Skip to main content
CNS Neuroscience & Therapeutics logoLink to CNS Neuroscience & Therapeutics
. 2015 Jul 14;21(8):619–625. doi: 10.1111/cns.12430

Association between Polymorphisms of the AKT1 Gene Promoter and Risk of the Alzheimer's Disease in a Chinese Han Population with Type 2 Diabetes

Sheng‐Yuan Liu 1,2, He‐Dan Zhao 3, Jin‐Long Wang 3, Tong Huang 4, Hua‐Wei Tian 5, Li‐Fen Yao 6, Hua Tao 1, Zhong‐Wei Chen 2, Chang‐Yi Wang 2, Si‐Tong Sheng 7, Hua Li 8, Bin Zhao 9,✉, Ke‐Shen Li 1,✉
PMCID: PMC6495330  PMID: 26178916

Summary

Aims

Alzheimer's disease (AD) is a multifactor disease that has been reported to have a close association with type 2 diabetes (T2D) where the v‐akt murine thymoma viral oncogene homolog 1 (AKT1) plays an important role in the protein synthesis pathways and cell apoptosis processes. Evidence has been shown that AKT1 protein may be related to AD risk among patients with T2D. The aim of this study was to analyze the potential association between single nucleotide polymorphisms of AKT1 promoter and the risk of AD among patients with T2D.

Methods

The association between AKT1 polymorphisms and AD risk in patients with T2D was assessed among 574 consecutive unrelated subjects including 112 AD patients with T2D, 231 patients with AD, and 231 healthy controls in a case–control study. The cognitive function of all subjects was assessed using MMSE. Six single nucleotide polymorphisms with minor allele frequency >0.2 (rs2498786, rs74090038, rs2494750, rs2494751, rs5811155, and rs2494752) in AKT1 promoter were analyzed by polymerase chain reaction (PCR), and the concentration of AKT1 protein in serum was tested using enzyme‐linked immunosorbent assay (ELISA).

Results

Overall, there was statistically significant difference in AKT1 rs2498786 polymorphism. The CC frequency of AKT1 rs2498786 polymorphism in AD with T2D group and AD control group was significantly higher than that in healthy control group (P AD+T2D vs. health < 0.0001, P AD vs. health < 0.0001). However, the difference was not found between AD with T2D group and AD control group. Compared with healthy control group, the plasma levels of AKT1 protein in AD with T2D group (P AD+T2D vs. health < 0.0001) and AD control group (P AD vs. health = 0.0003) decreased significantly. Among genotypes of AKT1 rs2498786 polymorphism, the AKT1 protein level in GG genotype was significantly higher than that in GC genotype (P GG vs. GC < 0.0001) and CC genotype (P GG vs. CC < 0.0001).

Conclusion

The study suggests that AKT1 rs2498786 polymorphism in insulin signaling pathway may be associated with AD risk and different genotypes may affects levels of protein expression. However, the polymorphism is not shown to be exclusive in AD patients with T2D.

Keywords: Alzheimer's disease, insulin signaling pathway, polymorphism, type 2 diabetes, v‐akt murine thymoma viral oncogene homolog 1

Introduction

Alzheimer's disease (AD), also called senile dementia of the Alzheimer type or primary degenerative dementia of the Alzheimer's type, is a degenerative disease of the central nervous system characterized by progressive cognitive impairment and memory damage. The AD includes early‐onset, late‐onset, and familial AD and, most often, is diagnosed in people over 65 years of age 1. According to data from the World Alzheimer Report, the number of people with AD is forecast to nearly double every 20 years from 36 million in 2010 to 115 million in 2050, and the costs associated with AD will reach the total of US$604 billion, about 1% of global GDP 2. Therefore, it is particularly urgent to gain an insight into the pathogenesis factors of AD in order to discover different possibilities of preventive and effective treatment.

So far, the clue for AD etiology is still essentially unknown and several competing hypotheses exist to try to explain the cause of the disease including cholinergic hypothesis 3, viral hypothesis (herpes simplex virus type 1) 4, and amyloid hypothesis5, 6. Recently, presumption about the role that type 2 diabetes (T2D) affecting approximately 6% of the world population (about 300 millions) 7 played in pathogenesis of AD has been suggested. Experimental study showed that glucose metabolism in hippocampal and cortical parts of patients with AD was significantly lower than in the control group 8. Another study showed that insulin levels and insulin‐mediated glucose metabolism in brain fluid of patients with AD were significantly reduced than in normal control group, but intraventricular administration of insulin can not only promote glucose synthesis and metabolism, but also help to improve the scale score of patients with AD 9. Therefore, it is hypothesized that the mechanism of T2D may affect occurrence of AD, and the hypothesis is evidenced that the insulin PI3K‐AKT signaling pathway in pathogenesis of T2D was associated with AD from the molecular point of view 10. Based on these backgrounds, the abnormality of the AKT1 gene in PI3K‐AKT signaling pathway may be used extensively as a biological marker for onset of AD, as well as a unique model for deciphering the mechanisms.

