Skip to main content
Cell Proliferation logoLink to Cell Proliferation
. 2009 Aug 25;42(6):762–769. doi: 10.1111/j.1365-2184.2009.00635.x

Differential effects of Nucleostemin suppression on cell cycle arrest and apoptosis in the bladder cancer cell lines 5637 and SW1710

P Nikpour 1, S J Mowla 1, S M Jafarnejad 2, U Fischer 3, W A Schulz 4
PMCID: PMC6495913  PMID: 19706044

Abstract

Objectives:  The Nucleostemin (NS) gene encodes a nucleolar protein enriched in adult and embryonic stem cells. NS is thought to regulate cancer cell proliferation, but the mechanisms involved are poorly understood. In this study, we have investigated the role of NS in bladder cancer.

Materials and methods:  Expression of NS was determined by quantitative reverse transcription–polymerase chain reaction in bladder carcinoma cell lines and in normal uro‐epithelial cell cultures. We used an RNAi strategy to investigate the function of NS in two selected carcinoma cell lines.

Results:  High NS expression was found in most bladder carcinoma cell lines and normal uro‐epithelial cells. Knockdown of NS expression induced a severe decline in cell proliferation in 5637 and SW1710 cell lines, both with mutant p53. Apoptosis was more strongly enhanced in 5637 cells lacking RB1 than in SW1710 cells lacking p16INK4A. Moreover, NS‐siRNA‐treated 5637 cells accumulated mainly in G2/M, whereas SW1710 cells arrested in G0/G1.

Conclusion:  Our data indicate that NS expression is necessary for cell proliferation and evasion of apoptosis in bladder cancer cells, independent of its effect on p53. Also, we speculate that the precise effect of NS on cell cycle regulation may relate to functional status of RB1 and CDKN2A/p16INK4A.

Introduction

Nucleostemin (NS) is a newly characterized nucleolar protein, primarily located in the nucleoli of embryonic and adult stem cells, but not in differentiated cells of most adult tissues (1, 2, 3, 4, 5). Expression of NS is abruptly down‐regulated during differentiation prior to terminal stages (1, 6, 7). However, observations of NS expression in adult renal tissue (8) or its re‐induction in the myocardium following cardiomyopathic injury (7, 9) call for re‐evaluation of NS expression and function in normal and pathological conditions.

Several knockdown experiments suggest that NS functions to maintain the proliferative capacity of stem and cancer cells. It is generally agreed that suppression of NS protein by siRNA blocks cell cycle progression and inhibits cell proliferation both in cultured stem cells and cancer cell lines (1, 4, 10, 11, 12). However, the precise effects of this vary between different cell lines. For example, knockdown of NS in PC3, a human prostate cancer cell line, results in increased numbers of apoptotic cells (13), whereas apoptosis was not enhanced in NS‐mutant mouse embryos (14). Likewise, in most cell lines, NS knockdown causes G0/G1 arrest, whereas in some others, G2/M arrest was observed (4, 11, 12, 13, 15). The reasons for these differences are not yet understood.

Co‐immunoprecipitation and pull‐down experiments have suggested that NS interacts with p53 (1). However, whether NS controls cell proliferation only in a p53‐dependent manner remains unclear. It seems plausible at present that there are p53‐dependent and p53‐independent mechanisms by which NS might influence cell proliferation (4, 11). NS may be important for proliferation of cancer cells, since its over‐expression has been reported in a number of human cancer cell lines and in several malignant tissues (1, 8, 16, 17). However, if NS functions solely through p53, it should not be essential in p53‐mutant cancer cells.

In this study, we examined expression of NS in a series of bladder carcinoma cell lines. A considerable fraction of invasive bladder cancers (18, 19) and most bladder cancer cell lines (20) have mutant p53. In addition, all bladder cancer cell lines harbour defects in key regulators of the cell cycle, either loss of p16INK4A, or the more severe loss of RB1 (20, 21). We used an RNAi strategy to investigate the function of NS in two bladder cancer cell lines with different genetic alterations; the 5637 line lacks RB1, whereas SW1710 lacks CDKN2A/p16INK4A. Both cell lines have mis‐sense mutations inactivating p53.

