCR levels 100 μg of protein from control cells and 25 μg of protein of Lov‐treated cells were loaded. The graphs show the densitometric analysis of HMGCR (two bands: ~97 and 55 kDa) and mature SREBP‐2 (60 and 65 kDa) levels in MSN cells. The results are normalized with loading control (β‐actin). Values are the mean ± SEM of 3 independent experiments. (B) Upper panel: Western blot for HMGCR in MSN cells after Lov (2 μM) treatment in serum‐free conditions during 5 days. The graph shows the densitometric analysis of HMGCR in MSN cells. The results are normalized with loading control (β‐actin). Values are the mean ± SEM of 3–6 independent experiments. Lower panel: HMGCR immunofluorescence after treatment with Lov (2 μM) in serum‐free medium during 5 days. Left panel: actin stained with phalloidin (green). Right panel: HMGCR, anti‐HMGCR (1:100) and Alexa Fluor‐546 (1:300, red). Images were acquired at 100×. (C) HMGCR mRNA expression. MSN cells were incubated in serum‐free medium with Lov (2 μM) (dark column) for 18 h. Each bar represents the mean ± SEM of triplicate determinations of four experiments. * P < 0.05 vs. Ctrl, ** P < 0.01 vs. Ctrl.

Systemic Administration of Lovastatin Does not Reduce Cholesterol Levels in the Brain

We decided to expand on the results obtained from cultured neurons by moving to an in vivo model. Rats were fed a diet containing high cholesterol (1%) or lovastatin (0.04%) for 5 days, and cholesterol levels were evaluated in the liver and in different regions of the brain. We expected the high‐cholesterol diet to cause an increase in hepatic cholesterol (42%) (Figure 3A). However, cholesterol levels in the brain remained unchanged in the cerebellum, cerebral cortex, and hippocampus (Figure 3B). As has been previously reported, basal cholesterol levels were significantly higher in the brain than in the liver. To determine whether lovastatin consumption has an impact on brain cholesterol, rats were fed with lovastatin for 5 days. While this resulted in a significant reduction (30%) in hepatic cholesterol levels, there was not a significant change in the cholesterol concentration of any brain region studied (Figure 3A, B).

Figure 3.

Figure 3

Determination of cholesterol concentration in liver and rat brain tissues. Rats were fed a regular diet (dark columns), HFD (gray columns), and 0.04% Lov (clear columns) for 5 days. Cholesterol concentration in (A) liver and (B) and brain tissues (Ctx, Cb and Hp) was determined using the Amplex Red cholesterol assay. The results are expressed as μmol of cholesterol after being normalized by protein content. The mean ± SEM of triplicate determinations of three experiments is plotted. * P < 0.05 vs. Ctrl.

Systemic Administration of Lovastatin Increases HMGCR and SREBP‐2 Levels in the Rat Brain

Because lovastatin induced a significant increase of HMGCR in differentiated neuroblastoma cells, we next investigated whether there was a similar regulation in vivo. Consistent with reports from Ness et al. 55, we found that rats fed 0.04% lovastatin for 5 days showed a marked increase in hepatic expression of HMGCR compared with rats fed a regular diet (Figure 4A). Although lovastatin did not change cholesterol levels in the brain, there was a significant increase in the HMGCR enzyme (Figure 4A). The administration of dietary cholesterol did not modify the levels of HMGCR in the liver or in the brain (Figure 4A). Together, these results demonstrate that in vivo, lovastatin exerts its regulatory effects in the brain at the level of HMGCR protein expression, without affecting cellular cholesterol levels. In addition to the effect of lovastatin on the expression of HMGCR, the mature form of SREBP‐2 was also increased, particularly in the liver, the cerebral cortex and the hippocampus (Figure 4B).

Figure 4.

Figure 4

Levels of HMGCR and mature SREBP‐2 in liver and rat brain tissues. (A) Western blots of HMGCR (~ 97 kDa) and (B) the mature form (~ 68 kDa) of SREBP‐2 in liver and brain (Ctx, Cb and Hp). Rats received a regular diet (dark columns), a HFD (gray columns), and 0.04% Lov (clear columns) for 5 days. The graphs represent changes in HMGCR and SREBP‐2 levels when normalized by a loading control (β‐actin) and compared to controls. The mean ± SEM of three experiments are depicted. * P < 0.05 vs. Ctrl. *** P < 0.001 vs. Ctrl.