Several molecular studies have investigated the associations of AKT1 variant with diseases among populations. The findings from Karege et al. 11 suggested polymorphisms of AKT1 gene appeared to impact the risk for a class of psychiatric symptoms of schizophrenia. Devaney et al. 12 reported that AKT1 was a risk factor for metabolic syndrome and insulin resistance. Kim et al. 13 showed the AKT1 polymorphisms could be used as prognostic markers for the patients with early‐stage NSCLC. The result from Wang et al. 14 indicated that AKT1 polymorphisms were associated with susceptibility to pulmonary TB. However, whether the common variants in the AKT1 are associated with the AD in a Chinese Han population with T2D is unclear so far.

The aims of this study were to explore the relationship of AKT1 promoter variants to occurrence of AD in patients with T2D and related traits found in a Chinese Han population and to identify the potential mechanisms underlying the associations.

Materials and Methods

Study Population and Characteristics

Consecutive patients were enrolled from the Kangci Hospital of Jiaxing, the Futian People's Hospital of Shenzhen, Shiyan Nursing Home of Shenzhen, and the First Affiliated Hospital of Harbin Medical University. The participants were classified into AD with T2D group and AD control group. T2D was diagnosed based on the diagnostic criteria defined by WHO in 1999 15 and the American Diabetes Association in 2003 16, or when the individual was receiving oral hypoglycemic agents or insulin injection therapy at the time of recruitment (fasting plasma glucose ≥7.0 mmol/L and/or 2‐h plasma glucose ≥11.1 mmol/L), probable AD was diagnosed based on criteria consistent with the National Institute of Neurological and Communicative Disorders and Stroke and the Alzheimer's Disease and Related Disorders Association (NINCDS‐ADRDA) Alzheimer's Criteria extensively updated in 2007 17. Meanwhile, unrelated normal controls were recruited from healthy people who were performed physical examination in above hospitals. A written informed consent was obtained from each participant after the study was explained in detail. The study was performed with the approval of the relevant ethical committee and adhered to the tenets of the Declaration of Helsinki.

The demographic and biochemical characteristics were extensively assessed among these groups. The characteristics in our study included age, gender, education, MMSE, ApoE, and AKT protein.

SNP Selection and Genotyping

Candidate SNPs in AKT1 were selected as follows: (i) SNPs of promoter region, (ii) SNPs from the public literatures and databases, (iii) SNPs that previously were reported to be associated with disease outcomes in epidemiological studies, and (iv) SNPs with a minor allele frequency >0.2. Finally, six tag SNPs (rs2498786, rs74090038, rs2494750, rs2494751, rs5811155, and rs2494752) were selected and genotyped. Genomic DNA was extracted from peripheral blood leukocytes using QIAGEN QIAamp DNA Mini Blood Kit (Germany). A total of 25 ng genomic DNA was amplified in a 20 ul final volume PCR containing 2 × Taq Unicorn Premix and 10 μmol of each primer. The amplification was performed at 94°C for 4 min with an initial denaturation, followed by 20 cycles of 94°C for 20 second, 57°C for 20 second, and 72°C for 20 second and a final extension of 3 min at 72°C. For more PCR fragment, the above PCR product was diluted into 1/100 and was amplified in a 25 μL final volume PCR containing 2 × Taq Unicorn Premix and 10 μmol of each primer again. The amplification was performed at 94°C for 2 min with an initial denaturation, followed by 20 cycles of 94°C for 15 second, 60°C for 15 second, and 72°C for 15 second and a final extension of 3 min at 72°C. Six sets of primers were designed as shown in Appendix Table A1. All amplified PCR products were mixed with formamide containing dextran blue dye, which was subjected to 1.2% agarose gels and visualized by staining with ethidium bromide. The SNPs were detected by the high‐throughput sequencing technique using PSTAR‐II plus (IDN01‐M‐P2). APOE genotyping was performed as described previously 18. Data on AKT1 levels for subjects were determined using established ELISA methods (Yuanye, Shanghai).

Statistical Analysis

In univariate analyses, Z‐test for quantitative data and chi‐square test or Fisher's exact test for qualitative data were used to determine whether there was significant difference in relevant factors between cases and controls. Chi‐square test was carried out to assess the deviations from the Hardy–Weinberg equilibrium (HWE) and frequencies of genotype and allele of AKT1 among cases and controls. Haplotype analyses were conducted using the PHASE 2.0 (University of Washington). The most common haplotype served as the referent, which happened to be the wild‐type allele for all six SNPs. Odds ratios (ORs) and corresponding 95% confidence intervals (CIs) were estimated to compare cases to controls in association with haplotypes. Logistic regression analysis was used to estimate the association between AKT1 polymorphisms and AD risk by adjusting for confounding factors. The function of polymorphisms with statistical significance in the ATK1 gene promoter was predicted by the bioinformatics software AliBaba2.1 (developed by Niels Grabe). All statistical tests were 2‐sided, and statistical significance was taken as P value less than 0.05.