Materials and Methods

Cell lines and cell culture

All bladder carcinoma cell lines were obtained from the German Collection of Microorganisms and Cell Cultures (DSMZ), Braunschweig, Germany, and were cultured in Dulbecco’s modified Eagle’s medium or RPMI‐1640 (Gibco Life Technologies, Karlsruhe, Germany), supplemented with 10% foetal calf serum and 100 mg/ml penicillin/streptomycin, as described elsewhere (22). Normal uro‐epithelial cells were prepared from ureters of nephrectomy patients by a standard method (23) with minor modifications (22). Normal cells were routinely maintained in keratinocyte serum‐free medium (KSFM, Gibco Life Technologies), supplemented with 50 mg/ml bovine pituitary extract (BPE), 5 ng/ml epidermal growth factor (EGF) and 30 ng/ml cholera toxin. After the first passage, at which non‐epithelial cells were removed, they were used for further experiments.

RNA interference

Double‐stranded, short (21‐mer) interfering RNA (siRNA) corresponding to NS mRNA and an irrelevant siRNA were designed with the following sense and anti‐sense sequences as described previously (4), and were purchased from MWG (Ebersberg, Germany):

NS:

Sense: GAACUAAAACAGCAGCAGdTdT

Anti‐sense: UCUGCUGCUGUUUUAGUUCdTdT

Irrelevant:

Sense: CUGAUGCAGGUAAUCGCGUdTdT

Anti‐sense: ACGCGAUUACCUGCAUCAGdTdT

Cells were harvested with 0.25% trypsin, 1 mm EDTA in phosphate‐buffered saline (PBS) without Ca2+ and Mg2+, and were plated in six‐well plates at 20 × 104 cells per well. Next day, when cultures were 30–50% confluent, siRNAs were transfected into cells using Lipofectamine™ RNAiMAX Transfection Reagent (Invitrogen, Carlsbad, CA, USA). In brief, 5 μl siRNA (20 μm solution) was mixed with 6 μl RNAiMAX reagent in 489 μl Optimem (Invitrogen) for 20 min; the mixture was then added to cells at final volume of 2.5 ml. For some assays, cells were transfected again after 3 days and cultured for 2 further days before harvesting. Furthermore, to rule out possible false results due to toxicity or off‐target effects of siRNAs as such, a blank control (without siRNA treatment) was run in parallel in all assays.

RNA extraction

Total RNA was isolated using Qiazol reagent and purified using RNeasy columns (both from Qiagen, Hilden, Germany). cDNA synthesis was performed using SuperScriptII reverse transcriptase (Promega, Mannheim, Germany) with oligo‐dT primers, as described elsewhere (24).

Reverse transcription–polymerase chain reaction (RT‐PCR)

Real‐time RT‐PCR assays were performed using the LightCycler II apparatus (Roche, Mannheim, Germany). Real‐time RT‐PCR for Nucleostemin and TBP mRNAs was performed using specific Quantitect primer assays (Qiagen) using the QuantiTect SYBR Green PCR Kit (Qiagen). Real‐time RT‐PCR for GAPDH and BTG2 mRNAs was performed using specific primers (GAPDH, Forward: TCCCATCACCATCTTCCA and Reverse: CAT CACGCCACAGTTTCC, BTG2, Forward: GAAGGGAA CCGACATGCTC and Reverse: CCAGTGGTGTTTGTAGTGCTC). LightCycler‐FastStart DNA Master PLUS SYBR Green I kit (Roche) was used for measurement of GAPDH mRNA and the QuantiTect SYBR Green PCR Kit (Qiagen) was used for the other three genes. PCR for the genes included an initial denaturation step at 95 °C for 15 min (10 min for GAPDH), followed by 40 amplification cycles consisting of denaturation at 94 °C for 15 s (95 °C for GAPDH), 55 °C for 20 s (59 °C for 10 s for GAPDH), and extension at 72 °C for 20 s (10 s for GAPDH). All measurements were performed in at least duplicates, until there was less than 10% difference. Relative gene expression was calculated using the standard curve method. During initial pilot experiments, we also ran agarose gels from the finished PCRs that proved the products had the correct expected sizes.

