The development and application of STTM technology to block miR-like RNAs in M. robertsii and A. flavus may allow for efficient generation of miR-like RNA mutants in various fungi, providing a powerful tool for functional genomics of small RNA molecules in fungi.
KEYWORDS: Aspergillus flavus, Metarhizium robertsii, microRNA-like RNAs, short tandem target mimic, small-RNA-degrading nuclease
ABSTRACT
MicroRNAs (miRNAs) have been recognized as sequence-specific regulators of the genome, transcriptome, and proteome in eukaryotes. However, the functions and working mechanisms of hundreds of fungal miRNA-like (miR-like) RNAs are obscure. Here, we report that a short tandem target mimic (STTM) triggered the degradation of several fungal miR-like RNAs in two different fungal species, Metarhizium robertsii and Aspergillus flavus, and that small-RNA-degrading nucleases (SDNs) were indispensable for such degradation. STTMs were most effective when the fungal polymerase II (Pol II) promoter was used for their expression, while the Pol III promoter was less effective. The length of the STTM spacer, approximately 48 to 96 nucleotides, and the number of miR-like RNA binding sites, from 2 to 4 copies, showed no significant difference in the degradation of miR-like RNAs. STTMs modulated the miR-like RNA expression levels in at least two different fungal species, which further impacted fungal asexual growth and sporulation. Further analysis showed that the degraded miR-like RNAs in STTM mutants led to the upregulation of potential target genes involved in fungal development and conidial production, which result in different phenotypes in these mutants. The STTM technology developed in this study is an effective and powerful tool for the functional dissection of fungal miR-like RNAs.
IMPORTANCE The development and application of STTM technology to block miR-like RNAs in M. robertsii and A. flavus may allow for efficient generation of miR-like RNA mutants in various fungi, providing a powerful tool for functional genomics of small RNA molecules in fungi.
INTRODUCTION
MicroRNAs are ∼21-nucleotide (nt) regulatory RNAs that have essential functions in a variety of biological processes in eukaryotes (1). The first fungal miRNA-like (miR-like) RNAs were identified in Neurospora crassa. Fungal miR-like RNAs (milRNAs) are produced by more than four mechanisms which are involved in various factors, such as RNase III enzyme Dicer and Argonaute-like protein QDE-2 (2). Subsequently, milRNAs have been discovered in different fungi, such as Metarhizium anisopliae, Aspergillus flavus, and Coprinopsis cinerea (3–9). Although hundreds of fungal miR-like RNAs have been found in various fungal species, only two target genes were identified and confirmed by QDE-2 immunoprecipitation for the miR-like RNA milR-1 in N. crassa, and milR-1 downregulated the expression of its target genes (2). The functions of fungal milRNAs and their working mechanisms remain unexplored because of inefficient traditional approaches or a shortage of effective methods.
Construction and characterization of genetic mutations are the widely used methods to investigate fungal gene functions. For example, fungal gene knockout mutants were generated by Agrobacterium tumefaciens-mediated transformation (10). However, fungal milRNAs are small identities, and they are often transcribed from multiple regions of functional or noncoding genes of the genome as a family. It is thus difficult to apply traditional methods to study such small milRNAs (3, 11). Similarly to plants, many fungal milRNAs may have multiple functionally overlapping members distributed in a genome, and a milRNA potentially regulates multiple target genes with diverse functions. Target prediction is also difficult for fungal milRNAs. Unlike plant miRNAs, animal miRNAs have a distinct regulatory mechanism in control of their targets. Thus, depending on distinct hosts, animal milRNAs may have regulatory machinery distinct from that of plant fungal milRNAs. To explore plant miRNA functions, construction and characterization of transgenic lines by the expression of milRNA-resistant targets, including silent mutations, may not work for insect fungal milRNAs. In addition, an approach using milRNA-resistant targets might only partially reveal the roles of the special milRNA in vivo (2, 12, 13). Therefore, exploring working and novel approaches for the study of fungal milRNAs is necessary.
Short tandem target mimic (STTM), as a recently developed method, has been used to block miRNA functions or identities, allowing a full functional overexpression of the target genes in plants (14). STTM uses a similar working mechanism but complements the existing technologies of “target mimic,” “miRNA sponge,” or RNA decoys termed “tough decoy (TuD) RNAs” and provides an effective method to block specific miRNAs in plant and animal cells (14–16). STTMs are composed of two small RNA binding sites, complementary to target small RNAs, except for the central three-nucleotide bulge, linked together by a 48- to 96-nt-long spacer (14). Owing to their small size, at approximately 100 nucleotides, STTMs have the potential to be arranged in various modules to silence multiple endogenous miRNAs. Furthermore, STTMs can be combined with other genomic tools, such as gene editing and artificial miRNA (amiRNA) technologies, to modulate the miRNA regulatory network. So far, STTM has been successfully applied to the functional analysis of rice miRNAs, showing their key roles in regulating important agronomic traits, such as seed size (16). However, no study has been reported on the degradation of fungal miR-like RNAs triggered by STTM.
The small-RNA-degrading nuclease (SDN) family of exonucleases contributes to the reduction of small RNAs in Arabidopsis spp., and both SDN1 and SDN2 were found to turn over miRNAs triggered by STTM in plants (14). In the small RNA/Argonaute (AGO) complex, while the small RNA 5′ and 3′ ends are anchored by different AGO domains without the target strand, the complementary target strand existence is predicted to cause the release of the small RNA 3′ end from the PAZ domain, and STTMs may promote SDNs to degrade the targeted small RNA by releasing the small RNA 3′ end from AGO (16). Therefore, STTM-triggered miRNA degradation is dependent on the presence of SDNs.
Metarhizium robertsii, used as an environmentally friendly alternative to chemical insecticides, has diverse lifestyles (as an insect pathogen, plant symbiont, and saprophyte), which is not matched by the “model” fungi Saccharomyces cerevisiae and N. crassa (17, 18). In M. robertsii, 15 miR-like RNAs were identified, and the expression levels of milR-1 and milR-7 in mycelia were approximately 10-fold higher and 6-fold lower than the expression levels in conidia, respectively; this may indicate that milR-1 and milR-7 play a key role in the regulation of mycelial growth and conidiation (3). Therefore, milR-1 and milR-7 were chosen to evaluate STTM efficiency in M. robertsii.