Results

Baseline Characteristics

The baseline characteristics of all participants in the study are summarized in Table 1. In 574 participants, 112 were AD patients with T2D, 231 were patients with AD, and 231 were healthy controls. The three groups were age‐ and gender‐matched. The mean age was 80.1 years (±8.7 years) for the AD patients with T2D, 79.6 years (±9.9 years) for the patients with AD, and 78.5 (±8.4 years) for the healthy controls. The gender (male/female) ratio was 1:1.3 in the AD patients with T2D, 1:1.1 in the patients with AD, and 1:1.1 in the healthy control. There were no statistical differences in education among three groups. AD patients with T2D displayed higher APOE є4+ frequency and lower MMSE scores than patients with AD and healthy controls.

Table 1.

Baseline characteristics of cases with type 2 diabetes and controls

Demographic characteristics AD with T2D group AD control group Healthy control group P (AD+T2D vs. AD) P (AD+T2D vs. health)
N 112 231 231
Age 80.1 ± 8.7 79.6 ± 9.9 78.5 ± 8.4 0.6488 0.1030
Gender (M/F) 48/64 113/118 113/118 0.2916 0.2916
Education 8.6 ± 4.1 8.7 ± 3.6 9.1 ± 3.7 0.8179 0.2583
Apoε4(+) 54 67 39 0.0005 <0.0001
MMSE scores 16.4 ± 5.2 18.6 ± 3.9 28.3 ± 2.7 <0.0001 <0.0001

Continuous data were expressed as the means ± SEM. Bold values represent statistical significance.

Polymorphisms of AKT1 Gene and the Risk of AD in Patients with Type 2 Diabetes

The genotype and allele frequencies of six SNPs in the study are shown in Table 2. The deviation from Hardy–Weinberg equilibrium for all the polymorphisms examined was absent in the distributions of genotypes in healthy control group and, however, was found in AD with T2D group and AD control group.

Table 2.

Genotype and allele frequencies of the AKT1 polymorphism, and their association with risk of AD among AD with T2D group, AD group, and controls group

Reference SNP ID Genotype and allele AD with T2D group AD control group Healthy control group P (AD+T2D vs. AD) P (AD+T2D vs. health) P (AD vs. health) P HWE
N (%) N (%) N (%)
AKT1 rs2498786 GG 49 (43.7) 110 (47.6) 136 (58.9) 0.4826 <0.0001 <0.0001 AD with T2D group: <0.001
GC 34 (30.4) 56 (24.3) 83 (35.9) AD group: <0.001
CC 29 (25.9) 65 (28.1) 12 (5.2) Healthy control group: 0.8851
G 132 (58.9) 276 (59.7) 355 (76.8) 0.8391 <0.0001 <0.0001
C 92 (41.1) 186 (40.3) 107 (23.2)
AKT1 rs74090038 CC 88 (78.6) 180 (77.9) 181 (78.4) 0.1642 0.9635 0.9104 AD with T2D group: 0.2041
CT 24 (21.4) 44 (19.1) 50 (21.6) AD group: 0.0441
TT 0 (0) 7 (3.0) 0 (0) Healthy control group: 0.0651
C 200 (89.3) 404 (87.4) 412 (89.2) 0.4816 0.9658 0.4127
T 24 (10.7) 58 (12.6) 50 (10.8)
AKT1 rs2494750 CC 14 (12.5) 32 (13.9) 33 (14.3) 0.4643 0.8912 0.4510 AD with T2D group: 0.7484
CG 49 (43.8) 85 (36.8) 97 (42.0) AD group: 0.0164
GG 49 (43.8) 114 (49.3) 101 (43.7) Healthy control group: 0.2212
C 77 (34.4) 149 (32.3) 163 (35.3) 0.5789 0.8154 0.3301
G 147 (65.6) 313 (67.7) 299 (64.7)
AKT1 rs2494751 AA 14 (12.5) 33 (14.3) 31 (13.4) 0.4201 0.9692 0.3538 AD with T2D group: 0.7484
AG 49 (43.8) 84 (36.4) 99 (42.9) AD group: 0.0095
GG 49 (43.8) 114 (49.3) 101 (43.7) Healthy control group: 0.3931
A 77 (34.4) 150 (32.5) 161 (34.8) 0.6186 0.9028 0.4438
G 147 (65.6) 312 (67.5) 301 (65.2)
AKT1 rs5811155 TT 14 (12.5) 33 (14.3) 31 (13.4) 0.4201 0.9692 0.3538 AD with T2D group: 0.7484
Tdel 49 (43.8) 84 (36.4) 99 (42.9) AD group: 0.0095
deldel 49 (43.8) 114 (49.3) 101 (43.7) Healthy control group: 0.3931
T 77 (34.4) 150 (32.5 161 (34.8) 0.6186 0.9028 0.4438
del 147 (65.6) 312 (67.5) 301 (65.2)
AKT1 rs2494752 GG 10 (8.9) 29 (12.5) 25 (10.8) 0.5910 0.8157 0.6498 AD with T2D group: 0.6915
GA 44 (39.3) 84 (36.4) 93 (40.3) AD group: 0.0266
AA 58 (51.8) 118 (51.1) 113 (48.9) Healthy control group: 0.3771
G 64 (28.6) 142 (30.7) 143 (31.0) 0.5619 0.5241 0.9432
A 160 (71.4) 320 (69.3) 319 (69.0)