Differential Effects of a HFD and Lovastatin on APP Levels and Aβ Production

Because statins have been proposed as alternative drugs for the treatment of AD due to the relationship between high cholesterol and Aβ production, we decided to investigate whether lovastatin regulates the level and metabolism of APP in vivo and in vitro. For the in vitro studies, differentiated human MSN cells expressing human APP695 were exposed to lovastatin 10 μM in the presence of serum or 2 μM in the serum‐free condition for 5 days. A significant increase was observed in APP levels in both conditions (Figure 5A). Unexpectedly, levels of secreted Aβ [1–42] and Aβ [1–40] were significantly reduced (11% and 27%, respectively) (Figure 5B). In contrast, rats fed with lovastatin for 5 days did not present elevated levels of APP or changes in Aβ [1–40] in either cerebral region (Figure 5D). Rats fed with a HFD displayed a significant increase in APP in the cerebral cortex and hippocampus (21% and 23%, respectively) (Figure 5C) as well as a significant increase (45%) in Aβ [1–40] in the cerebral cortex (Figure 5D).

Figure 5.

Figure 5

Differential effects of lovastatin on APP and Aβ levels in vivo and in vitro. Western blots of APP in MSN cells and in rat brains after Lov treatment. (A) MSN cells were treated with Lov 10 μM in 10% serum or 2 μM in serum‐free media for 5 days. The results were normalized with β‐actin. Graphs represent the densitometric analysis of APP levels. The mean ± SEM of three experiments is shown. (B) Aβ levels in culture medium after Lov treatment. Aβ [1–42] and Aβ [1–40] contents are represented as fold changes with respect to control cells. The mean ± SEM of three experiments in triplicate are plotted. (C) Western blot of APP levels in brain tissues (Ctx, Cb and Hp). Rats were fed with a regular diet (dark columns), HFD (gray columns), and Lov 0.04% (clear columns) for 5 days. The graphs represent changes in APP levels as compared with control. The results were normalized using a loading control (β‐actin) and presented as the mean ± SEM from three experiments. (D) Aβ levels in rat brain (Ctx, Cb and Hp). The results were normalized by tissue protein. * P < 0.05 vs. Ctrl, ** P < 0.01 vs. Ctrl.

Discussion

Although several lines of evidence support a relationship between high levels of circulating cholesterol and the risk of developing AD, the role of brain cholesterol in the expression of AD markers and the potential protective effects of statins remain unclear. We have demonstrated that a high‐cholesterol diet increases the expression of APP in vivo. Furthermore, a high‐cholesterol diet increases the expression of Aβ in vivo without affecting cholesterol levels in the brain.

In clinical situations, statins are widely used to lower plasmatic cholesterol. It has also been suggested that statins could be used for the prevention and treatment of AD due to their neuroprotective effects, including Aβ reduction 13, 30, 31, 32, antioxidant capacities 32, 33, and anti‐inflammatory effects, among others. However, the implications of lowering cholesterol levels and the pleiotropic effects of statins on the CNS are not well understood. Because cholesterol and its intermediate metabolites are crucial for normal brain function, statin therapy for AD is matter of debate. In fact, there have been reports of negative consequences from treatment with statins, such as adverse cognitive effects in animals 57, psychiatric manifestations in humans 58, impairment of neurotransmission 47, 59, 60, altered neuroplasticity 36, 38, 45, and even neurotoxicity 37, 42. This study demonstrates that prolonged exposure to lovastatin, over a range of doses, induces neuronal death in MSN cells. Lovastatin‐induced cell death occurred even with the addition of free cholesterol or LDL‐C, suggesting that the neurotoxicity may be attributed to the pleiotropic effects associated with statins 39, 40, 41, 42, 44. Consistent with our observations, other reports have shown that lovastatin only reduces cholesterol levels in serum‐free medium. This process is accompanied by the reduction of intermediates, such as FPP and GGPP, and the reduction of protein isoprenylation in cultured neurons 61, which may contribute to the observed toxic effects of lovastatin. Although lovastatin inhibits de novo cholesterol synthesis, we have confirmed that cellular cholesterol levels are maintained, at least in cultured neurons. This may be the result of lipoprotein uptake from cholesterol present in the serum. An interesting finding in this work was the presence of HMGCR in neurons and its remarkable upregulation induced by lovastatin. It is generally accepted that astrocytes are the cells that are mainly involved in cholesterol synthesis 62. Here, we demonstrated that neurons might also participate in cholesterol regulation in the brain and that statins may modify cholesterol metabolism in these cells. In vivo, 5 days of lovastatin treatment was sufficient to produce a remarkable reduction in hepatic cholesterol, although brain cholesterol was not affected, similar to the results obtained from cultured cells. There are multiple reasons that could explain why lovastatin did not have an effect on total brain cholesterol levels: for example, cholesterol in the brain has greater metabolic stability and a longer half‐life than cholesterol in peripheral organs 63. It is also possible that in this model, 5 days of lovastatin treatment is not sufficient to produce levels that completely inhibit HMGCR in the brain because lovastatin concentrations in CSF (0.9–1.4 ng/mL) 50 are lower than the IC50 for HMGCR inhibition in hepatocytes (2.7 ng/mL) 64. These differences suggest that there is only partial inhibition of HMGCR in the brain in our model. We do know that lovastatin entered the brain regions analyzed due to a notable increase in the expression of the HMGCR‐limiting enzyme as well as in the mature form of the transcription factor SREBP‐2. The upregulation of HMGCR protein we observed is similar to that reported for the liver of rats fed with the same diet (0.04% lovastatin); in these rats, cholesterol levels were effectively reduced 55. However, in this previous study, the authors found that reductase purified from the lovastatin‐fed rats had much lower specific activity 55. Interestingly, we observed that lovastatin exposure increased HMGCR protein levels and, paradoxically, also increased its degradation, which may indicate loss of the regulation of the enzyme by sterols or due to a mechanism unrelated to sterol concentration. In light of the fact that lovastatin inhibits synthesis of sterols and nonsterols, this result is in line with the widely held view that sterols regulate transcription and nonsterols act posttranscriptionally 65. The notable increase in HMGCR protein and mRNA may affect the production of other biologically active intermediates in the mevalonate pathway, possibly with negative consequences for neuronal function.