In this study, miR-like RNA degradation efficiencies of STTM with different promoters, spacer lengths, and number of miR-like RNA binding sites were detected to obtain the optimal STTM design rules for fungi. A. flavus, which is deleterious to animal and human health because of the production of aflatoxin, was selected to further confirm STTM-triggered miR-like RNA degradation efficiency in filamentous fungi (19). A total of 135 milRNAs were identified in A. flavus under different temperature or water conditions, and A. flavus milR-4 (AF-milR-4) and AF-milR-7 were expressed under all four conditions (28°C, 37°C, 93% water activity, and 99% water activity) and validated with a real-time PCR assay (6). Furthermore, the STTM technology was applied to block AF-milR-4 and AF-milR-7 in A. flavus, which resulted in significantly different phenotypes. Finally, the roles of SDN, a protein that widely exists in fungi, in STTMs were determined. Our results show that STTM technology is an effective and powerful tool for the functional dissection of fungal miR-like RNAs.
RESULTS
Design of an STTM for the functional blockage of milR-7 in M. robertsii.
The RNA polymerase II promoter (gpdA) and III promoter (SNR52 and U6) were selected to drive the expression of STTM-milR-7, which is based on the STTM structure shown in Fig. 1A to E (20). Real-time PCR results showed that only the gpdA promoter (PgpdA)-transcribed STTM-milR-7 can effectively block milR-7 expression in M. robertsii (Fig. 1F). The expression of milR-7 decreased approximately 45% in the fungi transfected with the RNA polymerase II promoter-transcribed STTM-milR-7 compared to the wild-type (WT) control. In contrast, the expression level of milR-7 was not affected by the introduction of RNA polymerase III promoter-transcribed STTM-milR-7.
FIG 1.
STTM RNA transcript structure and the STTM-directed target mimic for milR-7 with different promoters. (A) STTM RNA transcript structure. (B) Diagram of the STTM-48-milR-7 structure. Orange indicates the spacer sequence. The dotted line indicates the bulge sequences. The sequences are shown in Fig. S6. (C) Diagram of PU6-STTM-48nt-milR-7-TSUP4. (D) Diagram of PSNR52-STTM-48nt-milR-7-Tpoly(T). (E) Diagram of PgpdA-STTM-48nt-milR-7-TtrpC. (F) qRT-PCR analysis of milR-7 expression level in different strains. Error bars, SEM from six replicate assays. The asterisks represent a significant difference (P < 0.05). RB T-DNA, right border transfer DNA.
Optimal spacer length and number of miR-like RNA binding sites for STTM efficiency, and the detection of off-target effects.
Transgenic plants with various STTM spacer lengths showed distinct miRNA degradation efficiencies (14). In this study, spacers of 88 and 96 nucleotides were chosen to test the STTM-mediated milR-7 degradation efficiency. Similar to the STTM-milR-7 with a 48-nt spacer (STTM-milR-7-48nt), both STTM-milR-7-88nt and STTM-milR-7-96nt showed a significant decrease in milR-7 expression. However, all mutants showed similar milR-7 expression levels and degradation efficiencies (∼45%) (Fig. 2A to D).
FIG 2.
Diagrams of the STTM structures with various spacer region lengths and number of complementary regions. (A) Diagrams of the STTM structures with different spacer region lengths. Orange indicates the spacer region. Blue indicates the bulge sequences. (B) Diagram of PgpdA-STTM-88nt-milR-7-TtrpC. (C) Diagram of PgpdA-STTM-96nt-milR-7-TtrpC. (D) qRT-PCR analysis of the milR-7 expression level in different strains with the STTM structures of various spacer region lengths. (E) Diagrams of the STTM structures with four milR-7 complementary regions. (F) Diagram of PgpdA-STTM-2×48nt-milR-7-TtrpC. (G) qRT-PCR analysis of the milR-7 expression levels in different strains containing STTM structures with different numbers of milR-7 complementary regions. Error bars, SEM from six replicate assays. The asterisks represent a significant difference (P < 0.05).
To explore whether the number of miR-like RNA binding sites could affect the functional blockage of milR-7, an STTM with four miR-like RNA binding sites was designed (Fig. 2E and F). Similar to the STTM-milR-7 with two milR-7 binding sites, STTM-milR-7 with four milR-7 binding sites showed a significant decrease in milR-7 expression. However, all mutants showed a similar milR-7 expression level and degradation efficiency (∼45%) (Fig. 2G).
To examine the off-target effects of STTM, all M. robertsii miR-like RNA expression levels in STTM-gpdA-48-milR-7 were detected with real-time quantitative PCR (qPCR) (3). Only the expression of milR-7 decreased significantly in the STTM-gpdA-48-milR-7 compared to the wild type (see Fig. S1 in the supplemental material). Those data revealed that these STTMs are specific to the miRNA-like RNAs they are targeting.
Based on these results, we recommend the following general rules for STTM design: two noncleavable miRNA binding sites linked by a 48-nt spacer that should be transcribed by the RNA polymerase II promoter.
Degradation of milR-1 and milR-7, and expression of potential miR-like RNA targets in M. robertsii mutants.
To evaluate if the STTM also triggers the reduction of other miR-like RNAs in M. robertsii, the plasmid of STTM-milR-1 with two milR-1 binding sites was transformed into the fungi. The expression of milR-1 decreased approximately 40% in the fungi compared to the control, similar to the expression of milR-7 (Fig. 3A).
FIG 3.
STTM-directed functional blockage of other miR-like RNAs in M. robertsii and A. flavus. (A) Diagrams of the STTM structures used to block other miR-like RNAs in M. robertsii and A. flavus, and qRT-PCR analysis of those miR-like RNA expression levels in different strains. (B) Growth, conidial production, and the expression of milR-7 and milR-1 target genes in different M. robertsii strains. Black scale bar = 1 cm. (C) Growth and conidial production of different A. flavus strains. White scale bar = 1 cm. Error bars, SEM from six replicate assays. The asterisks represent a significant difference (P < 0.05).
The phenotypes of STTM-gpdA-48-milR-1 and STTM-gpdA-48-milR-7 were examined in M. robertsii. The growth rate of STTM-gpdA-48-milR-1 markedly increased by 12.6% (P < 0.05), while STTM-gpdA-48-milR-7 showed no difference in growth rate compared with that of the M. robertsii wild-type strain (MR-WT) (Fig. 3B). For conidial yield, STTM-gpdA-48-milR-7 produced more (∼1.98-fold, P < 0.05) than the STTM-gpdA-48-milR-1 and MR-WT (Fig. 3B).