P (AD+T2D vs AD), P (AD+T2D vs health) and P (AD vs health) represent the whole comparison among three genotypes in both groups when exploring the genotype difference. Bold values represent statistical significance.

When compared with genotype distributions in healthy control group (P AD+T2D vs. health < 0.0001, P AD vs. health < 0.0001), the CC genotype of AKT1 rs2498786 in AD with T2D group and AD control group had significantly higher frequency shown by the chi‐square test. However, the differences in genotype distribution were not found between AD with T2D group and AD control group (P AD+T2D vs. AD = 0.4826). In addition, significant differences were observed in the frequency of the AKT1 rs2498786 G→C alleles between AD with T2D group and healthy control group (P < 0.0001), and AD control group and healthy control group (P < 0.0001), with the frequency of the C allele being higher in AD patients with T2D and patients with AD (Table 2). However, no significant differences were observed among other polymorphisms. After adjustment for confounding factors (age, gender, and APOE status), the results still remained robust. In addition, all haplotype analyses are shown in Table 3.

Table 3.

Haplotype frequencies in the promoter region of AKT1 gene among three groups

Haplotypes AD with T2D group n (%) Control group n (%) OR (95% CI) P
G‐C‐C‐A‐T‐G 22 (9.82) 18 (3.9) 1 –
G‐C‐C‐C‐del‐G 36 (16.07) 88 (19.05) 0.3347 (0.1607–0.6972) 0.0028
G‐C‐C‐C‐del‐A 14 (6.25) 14 (3.03) 0.8182 (0.3108–2.1538) 0.6843
G‐C‐G‐A‐T‐A 15 (6.7) 9 (1.95) 1.3636 (0.4845–3.8383) 0.5564
G‐C‐G‐C‐del‐A 4 (1.79) 2 (0.43) 1.6364 (0.2683–9.9796) 0.6836
G‐C‐G‐C‐del‐A 32 (14.29) 196 (42.42) 0.1336 (0.0646–0.2762) <0.0001
C‐C‐G‐A‐T‐A 17 (7.59) 50 (10.82) 0.2782 (0.1212–0.6387) 0.0021
C‐C‐G‐C‐del‐A 49 (21.88) 5 (1.08) 8.0182 (2.6394–24.3587) <0.0001
C‐T‐C‐A‐T‐G 2 (0.89) 12 (2.6) 0.1364 (0.0269–0.6900) 0.0083
C‐T‐G‐A‐T‐A 18 (8.04) 7 (1.52) 2.1039 (0.7199–6.1489) 0.1705
AD with T2D group n (%) AD control group n (%)
G‐C‐C‐A‐T‐G 22 (9.82) 35 (7.58) 1 –
G‐C‐C‐A‐T‐A 3 (1.34) 8 (1.73) 0.5966 (0.1428–2.4931) 0.7341
G‐C‐C‐C‐T‐G 3 (1.34) 1 (0.22) 4.7727 (0.4666–48.8164) 0.2958
G‐C‐C‐C‐del‐A 36 (16.07) 75 (16.23) 0.7636 (0.3927–1.4850) 0.4262
G‐C‐C‐C‐del‐A 14 (6.25) 10 (2.16) 2.2273 (0.8435–5.8815) 0.1026
G‐C‐G‐A‐T‐A 15 (6.7) 49 (10.61) 0.4870 (0.2218–1.0695) 0.0708
G‐C‐G‐C‐del‐G 4 (1.79) 5 (1.08) 1.2727 (0.3080–5.2592) 0.7304
G‐C‐G‐C‐del‐A 32 (14.29) 66 (14.29) 0.7713 (0.3907–1.5228) 0.4539
C‐C‐G‐A‐T‐A 17 (7.59) 1 (0.22) 27.0455 (3.3583–217.8081) <0.0001
C‐C‐G‐C‐del‐A 49 (21.88) 141 (31.52) 0.5529 (0.2961–1.0324) 0.0610
C‐T C‐A‐T‐G 2 (0.89) 15 (3.25) 0.2121 (0.0442–1.0184) 0.0381
C‐T‐G C‐del‐G 18 (8.04) 17 (3.68) 1.6845 (0.7194–3.9440) 0.2280
AD control group n (%) Control group n (%)
G‐C‐C‐A‐T‐G 35 (7.58) 18 (3.9) 1 –
G‐C‐C‐A‐T‐A 8 (1.73) 1 (0.22) 4.1143 (0.4768–35.5041) 0.2533
G‐C‐C‐C‐del‐G 75 (16.23) 88 (19.05) 0.4383 (0.2296–0.8367) 0.0113
G‐C‐C‐C‐del‐A 10 (2.16) 14 (3.03) 0.3673 (0.1364–0.9894) 0.0444
G‐C‐G‐A‐T‐A 49 (10.61) 9 (1.95) 2.8000 (1.1269–6.9572) 0.0237
G‐C‐G‐C‐del‐A 66 (14.29) 196 (42.42) 0.1732 (0.0919–0.3262) <0.0001
G‐T‐C‐A‐T‐A 4 (0.87) 10 (2.16) 0.2057 (0.0565–0.7484) 0.0115
G‐T‐G‐A‐T‐A 11 (2.38) 12 (2.6) 0.4714 (0.1741–1.2767) 0.1357
C‐C‐G‐A‐T‐A 1 (0.22) 50 (10.82) 0.0103 (0.0013–0.0807) <0.0001
C‐C‐G‐C‐del‐A 141 (30.52) 5 (1.08) 14.5029 (5.0362–41.7640) <0.0001
C‐T‐C‐A‐T‐G 15 (3.25) 12 (2.6) 0.6429 (0.2490–1.6595) 0.3598
C‐T‐G‐A‐T‐A 17 (3.68) 7 (1.52) 1.2490 (0.4380–3.5614) 0.6772