High levels of circulating cholesterol have been proposed to affect the production and accumulation of Aβ in the brain 10, 11, 12, 13, 29. Therefore, statins have been proposed as an alternate therapy for the treatment and prevention of AD. However, the role of cholesterol in the brain and the effects of statins on APP metabolism are not known. In this study, we showed that rats fed with a HFD presented increased cholesterol in the liver but not in the brain. Additionally, we observed an important rise in the production of APP in the hippocampus and cerebral cortex. However, this was accompanied by an increase in Aβ levels only in the cerebral cortex, indicating that the metabolic condition of the cortex makes it particularly sensitive to Aβ accumulation. This study is the first demonstration that only 5 days of a HFD is sufficient to change the expression and processing of APP without altering the accumulation of cholesterol in the brains of normal rats. Currently, there is no mechanistic explanation for this apparent paradox. High levels of serum cholesterol may induce vascular changes that alter BBB permeability to favor the access of reactive molecules, such as cytokines or reactive oxygen species, to the CNS 66. Consistent with our results, Ghribi et al. 67 reported that cholesterol‐induced Aβ and iron deposition was greater in the rabbit cortex than in the hippocampus and was associated with BBB disruption. Interestingly, the Aβ load in the cerebral cortex is an early indicator for patients with AD 68.

Previous studies have found that statins have anti‐amyloidogenic properties 13, 20, 28, 69. In this study, we demonstrated the differential effects of lovastatin treatment on the expression of APP and Aβ in vivo and in vitro. In cultured neurons, lovastatin‐mediated inhibition of HMGCR decreased Aβ secretion, consistent with the studies mentioned above. This effect was independent of the reduction in cholesterol, indicating an alternate mechanism is responsible for the effect of statins on APP metabolism. In contrast, in vivo lovastatin treatment produced a slight increase in APP without affecting Aβ production. It is possible that 5 days of lovastatin treatment was not sufficient to reach pharmacological doses that affect Aβ metabolism. However, the treatment was sufficient to produce a robust increase in molecules related to cholesterol metabolism, such as HMGCR and SREBP, in the cerebral cortex and in the hippocampus. Some studies have indicated that different metabolites of the mevalonate pathway (cholesterol and isoprenoids) have differential effects on APP expression and Aβ production. This finding would explain some of the apparent discrepancies between the in vivo and in vitro effects of lovastatin, depending on the doses reached in cells. For example, Ostrowski et al. 70 showed that the inhibition of protein isoprenylation by simvastatin and lovastatin in neuroblastoma cells causes the accumulation of APP through the inhibition of G proteins (Rho, Rac, Ras and Rab) that reduce APP C‐terminal fragments and Aβ secretion. These results, together with our findings, suggest that the in vivo effect of statins on APP are extremely complex because multiple molecules altered by the inhibition of HMGCR are affected by statin treatment in vitro and in vivo 30, 71, 72. Although we explored the short‐term effects of lovastatin on basal Aβ production, other studies have shown that long‐term administration of simvastatin is able to reduce levels of Aβ in transgenic mice that overproduce this peptide 73 and increases memory‐related protein levels and synaptic plasticity 74, 75. However, AD patients treated with simvastatin for 12 weeks did not exhibit changes in AD‐related markers and exhibited only a modest decrease in brain cholesterol metabolism 76. In conclusion, we demonstrated that lovastatin at the doses used, differentially affect the expression and production of APP and Aβ in vivo and in vitro. We showed that several of the effects of lovastatin‐induced HMGCR inhibition have detrimental implications for neuronal survival in vitro. These effects are independent of a statin‐induced reduction in cholesterol. In vivo, short‐term administration of lovastatin does not directly reduce cholesterol levels; instead, it affects the mevalonate pathway, as indicated by the increase in mature SREBP‐2 and upregulation of HMGCR we observed. These findings may help to elucidate some of the effects of lovastatin on cholesterol homeostasis in the brain and may provide additional evidence on the role of statins on APP expression and metabolism.

