Skip to main content
NCBI home page
Cell Proliferation logoLink to Cell Proliferation
. 2011 Mar 15;44(2):128–138. doi: 10.1111/j.1365-2184.2010.00735.x

Inhibition of metastasis‐associated gene 1 expression affects proliferation and osteogenic differentiation of immortalized human mesenchymal stem cells

A Kumar 1,2, B P Salimath 2, M Schieker 3, G B Stark 1, G Finkenzeller 1
PMCID: PMC6495325  PMID: 21401754

Abstract

Objectives:  MTA1 is known to be responsible for independent nucleosome remodelling and deacetylase complexes with ability to regulate divergent cellular pathways. However, additional biological functions have, up to now, remained largely unexplored. The present study was initiated to investigate involvement of MTA1 in osteogenic differentiation of immortalized human mesenchymal stem cells (MSCs).

Materials and methods:  MSCs were examined for expression of MTA1 and stably transfected clones expressing shRNA to MTA1 were generated. Cells were grown under osteogenic and non‐osteogenic conditions. Effects of silencing on cell proliferation, calcium deposition and alkaline phosphatase (ALP) activity were studied. mRNA expression of bone sialoprotein (BSP), osteopontin (OSP), runt‐related transcription factor 2 (Runx2), osteocalcin (OC), collagen type I (Col1A) and ALP were analysed.

Results:  Transfected cells showed reduction in proliferation and significant increase in calcium deposition and expression of osteogenic marker genes, BSP, OSP, Runx2, OC and Col1A, when they were grown under osteogenic conditions. Under non‐osteogenic conditions, expression of BSP and OSP were also markedly upregulated, whereas expression of osteogenic marker genes, Runx2, OC and Col1A, was almost unaffected. Expression of ALP was slightly suppressed under non‐osteogenic conditions but significantly increased under osteogenic differentiation conditions, as assessed by enzyme activity and mRNA expression assays.

Conclusions:  Our data collectively suggest that endogenously produced MTA1 constrains osteogenic differentiation of MSCs and that targeting of this molecule may provide a novel strategy for enhancing bone regeneration.

Introduction

With aging, bone mass tends to decrease, resulting in onset of many diseases associated with bone mass leakage. For example, osteoporosis, characterized by low bone mass and structural deterioration of bone tissue with increased susceptibility to fractures, is a major public health threat to elderly people (1, 2). Maintenance of stable bone mass during adult life, following rapid skeletal growth during childhood, is the result of carefully controlled balance between activities of bone forming (osteoblast) and bone resorbing (osteoclast) cells. Osteoblasts are derived from precursor mesenchymal stem cells (MSCs) that reside in the bone marrow and play key roles in bone homeostasis, because they actively proliferate, migrate and undergo osteogenic, chondrogenic or adipogenic differentiation in response to different stimuli (3, 4, 5). For example, bone morphogenic protein‐2 and ‐7, members of the TGF‐β superfamily, promote osteoblast differentiation (6, 7). Because of their pluripotency, MSCs have shown great potential in cell‐based therapies for regeneration of mesenchymal tissues (8, 9, 10, 11). Attractiveness of MSCs for therapeutic applications is further strengthened by the fact that these cells can be easily isolated and expanded from a variety of tissues, including adipose tissue (12), skin (13) and bone marrow (14, 15), thereby maintaining pluripotency after prolonged in vitro culture. MSCs are specially interesting in the context of bone tissue engineering applications because these progenitor cells can be easily differentiated into bone‐forming osteoblasts and promote osteogenesis upon implantation. However, studies have shown that MSCs undergo senescence‐associated growth arrest under current culture conditions, a phenomenon termed replicative senescence (16). Hence, several groups have tried to overcome this hurdle by introducing the gene that codes for human telomerase reverse transcriptase (hTERT) under the control of a constitutive promoter, into MSCs. In human MSCs, ectopic expression of hTERT has abolished senescence‐associated phenotype and maintained MSC function including unlimited proliferative capacity and ability to differentiate into multiple cell lineages in vitro and in vivo (17, 18, 19, 20, 21).

Nucleosome complexes formed by histone protein and associated DNA are the fundamental units of eukaryotic chromatin (22). Dynamic changes in chromatin architecture include several modifications of histone proteins such as acetylation, phosphorylation, ubiquitination and methylation, which are closely linked to regulation of eukaryotic gene expression (23, 24, 25). For instance, histone acetylation contributes to formation of a transcriptionally competent environment by relaxing chromatin structure and allowing general transcription factors to access target DNA sequences (26, 27). On the contrary, histone deacetylation makes chromatin structure compact and leads to transcriptional repression. Transcription activators are often associated with histone acetyltransferases (HATs) to increase target gene expression, whereas transcription repressors frequently interact with histone deacetylases (HDACs) to downregulate target gene expression (22, 28).