To further confirm that phenotypes of different STTM strains were caused by decreased expression of miR-like RNAs and the upregulation of the potential milR target genes in M. robertsii, expression levels of potential milR-7 and milR-1 target genes were predicted and detected with real-time qPCR in STTM-gpdA-48-milR-7 and STTM-gpdA-48-milR-1, respectively (Fig. S2 and Table 1). Real-time qPCR results showed that expression of three potential milR-7 target genes (MAA_03019, cell division protein Cdc14; MAA_06604, cytochrome P450; and MAA_04522, ubiquitin carboxyl-terminal hydrolase) were significantly increased, while other genes were similar in STTM-gpdA-48-milR-7 compared with the wild type (Fig. 3B and S2A). Two milR-1 predicted target genes (MAA_02361, vegetative cell wall protein gp1; and MAA_07800, regulator of G protein signaling superfamily) were significantly increased, while the other genes were similar in STTM-gpdA-48-milR-1 (Fig. 3B and S2B). In fungi, cytochrome P450 enzymes and cell division proteins were found to be essential for conidial production, and the vegetative cell wall protein gp1 and regulator of G protein signaling superfamily were found to be required for normal cell growth (21–24). In STTM mutants, the expression of milR-1 or milR-7 was inhibited, while their predicted target gene expression levels were enhanced, which may result in phenotypic changes in M. robertsii.
TABLE 1.
Predicted milR-7 and milR-1 target genes in M. robertsii
| milRNA | Gene IDa | Gene name or description | Target region |
|---|---|---|---|
| milR-7 | MAA_03019 | Cell division protein Cdc14 | Untranslational region |
| MAA_01304 | FAD/NAD(P)-binding domain-containing protein | Coding region | |
| MAA_05318 | Fungal transcriptional regulatory protein | Coding region | |
| MAA_00354 | Protein kinase-like protein | Untranslational region | |
| MAA_04883 | NAD(P)-binding domain protein | Coding region | |
| MAA_06604 | Cytochrome P450 | Coding region | |
| MAA_04521 | F-box domain-containing protein | Coding region | |
| MAA_09298 | Phosphoglycerate mutase | Untranslational region | |
| MAA_04522 | Ubiquitin carboxyl-terminal hydrolase | Coding region | |
| milR-1 | MAA_06363 | C6 zinc finger domain-containing protein | Coding region |
| MAA_03396 | Peroxisomal biogenesis factor 6 | Coding region | |
| MAA_02186 | Acetylhydrolase | Coding region | |
| MAA_04806 | SNF2 family DNA-dependent ATPase | Untranslational region | |
| MAA_03776 | AMP-binding enzyme | Coding region | |
| MAA_02361 | Vegetative cell wall protein gp1 | Untranslational region | |
| MAA_07800 | Regulator of G protein signaling superfamily | Coding region | |
| MAA_03118 | Isocitrate dehydrogenase | Coding region | |
| MAA_08707 | Farnesyl pyrophosphate synthetase 1 | Untranslational region | |
| MAA_04793 | ATP-dependent RNA helicase DBP4 | Untranslational region | |
| MAA_02764 | F-box domain protein | Coding region |
ID, identifier.
STTM functions in another fungus, A. flavus.
To evaluate whether STTM functions in other fungi as well, the STTM plasmids with two AF-milRNA-4 or AF-milRNA-7 binding sites were constructed and transformed into A. flavus (Fig. 3A). Real-time PCR results showed that the expression of AF-milRNA-4 and AF-milRNA-7 decreased approximately 40% in the fungi compared to the control, revealing that the STTM technology also functions in A. flavus and can be widely used in fungi (Fig. 3A).
The phenotypes of STTM-gpdA-48-milR-1 and STTM-gpdA-48-milR-7 were examined in A. flavus as well. The growth rate of the STTM-gpdA-48-AF-milR-7 was significantly increased by 15.4% (P < 0.05), while the growth of STTM-gpdA-48-AF-milR-4 showed no difference from that of the A. flavus WT strain (AF-WT) (Fig. 3C). For conidial yield, both STTM-gpdA-48-AF-milR-4 and STTM-gpdA-48-AF-milR-7 produced fewer conidia (∼16.7% and 73.5%, respectively; P < 0.05) than did the AF-WT (Fig. 3C). These results further indicate that STTMs could be widely applied to study the functions of various fungal miR-like RNAs.
SDN is indispensable for the reduction of miR-like RNAs triggered by STTMs in fungi.
The fungal homologs of Arabidopsis SDN1 and SDN2 genes were sought through online BLAST analysis, and only one type of homologous gene was found in fungi (Fig. 4A). Further analysis showed that all fungal SDNs contain a REX1_like domain, belonging to the subfamily of DEDDh 3ʹ–5ʹ exonuclease domain of RNA exonucleases 1 and 3 (https://www.ncbi.nlm.nih.gov/Structure/cdd/cd06145), and functioning in the processing and maturation of many RNA species (25, 26). SDN genes widely exist in fungi such as Saccharomyces cerevisiae, Cryptococcus gattii, Mucor ambiguus, Pleurotus ostreatus, N. crassa, A. flavus, Fusarium graminearum, M. robertsii, Trichoderma gamsii, Cordyceps militaris, and others which contain a highly conserved REX1_like domain (Fig. 4A).
FIG 4.
SDNs in diverse organisms and diagrams of plasmids used for M. robertsii SDN knockout. (A) Analysis of SDNs and the domain architecture of representative SDNs. Alignments of the SDN REX1_like sequences. The asterisks represent amino acid similarity equal to 100%. (B) Construction of different mutant transgenic fungi. (C) qRT-PCR analysis of the milR-7 expression level in different strains. (D) Growth of different M. robertsii strains. (E) Conidial production of different M. robertsii strains. (C to E) Error bars, SEM from six replicate assays. The asterisks represent a significant difference compared with MR-WT (P < 0.05).
To test if the reduction of miR-like RNAs triggered by STTMs may be attributed to the degradation of miR-like RNAs by SDNs, STTM-milR-7 transgenic fungi were generated in the background of the SDN mutant (ΔMrSDN-STTM-milR-7; MrSDN, M. robertsii SDN) (Fig. 4B). The results showed that the expression of milR-7 increased significantly in the ΔMrSDN-STTM-milR-7 compared to the wild type, while revealing an expression level similar to that of the ΔMrSDN mutant. STTM-milR-7, in the complemented strain (Com-MrSDN-STTM-milR-7), showed milR-7 degradation efficiency similar to that of the wild-type strain (Fig. 4C). These results show that the SDN enzyme is necessary for the miR-like RNA degradation or blockage by STTM in fungi.
The phenotypes of the ΔMrSDN, Com-MrSDN, ΔMrSDN-STTM-milR-7, and Com-MrSDN-STTM-milR-7 mutants were examined. The growth rate of the ΔMrSDN mutant markedly increased by 26.2% (P < 0.05), while the conidial yield significantly decreased 61.8% (P < 0.005) compared with that of the MR-WT strain (Fig. 4D and E). Both the growth rate and conidial yield of the ΔMrSDN mutant were significantly different (P < 0.005) from those of STTM-gpdA-48-milR-7, suggesting an indispensable role of SDN in the function of STTM in targeting milR-7 for downregulation and the resultant phenotypes.