Disclosures

The authors declare no conflict of interest.

Acknowledgments

A. M‐O received a fellowship from CONACYT, México for her PhD in the program: Doctorado en Ciencias Bioquímicas, Instituto de Investigaciones Biomédicas, UNAM. This work also was supported by research grants from CONACYT, México 166482 and PAPIIT IN204212, UNAM.

References

  • 1. Ledesma MD, Dotti CG. Peripheral cholesterol, metabolic disorders and Alzheimer's disease. Front Biosci 2012;4:181–194. [DOI] [PubMed] [Google Scholar]
  • 2. Kalaria RN. Small vessel disease and Alzheimer's dementia: pathological considerations. Cerebrovasc Dis 2002;13(Suppl 2):48–52. [DOI] [PubMed] [Google Scholar]
  • 3. Vermeer SE, Koudstaal PJ, Oudkerk M, Hofman A, Breteler MM. Prevalence and risk factors of silent brain infarcts in the population‐based Rotterdam Scan Study. Stroke 2002;33:21–25. [DOI] [PubMed] [Google Scholar]
  • 4. Jarvik GP, Austin MA, Fabsitz RR, et al. Genetic influences on age‐related change in total cholesterol, low density lipoprotein‐cholesterol, and triglyceride levels: longitudinal apolipoprotein E genotype effects. Genet Epidemiol 1994;11:375–384. [DOI] [PubMed] [Google Scholar]
  • 5. Notkola IL, Sulkava R, Pekkanen J, et al. Serum total cholesterol, apolipoprotein E ε4 allele, and Alzheimer's disease. Neuroepidemiology 1998;17:14–20. [DOI] [PubMed] [Google Scholar]
  • 6. Hardy J, Selkoe DJ. The amyloid hypothesis of Alzheimer's disease: progress and problems on the road to therapeutics. Science 2002;297:353–356. [DOI] [PubMed] [Google Scholar]
  • 7. De Strooper B, Annaert W. Proteolytic processing and cell biological functions of the amyloid precursor protein. J Cell Sci 2000;113(Pt 11):1857–1870. [DOI] [PubMed] [Google Scholar]
  • 8. Glenner GG, Wong CW. Alzheimer's disease: initial report of the purification and characterization of a novel cerebrovascular amyloid protein. Biochem Biophys Res Commun 1984;120:885–890. [DOI] [PubMed] [Google Scholar]
  • 9. Vassar R, Bennett BD, Babu‐Khan S, et al. β‐secretase cleavage of Alzheimer's amyloid precursor protein by the transmembrane aspartic protease BACE. Science 1999;286:735–741. [DOI] [PubMed] [Google Scholar]
  • 10. Sparks DL, Scheff SW, Hunsaker JC 3rd, Liu H, Landers T, Gross DR. Induction of Alzheimer‐like β‐amyloid immunoreactivity in the brains of rabbits with dietary cholesterol. Exp Neurol 1994;126:88–94. [DOI] [PubMed] [Google Scholar]
  • 11. Refolo LM, Malester B, LaFrancois J, et al. Hypercholesterolemia accelerates the Alzheimer's amyloid pathology in a transgenic mouse model. Neurobiol Dis 2000;7:321–331. [DOI] [PubMed] [Google Scholar]
  • 12. Shie FS, Jin LW, Cook DG, Leverenz JB, LeBoeuf RC. Diet‐induced hypercholesterolemia enhances brain Aβ accumulation in transgenic mice. NeuroReport 2002;13:455–459. [DOI] [PubMed] [Google Scholar]
  • 13. Simons M, Keller P, De Strooper B, Beyreuther K, Dotti CG, Simons K. Cholesterol depletion inhibits the generation of β‐amyloid in hippocampal neurons. Proc Nat Acad Sci USA 1998;95:6460–6464. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Kalvodova L, Kahya N, Schwille P, et al. Lipids as modulators of proteolytic activity of BACE: involvement of cholesterol, glycosphingolipids, and anionic phospholipids in vitro . J Biol Chem 2005;280:36815–36823. [DOI] [PubMed] [Google Scholar]
  • 15. Mendoza‐Oliva A, Ferrera P, Arias C. Interplay between cholesterol and homocysteine in the exacerbation of amyloid‐beta toxicity in human neuroblastoma cells. CNS Neurol Disord Drug Target 2013;12:842–848. [DOI] [PubMed] [Google Scholar]