One family of chromatin modifiers that is ubiquitously expressed is that of metastasis‐associated proteins (MTA), which are integral parts of nucleosome remodelling and histone deacetylation (NuRD) complexes. MTA1, founding member of MTA family of genes, was originally identified through differential screening of a cDNA library from rat metastatic breast tumours (29). Subsequent studies indicated that the 80 kDa peptide, part of the NuRD, complex could enhance the aggressive course of several carcinomas by recruiting histone deacetylase and changing status of chromatin remodelling (30, 31). Besides strong correlation between MTA1 upregulation and cancer, growing evidence strongly suggests that MTA1 could regulate divergent cell pathways by modifying acetylation status of crucial target genes under both pathological and physiological statuses (32). For example, inactivation of MTA1 homologues egl‐27 and egr‐1 (also known as lin‐40) in Caenorhabditis elegans, leads to abnormal patterning of cells in the embryo, and forced overexpression of MTA1 in mouse mammary gland epithelium was accompanied by extensive ductal branching and proliferation in virgin glands, suggesting a role for MTA1 in both embryonic development and mammary gland development (33, 34). However, physiological characteristics of MTA1 have still been poorly addressed.

In skeletal biology, HDACs have been involved as negative regulators of chondrocyte hypertrophy by binding and inhibiting activity of runt‐related transcription factor 2 (Runx2) (35). Furthermore, binding of HDAC3 to Runx2 leads to inhibition of osteogenesis (36). In agreement with this, two groups have recently described that HDAC inhibitors stimulate mineralization phase of mouse MC3T3 and human MSCs (37, 38). Recently, functional consequence of HDAC1/2 and MTA1/2‐containing complex NODE (for Nanog and Oct4 associated deacetylase) on embryonic stem (ES) cell differentiation, has also been identified (39). As HDACs are important modulators of osteogenic differentiation of MSCs, we speculate that MTA1 has a certain distinct regulatory role in MSCs. Thus, the present study was initiated to investigate potential involvement of MTA1 in osteogenic differentiation of MSCs. MTA1 expression level was first explored in immortalized human MSCs and possible participation of MTA1 in MSC proliferation and osteogenic differentiation was examined. Our combined analysis sheds light on biological relevance of this newly characterized molecule.

Materials and methods

Cell culture

In this study, immortalized hTERT‐overexpressing human MSCs were used (18). Cells were cultured in alpha‐MEM medium (Gibco‐BRL, Eggenstein, Germany) supplemented with 10% foetal calf serum (FCS; Biochrom AG, Berlin, Germany), 50 μg/ml gentamicin (Sigma‐Aldrich, Deisenhofen, Germany) under 5% CO2 at 37 °C (non‐osteogenic conditions). For osteogenic differentiation, MSCs were cultured in osteogenic differentiation medium (DMEM supplemented with 10% FCS, 50 μg/ml gentamicin, 10 mmβ‐glycerolphosphate, 0.1 μm dexamethasone and 50 μm ascorbic acid) for up to 14 days, with media change three times a week.

Stable transfection and clone selection

pSilencer3.1‐MTA1‐short hairpin RNA (shRNA) and pSilencer3.1‐Scramble‐shRNA plasmids (40) were transfected into MSCs using Amaxa nucleofection kit (Lonza, Basel, Switzerland) and programme U‐023. Transfected cells were selected with 200 μg/ml of G418 (Sigma‐Aldrich). Stably transfected MSCs were allowed to proliferate under selection pressure. G418‐resistant monoclones were pooled together and amplified under non‐osteogenic conditions. At 90% confluence, MTA1 gene expression was verified by quantitative real‐time RT‐PCR and western blot analysis. Transfected clones were grown under both non‐osteogenic and osteogenic conditions and expression of MTA1 was studied by quantitative real‐time RT‐PCR at different time intervals.

Western blot analysis

Total protein was isolated from scramble shRNA and MTA1‐shRNA clones using lysis buffer (50 mm Tris–HCl, pH 7.4, 150 mm NaCl, 1 mm EDTA, 0.25% Na‐deoxycholate, 1% NP‐40, 1 mm phenylmethane sulphonylfluoride, 1 mm sodium orthovanadate, 1 μg/ml leupeptin, 1 μg/ml aprotinin and 1 μg/ml pepstatin). Equivalent amounts (20 μg) of protein were separated on 7.5% sodium dodecyl sulphate–polyacrylamide gel electrophoresis gels and subsequently transferred to Hybond enhanced chemiluminescence (ECL) nitrocellulose membranes. Membranes were probed with anti‐MTA1 antibodies (Santa Cruz Biotechnology, Santa Cruz, CA, USA). To confirm equal loading of gels, membranes were stripped and re‐probed with a monoclonal antibody against beta‐actin (Sigma). Visualization of protein bands was accomplished using ECL (GE Healthcare, Munich, Germany) and captured on Hyperfilm ECL (GE Healthcare).

Cell proliferation assay

Cells were seeded in six‐well plates (1.5 × 104 cells/well) in alpha‐MEM containing 10% FCS and 50 μg/ml gentamicin and incubated at 37 °C in humidified atmosphere of 5% CO2 for 21 days. Medium was changed three times a week. Cell counting was performed by CASY1 (Innovatis, Reutlingen, Germany) at indicated time points.

MTS assay

Effect of gene silencing of MTA1 on cell proliferation was examined by CellTiter 96 Aqueous one solution (Promega, Heidelberg, Germany) according to manufacturer’s instructions. Briefly, 1 × 104 cells were seeded in triplicate in 96‐well plates and incubated at 37 °C in 5% CO2 atmosphere for 24, 48 and 72 h. Twenty microlitres of MTS solution was added per well and plates were incubated for 2 h at 37 °C. Formazan synthesis in each well was measured by absorbance at 490 nm (SpectraFluorPlus; Tecan, Crailsheim, Germany).