Viability assay

Cell viability was determined using Cell Titer‐Glo Luminescent Cell Viability Assay (Promega), performed in accordance with the manufacturer’s instructions. This is a homogeneous assay for determining number of viable, metabolically active cells in a culture, based on quantification of ATP level. The assay involves adding a reagent that in a single step generates a luminescent signal proportional to amount of ATP present in cells and is linear across many orders of magnitude. Results were based on four separate experiments and quantity of viable cells is reflected by number of relative luminescence units.

Cell cycle analysis

For fluorescence‐activated cell sorting analysis, cells were harvested by trypsinization 48 h after the second transfection, washed in PBS, then stained with 50 μg/ml propidium iodide solution containing 0.1% Triton X‐100 and sodium citrate, as described elsewhere (25), and were analyzed for cell cycle distribution using FACS Calibur instrumentation (Becton Dickinson, Heidelberg, Germany). Cell cycle profiles were analysed using WinMDI version 2.8 software.

Analysis of apoptosis

Apoptosis was quantified by measuring caspase‐3 and caspase‐7 activities using Caspase‐Glo 3/7 reagent (Promega). Briefly, after adding Caspase‐Glo 3/7 reagent to cell suspension aliquots in quadruplicate, and incubating them at room temperature for 1 h, luminescence of each sample was measured using a plate reader luminometer (Victor2, PerkinElmer, Waltham, MA, USA). Following subtraction of blank, values were normalized to the cell numbers.

Western blotting

Cells were lysed 48 h after the second siRNA transfection in RIPA buffer containing 1% Triton X‐100, 0.5% sodium deoxycholate, 0.1% sodium dodecyl sulphate and complete protease inhibitor cocktail (Sigma, Munich, Germany). Lysates containing equivalent of 30 μg protein per lane were electrophoresed on 12% sodium dodecyl sulphate–polyacrylamide gel, and were blotted on Immobilon‐P membranes (Millipore, Hamburg, Germany). Blots were blocked for 1 h with 5% milk powder in Phosphate buffer saline containing 0.2% Tween 20 (PBST). Samples were then probed with polyclonal antibodies against NS (1 : 500; Santa Cruz Biotechnology, Santa Cruz, CA, USA), α‐tubulin (1 : 10000; Sigma) and subsequently, with horseradish peroxidase‐conjugated anti‐goat (1 : 5000; Jackson Immunoresearch, Hamburg, Germany) or anti‐mouse (1 : 5000; Santa Cruz Biotechnology) antibodies. Immunoreactivity was visualized using a chemiluminescence kit (Amersham Biosciences, Freiburg, Germany).

Statistical analyses

All experiments were replicated at least in triplicate, and statistical significance was measured using Student’s t‐test. P‐values of <0.05 were considered statistically significant.

Results

NS expression in bladder carcinoma cell lines and normal uro‐epithelial cells

We compared relative expression of NS in several established bladder carcinoma cell lines and several independent primary cultures of normal uro‐epithelial cells (Fig. 1). Interestingly, we observed high NS expression in most examined normal uro‐epithelial cells. Ten out of 18 carcinoma cell lines displayed comparable or higher NS relative expression than the mean ± standard deviation of normal cells. Nevertheless, NS expression was very low in some other lines, especially T24, RT4, EJ and TSU‐PR1. For knockdown experiments, we initially selected the 5637 cell line, with mutant TP53 and RB1 but wild‐type CDKN2A, with high NS expression. Subsequently, we used another cell line, SW1710, with mutant TP53 and homozygous deletion of CDKN2A but wild‐type RB1, with nearly the same level of NS expression.

Figure 1.

Figure 1

Expression of Nucleostemin (NS) in bladder cancer cell lines and normal urothelial cells. Histograms comparing relative gene expression of NS to GAPDH as determined by quantitative real‐time RT‐PCR in various bladder cancer cell lines (black columns) and several independent cultures of normal uro‐epithelial cells (NUEC, white columns). Cancer cell lines with reported wild‐type p53 are indicated by an asterisk. Values shown represent mean ± standard deviation.

Specific down‐regulation of NS expression after RNAi treatment

Application of NS‐siRNA resulted in a dramatic reduction in NS mRNA expression in both 5637 (P = 0.003) and SW1710 (P = 0.03) cell lines compared to cells treated with irrelevant (IR)‐siRNA (Fig. 2a,b). Western blotting performed on cell lysates of IR‐siRNA‐ or NS‐siRNA‐treated cells demonstrated that NS protein was likewise down‐regulated in both cell lines following siRNA treatment (Fig. 2c,d).