  • 16. Endo A. A historical perspective on the discovery of statins. Proc Jpn Acad Ser B Phys Biol Sci 2010;86:484–493. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Jick H, Zornberg GL, Jick SS, Seshadri S, Drachman DA. Statins and the risk of dementia. Lancet 2000;356:1627–1631. [DOI] [PubMed] [Google Scholar]
  • 18. Wolozin B, Kellman W, Ruosseau P, Celesia GG, Siegel G. Decreased prevalence of Alzheimer disease associated with 3‐hydroxy‐3‐methyglutaryl coenzyme A reductase inhibitors. Arch Neurol 2000;57:1439–1443. [DOI] [PubMed] [Google Scholar]
  • 19. Zamrini E, McGwin G, Roseman JM. Association between statin use and Alzheimer's disease. Neuroepidemiology 2004;23:94–98. [DOI] [PubMed] [Google Scholar]
  • 20. Fassbender K, Simons M, Bergmann C, et al. Simvastatin strongly reduces levels of Alzheimer's disease β‐amyloid peptides Aβ 42 and Aβ 40 in vitro and in vivo . Proc Nat Acad Sci USA 2001;98:5856–5861. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Scott H. Statins for the prevention of Alzheimer's disease. Cochrane Database Syst Rev 2001; CD003160. [DOI] [PubMed] [Google Scholar]
  • 22. McGuinness B. Can statins prevent or help treat Alzheimer's disease? J Alzheimers Dis 2010;20:925–933. [DOI] [PubMed] [Google Scholar]
  • 23. Butterfield D. Cholesterol‐independent neuroprotective and neurotoxic activities of statins: perspectives for statin use in Alzheimer disease and other age‐related neurodegenerative disorders. Pharmacol Res 2011;64:180–186. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Bosel J, Gandor F, Harms C, et al. Neuroprotective effects of atorvastatin against glutamate‐induced excitotoxicity in primary cortical neurones. J Neurochem 2005;92:1386–1398. [DOI] [PubMed] [Google Scholar]
  • 25. Bate C, Rumbold L, Williams A. Cholesterol synthesis inhibitors protect against platelet‐activating factor‐induced neuronal damage. J Neuroinflammation 2007;4:5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Evangelopoulos ME, Weis J, Kruttgen A. Mevastatin‐induced neurite outgrowth of neuroblastoma cells via activation of EGFR. J Neurosci Res 2009;87:2138–2144. [DOI] [PubMed] [Google Scholar]
  • 27. Pooler AM, Xi SC, Wurtman RJ. The 3‐hydroxy‐3‐methylglutaryl co‐enzyme A reductase inhibitor pravastatin enhances neurite outgrowth in hippocampal neurons. J Neurochem 2006;97:716–723. [DOI] [PubMed] [Google Scholar]
  • 28. Kojro E, Fuger P, Prinzen C, et al. Statins and the squalene synthase inhibitor zaragozic acid stimulate the non‐amyloidogenic pathway of amyloid‐β protein precursor processing by suppression of cholesterol synthesis. J Alzheimers Dis 2010;20:1215–1231. [DOI] [PubMed] [Google Scholar]
  • 29. Hoglund K, Thelen KM, Syversen S, et al. The effect of simvastatin treatment on the amyloid precursor protein and brain cholesterol metabolism in patients with Alzheimer's disease. Dement Geriatr Cogn Disord 2005;19:256–265. [DOI] [PubMed] [Google Scholar]
  • 30. Won JS, Im YB, Khan M, Contreras M, Singh AK, Singh I. Lovastatin inhibits amyloid precursor protein (APP) β‐cleavage through reduction of APP distribution in Lubrol WX extractable low density lipid rafts. J Neurochem 2008;105:1536–1549. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Hosaka A, Araki W, Oda A, Tomidokoro Y, Tamaoka A. Statins reduce amyloid β‐peptide production by modulating amyloid precursor protein maturation and phosphorylation through a cholesterol‐independent mechanism in cultured neurons. Neurochem Res 2013;38:589–600. [DOI] [PubMed] [Google Scholar]