DISCUSSION
In this study, we explored the use of a synthetic noncoding RNA (sncRNA), STTM, to trigger the degradation of endogenous miR-like RNAs in fungi. In Arabidopsis spp., miR165/166 was degraded approximately 90% by STTM technology (14). The reduction of different miR-like RNAs by STTM was also observed at the level of ∼45% in fungi, similar to the level of miR-30d in animals (∼40%) but less than that in plants (∼90%), suggesting that the relatively low reduction of miRNAs by STTM may be attributed to an unidentified mechanism of STTM-triggered inhibition likely shared between fungi and animals (15). However, all transgenic fungi showed significant phenotypic differences in asexual growth or sporulation, demonstrating that STTM could be used to block miR-like RNA functions in fungi. To further confirm that phenotypes of different STTM strains were caused by decreased expression of miR-like RNAs in M. robertsii, potential milR-7 and milR-1 target genes were predicted, and these expression levels were detected. In Fusarium graminearum, both cytochrome P450 enzymes and cell division protein Cdc14, essential for conidial production, were predicted to be the targets of milR-7, and the expression of these two gene genes was significantly increased when milR-7 was blocked by STTM, which may lead to a high conidial yield (21, 22). Similarly, the vegetative cell wall protein gp1 and regulator of G protein signaling superfamily, which were required for fungal normal cell growth and performed a variety of functions in structural roles, were predicted to be the target genes of milR-1. The expression of these two target genes was enhanced when milR-1 was inhibited by STTM-gpdA-48-milR-1, which may lead to an increased growth rate (23, 24). All these data suggest that phenotypic changes in different STTM fungal strains were caused by the STTM-triggered inhibition of miR-like RNAs.
In M. robertsii, 15 miR-like RNAs were identified, and milR-7 was expressed significantly in the mycelium and conidium, suggesting a key role of milR-7 in the regulation of mycelial growth and conidiation (3). Therefore, milR-7 was chosen to evaluate STTM efficiency in M. robertsii. Unlike in plants and animals, in N. crassa, polymerase III was reported to be responsible for the transcription of the major miR-like RNAs produced, and the inhibition of Pol III activity abolishes the production of the most abundant miR-like RNAs and pre-milRNAs (20). Here, both RNA Pol II and III were used to drive the expression of STTM-milR-7. The results showed that only RNA Pol II-transcribed STTM-milR-7 effectively triggered the degradation of milR-7, while the RNA Pol III promoter was ineffective in blocking the functions of milR-7, suggesting that Pol II-transcribed 5′-capped and 3′-poly(A)-tailed STTM RNAs were more stable and thus more effective in degrading the targeted milRNAs in fungi (27).
STTMs could not function without a sufficient length (48 to 96 nucleotides) of the linked spacer between the two miRNA binding sites in plants, and longer spacers (88 to 96 nt) were a little more effective than the minimal-length (48 nt) spacer (14). STTMs of milR-7 with various lengths of spacers (48, 88, and 96 nucleotides) were also used to determine milR-7 degradation efficiency. The results revealed that STTM-milR-7 with various lengths of spacers showed degradation efficiency similar to that of milR-7, suggesting that a 48-nt spacer is sufficient in triggering the degradation/blockage of milRNAs in fungi. The inactivation efficiency of miR-like RNAs by STTM may be affected by the copy number of the milRNA binding site, as revealed by the miRNA sponge (SP) technology (28). However, in our hands, an STTM with four milR-7 binding sites showed no significant differences in milRNA degradation efficiencies compared to that of the STTM with the traditional two milR-7 binding sites, indicating that two copies of milRNA binding sites are sufficient in degradation/blockage of milRNA in fungi.
Other miR-like RNAs in M. anisopliae (milR-1) and A. flavus (AF-milR-4 and AF-milR-7) were also effectively blocked by the STTM structure, demonstrating that STTMs could function generally in fungi. The impact of blocking different miR-like RNAs in the life cycle of fungi was examined by the observation of phenotypic changes in transgenic STTM lines. In M. robertsii, we observed that the radial growth for STTM-gpdA-48-milR-1 was considerably increased and the conidial production for STTM-gpdA-48-milR-7 was significantly increased compared to those in the wild type. In A. flavus, we observed that the radial growth for STTM-gpdA-48-AF-milR-7 was noticeably increased and the conidial production for both STTM-gpdA-48-AF-milR-4 and STTM-gpdA-48-AF-milR-7 was significantly increased compared to the wild type. These data further confirm that STTMs could be used to study miR-like RNA function in fungi.
The SDN family of exonucleases was found to turn over small RNAs in Arabidopsis spp., and both SDN1 and SDN2 contribute to the reduction of miR-like RNAs triggered by STTMs in plants (14, 26). By performing a BLAST search using the amino acid sequences of Arabidopsis SDN proteins, only one type of homologous SDN protein was found in fungi, which is unlike plants that contain five members of an SDN family. Real-time qPCR showed that nine of 15 miR-like RNA expression levels in the M. robertsii sdn mutant increased significantly, while no significant change in expression was observed for the other six miR-like RNAs; this suggests that miR-like RNA degradation occurs partially through SDN, and other mechanisms in control of milRNA turnover may exist in fungi (Fig. S3). STTM-milR-7 transgenic fungi were generated in the background of the SDN mutant and showed no significant milR-7 expression difference compared to the SDN mutant, suggesting that miR-like RNA by STTMs is possibly through the SDN enzyme in fungi. Further analysis showed that SDN gene is widely conserved in fungi, and thus, STTM technology could be widely used for functional analysis of miR-like RNAs in fungi.
In conclusion, STTMs triggered the degradation of several fungal miR-like RNAs in two different fungal species, and the STTM technology developed in this study is an effective and powerful tool for the functional dissection of fungal miRNAs.
MATERIALS AND METHODS
Fungal strains, Agrobacterium spp., and growth conditions.
M. robertsii strain ARSEF 23 was grown on potato dextrose agar (PDA; 20% potato, 2% dextrose, and 2% agar [wt/vol]) in the dark at 28°C for 7 days. A. flavus NRRL 3357 was grown at 30°C on PDA plates in the dark for 7 days. A. tumefaciens strain AGL-1 was cultured on solid YEB medium (0.5% sucrose, 1% tryptone, 0.1% yeast extract, 0.05% MgSO4·7H2O, and 2% agar [wt/vol]) at 28°C.
Synthesis of STTM structure targeting milR-7 with different promoters.