Figure 2.

Figure 2

 Downregulation of Nucleostemin (NS) expression by siRNA in bladder cancer cell lines. Knocking down expression of NS by means of siRNA caused efficient down‐regulation of NS mRNA in 5637 (a) and SW1710 (b) cell lines as determined by quantitative RT‐PCR, and of protein levels (c and d, respectively) as determined by Western blotting, after 72 h. In (a) and (b), relative expression of NS in IR‐siRNA‐treated controls was adjusted to 100. α‐tubulin was used as loading control for Western blotting in (c) and (d).

Cell viability reduction after NS suppression

The effect of NS knockdown on cell proliferation was measured using cell Titer‐Glo luminescent cell viability assay kit, which determines number of viable cells based on overall amounts of ATP present in the culture, determined by luciferase luminescence. There was a dramatic reduction of luminescence (82.5%) in NS‐siRNA‐treated 5637 cells compared to the cells treated with IR‐siRNA (Fig. 3a, P = 0.02). A likewise significant but weaker decrease (40.6%) was observed on NS down‐regulation in SW1710 cells (Fig. 3b, P = 0.04).

Figure 3.

Figure 3

 Effect of Nucleostemin (NS) knockdown on cell viability in bladder cancer cell lines. Suppression of NS caused significant reduction in number of viable 5637 (a) and SW1710 (b) cells as assessed by luminescence‐based ATP measurements, represented as relative luminescence units (RLU). Values shown are mean ± standard deviation.

Detection of apoptotic cell death in 5637 and SW1710 cell lines treated with NS‐siRNA

To compare levels of apoptotic cell death after NS‐siRNA treatment, relative activities of caspase‐3 and caspase‐7 were measured using a luminescence‐based assay. NS‐siRNA‐treated 5637 cells showed 6.43‐fold elevation in caspase‐3 and caspase‐7 activities compared to cells treated with IR‐siRNA (Fig. 4a, P = 0.007). Assessment of relative activities of caspase‐3 and caspase‐7 in NS‐siRNA‐treated SW1710 cells showed a still significant, albeit weaker elevation of apoptosis (Fig. 4b, P = 0.01).

Figure 4.

Figure 4

 Effect of Nucleostemin (NS) suppression on caspase activity. Elevation of caspase‐3/caspase‐7 relative activities in response to NS knockdown in 5637 (a) and SW1710 (b) cells was determined using Caspase‐Glo 3/7 kit, as a measurement of the apoptotic level. Values were normalized to viable cell numbers as measured in Fig. 3 and represented as mean ± standard deviation.

Differential cell cycle redistribution of 5637 and SW1710 cell lines following NS suppression

Cell cycle alterations in 5637 and SW1710 cells treated with NS‐ and IR‐siRNAs were investigated by flow cytometry. Figure 5a shows that NS‐siRNA treatment of 5637 cells resulted in an increase in percentage of cells in G2/M phase (41.8 ± 0.01%versus 35.2 ± 0.2% in IR‐siRNA‐treated cells; P = 0.011). Moreover, the fraction of cells appearing in ‘sub‐G1’, a characteristic feature of apoptotic cells, increased from 17.9 ± 2.5% in IR‐treated cells to 33.6 ± 1.6% (Fig. 5a, upper panel, P = 0.025).

Figure 5.

Figure 5

 Effect of Nucleostemin (NS) knockdown on cell cycle distribution in bladder cancer cell lines. Cell cycle re‐distribution of 5637 (a) and SW1710 (b) cell lines after NS‐siRNA treatment. Upper panels show sub‐G1 population of cells as depicted by the FL3 filter of FACS instrumentation and lower panels show distribution and percentage of cells in the G0/G1, S and G2/M phases.

Accordingly, as evident in Fig. 5b, NS‐siRNA treatment in SW1710 cells caused significant increase in percentage of sub‐G1 cells compared to IR‐treated cells (10.4 ± 0.7%versus 4.6 ± 0.5%; P = 0.014). In contrast to 5637 cells, no increased G2/M fraction was seen, but fraction of G0/G1 cells was strongly and significantly elevated (84.2 ± 0.5% versus 45.2 ± 0.5%; P = 0.011).