  • 32. Barone E, Cenini G, Di Domenico F, et al. Long‐term high‐dose atorvastatin decreases brain oxidative and nitrosative stress in a preclinical model of Alzheimer disease: a novel mechanism of action. Pharmacol Res 2011;63:172–180. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Kurinami H, Sato N, Shinohara M, et al. Prevention of amyloid β‐induced memory impairment by fluvastatin, associated with the decrease in amyloid β accumulation and oxidative stress in amyloid β injection mouse model. Int J Mol Med 2008;21:531–537. [PubMed] [Google Scholar]
  • 34. Kurata T, Miyazaki K, Kozuki M, et al. Atorvastatin and pitavastatin reduce senile plaques and inflammatory responses in a mouse model of Alzheimer's disease. Neurol Res 2012;34:601–610. [DOI] [PubMed] [Google Scholar]
  • 35. Zhang YY, Fan YC, Wang M, Wang D, Li XH. Atorvastatin attenuates the production of IL‐1β, IL‐6, and TNF‐α in the hippocampus of an amyloid β1‐42‐induced rat model of Alzheimer's disease. Clin Interv Aging 2013;8:103–110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Vural K, Tuglu MI. Neurotoxic effect of statins on mouse neuroblastoma NB2a cell line. Eur Rev Med Pharmacol Sci 2011;15:985–991. [PubMed] [Google Scholar]
  • 37. Michikawa M, Yanagisawa K. Inhibition of cholesterol production but not of nonsterol isoprenoid products induces neuronal cell death. J Neurochem 1999;72:2278–2285. [DOI] [PubMed] [Google Scholar]
  • 38. Tanaka T, Tatsuno I, Uchida D, et al. Geranylgeranyl‐pyrophosphate, an isoprenoid of mevalonate cascade, is a critical compound for rat primary cultured cortical neurons to protect the cell death induced by 3‐hydroxy‐3‐methylglutaryl‐CoA reductase inhibition. J Neurosci 2000;20:2852–2859. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Garcia‐Roman N, Alvarez AM, Toro MJ, Montes A, Lorenzo MJ. Lovastatin induces apoptosis of spontaneously immortalized rat brain neuroblasts: involvement of nonsterol isoprenoid biosynthesis inhibition. Mol Cell Neurosci 2001;17:329–341. [DOI] [PubMed] [Google Scholar]
  • 40. Arnold DE, Gagne C, Niknejad N, McBurney MW, Dimitroulakos J. Lovastatin induces neuronal differentiation and apoptosis of embryonal carcinoma and neuroblastoma cells: enhanced differentiation and apoptosis in combination with dbcAMP. Mol Cell Biochem 2010;345:1–11. [DOI] [PubMed] [Google Scholar]
  • 41. Marcuzzi A, Tricarico PM, Piscianz E, Kleiner G, Vecchi Brumatti L, Crovella S. Lovastatin induces apoptosis through the mitochondrial pathway in an undifferentiated SH‐SY5Y neuroblastoma cell line. Cell Death Dis 2013;4:e585. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42. Ferrera P, Mercado‐Gomez O, Silva‐Aguilar M, Valverde M, Arias C. Cholesterol potentiates β‐amyloid‐induced toxicity in human neuroblastoma cells: involvement of oxidative stress. Neurochem Res 2008;33:1509–1517. [DOI] [PubMed] [Google Scholar]
  • 43. Fan QW, Yu W, Senda T, Yanagisawa K, Michikawa M. Cholesterol‐dependent modulation of tau phosphorylation in cultured neurons. J Neurochem 2002;76:391–400. [DOI] [PubMed] [Google Scholar]
  • 44. Meske V, Albert F, Richter D, Schwarze J, Ohm TG. Blockade of HMG‐CoA reductase activity causes changes in microtubule‐stabilizing protein tau via suppression of geranylgeranylpyrophosphate formation: implications for Alzheimer's disease. Eur J Neurosci 2003;17:93–102. [DOI] [PubMed] [Google Scholar]