Bold values represent statistical significance.

The Level of AKT1 Protein and the Risk of AD in Patients with Type 2 Diabetes

The level of AKT1 protein was measured in AD with T2D group, AD control group, and healthy control group (Table 4). Significantly lower plasma AKT1 level was detected in the AD with T2D group (P < 0.0001) and the AD control group (P = 0.0003) than that in healthy control group. However, the difference in level of AKT1 protein was not found between AD with T2D group and AD control group (P = 0.4546).

Table 4.

Plasma levels of AKT1 protein in the AD with T2D group, AD control group, and healthy control group

Protein AD with T2D group AD control group Healthy control group P (AD+T2D vs. AD) P (AD+T2D vs. health) P (AD vs. health)
AKT (μmol/L) 14.6 ± 4.0 14.9 ± 3.2 16.0 ± 3.3 0.4546 <0.0001 0.0003

Bold values represent statistical significance.

The Association of AKT1 rs2498786 Polymorphism with AKT1 Protein Level

The association between AKT1 rs2498786 and AKT1 protein level was analyzed among three genotypes (Table 5). Among the genotypes of rs2498786, the AKT1 protein levels in subjects with GC (P < 0.0001) and CC (P < 0.0001) genotypes were significantly lower than that in the subjects with GG genotype. The genotype‐related differences in AKT1 protein levels were also observed in the subgroup of AD with T2D, AD control, and healthy control subjects, and the lowest AKT protein levels were found in subjects involving GC and CC genotypes.

Table 5.

Plasma levels of AKT1 protein according to the AKT1 genotypes

GG GC CC P (GG vs. GC) P (GG vs. CC)
Total (N = 574) 295 173 106
AKT1 (μmol/L) 17.0 ± 3.3 14.2 ± 2.7 12.2 ± 3.8 <0.0001 <0.0001
AD with T2D group (n = 112) 49 34 29
AKT1 (μmol/L) 16.9 ± 2.8 13.7 ± 3.3 11.9 ± 3.1 <0.0001 <0.0001
AD control group (n = 231) 110 56 65
AKT1 (μmol/L) 16.6 ± 2.2 14.5 ± 3.2 12.4 ± 4.6 <0.0001 <0.0001
Healthy control group (n = 231) 136 83 12
AKT1 (μmol/L) 17.3 ± 3.7 14.3 ± 2.5 12.2 ± 4.6 <0.0001 <0.0001

Bold values represent statistical significance.

The Function Prediction of AKT1 rs2498786 Polymorphism

The predicted result from the bioinformatics software showed that the polymorphism C had not binding site with other proteins. However, the substitution of C to G obtained potential ability to combine with 2 transcription factors (ADR1 and Sp1).

Discussion

Although the role of T2D in AD development is not fully elucidated, it has been proposed that it could be responsible for the risk of AD 19. In T2D individuals, there is a tendency of AD prevalence to be higher than in non‐T2D, which may be related to the decreased activity of insulin signaling pathway of T2D 10.

The insulin PI3K‐AKT signaling pathway is the most discussed topic by many studies because it has been found to prevent excessive accumulation of Aβ protein and abnormal phosphorylation of tau protein that contributed to senile plaques and neurofibrillary tangles in AD by downregulating GSK3 level 20 when exploring the association between T2D and AD risk. Therefore, the insulin PI3K‐AKT signaling pathway is considered to be the pathobiochemical basis for the drastic reduction in glucose/energy metabolism in Alzheimer's brain 21.