Cytochemical staining

MSCs were seeded in 24‐well plates (6 × 104 cells/well) in osteogenic as well as in non‐osteogenic differentiation media and cultured for 14 days. Medium was changed three times per week. Mineral deposition was assessed by von Kossa staining after 14 days. Monolayers in 24‐well plates were washed in PBS and fixed in 4% formalin, then treated with 5% silver nitrate. After that, cells were exposed to UV light for 1 h, 5% thiosulphate was added and cells were placed at room temperature after washing step in distilled water. Mineral deposition was also assessed by staining in alizarin‐red after 14 days. Cells were washed once in PBS and fixed in phosphate‐buffered formalin for 20 min. Fixed cells were washed in PBS and subsequently stained in 1% alizarin‐red S (Sigma) dissolved in distilled water, for 15 min. Remaining dye was washed out with distilled water, and cells were washed once more and air‐dried. Images of stained cells were captured using a light microscope and appropriate image analysing software (Leica, Solms, Germany). Stained plates were photographed using a digital camera.

Calcium content assay

MSCs were seeded in 24‐well plates (6 × 104 cells/well) in osteogenic as well as in non‐osteogenic differentiation media and cultured for 14 days. Medium was changed three times per week and mineralized matrix was quantified by measuring the Ca2+‐levels. Calcium content assay was performed by dissolving crystals in 0.4 ml of 0.5 N acetic acid overnight, and quantifying them using a calcium assessment kit (BioAssay System, Hayward, CA, USA) according to manufacturer’s instructions. Calcium levels were normalized to total protein content using BCA protein assay kit (Thermo Scientific, Rockford, IL, USA).

Alkaline phosphatase enzyme activity assay

Experiments were performed in 12‐well (5 × 104 cells/well) plates as described previously (41). MSCs were seeded in osteogenic as well as in non‐osteogenic differentiation media and cultured for 3, 6, 9 and 14 days. Cell lysates were prepared with 300 μl assay buffer containing 25 mm Tris–HCl (pH 8.5) and 0.5% Triton X‐100. Twenty microlitres of each sample was mixed with 100 μl of CSPD substrate (Applied Biosystems, Foster City, CA, USA) and incubated at 37 °C for 30 min. Light output was measured as relative luminescence units (RLU) using a plate luminometer (SpectraFluorPlus; Tecan). Cell alkaline phosphatase (ALP) activities were normalized to total protein content using BCA protein assay kit (Thermo Scientific).

Quantitative real‐time RT‐PCR

TaqMan RT‐PCR was carried out as described previously (42). MSCs were seeded in six‐well plates (2 × 105 cells/well) in osteogenic and non‐osteogenic differentiation media, and total RNA was prepared at indicated time points, using RNeasy Mini Kit (Qiagen, Hilden, Germany) according to manufacturer’s instructions. Total RNA (3 μg) was treated with 3 U of deoxyribonuclease I (DNase I; Invitrogen, Karlsruhe, Germany) to digest genomic DNA contamination. Random‐primed cDNA synthesis was performed using 3 μg of DNase I‐treated total RNA and 1 μl of AffinityScript reverse transcriptase according to the manufacturer’s instructions (Stratagene, La Jolla, CA, USA). TaqMan PCR assays were performed in 384‐well optical plates on LightCycler (Roche, Mannheim, Germany) using Absolute QPCR ROX Mix (Abgene, Hamburg, Germany) according to manufacturer’s instructions. Oligonucleotide primers and probes for human GAPDH (GADPH forward: 5′‐TGGGCTACACTGAGCACCAG‐3′; GAPDH reverse: 5′‐CAGCGTCAAAGGTGGAGGAG‐3′, GAPDH probe: 5′‐FAM‐TCTCCTCTGACTTCAACAGCGACACCC‐TAMRA‐3′) and human osteocalcin (OC forward: 5′‐TGAGCTCAATCCGGACTGTG‐3′, OC reverse: 5′‐GCCGTAGAAGCGCCGATAG‐3′, OC probe: 5′‐FAM‐CGAGTTGGCTGACCACATCGGCTT‐TAMRA‐3′) were designed using Primer Express software (Applied Biosystems) according to company guidelines. Oligonucleotide primers and TaqMan probes for human MTA1 (cat.‐no.: Hs00183042_m1), ALP (cat.‐no.: Hs01029144_m1), Runx2 (cat.‐no.: Hs00231692_m1), osteopontin (OSP; cat.‐no.: Hs00959006_g1), collagen type I (Col1A; cat.‐no.: Hs01076765_g1) and bone sialoprotein (BSP; cat.‐no.: Hs00913377_m1) were purchased from Applied Biosystems. Thermal cycling conditions were 95 °C for 15 min followed by 50 cycles at 95 °C for 15 s and at 60 °C for 1 min. Data were analysed using the relative standard curve method, with each sample being normalized to GAPDH to correct for differences in RNA quality and quantity. Results from three independent experiments, performed in triplicates, are expressed as mean arbitrary units ± SD.

Statistical analysis

Statistically significant differences between groups were determined using an unpaired Student’s t‐test. Statistical significance was defined when P < 0.05.