  • 45. Schulz JG, Bosel J, Stoeckel M, Megow D, Dirnagl U, Endres M. HMG‐CoA reductase inhibition causes neurite loss by interfering with geranylgeranylpyrophosphate synthesis. J Neurochem 2004;89:24–32. [DOI] [PubMed] [Google Scholar]
  • 46. Kannan M, Steinert JR, Forsythe ID, Smith AG, Chernova T. Mevastatin accelerates loss of synaptic proteins and neurite degeneration in aging cortical neurons in a heme‐independent manner. Neurobiol Aging 2010;31:1543–1553. [DOI] [PubMed] [Google Scholar]
  • 47. Mailman T, Hariharan M, Karten B. Inhibition of neuronal cholesterol biosynthesis with lovastatin leads to impaired synaptic vesicle release even in the presence of lipoproteins or geranylgeraniol. J Neurochem 2011;119:1002–1015. [DOI] [PubMed] [Google Scholar]
  • 48. Mendoza‐Oliva A, Zepeda A, Arias C. The complex actions of statins in brain and their relevance for Alzheimer's disease treatment: an analytical review. Curr Alzheimer Res 2014;11:817–833. [PubMed] [Google Scholar]
  • 49. Wood WGLL, Müller WE, Eckert GP. Cholesterol as a causative factor in Alzheimer's disease: a debatable hypothesis. J Neurochem 2014;129:559–572. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50. Botti RE, Triscari J, Pan HY, Zayat J. Concentrations of pravastatin and lovastatin in cerebrospinal fluid in healthy subjects. Clin Neuropharmacol 1991;14:256–261. [DOI] [PubMed] [Google Scholar]
  • 51. Reynolds CP, Biedler JL, Spengler BA, et al. Characterization of human neuroblastoma cell lines established before and after therapy. J Natl Cancer Inst 1986;76:375–387. [PubMed] [Google Scholar]
  • 52. Mosmann T. Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. J Immunol Methods 1983;65:55–63. [DOI] [PubMed] [Google Scholar]
  • 53. Kruth HS. Localization of unesterified cholesterol in human atherosclerotic lesions. Demonstration of filipin‐positive, oil‐red‐O‐negative particles. Am J Pathol 1984;114:201–208. [PMC free article] [PubMed] [Google Scholar]
  • 54. Pfaffl MW. A new mathematical model for relative quantification in real‐time RT‐PCR. Nucleic Acids Res 2001;29:e45. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55. Ness GC, Eales S, Lopez D, Zhao Z. Regulation of 3‐hydroxy‐3‐methylglutaryl coenzyme A reductase gene expression by sterols and nonsterols in rat liver. Arch Biochem Biophys 1994;308:420–425. [DOI] [PubMed] [Google Scholar]
  • 56. Cheng HH, Xu L, Kumagai H, Simoni RD. Oligomerization state influences the degradation rate of 3‐hydroxy‐3‐methylglutaryl‐CoA reductase. J Biol Chem 1999;274:17171–17178. [DOI] [PubMed] [Google Scholar]
  • 57. Maggo S, Ashton JC. Effects of HMG‐CoA reductase inhibitors on learning and memory in the guinea pig. Eur J Pharmacol 2014;723:294–304. [DOI] [PubMed] [Google Scholar]
  • 58. Hyyppa MT, Kronholm E, Virtanen A, Leino A, Jula A. Does simvastatin affect mood and steroid hormone levels in hypercholesterolemic men? A randomized double‐blind trial Psychoneuroendocrinology 2003;28:181–194. [DOI] [PubMed] [Google Scholar]
  • 59. Matthies H Jr, Schulz S, Hollt V, Krug M. Inhibition by compactin demonstrates a requirement of isoprenoid metabolism for long‐term potentiation in rat hippocampal slices. Neuroscience 1997;79:341–346. [DOI] [PubMed] [Google Scholar]
  • 60. Linetti A, Fratangeli A, Taverna E, et al. Cholesterol reduction impairs exocytosis of synaptic vesicles. J Cell Sci 2010;123:595–605. [DOI] [PubMed] [Google Scholar]