In our study, we examined whether polymorphic variation of AKT1 gene encoding AKT1 protein in the insulin PI3K‐AKT signaling pathway was associated with genetic risk for AD among T2D population. AKT1 protein is an important serine/threonine protein kinase that plays a key role in mediating the effects of insulin [or insulin‐like growth factor (IGF)] regulation of neuronal survival and promoting the survival of a range of cell types in response to various growth factors 22. Activation of AKT1 is favorable to upstream of Aβ protein and normal phosphorylation of Tau protein that is associated with AD by inhibiting GSK3 and promoting mTORC1. In view of the above‐mentioned involvement of AKT1 protein in a wide range of cellular functions in neuronal survival, it is obvious to consider its protective role in various conditions such as nervous system (AKT1 has been shown to phosphorylate both Thr212 and Ser214 in the longest and shortest tau isoforms, which may be involved in phosphorylation of tau relevant to AD and other neurodegenerations 23). Furthermore, AKT1 activity was often affected by the polymorphic variation of AKT1 gene. Previous studies have shown that polymorphisms of the AKT1 gene changed AKT expression activity 24, 25. Subsequently, these findings provide evidence that AKT1 polymorphisms may lead to variability in the insulin signaling pathway. Based on these data, it is hypothesized in our study that AKT1 polymorphisms may be potentially associated with the AD in patients with T2D. As is expected, our findings demonstrated a significant association between the AKT1 rs2498786 polymorphism and AD risk in the AD with T2D group and AD control group compared with healthy control group. The association is possible because the rs2498786 polymorphism is located in promoter in AKT1 and may have the ability to regulate AKT1 protein expression. In fact, in our study, we found the lower AKT1 protein level in AD with T2D group and AD control group, and the genotype‐related differences in AKT1 protein levels in the subgroup of AD with T2D, AD control, and healthy control subjects. Meanwhile, AKT1 mutant modulated reward learning and reward prediction error related to AD development in mice model. Therefore, it is speculated that the aberrant modulation of AKT1 polymorphism on AKT1 protein may affect the insulin signaling pathway leading to AD development. However, the association between the AKT1 rs2498786 polymorphism and AD was independent of T2D status, which may be explained by the increasing evidence demonstrating that AD has some pathological features in common with T2D, and the two disorders may share a similar etiology 26.

In this study, the genotype‐related differences in AKT1 protein levels were also observed in the subgroup of AD with T2D, AD control, and healthy control subjects. Among the examined SNP, the levels of AKT1 protein in subjects with GC and CC genotypes of rs2498786 were significantly lower than that of the subjects with GG genotype, which is speculated that level of AKT1 protein may be relevant to SNP of AKT1. Moreover, the findings have the resonance with other studies that demonstrated the attribute of the genotype‐related difference in AKT1 protein levels 24, 25.

So far, many publications have shown genetic associations of polymorphisms in and upstream of the AKT1 gene with human phenotypes. Karege et al. suggested AKT1 polymorphisms (rs3803300, rs2494732, rs2498804) may be associated with pathogenesis of both schizophrenia and bipolar disorder 11, 24. Devaney et al. demonstrated that AKT1 variant (rs1130214) may be used as a marker in the endophenotypes that made up metabolic syndrome 12. Xiromerisiou et al. showed that variability (rs2498788) within AKT1 gene had a role as a risk factor for Parkinson's disease 25. However, most studies mainly focused on regions like exons, introns, and 3′ UTR in AKT1 gene, and few studies were performed on promoter in AKT1 gene, especially six polymorphisms of promoter included in our study. We further predicted the function of AKT1 rs2498786 polymorphism with statistical significance, and the finding from bioinformatics software showed that the substitution of C to G obtained potential ability to combine with 2 transcription factors (ADR1 and Sp1). In fact, Sp1 has been demonstrated to bind to GC boxes of the promoters of several genes expressed in a wide variety of tissues 27, 28, which has the resonance with our predicted findings. The binding phosphorylated Sp1 to regulate the effects of Sp1 on gene expression 29, 30. For example, Sp1 has been shown to positively regulate of the expression of APP 31, the expression of BACE1 associated with APP cleavage 32, and the expression of tau 33. Therefore, it is speculated that the potential binding of Sp1 to AKT1 rs2498786 polymorphism may affect the expression of hallmarks involved in the pathology of AD.

In conclusion, this study is the first report on the relationship of AKT1 to AD in patients with T2D. Our findings supported the hypothesis that the genetic variant in the AKT1 rs2498786 may contribute to the occurrence of AD. But the polymorphism may be not exclusive in AD patients with T2D due to no difference in genotype distribution between AD patients with T2D and simple patients with AD. The findings may help to evaluate individual susceptibility and explore the effective measures of disease control and prevention. Regardless, these results need further epidemiological studies to confirm the relationship of molecular mechanism of AKT1 gene to risk of AD in patients with type 2 diabetes.