Results

Silencing MTA1 gene in MSCs by shRNA transfection

To determine functional significance of MTA1 on osteogenic differentiation, endogenous expression was suppressed in MSCs using shRNA interference. MTA1‐shRNA and scrambled (SCR) shRNA containing plasmid pSilencer 3.1 was stably transfected into human immortalized MSCs. Transfected MSCs showed clear reduction in expression level of MTA1 compared to MSCs transfected with SCR, at RNA level in quantitative real‐time PCR under non‐osteogenic conditions (Fig. 1a). MTA1 protein level in MSCs expressing MTA1‐shRNA was also reduced in comparison to SCR‐shRNA‐transfected and wild‐type MSCs under non‐osteogenic conditions (Fig. 1b). To confirm effective gene silencing of MTA1, quantitative real‐time RT‐PCR under non‐osteogenic (Fig. 1c) and osteogenic conditions (Fig. 1d) was performed for indicated time periods. Results clearly show that silencing MTA1 gene expression was effectively maintained.

Figure 1.

Figure 1

Open in a new tab

  Silencing MTA1 by shRNA in immortalized MSCs. (a) Quantitative real‐time RT‐PCR of MSCs stably transfected with the scrambled (SCR)‐shRNA or MTA1‐shRNA under non‐osteogenic conditions. mRNA expression levels were normalized to GAPDH. Results are expressed as mean arbitrary units ± SD (n = 3). Asterisks represent statistically significant differences between the groups (***P < 0.0005). (b) Western blot analysis of wild‐type (wt) MSCs and MSCs stably transfected with SCR‐shRNA or MTA1‐shRNA under non‐osteogenic conditions. Cell proteins (20 μg/lane) were separated by 7.5% SDS–PAGE, blotted on nitrocellulose membranes and probed with an anti‐MTA1 antibody. Equal loading of the gel was confirmed by re‐probing the membrane with antibody to beta‐actin. (c) MTA1 expression levels were studied in transfected cells under non‐osteogenic conditions for indicated time periods by quantitative real‐time RT‐PCR. (d) MTA1 expression levels were studied in transfected cells under osteogenic conditions for indicated time periods by quantitative real‐time RT‐PCR. Results are expressed as mean arbitrary units ± SD (n = 3). Asterisks represent statistically significant differences between the groups (**P < 0.005, ***P < 0.0005).

Effect of MTA1 gene silencing on MSC proliferation

To investigate effects of MTA1 gene knockout on proliferation, MSCs were plated in non‐osteogenic growth medium containing 10% FCS. We observed drastic changes in cell proliferation of MTA1‐shRNA‐transfected MSCs, as shown in Fig. 2a. There was significant decrease in cell number of MTA1‐shRNA‐transfected MSCs (6.5 × 104 ± 0.37) in comparison to SCR‐shRNA‐transfected (75 × 104 ± 2.16) and wild‐type (91.3 × 104 ± 2.49) MSCs on day 21. In the context of the MTS cell proliferation assay, MTA1‐shRNA‐transfected MSCs (0.92 ± 0.02) also showed reduced proliferation rate in comparison to SCR‐shRNA‐transfected (1.6 ± 0.181) and wild‐type (1.8 ± 0.15) MSCs at 72 h (Fig. 2b).

Figure 2.

Figure 2

Open in a new tab

  Effect of MTA1 gene silencing on proliferation of MSCs. (a) Wild‐type (wt) MSCs and MSCs transfected with scrambled (SCR)‐shRNA or MTA1‐shRNA were plated in six‐well plates and incubated for indicated time periods in growth medium containing 10% FCS. Results shown are mean ± SD (n = 3). (b) MSCs (wild type and transfected) were seeded in 96‐well plates in growth medium for indicated time points. Proliferative activities were quantified by MTS assay. Result shown are mean ± SD (n = 3). Asterisks represent statistically significant differences between the groups (*P < 0.05; **P < 0.005, ***P < 0.0005).

Effect of MTA1 gene silencing on osteogenic differentiation of MSCs

To evaluate effects of MTA1 gene silencing on osteogenic differentiation, MSCs were grown either under osteogenic growth conditions or under non‐osteogenic differentiation medium, for 14 days. For assessment of mineralized‐matrix production, MSCs were stained with von Kossa’s stain (Fig. 3a) or alizarin‐red (Fig. 3b). In addition, extracellular Ca2+ was quantitatively measured by a Ca2+ assay (Fig. 4a,b). As expected, in all the three mineralization assays, mineralized‐matrix production was strongly increased on incubation of immortalized MSCs under osteogenic differentiation conditions. Results of staining indicated a significant increase in mineralized‐matrix production in MTA1‐shRNA‐transfected cells in comparison to wild‐type and SCR‐shRNA‐transfected MSCs, when grown under osteogenic differentiation conditions (Fig. 3a,b).

Figure 3.

Figure 3

Open in a new tab

  Effect of MTA1 gene silencing on mineralized‐matrix production of MSCs. MSCs (wild type and transfected) were seeded in 24‐well plates and grown either under osteogenic growth conditions or non‐osteogenic differentiation medium for 14 days. Medium was changed three times per week. Cells were stained with (a) von Kossa and (b) alizarin‐red reagents. Images of stained cells by different staining procedures were obtained by light microscopy at 100× magnification. Macroscopic images from stained plates were also photographed using a digital camera.

Figure 4.

Figure 4

Open in a new tab

  Effect of MTA1 gene silencing on extracellular Ca 2+ formation. Wild‐type (wt) MSCs and MSCs stably transfected with scrambled (SCR)‐shRNA or MTA1‐shRNA were seeded in 24‐well plates and grown either under (a) non‐osteogenic growth conditions or in (b) osteogenic differentiation medium for 14 days. At day 14, extracellular Ca2+ was measured using a Ca2+ assay kit. Measurement of Ca2+ was carried out in triplicate. Shown are mean ± SD (n = 3). Asterisks represent statistically significant differences between the groups (**P < 0.005, ***P < 0.0005).