STTM is an artificial noncoding RNA and composed of two miR-like RNA binding sites with a 48- to 88-nt-long spacer between them (Fig. 1A) (15). STTM structures targeting different miR-like RNAs were synthesized using 5ʹ-promoter-NNNNNNNNNNNbbbNNNNNNNNNNgttgttgttgttatggtctaatttaaatatggtctaaagaagaagaatNNNNNNNNNNNbbbNNNNNNNNNN-terminator-3ʹ, where “N” indicates the sequence that complements the target miR-like RNA, and “bbb” indicates the trinucleotide “bulge” formed between the miR-like RNA and its binding site corresponding to the region between the 10th and 11th positions of the miR-like RNA, which is designed to allow the STTM capturing the targeted small RNA RNA-induced silencing complexes (RISCs) without being cleaved by them. The underlined 48-bp lowercase nucleotides in the middle represent the spacer between the two miR-like RNA binding sites.
STTM structures targeting milR-7 with different promoters and terminators [gpdA promoter with the trpC terminator from Aspergillus nidulans, the U6 promoter with the poly(T) terminator from M. robertsii, and the SNR52 promoter with the SUP4 terminator] were synthesized including the EcoRI and PstI sites at the 5ʹ and 3ʹ ends of each sequence, respectively.
STTM plasmid construction and fungal transformation.
pDHt-SK-bar (harboring an ammonium glufosinate resistance gene) and pDHt-SK-ben (harboring a benomyl resistance gene) were used for transforming M. robertsii (Fig. S4A and B). The zeocin resistance gene (ble) was used as the selection marker for transformed A. flavus. The bar coding sequence was replaced by the ble coding sequence to produce the binary vector pDHt-SK-ble (Fig. S4C).
The synthesized STTM structures and pDHt-SK-bar vector were digested with EcoRI and PstI (TaKaRa, Dalian, China), respectively, in a 50-μl reaction mixture, as follows: STTM structures or pDHt-SK-bar vector, 5 μl; buffer (10×), 5 μl; EcoRI (10 U/μl), 2.5 μl; PstI (10 U/μl), 2.5 μl; and H2O, 35 μl. The reaction mixture was incubated at 37°C for 3 h and at 70°C for 10 min, and purification was performed using a DNA purification kit (Invitrogen), according to the manufacturer’s instructions. After digestion and purification, the DNA product of STTM structures and pDHt-SK-bar vector were ligated at 16°C overnight in a 20 μl volume, as follows: cleaved STTM structures, 5 μl; cleaved vector, 2 μl; ligase buffer (10×), 2 μl; DNA ligase (3 U/μl), 1 μl; and H2O, 10 μl. The product was transformed into Escherichia coli cells and verified by DNA sequencing, and the positive plasmids were transformed into the fungi through Agrobacterium spp.
STTM structures targeting milR-7 with various spacer lengths (48, 88, and 96 nt) and four complementary sequences targeting milR-1, AF-milR-4, and AF-milR-7, were synthesized and then inserted into the corresponding sites of the binary vector as mentioned above for Agrobacterium-mediated fungal transformation (Table 2 and Fig. S5). The synthesized sequences are listed in Fig. S6, and the strains and plasmids used are listed in Table 2.
TABLE 2.
Strains and plasmids used in this study
| Strain | Characteristics | Plasmid used |
|---|---|---|
| MR-WT | Wild-type Metarhizium robertsii ARSEF 23 | |
| AF-WT | Wild-type Aspergillus flavus NRRL 3357 | |
| STTM-gpdA-48-milR-7 | STTM structures (48-nt spacer length and 2 milRNA binding sites) targeting M. robertsii milR-7 with gpdA promoter | PgpdA-STTM-48nt-milR-7-TtrpC |
| STTM-U6-48-milR-7 | STTM structures (48-nt spacer length and 2 milRNA binding sites) targeting M. robertsii milR-7 with U6 promoter | PU6-STTM-48nt-milR-7-TSUP4 |
| STTM-SNR52-48-milR-7 | STTM structures (48-nt spacer length and 2 milRNA binding sites) targeting M. robertsii milR-7 with SNR52 promoter | PSNR52-STTM-48nt-milR-7-Tpoly(T) |
| STTM-gpdA-2×48-milR-7 | STTM structures (48-nt spacer length and 4 milRNA binding sites) targeting M. robertsii milR-7 with gpdA promoter | PgpdA-STTM-2×48nt-milR-7-TtrpC |
| STTM-gpdA-88-milR-7 | STTM structures (88-nt spacer length and 2 milRNA binding sites) targeting M. robertsii milR-7 with gpdA promoter | PgpdA-STTM-88nt-milR-7-TtrpC |
| STTM-gpdA-96-milR-7 | STTM structures (96-nt spacer length and 2 milRNA binding sites) targeting M. robertsii milR-7 with gpdA promoter | PgpdA-STTM-96nt-milR-7-TtrpC |
| STTM-gpdA-48-milR-1 | STTM structures (48-nt spacer length and 2 milRNA binding sites) targeting M. robertsii milR-1 with gpdA promoter | PgpdA-STTM-48nt-milR-1-TtrpC |
| STTM-gpdA-48-AF-milR-4 | STTM structures (48-nt spacer length and 2 milRNA binding sites) targeting A. flavus milR-4 with gpdA promoter | PgpdA-STTM-48nt-AF-milR-4-TtrpC |
| STTM-gpdA-48-AF-milR-7 | STTM structures (48-nt spacer length and 2 milRNA binding sites) targeting A. flavus milR-7 with gpdA promoter | PgpdA-STTM-48nt-AF-milR-7-TtrpC |
| ΔMrSDN | SDN gene mutant | pDHt-SDN-bar |
| Comp-MrSDN | Complementation strain of ΔMrSDN mutant | Com-pben-SDN |
| ΔMrSDN-STTM-milR-7 | STTM-gpdA-48-milR-7 transgenic fungus in the background of the SDN mutant | pDHt-SDN-bar-STTM |
| Comp-MrSDN-STTM-milR-7 | Complementation strain of ΔMrSDN-STTM-milR-7 | Com-pben-SDN |
Bioinformatic analysis of SDN homologues in different fungi.
SDN1 (At3g50100) and SDN2 (At5g05540) sequences from Arabidopsis spp. in the NCBI database were used as queries to search the different fungal genome databases. The protein domains were predicted by an online BLAST search (https://blast.ncbi.nlm.nih.gov/Blast.cgi), and alignment sequences were used for phylogenetic analysis by MEGA7 (http://www.megasoftware.net) using a neighbor-joining method.
Generation of gene deletion and complementation mutant.
Target genes were deleted as described previously (29). In brief, the 5ʹ and 3ʹ flanking regions of the MrSDN gene were amplified and inserted into the binary vector pDHt-SK-bar. The complementation vector Com-pben-SDN was constructed using the entire MrSDN gene plus 1.1 and 0.5 kb of the upstream and downstream sequences, respectively, and transformed into the ΔMrSDN mutant strain (Fig. S7). The primers used are listed in Table 3.
TABLE 3.