Conflict of Interest

The authors declare no conflict of interest.

Acknowledgments

This work was supported by funding from the National Natural Science Foundation of China (Grant Number: 81302482), the China Postdoctoral Fund Project (Grant Number 2013M531879) and Nanshan Science and Technology Bureau Fund project (Grant Number: 2012007).

Appendix 1.

Table A1.

The information on primers of AKT1 gene in this study

rs number Primer name Primer sequence
AKT1 rs2498786 JYDT‐SNP‐16(90)F 5′ ATTCGTCCCTGACCTGTCTC 3′
JYDT‐SNP‐16(90)R 5′ AGTTTCCCCGTCTGTAAAGTG 3′
AKT1 rs74090038 JYDT‐SNP‐17(104)F 5′ GAGGAGGAGCGGTGTCTAGG 3′
JYDT‐SNP‐17(104)R 5′ CCCAGTGGACTTCGGACTG 3′
AKT1 rs2494750 JYDT‐SNP‐18(106)F 5′ CGGGTATGGAATGAGTAAGTGG 3′
JYDT‐SNP‐18(106)R 5′ CGGAGGAACTTCTGGCTAGG 3′
AKT1 rs2494751 JYDT‐SNP‐19(82)F 5′ GTGACTGCCACCCCGACC 3′
JYDT‐SNP‐19(82)R 5′ TATCAACTGTGGGCCTCTGG 3′
AKT1 rs5811155 JYDT‐SNP‐21(105)F 5′ CCCAGCTCAGACTTTGTAACC 3′
JYDT‐SNP‐21(105)R 5′ CAACCCTTGTGTCAGGTATCC 3′
AKT1 rs2494752 JYDT‐SNP‐22(103)F 5′ TGGGCTCTGCCATGCAAG 3′
JYDT‐SNP‐22(103)R 5′ CCACATCCCCAAGCCTCG 3′

The first two authors contributed equally to this work.