Quantification of extracellular Ca2+ revealed moderate, but statistically significant, increase in Ca2+ deposition in MTA1‐shRNA‐transfected cells in comparison to mock‐transfected or wild‐type MSCs (Fig. 4a). However, this difference was much more pronounced when cells were grown under osteogenic differentiation conditions (Fig. 4b).

Results of ALP activity measurements of cell extracts showed that ALP activity was slightly suppressed by silencing MTA1 gene, when MSCs were grown under non‐osteogenic growth conditions (Fig. 5a). However, MTA1 silencing dramatically increased ALP activity in comparison to mock‐transfected or wild‐type MSCs, when MSCs were grown under osteogenic differentiation conditions (Fig. 5b).

Figure 5.

Figure 5

Open in a new tab

  Effect of MTA1 gene silencing on ALP activity. MSCs were seeded in 12‐well plates and grown either under (a) non‐osteogenic growth conditions or in (b) osteogenic differentiation medium for the indicated time periods. Medium was changed three times per week. ALP activity was then measured in cell lysates. Shown are mean ± SD (n = 3). Asterisks represent statistically significant differences between the groups (*P < 0.05; **P < 0.005; ***P < 0.0005).

Effect of MTA1 gene silencing on osteogenic marker gene expression

We next investigated effects of MTA1 gene silencing on expression of osteogenic marker genes, ALP, OC, Runx2, OSP, Col1A and BSP, by quantitative real‐time RT‐PCR. MSCs were grown under non‐osteogenic (Fig. 6) and osteogenic growth conditions (Fig. 7) for indicated time periods. Results show that BSP mRNA expression was dramatically enhanced on MTA1 silencing day 1(3.5‐fold), day 7 (67.7‐fold) and day 14 (13.6‐fold) in MSCs grown under non‐osteogenic growth conditions (Fig. 6a) and at day 1 (3.2‐fold), day 7 (24‐fold) and day 14 (10.5‐fold) under osteogenic differentiation conditions (Fig. 7a). Similarly, OSP mRNA expression was upregulated on MTA1 silencing in cells grown under non‐osteogenic conditions (Fig. 6b) at day 1 (6.6‐fold), day 7 (12.3‐fold) and day 14 (16.21‐fold) as well as in osteogenic differentiation medium (Fig. 7b) on day 1 (9.35‐fold), day 7 (21.37‐fold) and day 14 (16.5‐fold). mRNA expression of Runx2, OC and Col1A also increased 1.8‐, 1.74‐ and 1.6‐fold, respectively, on day 14 on MTA1 gene silencing in MSCs grown under osteogenic differentiation conditions (Fig. 7c–e), but expression of these genes remained almost unaffected in cells grown under non‐osteogenic conditions (Fig. 6c–e). In accordance with ALP activity measurements, ALP mRNA expression was slightly suppressed in cells grown under non‐osteogenic conditions (Fig. 6f). However, ALP mRNA expression was significantly increased on MTA1 gene silencing on day 7 (2.1‐fold) and day 14 (3.77‐fold) when MSCs were grown in osteogenic differentiation medium (Fig. 7f).

Figure 6.

Figure 6

Open in a new tab

  Effect of MTA1 gene silencing on osteogenic marker gene expression under non‐osteogenic conditions assessed by quantitative real‐time RT‐PCR. Scrambled (SCR)‐shRNA‐ and MTA1‐shRNA‐transfected MSCs were seeded in six‐well plates and grown under non‐osteogenic growth conditions for the indicated time periods. Total RNA was extracted and measured by real‐time RT‐PCR for (a) bone sialoprotein (BSP), (b) osteopontin (OSP), (c) Runx2, (d) osteocalcin (OC), (e) collagen type I (Col1A) and (f) alkaline phosphatase (ALP) mRNA expression. mRNA expression levels were normalized to GAPDH. Results are expressed as mean arbitrary units ± SD (n = 3). Asterisks represent statistically significant differences between the groups (*P < 0.05; **P < 0.005; ***P < 0.0005).

Figure 7.

Figure 7

Open in a new tab

  Effect of MTA1 gene silencing on osteogenic marker gene expression under osteogenic differentiation conditions assessed by quantitative real‐time RT‐PCR. Scrambled (SCR)‐shRNA‐ and MTA1‐shRNA‐transfected MSCs were seeded in six‐well plates and grown under osteogenic growth conditions for indicated time periods. Total RNA was extracted and measured by real‐time RT‐PCR for (a) bone sialoprotein (BSP), (b) osteopontin (OSP), (c) Runx2, (d) osteocalcin (OC), (e) collagen type I (Col1A) and (f) alkaline phosphatase (ALP) mRNA expression. mRNA expression levels were normalized to GAPDH. Results are expressed as mean arbitrary units ± SD (n = 3). Asterisks represent statistically significant differences between the groups (*P < 0.05; **P < 0.005; ***P < 0.0005).