In addition, we measured relative mRNA levels of BTG2, as an anti‐proliferative and a cell cycle regulatory gene. NS‐siRNA‐treated 5637 cells showed 1.5‐fold elevation in BTG2 mRNA expression level compared to cells treated with IR‐siRNA (Fig. 6a, P = 0.047). Relative mRNA levels of BTG2 increased more strongly, 6.8‐fold in NS‐siRNA‐ versus IR‐siRNA‐treated SW1710 cells (Fig. 6b, P = 0.032).

Figure 6.

Figure 6

 Relative mRNA expression changes of BTG2 in bladder cancer cell lines in response to Nucleostemin (NS) knockdown. Knocking down expression of NS by means of siRNA caused up‐regulation of BTG2 mRNA in 5637 (a) and more strongly in SW1710 (b) cells as determined by relative quantitative real‐time RT‐PCR. Values shown represent mean ± standard deviation.

Discussion

Nucleostemin (NS) has been recently cloned and characterized as a novel p53‐binding protein that is highly expressed in stem/progenitor cells and some cancer cell lines (1). Recently, its expression has also been observed in normal differentiated renal tissues (8) and differentiated heart cells following pathological stresses (7). According to original reports, NS has a functional role in proliferation of both stem and cancer cells and it may exert a novel control mechanism of cell cycle progression, especially in late S and G2 phases (1). NS expression has been further reported in several human cancer cell lines and tissues (8, 16, 17). However, its exact mechanism of action and whether it has a similar or different role in normal stem cells as opposed to malignant cells are not well understood.

Using quantitative RT‐PCR, we compared relative expression of NS in several bladder carcinoma cell lines and independent primary cultures of normal uro‐epithelial cells. While overexpression of NS was found in most urothelial carcinoma cell lines, there was only low expression of NS in several others, suggesting that involvement of NS differs even between tumours of the same type, such as invasive bladder cancers. Expression of NS is particularly low in all derivatives of the T24 line, including EJ and TSU‐PR1 cells, which have non‐sense mutations in TP53 (20, 26, 27), and in the RT4 cell line, which is one of the few cell lines that has been derived from a superficial bladder tumour and retains wild‐type TP53 (28).

Interestingly, we also observed high relative expression of NS in most examined normal uro‐epithelial cells. This finding may be explained as follows: cultured normal uro‐epithelial cells proliferate spontaneously and mimic rapid and dramatic regeneration of urothelium during wound healing, growing at similar rates as bladder cancer cell lines (22, 23). However, they do not differentiate spontaneously and do not express markers of fully differentiated urothelial cells, such as uroplakins. Therefore, NS may function to maintain the proliferative capacity of these precursor cells.

We next investigated whether NS plays a functional role in proliferation of bladder carcinoma cell lines; we chose 5637 and SW1710 cell lines with similarly high expression of NS. Like almost all cell lines from invasive bladder cancers, they harbour mutant p53, but differ in the genetic defect, leading to disturbed cell cycle regulation (that is, RB1 and p16INK4A loss, respectively). Successful suppression of NS in both lines, as confirmed by real‐time RT‐PCR and Western blotting, lead to significant decrease in number of viable cells, indicative of an important regulatory role for NS in maintaining proliferation of these cells. Decline in population of proliferating cells after NS suppression is in accordance with previous reports (1, 4, 10, 11, 12).

Both cell lines showed evidence for cell cycle arrest. Interestingly, while NS‐siRNA‐treated 5637 cells showed primarily accumulation of cells in G2/M, SW1710 cells accumulated mostly in G0/G1. While most reports have shown G1 arrest after NS depletion in normal stem and malignant cell lines (4, 11, 12, 13), Zhu etal. (15) reported an increase in sub‐G1 and G2/M fractions of NS+/− cultured mouse embryonic fibroblasts from passage 3 to 5. Furthermore, Tsai and McKay (1) reported that over‐expression of GTP‐deleted mutants of NS blocked cell cycle progression in late S phase, which lead to increased level of apoptosis in U2OS cell line, with wild‐type p53. They concluded that NS may function through known tumor suppressor genes in late S and G2 phases. Our study suggests a differential mechanism of action for NS in our two cell lines, which may not only depend on p53, but also on status of RB1. However, further detailed studies need to be performed to unveil the molecular mechanisms responsible for influences of NS on RB signalling pathway and/or vice versa.