PCR primers used in this study
| Primer by design function | Forward primer (5′–3′) | Reverse primer (5′–3′) |
|---|---|---|
| STTM structure construction | ||
| Promoter-STTM-terminator | CCTCGTGACCACCCTGGAATTC | CCAATGCATTGGTTCTGCAG |
| ble gene | ACTAGTATGGCCAAGTTGACCAGTGCCG | ACTAGTTCAGTCCTGCTCCTCGGCCACG |
| Disruption and complementation of SDN | ||
| SDN 5′ flanking | GGAATTCTGGACGCCAAGAGTAACTGC | CGGGATCCGTCACTGTGATGGTGAGGAGC |
| SDN 3′ flanking | GCTCTAGACAGGGCTGGTGGAACAAGAAC | GCTCTAGACTGGACCTCTTGGGTAGTTCTGC |
| SDN examination | TAGCCTGAAGCGCACGAGTCCC | GGCGTCCTGTTGTTCCTCCATCC |
| Comp-SDN | GCTCTAGATGGACGCCAAGAGTAACTGC | GCTCTAGACTGGACCTCTTGGGTAGTTCTGC |
| Real-time qPCR | ||
| Mr-U6 | GAACTCTGTTACTAACATACGCAC | TTTAGCTTCTCTTTGATTGAGCGT |
| AF-18S | CTGAAGACTAACTACTGCGAAAGC | GAGCGGGTCATCATAGAAACAC |
| milR-7-RT-loop | GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTAAACGCT | |
| milR-7-F | ATGGTTCGTGGGGCGGGTGCTGAGAAAG | GCAGGGTCCGAGGTATTC |
| milR-1-RT-loop | GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTACCTATT | |
| milR-1-F | ATGGTTCGTGGGTATCTTGTGGACTAATA | GCAGGGTCCGAGGTATTC |
| AF-milR-4-RT-loop | GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACCCCGTC | |
| AF-milR-4-F | ATGGTTCGTGGGGTGGAGGATTGGGACG | GCAGGGTCCGAGGTATTC |
| AF-milR-7-RT-loop | GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTACCACCC | |
| AF-milR-7-F | ATGGTTCGTGGGGTGGGAGGTTGAGTGG | GCAGGGTCCGAGGTATTC |
| milR-2-RT-loop | GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACCTTGCTC | |
| milR-2-F | ATGGTTCGTGGGTACAAGGGCACGAGCAA | GCAGGGTCCGAGGTATTC |
| milR-3-RT-loop | GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAATAGTGG | |
| milR-3-F | ATGGTTCGTGGGTTGTCGAGGCATACC | GCAGGGTCCGAGGTATTC |
| milR-4-RT-loop | GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAGATCAGCT | |
| milR-4-F | ATGGTTCGTGGGTCGAGGAGCAGAAGCT | GCAGGGTCCGAGGTATTC |
| milR-5-RT-loop | GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTATCCCTC | |
| milR-5-F | ATGGTTCGTGGGTTAACAAGGCGTCGA | GCAGGGTCCGAGGTATTC |
| milR-6-RT-loop | GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAACACAGC | |
| milR-6-F | ATGGTTCGTGGGTTTGGAGAGGCTGCTG | GCAGGGTCCGAGGTATTC |
| milR-8-RT-loop | GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAAUAAGUC | |
| milR-8-F | ATGGTTCGTGGGTTGCATGATGAGACTT | GCAGGGTCCGAGGTATTC |
| milR-9-RT-loop | GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCTGATCTAC | |
| milR-9-F | ATGGTTCGTGGGTGCCTAGGCAGGGTAG | GCAGGGTCCGAGGTATTC |
| milR-10-RT-loop | GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAGCCTTC | |
| milR-10-F | ATGGTTCGTGGGAGGGATCTAGAAAAG | GCAGGGTCCGAGGTATTC |
| milR-11-RT-loop | GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCAACGACGA | |
| milR-11-F | ATGGTTCGTGGGTGCAGGGGAGCATCGT | GCAGGGTCCGAGGTATTC |
| milR-12-RT-loop | GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAATGCCAGC | |
| milR-12-F | ATGGTTCGTGGGAGACCTCGTTGATGCTG | GCAGGGTCCGAGGTATTC |
| milR-13-RT-loop | GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTTGTCCTCG | |
| milR-13-F | ATGGTTCGTGGGCGACGACTCTGGCGAG | GCAGGGTCCGAGGTATTC |
| milR-14-RT-loop | GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGCCTTCTTT | |
| milR-14-F | ATGGTTCGTGGGTTAAAGATGTGGAAAA | GCAGGGTCCGAGGTATTC |
| milR-15-RT-loop | GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGAGCCCCGG | |
| milR-15-F | ATGGTTCGTGGGGATGTCGAATCGTGCC | GCAGGGTCCGAGGTATTC |
| MAA_03019 | GCTGCTGACGCTCGTGGTCG | GCGAGGTGCTGCGGGACTTG |
| MAA_01304 | ACACTGACACCAACAGGCAAGAATC | AGGGGCAGGAAGAAATGAGGC |
| MAA_05318 | CGCAATGTGGATGACGAAGAG | AACGGTGACCTGTCGAGAAGG |
| MAA_00354 | ATGGAGTGCGAGCTGGACCGAATCG | CGATTCGGTCCAGCTCGCACTCCAT |
| MAA_04883 | CCTACCGAGCCAGCAAGACG | GGCAGGAAAGGACCAAAGACC |
| MAA_06604 | TTCATCCTCTGGCTCGCTTTCC | GGCCGTATTCTCCATGTAATTCTGCA |
| MAA_04521 | GCGTGCCAACAATCTAACCG | TTCATGCTCTTCATGTCGCAAA |
| MAA_09298 | CGGACGTTTGAGCTGATAAACCTGG | CGTAGTCGCCATAGTCCCACTCCCT |
| MAA_04522 | TCTTCGTGGGCACAGCATCA | TGGAATCACTAACGTCGTTCTCC |
| MAA_06363 | ATGGCGAACCTACCAGAAGAA | CCACCTTGATAATAGTCGGAGC |
| MAA_03396 | GAACACGAACGGCGACACTG | TGGAATCGGAGAAGTTCTTACGG |
| MAA_02186 | AAGGGTAGACGCCGTTGAAAT | CCATTGTTTACCACCGACCTG |
| MAA_04806 | GGTAAGACGCTAGGCGAACATAA | CATTTCATCGGCAAGAATCCC |
| MAA_03776 | GACGTGGCCCAACGAACCGACTA | GGACTGACCGTGTTCAGCGAGTACAGA |
| MAA_02361 | TTCCGCAGGGCTACTCACTCAA | CATGTCGGCGATGGGCTTGT |
| MAA_07800 | GTCTCGCAACATCAACGACACTCA | CAGGGACGTAAAGGGCAATGAG |
| MAA_03118 | TGATGCCGCCGAGGCTATTA | AGTGCCGCCCAGAGCATTTC |
| MAA_08707 | CCTATGAGGAGCAGCAAAGAGCC | CCCTTTCTGAACCCATCAAACAA |
| MAA_04793 | AGAAGCTAGAACGGGCTGTGAAT | CTTCGGTGAGTGTCTGAAAGTGC |
| MAA_02764 | AAAGGGCACAGTTCCAGCAAA | TGGATAACAAGGTGGCAGGGTC |
Expression analysis for miR-like RNA using stem-loop RT-qPCR.