Discussion

MTA1 is an integral subunit of the Mi‐2/NuRD complex. As the latter contains both histone deacetylase and chromatin remodelling ATPase activities, it is thought that such complexes are involved in hypoacetylation of core histones and that HDAC‐containing complexes participate in transcriptional repression. To date, most direct targets of MTA1 identified are nuclear proteins such as ER‐α, HDAC1, MTA1‐interacting coactivator (MICoA) and nuclear receptor‐interacting factor 3 (NRIF3) (31). All together, studies have demonstrated that MTA1 gene regulates divergent cellular pathways including hormonal action, epithelial‐to‐mesenchymal transitions, differentiation, protein stability and development, and cell fate programmes, by modifying the acetylation status of crucial target genes (32). However, the role of the MTA family of chromatin modifiers in controlling cell and physiological functions of mesenchymal stem cells, particularly in the context of osteogenesis, has not been studied. Here, we have demonstrated that downregulation of MTA1 expression affects osteogenic differentiation of immortalized MSCs.

There are several reports that show that HDACs act as regulators in bone formation. HDAC4 or HDAC5 is involved in TGF‐β/Sma‐ and Mad‐related protein (Smad) 3‐mediated repression of Runx2 function in osteogenesis and mineralization (43). HDAC represses activity of Runx2, and overexpression of HDAC4 in chondrocytes in vivo inhibits chondrocyte hypertrophy and differentiation, indicating that HDAC4 would act as a key regulator of endochondral bone formation (36). In this context, it is tempting to presume that MTA1 should regulate osteogenic marker genes by inducing histone deacetylation.

To investigate the role of MTA1 in osteogenic differentiation of MSCs, we established MSCs stably expressing shRNA to MTA1. MSCs were grown under non‐osteogenic differentiation conditions as well as in osteogenic differentiation medium, containing classical inducers of osteogenesis: β‐glycerolphosphate, dexamethasone and ascorbic acid. Silencing MTA1 was effectively maintained in MSCs for indicated time periods under both growth conditions. We have been able to show that silencing MTA1 strongly suppressed proliferation of MSCs. This result is in agreement with findings from other groups (35, 44), demonstrating the critical importance of this coregulator for the proliferative response of immortalized MSCs. We have seen in our study that as expected, mineralized‐matrix production was dramatically increased on culture of MSCs in osteogenic differentiation medium in comparison with non‐osteogenic conditions, demonstrating the principal osteoblastic differentiation capacity of immortalized MSCs used in our experiments. Suppression of MTA1 by RNA interference in MSCs caused strong upregulation of OSP and BSP and consequently accelerated late‐stage events in osteoblast differentiation, namely calcium deposition in the mineralized matrix. Mineralized‐matrix production, as evaluated by von Kossa and alizarin‐red staining procedures or by quantitative measurement of Ca2+‐levels, was significantly increased on MTA1 gene silencing in MSCs grown under osteogenic differentiation conditions. Likewise, expression of all investigated osteogenic marker genes increased on MTA1 gene silencing in MSCs grown under osteogenic differentiation conditions. Strong upregulation of OSP and BSP on MTA1 silencing was also observed in MSCs grown under non‐osteogenic conditions, whereas mRNA expression of Runx2, OC, Col 1A and ALP remained almost unaffected under these conditions.

Our results indicate that osteogenic differentiation potential of MSCs was drastically enhanced by MTA1 gene silencing when MSCs were commited to the osteoblastic lineage by treatment with classical osteogenic inducers, β‐glycerolphosphate, dexamethasone and asorbic acid. Our findings are in line with results of Liang et al., who show that knockdown of MTA1 induces ES cell differentiation (39). They also showed that MTA1‐RNAi cells have much lower ALP activity during the early stage of differentiation, consistent with our findings. These data suggest that MTA1 may have a crucial role in MSC self‐renewal or inhibition of differentiation.

Although histone modifications play crucial roles in transcriptional regulation of most eukaryotic genes, the relationship between specific cell type differentiation and histone modifications has not been completely understood. Overall, data presented in this study indicate that MTA1 is involved in immortalized MSC proliferation, and transcriptional repression of osteoblastic marker genes. Therefore, exact underlying mechanisms of the role of MTA1 in osteogenic differentiation is an area of great interest. As MTA1 suppression enhances osteoblast differentiation, it would be possible to develop tissue‐selective MTA1 inhibitors for potential remedy of bone‐related diseases, including osteoporosis.

Acknowledgements

We thank Beate vom Hoevel for excellent technical assistance and Dr Chen Lin for providing the pSilencer3.1‐MTA1‐shRNA and pSilencer3.1‐Scramble‐shRNA plasmids. This study was supported by funding through the DAAD (A/07/72092), the Department of Biotechnology, New Delhi (BT/PR/1026/Med/30/123/2008) and the Deutsche Forschungsgemeinschaft (FI790/2‐1).