References

  • 1. Brookmeyer R, Gray S, Kawas C. Projections of Alzheimer's disease in the United States and the public health impact of delaying disease onset. Am J Public Health 1998;88:1337–1342. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Alzheimer's disease International. World Alzheimer Report 2009–2011. 2012. http://www.alz.co.uk/research/world-report.
  • 3. Francis PT, Palmer AM, Snape M, Wilcock GK. The cholinergic hypothesis of Alzheimer's disease: A review of progress. J Neurol Neurosurg Psychiatry 1999;66:137–147. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Itzhaki RF, Wozniak MA. Herpes simplex virus type 1 in Alzheimer's disease: The enemy within. J Alzheimers Dis 2008;13:393–405. [DOI] [PubMed] [Google Scholar]
  • 5. Hardy J, Allsop D. Amyloid deposition as the central event in the aetiology of Alzheimer's disease. Trends Pharmacol Sci 1991;12:383–388. [DOI] [PubMed] [Google Scholar]
  • 6. Mudher A, Lovestone S. Alzheimer's disease‐do tauists and baptists finally shake hands? Trends Neurosci 2002;25:22–26. [DOI] [PubMed] [Google Scholar]
  • 7. Meetoo D, McGovern P, Safadi R. An epidemiological overview of diabetes across the world. Br J Nurs 2007;16:1002–1007. [DOI] [PubMed] [Google Scholar]
  • 8. Herholz K, Schopphoff H, Schmidt M, et al. Direct comparison of spatially normalized PET and SPECT scans in Alzheimer's disease. J Nucl Med 2002;43:21–26. [PubMed] [Google Scholar]
  • 9. Craft S, Asthana S, Cook DG, et al. Insulin dose‐response effects on memory and plasma amyloid precursor protein in Alzheimer's disease: Interactions with apolipoprotein E genotype. Psychoneuroendocrinology 2003;28:809–822. [DOI] [PubMed] [Google Scholar]
  • 10. Liu Y, Liu F, Grundke‐Iqbal I, Iqbal K, Gong CX. Deficient brain insulin signalling pathway in Alzheimer's disease and diabetes. J Pathol 2011;225:54–62. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Karege F, Meary A, Perroud N, et al. Genetic overlap between schizophrenia and bipolar disorder: A study with AKT1 gene variants and clinical phenotypes. Schizophr Res 2012;135:8–14. [DOI] [PubMed] [Google Scholar]
  • 12. Devaney JM, Gordish‐Dressman H, Harmon BT, et al. AKT1 polymorphisms are associated with risk for metabolic syndrome. Hum Genet 2011;129:129–139. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Kim MJ, Kang HG, Lee SY, et al. AKT1 polymorphisms and survival of early stage non‐small cell lung cancer. J Surg Oncol 2012;105:167–174. [DOI] [PubMed] [Google Scholar]
  • 14. Wang X, Cao Z, Jiang J, et al. AKT1 polymorphisms are associated with tuberculosis in the Chinese population. Int J Immunogenet 2010;37:97–101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Alberti KG, Zimmet PZ. Definition, diagnosis and classification of diabetes mellitus and its complications. Part 1: Diagnosis and classification of diabetes mellitus provisional report of a WHO consultation. Diabet Med 1998;15:539–553. [DOI] [PubMed] [Google Scholar]
  • 16. Expert Committee on the Diagnosis and Classification of Diabetes Mellitus . Report of the expert committee on the diagnosis and classification of diabetes mellitus. Diabetes Care 2003;26(Suppl 1):S5–S20. [DOI] [PubMed] [Google Scholar]
  • 17. Dubois B, Feldman HH, Jacova C, et al. Research criteria for the diagnosis of Alzheimer's disease: Revising the NINCDS‐ADRDA criteria. Lancet Neurol 2007;6:734–746. [DOI] [PubMed] [Google Scholar]
  • 18. Leoni V. The effect of apolipoprotein E (ApoE) genotype on biomarkers of amyloidogenesis, tau pathology and neurodegeneration in Alzheimer's disease. Clin Chem Lab Med 2011;49:375–383. [DOI] [PubMed] [Google Scholar]
  • 19. Leibson CL, Rocca WA, Hanson VA, et al. Risk of dementia among persons with diabetes mellitus: A population‐based cohort study. Am J Epidemiol 1997;145:301–308. [DOI] [PubMed] [Google Scholar]
  • 20. Hong M, Lee VM. Insulin and insulin‐like growth factor‐1 regulate tau phosphorylation in cultured human neurons. J Biol Chem 1997;272:19547–19553. [DOI] [PubMed] [Google Scholar]
  • 21. Hoyer S. Is sporadic Alzheimer disease the brain type of non‐insulin dependent diabetes mellitus? A challenging hypothesis J Neural Transm 1998;105:415–422. [DOI] [PubMed] [Google Scholar]
  • 22. Dudek H, Datta SR, Franke TF, et al. Regulation of neuronal survival by the serine‐threonine protein kinase Akt. Science 1997;275:661–665. [DOI] [PubMed] [Google Scholar]
  • 23. Ksiezak‐Reding H, Pyo HK, Feinstein B, Pasinetti GM. Akt/PKB kinase phosphorylates separately Thr212 and Ser214 of tau protein in vitro . Biochim Biophys Acta 2003;1639:159–168. [DOI] [PubMed] [Google Scholar]
  • 24. Karege F, Perroud N, Schurhoff F, et al. Association of AKT1 gene variants and protein expression in both schizophrenia and bipolar disorder. Genes Brain Behav 2010;9:503–511. [DOI] [PubMed] [Google Scholar]
  • 25. Xiromerisiou G, Hadjigeorgiou GM, Papadimitriou A, Katsarogiannis E, Gourbali V, Singleton AB. Association between AKT1 gene and Parkinson's disease: A protective haplotype. Neurosci Lett 2008;436:232–234. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Stewart R, Liolitsa D. Type 2 diabetes mellitus, cognitive impairment and dementia. Diabet Med 1999;16:93–112. [DOI] [PubMed] [Google Scholar]
  • 27. Cook T, Gebelein B, Urrutia R. Sp1 and its likes: Biochemical and functional predictions for a growing family of zinc finger transcription factors. Ann N Y Acad Sci 1999;880:94–102. [DOI] [PubMed] [Google Scholar]
  • 28. Philipsen S, Suske G. A tale of three fingers: The family of mammalian Sp/XKLF transcription factors. Nucleic Acids Res 1999;27:2991–3000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Chu S, Ferro TJ. Sp1: Regulation of gene expression by phosphorylation. Gene 2005;348:1–11. [DOI] [PubMed] [Google Scholar]
  • 30. Jackson SP, MacDonald JJ, Lees‐Miller S, Tjian R. GC box binding induces phosphorylation of Sp1 by a DNA‐dependent protein kinase. Cell 1990;63:155–165. [DOI] [PubMed] [Google Scholar]
  • 31. Docagne F, Gabriel C, Lebeurrier N, et al. Sp1 and Smad transcription factors co‐operate to mediate TGF‐beta‐dependent activation of amyloid‐beta precursor protein gene transcription. Biochem J 2004;383:393–399. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Christensen MA, Zhou W, Qing H, Lehman A, Philipsen S, Song W. Transcriptional regulation of BACE1, the beta‐amyloid precursor protein beta‐secretase, by Sp1. Mol Cell Biol 2004;24:865–874. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Heicklen‐Klein A, Ginzburg I. Tau promoter confers neuronal specificity and binds Sp1 and AP‐2. J Neurochem 2000;75:1408–1418. [DOI] [PubMed] [Google Scholar]

Articles from CNS Neuroscience & Therapeutics are provided here courtesy of Wiley

RESOURCES