Total RNA was extracted with the TRIzol reagent (Invitrogen) and treated with recombinant DNase I (rDNase I; Sigma). A stem-loop reverse transcription-quantitative PCR (RT-qPCR) method was used to quantitate miR-like RNA expression as in a previous study (3). Briefly, a stem-loop RT primer was used to reverse-transcribe mature miR-like RNAs to complementary DNAs (cDNAs). Quantitative RT-PCR amplification was performed with a SYBR green kit (TaKaRa, Dalian, China) and the CFX96 system (Bio-Rad, CA, USA). All reactions were run in triplicate. Values were obtained by normalizing to 5S rRNA, and the 2−ΔΔCT method was used for calculating the relative gene expression levels. Each experiment was performed six times, and all the data are shown as the mean ± standard error of the mean (SEM) of six replicates. The primers used are presented in Table 3.
Phenotypic assays.
For the fungal growth assay, conidial suspensions (1 × 106 conidia ml−1) of wild-type (WT) and mutant cultures growing on PDA plates were spotted in the center of PDA plates. The radial growth (colony diameter) of the vegetative mycelia at 28°C was measured daily.
For examination of conidial yield, the sporulation capacity of WT and each mutant was observed by spreading 100 μl freshly isolated conidia on PDA plates and culturing for 20 days at 28°C. The inoculated plates were sampled daily to evaluate sporulation capacity. All experiments were performed in six replicates for all phenotypic assays.
Prediction of milR-7 and milR-1 target genes and expression analysis of these target genes in STTM-gpdA-48-milR-7 and STTM-gpdA-48-milR-1.
PsRobot, TargetFinder, and psRNATarget were used for the prediction of miR-like RNA targets based on the methods described by Zeng et al. (11). In brief, the following criteria were used: (i) fewer than four mismatches in total and no more than two adjacent mismatches; (ii) in positions 1 to 12, no more than 2.5 mismatches; and (iii) after position 17, one gap or bulge was permitted. Sequence data of high-throughput transcriptomics were used for miRNA target prediction (18). Total RNA was extracted from different fungal tissue, and quantitative RT-PCR amplification was performed as mentioned above.
Statistical analysis.
The data were analyzed with a one-way analysis of variance (ANOVA) followed by Dunnett’s multiple comparison, correlation coefficient, and Tukey’s tests using the SPSS version 23.0 software (IBM SPSS, IL, USA). The values are expressed as the mean ± standard error of the mean (SEM), and all results are expressed as the mean ± SEM. A P value of <0.05 was considered statistically significant.
Supplementary Material
ACKNOWLEDGMENTS
This work was supported by the National Science Foundation of China (grants 31471821, 31772226, and 31272096) and the National Key R&D Program of China (grant 2017YFD0200400).
We declare no conflicts of interest.
Footnotes
Supplemental material for this article may be found at https://doi.org/10.1128/AEM.03132-18.
REFERENCES
- 1.Reis RS. 2017. The entangled history of animal and plant microRNAs. Funct Integr Genomics 17:127–134. doi: 10.1007/s10142-016-0513-0. [DOI] [PubMed] [Google Scholar]
- 2.Lee HC, Li L, Gu W, Xue Z, Crosthwaite SK, Pertsemlidis A, Lewis ZA, Freitag M, Selker EU, Mello CC, Liu Y. 2010. Diverse pathways generate microRNA-like RNAs and Dicer-independent small interfering RNAs in fungi. Mol Cell 38:803–814. doi: 10.1016/j.molcel.2010.04.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Zhou Q, Wang Z, Zhang J, Meng H, Huang B. 2012. Genome-wide identification and profiling of microRNA-like RNAs from Metarhizium anisopliae during development. Fungal Biol 116:1156–1162. doi: 10.1016/j.funbio.2012.09.001. [DOI] [PubMed] [Google Scholar]
- 4.Zhou J, Fu Y, Xie J, Li B, Jiang D, Li G, Cheng J. 2012. Identification of microRNA-like RNAs in a plant pathogenic fungus Sclerotinia sclerotiorum by high-throughput sequencing. Mol Genet Genomics 287:275–282. doi: 10.1007/s00438-012-0678-8. [DOI] [PubMed] [Google Scholar]
- 5.Lau SK, Chow WN, Wong AY, Yeung JM, Bao J, Zhang N, Lok S, Woo PC, Yuen KY. 2013. Identification of microRNA-like RNAs in mycelial and yeast phases of the thermal dimorphic fungus Penicillium marneffei. PLoS Negl Trop Dis 7:e2398. doi: 10.1371/journal.pntd.0002398. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Bai Y, Lan F, Yang W, Zhang F, Yang K, Li Z, Gao P, Wang S. 2015. sRNA profiling in Aspergillus flavus reveals differentially expressed miRNA-like RNAs response to water activity and temperature. Fungal Genet Biol 81:113–119. doi: 10.1016/j.fgb.2015.03.004. [DOI] [PubMed] [Google Scholar]
- 7.Zhang W, Li X, Ma L, Urrehman U, Bao X, Zhang Y, Zhang CY, Hou D, Zhou Z. 2018. Identification of microRNA-like RNAs in Ophiocordyceps sinensis. Sci China Life Sci doi: 10.1007/s11427-017-9277-9. [DOI] [PubMed] [Google Scholar]
- 8.Lau AY-T, Cheng X, Cheng CK, Nong W, Cheung MK, Chan RH-F, Hui JHL, Kwan HS. 2018. Discovery of microRNA-like RNAs during early fruiting body development in the model mushroom Coprinopsis cinerea. PLoS One 13:e0198234. doi: 10.1371/journal.pone.0198234. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Kang K, Zhong J, Jiang L, Liu G, Gou CY, Wu Q, Wang Y, Luo J, Gou D. 2013. Identification of microRNA-like RNAs in the filamentous fungus Trichoderma reesei by solexa sequencing. PLoS One 8:e76288. doi: 10.1371/journal.pone.0076288. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Jiang D, Zhu W, Wang Y, Sun C, Zhang KQ, Yang J. 2013. Molecular tools for functional genomics in filamentous fungi: recent advances and new strategies. Biotechnol Adv 31:1562–1574. doi: 10.1016/j.biotechadv.2013.08.005. [DOI] [PubMed] [Google Scholar]