References

  • 1. Pei L, Tontonoz P (2004) Fat’s loss is bone’s gain. J. Clin. Invest. 113, 805–806. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Katagiri T, Takahasi N (2002) Regulatory mechanism of osteoblast and osteoclast differentiation. Oral Dis. 8, 147–159. [DOI] [PubMed] [Google Scholar]
  • 3. Wagers AJ, Weissman IL (2004) Plasticity of adult stem cells. Cell 116, 639–648. [DOI] [PubMed] [Google Scholar]
  • 4. Caplan AI, Bruder SP (2001) Mesenchymal stem cells: building blocks for molecular medicine in the 21st century. Trends Mol. Med. 7, 259–264. [DOI] [PubMed] [Google Scholar]
  • 5. Pittenger MF, Mackay AM, Beck SC, Jaiswal RK, Douglas R, Mosca JD et al. (1999) Multilineage potential of adult human mesenchymal stem cells. Science 284, 143–147. [DOI] [PubMed] [Google Scholar]
  • 6. Roelen BA, Dijke P (2003) Controlling mesenchymal stem cells differentiation by TGFβ family members. J. Orthop. Sci. 8, 740–748. [DOI] [PubMed] [Google Scholar]
  • 7. Shea CM, Edgar CM, Einhorn TA, Gerstenfeld LC (2003) BMP treatment of C3H10T1/2 mesenchymal stem cells induces both chondrogenesis and osteogenesis. J. Cell. Biochem. 90, 1112–1127. [DOI] [PubMed] [Google Scholar]
  • 8. Lazarus HM, Haynesworth SE, Gerson SL, Rosenthal NS, Caplan AI (1995) Ex vivo expansion and subsequent infusion of human bone marrow‐derived stromal progenitor cells (mesenchymal progenitor cells): implications for therapeutic use. Bone Marrow Transplant. 16, 557–564. [PubMed] [Google Scholar]
  • 9. Mooney DJ, Mikos AG (1999) Growing new organs. Sci. Am. 280, 60–65. [DOI] [PubMed] [Google Scholar]
  • 10. Bruder SP, Jaiswal N, Haynesworth SE (1997) Growth kinetics, self‐renewal, and the osteogenic potential of purified human mesenchymal stem cells during extensive subcultivation and following cryopreservation. J. Cell. Biochem. 64, 278–294. [DOI] [PubMed] [Google Scholar]
  • 11. Datta N, Holtorf HL, Sikavitsas VI, Jansen JA, Mikos AG (2005) Effect of bone extracellular matrix synthesized in vitro on the osteoblastic differentiation of marrow stromal cells. Biomaterials 26, 971–977. [DOI] [PubMed] [Google Scholar]
  • 12. Nakagami H, Morishita R, Maeda K, Kikuchi Y, Ogihara T, Kaneda Y (2006) Adipose tissue‐derived stromal cells as a novel option for regenerative cell therapy. J. Atheroscler. Thromb. 13, 77–81. [DOI] [PubMed] [Google Scholar]
  • 13. Chunmeng S, Tianmin C (2004) Skin: a promising reservoir for adult stem cell populations. Med. Hypotheses 62, 683–688. [DOI] [PubMed] [Google Scholar]
  • 14. Lee RH, Kim B, Choi I, Kim H, Choi HS, Suh K et al. (2004) Characterization and expression analysis of mesenchymal stem cells from human bone marrow and adipose tissue. Cell. Physiol. Biochem. 14, 311–324. [DOI] [PubMed] [Google Scholar]
  • 15. Conget PA, Minguell JJ (1999) Phenotypical and functional properties of human bone marrow mesenchymal progenitor cells. J. Cell. Physiol. 181, 67–73. [DOI] [PubMed] [Google Scholar]
  • 16. Stenderup K, Justesen J, Clausen C, Kassem M (2003) Aging is associated with decreased maximal life span and accelerated senescence of bone marrow stromal cells. Bone 33, 919–926. [DOI] [PubMed] [Google Scholar]
  • 17. Simonsen JL, Rosada C, Serakinci N, Justesen J, Stenderup K, Rattan SI et al. (2002) Telomerase expression extends the proliferative lifespan and maintains the osteogenic potential of human bone marrow stromal cells. Nat. Biotechnol. 20, 592–596. [DOI] [PubMed] [Google Scholar]
  • 18. Böker W, Yin Z, Drosse I, Haasters F, Rossmann O, Wierer M et al. (2008) Introducing a single‐cell‐derived Human mesenchymal stem cell line expressing hTERT after lentiviral gene transfer. J. Cell. Mol. Med. 12, 1347–1359. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Jun ES, Lee TH, Cho HH, Suh SY, Jung JS (2004) Expression of telomerase extends longevity and enhances differentiation in human adipose tissue‐derived stromal cells. Cell. Physiol. Biochem. 14, 261–268. [DOI] [PubMed] [Google Scholar]
  • 20. Mihara K, Imai C, Coustan‐Smith E, Dome JS, Dominici M, Vanin E et al. (2003) Development and functional characterization of human bone marrow mesenchymal cells immortalized by enforced expression of telomerase. Br. J. Haematol. 120, 846–849. [DOI] [PubMed] [Google Scholar]
  • 21. Shi S, Gronthos S, Chen S, Reddi A, Counter CM, Robey PG et al. (2002) Bone formation by human postnatal bone marrow stromal stem cells is enhanced by telomerase expression. Nat. Biotechnol. 20, 587–591. [DOI] [PubMed] [Google Scholar]
  • 22. Hassig CA, Schreiber SL (1997) Nuclear histone acetylases and deacetylases and transcriptional regulation: HATs off to HDACs. Curr. Opin. Chem. Biol. 1, 300–308. [DOI] [PubMed] [Google Scholar]