  • 61. Hooff GP, Peters I, Wood WG, Muller WE, Eckert GP. Modulation of cholesterol, farnesylpyrophosphate, and geranylgeranylpyrophosphate in neuroblastoma SH‐SY5Y‐APP695 cells: impact on amyloid β‐protein production. Mol Neurobiol 2010;41:341–350. [DOI] [PubMed] [Google Scholar]
  • 62. Nieweg K, Schaller H, Pfrieger FW. Marked differences in cholesterol synthesis between neurons and glial cells from postnatal rats. J Neurochem 2009;109:125–134. [DOI] [PubMed] [Google Scholar]
  • 63. Dietschy JM, Turley SD. Cholesterol metabolism in the brain. Curr Opin Lipid 2001;12:105–112. [DOI] [PubMed] [Google Scholar]
  • 64. Haley RW, Dietschy JM. Is there a connection between the concentration of cholesterol circulating in plasma and the rate of neuritic plaque formation in Alzheimer disease? Arch Neurol 2000;57:1410–1412. [DOI] [PubMed] [Google Scholar]
  • 65. Goldstein JL, Brown MS. Regulation of the mevalonate pathway. Nature 1990;343:425–430. [DOI] [PubMed] [Google Scholar]
  • 66. Puig KL, Floden AM, Adhikari R, Golovko MY, Combs CK. Amyloid precursor protein and proinflammatory changes are regulated in brain and adipose tissue in a murine model of high fat diet‐induced obesity. PLoS ONE 2012;7:e30378. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67. Ghribi O, Golovko MY, Larsen B, Schrag M, Murphy EJ. Deposition of iron and β‐amyloid plaques is associated with cortical cellular damage in rabbits fed with long‐term cholesterol‐enriched diets. J Neurochem 2006;99:438–449. [DOI] [PubMed] [Google Scholar]
  • 68. Thal DR, Rub U, Orantes M, Braak H. Phases of Aβ‐deposition in the human brain and its relevance for the development of AD. Neurology 2002;58:1791–1800. [DOI] [PubMed] [Google Scholar]
  • 69. Murphy MP, Morales J, Beckett TL, et al. Changes in cognition and amyloid‐β processing with long term cholesterol reduction using atorvastatin in aged dogs. J Alzheimers Dis 2010;22:135–150. [DOI] [PubMed] [Google Scholar]
  • 70. Ostrowski SM, Wilkinson BL, Golde TE, Landreth G. Statins reduce amyloid‐β production through inhibition of protein isoprenylation. J Biol Chem 2007;282:26832–26844. [DOI] [PubMed] [Google Scholar]
  • 71. Cole SL, Vassar R. Isoprenoids and Alzheimer's disease: a complex relationship. Neurobiol Dis 2006;22:209–222. [DOI] [PubMed] [Google Scholar]
  • 72. Cole SL, Grudzien A, Manhart IO, Kelly BL, Oakley H, Vassar R. Statins cause intracellular accumulation of amyloid precursor protein, β‐secretase‐cleaved fragments, and amyloid β‐peptide via an isoprenoid‐dependent mechanism. J Biol Chem 2005;280:18755–18770. [DOI] [PubMed] [Google Scholar]
  • 73. Papadopoulos P, Tong XK, Hamel E. Selective benefits of simvastatin in bitransgenic APPSwe, Ind/TGF‐β1 mice. Neurobiol Aging 2014;35:203–212. [DOI] [PubMed] [Google Scholar]
  • 74. Tong XK, Lecrux C, Rosa‐Neto P, Hamel E. Age‐dependent rescue by simvastatin of Alzheimer's disease cerebrovascular and memory deficits. J Neurosci 2012;32:4705–4715. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 75. Métais C, Brennan K, Mably AJ, Scott M, Walsh DM, Herron CE. Simvastatin treatment preserves synaptic plasticity in AβPPswe/PS1dE9 mice. J Alzheimers Dis 2014;39:315–329. [DOI] [PubMed] [Google Scholar]
  • 76. Serrano‐Pozo A, Vega GL, Lutjohann D, et al. Effects of simvastatin on cholesterol metabolism and Alzheimer disease biomarkers. Alzheimer Dis Assoc Dis 2010;24:220–226. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from CNS Neuroscience & Therapeutics are provided here courtesy of Wiley

RESOURCES