- 11.Zeng W, Wang J, Wang Y, Lin J, Fu Y, Xie J, Jiang D, Chen T, Liu H, Cheng J. 2018. Dicer-like proteins regulate sexual development via the biogenesis of perithecium-specific microRNAs in a plant pathogenic fungus Fusarium graminearum. Front Microbiol 9:818. doi: 10.3389/fmicb.2018.00818. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Yan J, Zhao C, Zhou J, Yang Y, Wang P, Zhu X, Tang G, Bressan RA, Zhu JK. 2016. The miR165/166 mediated regulatory module plays critical roles in ABA homeostasis and response in Arabidopsis thaliana. PLoS Genet 12:e1006416. doi: 10.1371/journal.pgen.1006416. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Qiong L, Lai CC, Sheng SH, Bao WS. 2017. The effects of mro-miR-33 on the conidial production in Metarhizium robertsii. Mycosystema 36:671–678. [Google Scholar]
- 14.Yan J, Gu Y, Jia X, Kang W, Pan S, Tang X, Chen X, Tang G. 2012. Effective small RNA destruction by the expression of a short tandem target mimic in Arabidopsis. Plant Cell 24:415–427. doi: 10.1105/tpc.111.094144. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Tang G, Yan J, Gu Y, Qiao M, Fan R, Mao Y, Tang X. 2012. Construction of short tandem target mimic (STTM) to block the functions of plant and animal microRNAs. Methods 58:118–125. doi: 10.1016/j.ymeth.2012.10.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Zhang H, Zhang J, Yan J, Gou F, Mao Y, Tang G, Botella JR, Zhu J-K. 2017. Short tandem target mimic rice lines uncover functions of miRNAs in regulating important agronomic traits. Proc Natl Acad Sci U S A 114:5277–5282. doi: 10.1073/pnas.1703752114. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Lord JC. 2005. From Metchnikoff to Monsanto and beyond: the path of microbial control. J Invertebr Pathol 89:19–29. doi: 10.1016/j.jip.2005.04.006. [DOI] [PubMed] [Google Scholar]
- 18.Gao Q, Jin K, Ying SH, Zhang Y, Xiao G, Shang Y, Duan Z, Hu X, Xie XQ, Zhou G, Peng G, Luo Z, Huang W, Wang B, Fang W, Wang S, Zhong Y, Ma LJ, St Leger RJ, Zhao GP, Pei Y, Feng MG, Xia Y, Wang CS. 2011. Genome sequencing and comparative transcriptomics of the model entomopathogenic fungi Metarhizium anisopliae and M. acridum. PLoS Genet 7:e1001264. doi: 10.1371/journal.pgen.1001264. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Klich MA. 2007. Aspergillus flavus the major producer of aflatoxin. Mol Plant Pathol 8:713–722. doi: 10.1111/j.1364-3703.2007.00436.x. [DOI] [PubMed] [Google Scholar]
- 20.Yang Q, Li L, Xue Z, Ye Q, Zhang L, Li S, Liu Y. 2013. Transcription of the major Neurospora crassa microRNA-like small RNAs relies on RNA polymerase III. PLoS Genet 9:e1003227. doi: 10.1371/journal.pgen.1003227. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Črešnar B, Petrič Š. 2011. Cytochrome P450 enzymes in the fungal kingdom. Biochim Biophys Acta 1814:29–35. doi: 10.1016/j.bbapap.2010.06.020. [DOI] [PubMed] [Google Scholar]
- 22.Chen A, Xie Q, Lin Y, Xu H, Shang W, Zhang J, Zhang DM, Zheng WH, Li GP, Wang ZH. 2016. Septins are involved in nuclear division, morphogenesis and pathogenicity in Fusarium graminearum. Fungal Genet Biol 94:79–87. doi: 10.1016/j.fgb.2016.07.005. [DOI] [PubMed] [Google Scholar]
- 23.Trow JA. 2013. Processing of GPI-anchored cell wall proteins in Saccharomyces cerevisiae and a role for DCW1. The Johns Hopkins University, Baltimore, MD. [Google Scholar]
- 24.Corrochano LM, Kuo A, Marcet-Houben M, Polaino S, Salamov A, Villalobos-Escobedo JM, Grimwood J, Álvarez MI, Avalos J, Bauer D, Benito EP, Benoit I, Burger G, Camino LP, Cánovas D, Cerdá-Olmedo E, Cheng J-F, Domínguez A, Eliáš M, Eslava AP, Glaser F, Gutiérrez G, Heitman J, Henrissat B, Iturriaga EA, Lang BF, Lavín JL, Lee SC, Li W, Lindquist E, López-García S, Luque EM, Marcos AT, Martin J, McCluskey K, Medina HR, Miralles-Durán A, Miyazaki A, Muñoz-Torres E, Oguiza JA, Ohm RA, Olmedo M, Orejas M, Ortiz-Castellanos L, Pisabarro AG, Rodríguez-Romero J, Ruiz-Herrera J, Ruiz-Vázquez R, Sanz C, Schackwitz W, et al. 2016. Expansion of signal transduction pathways in fungi by extensive genome duplication. Curr Biol 26:1577–1584. doi: 10.1016/j.cub.2016.04.038. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Marchler-Bauer A, Bo Y, Han L, He J, Lanczycki CJ, Lu S, Chitsaz F, Derbyshire MK, Geer RC, Gonzales NR, Gwadz M, Hurwitz DI, Lu F, Marchler GH, Song JS, Thanki N, Wang Z, Yamashita RA, Zhang D, Zheng C, Geer LY, Bryant SH. 2017. CDD/SPARCLE: functional classification of proteins via subfamily domain architectures. Nucleic Acids Res 45:D200–D203. doi: 10.1093/nar/gkw1129. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Ramachandran V, Chen X. 2008. Degradation of microRNAs by a family of exoribonucleases in Arabidopsis. Science 321:1490–1492. doi: 10.1126/science.1163728. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Guhaniyogi J, Brewer G. 2001. Regulation of mRNA stability in mammalian cells. Gene 265:11–23. doi: 10.1016/S0378-1119(01)00350-X. [DOI] [PubMed] [Google Scholar]
- 28.Ebert MS, Neilson JR, Sharp PA. 2007. MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells. Nat Methods 4:721. doi: 10.1038/nmeth1079. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Wang Y, Wang T, Qiao L, Zhu J, Fan J, Zhang T, Wang Z, Li W, Chen A, Huang B. 2017. DNA methyltransferases contribute to the fungal development, stress tolerance and virulence of the entomopathogenic fungus Metarhizium robertsii. Appl Microbiol Biotechnol 101:4215–4226. doi: 10.1007/s00253-017-8197-5. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.