  • 23. Rice JC, Allis CD (2001) Histone methylation versus histone acetylation: new insights into epigenetic regulation. Curr. Opin. Cell Biol. 13, 263–273. [DOI] [PubMed] [Google Scholar]
  • 24. Wu J, Grunstein M (2000) 25 years after the nucleosome model: chromatin modifications. Trends Biochem. Sci. 25, 619–623. [DOI] [PubMed] [Google Scholar]
  • 25. Carrozza MJ, Utley RT, Workman JL, Cote J (2003) The diverse functions of histone acetyltransferase complexes. Trends Genet. 19, 321–329. [DOI] [PubMed] [Google Scholar]
  • 26. Cheung WL, Briggs SD, Allis CD (2000) Acetylation and chromosomal functions. Curr. Opin. Cell Biol. 12, 326–333. [DOI] [PubMed] [Google Scholar]
  • 27. Blair HC, Zaidi M, Schlesinger PH (2002) Mechanisms balancing skeletal matrix synthesis and degradation. Biochem. J. 364, 329–341. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Ng HH, Bird A (2000) Histone deacetylases: silencers for hire. Trends Biochem. Sci. 25, 121–126. [DOI] [PubMed] [Google Scholar]
  • 29. Toh Y, Pencil SD, Nicolson GL (1994) A novel candidate metastasis‐associated gene, mta1, differentially expressed in highly metastatic mammary adenocarcinoma cell lines. cDNA cloning, expression, and protein analyses. J. Biol. Chem. 269, 22958–22963. [PubMed] [Google Scholar]
  • 30. Manavathi B, Singh K, Kumar R (2007) MTA family of coregulators in nuclear receptor biology and pathology. Nucl. Recept. Signal. 5, e010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Manavathi B, Kumar R (2007) Metastasis tumor antigens, an emerging family of multifaceted master coregulators. J. Biol. Chem. 282, 1529–1533. [DOI] [PubMed] [Google Scholar]
  • 32. Kumar R, Wang RA, Bagheri‐Yarmand R (2003) Emerging roles of MTA family members in human cancers. Semin. Oncol. 30, 30–37. [DOI] [PubMed] [Google Scholar]
  • 33. Solari F, Bateman A, Ahringer J (1999) The Caenorhabditis elegans genes egl‐27 and egr‐1 are similar to MTA1, a member of a chromatin regulatory complex, and are redundantly required for embryonic patterning. Development 126, 2483–2494. [DOI] [PubMed] [Google Scholar]
  • 34. Bagheri‐Yarmand R, Talukder AH, Wang RA, Vadlamudi RK, Kumar R (2004) Metastasis associated protein 1 deregulation causes inappropriate mammary gland development and tumorigenesis. Development 131, 3469–3479. [DOI] [PubMed] [Google Scholar]
  • 35. Vega RB, Matsuda K, Oh J, Barbosa AC, Yang X, Meadows E et al. (2004) Histone deacetylase 4 controls chondrocyte hypertrophy during skeletogenesis. Cell 119, 555–566. [DOI] [PubMed] [Google Scholar]
  • 36. Schroeder TM, Kahler RA, Li X, Westendorf JJ (2004) Histone deacetylase 3 interacts with runx2 to repress the osteocalcin promoter and regulate osteoblast differentiation. J. Biol. Chem. 279, 41998–42007. [DOI] [PubMed] [Google Scholar]
  • 37. Schroeder TM, Westendorf JJ (2005) Histone deacetylase inhibitors promote osteoblast maturation. J. Bone Miner. Res. 20, 2254–2263. [DOI] [PubMed] [Google Scholar]
  • 38. Cho HH, Park HT, Kim YJ, Bae YC, Suh KT, Jung JS (2005) Induction of osteogenic differentiation of human mesenchymal stem cells by histone deacetylase inhibitors. J. Cell. Biochem. 96, 533–542. [DOI] [PubMed] [Google Scholar]
  • 39. Liang J, Wan M, Zhang Y, Gu P, Xin H, Jung SY et al. (2008) Nanog and Oct4 associate with unique transcriptional repression complexes in embryonic stem cells. Nat. Cell Biol. 10, 731–739. [DOI] [PubMed] [Google Scholar]
  • 40. Qian H, Yu J, Li Y, Wang H, Song C, Zhang X et al. (2007) RNA interference of metastasis‐associated gene 1 inhibits metastasis of B16F10 melanoma cells in a C57BL/6 mouse model. Biol. Cell 99, 573–581. [DOI] [PubMed] [Google Scholar]
  • 41. Blum JS, Li RH, Mikos AG, Barry MA (2001) An optimized method for the chemiluminescent detection of alkaline phosphatase levels during osteodifferentiation by bone morphogenetic protein 2. J. Cell. Biochem. 80, 532–537. [DOI] [PubMed] [Google Scholar]
  • 42. Medhurst AD, Harrison DC, Read SJ, Campbell CA, Robbins MJ, Pangalos MN (2000) The use of TaqMan RT‐PCR assays for semiquantitative analysis of gene expression in CNS tissues and disease models. J. Neurosci. Methods 98, 9–20. [DOI] [PubMed] [Google Scholar]
  • 43. Kang JS, Alliston T, Delston R, Derynck R (2005) Repression of Runx2 function by TGF‐β through recruitment of class II histone deacetylases by Smad3. EMBO J. 24, 2543–2555. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44. Nawa A, Nishimori K, Lin P, Maki Y, Moue K, Sawada H et al. (2000) Tumor metastasis‐associated human MTA1 gene: its deduced protein sequence, localization, and association with breast cancer cell proliferation using antisense phosphorothioate oligonucleotides. J. Cell. Biochem. 79, 202–212. [PubMed] [Google Scholar]

Articles from Cell Proliferation are provided here courtesy of Wiley

RESOURCES