Increased percentage of sub‐G1 cells after NS‐siRNA treatment in both cell lines indicates a potential role for NS in regulating apoptosis. This conclusion was further supported by increased activities of caspase‐3 and caspase‐7 in NS‐suppressed cells. Elevated apoptotic level following NS suppression was also observed in some previous reports (13, 15), but not in others. For instance, Beekman etal. (14) reported that decreased cell numbers of NS+/− E3.5–4.5 mouse embryos were not associated with increased level of apoptotic cells. This discrepancy could be due to possible intrinsic differences, such as presence of intact or else mutant p53.

Additionally, we measured relative expression of BTG2 (TIS21) after treating the cells with NS‐siRNA. BTG2 is recognized as an antiproliferative gene that regulates cell cycle transitions between the G1/S and G2/M phases in malignant cells lacking active pRB1 and/or p53 (29, 30). In normal cells with wild‐type p53 and pRB1, BTG2 inhibits expression of cyclin D1, resulting in arrest of cells at the G1/S transition in pRB‐ and p53‐dependent manner. Moreover, BTG2 inhibits degradation of cyclin A and cyclin B1 in G2/M, and directly binds to cdc2. In p53 null tumour cells, this function results in failure of mitotic exit and increased tumour cell death (20, 31). NS suppression in both cell lines led to a significant increase in BTG2 expression, which was consistent with the increased fraction of cells in sub‐G1, G2/M and G0/G1 phases in NS‐siRNA‐treated 5637 and SW1710 cells.

It was at first proposed that proliferation‐promoting role of NS is only due to its property of binding and inactivating p53 (1). Like most bladder carcinoma cell lines, 5637 and SW1710 cell lines have mutant p53 (20, 32). Therefore, promotion of proliferation by NS and its anti‐apoptotic function cannot be merely due to its p53 binding activity. Accordingly, down‐regulation of NS decreased the level of proliferation of p53 mutant HeLa and PC3 cells and increased percentages of apoptotic cells in PC3 cell line (10, 13). Therefore, our observations lend further support to the notion that NS exerts its role via mediators additional to p53. Intriguingly, a recently published paper also revealed that p53 knockout did not rescue the lethality of NS knockout in mice (14). Based on previous studies and the current investigation, it seems plausible that there are p53‐dependent and p53‐independent mechanisms of actions for NS to regulate cell proliferation and apoptosis.

To further clarify the dependency of NS on p53, RB1 or p16, it would be helpful to investigate bladder cancer cell lines with mutations in each individual gene at a time. However, in the case of bladder malignant cell lines, this strategy is not straightforwardly feasible, because disturbances of both the p53 and RB1 regulatory networks are fundamental in this cancer type (19, 33). The only commonly available bladder cancer cell lines with wild‐type p53, RT4 and 253J, have very low expression of NS; however, they harbour deletions in CDKN2A, which compromise p53 activation through p14ARF. In the other bladder cancer cell lines, re‐expression of wild‐type p53 induces rapid apoptosis (34). Identification of NS expression in normal uro‐epithelial cells at a level comparable to many urothelial carcinoma cells suggests that NS over‐expression and knock‐down approaches in these cells may eventually lead to insights into NS function in normal cells.

In conclusion, our data show that NS, in a p53‐independent manner, differentially regulates proliferation and apoptosis in two human bladder cancer cell lines (5637 and SW1710). Moreover, the precise effect of NS on controlling cell cycle distribution seems to be dependent on functional status of RB1 and CDKN2A genes in cancer cells. These insights lay the ground for identification of the p53‐independent mechanism of NS in regulation of cell proliferation and apoptosis.

Acknowledgements

We thank Modjtaba Emadi‐Baygi for his assistance in some experiments and helpful suggestions. P.N. is supported partially by Urology and Nephrology Research Center of Shahid Beheshti University and by the Christiane and Claudia Hempel‐Stiftung.

References

  • 1. Tsai RY, McKay RD (2002) A nucleolar mechanism controlling cell proliferation in stem cells and cancer cells. Genes Dev. 16, 2991–3003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Baddoo M, Hill K, Wilkinson R, Gaupp D, Hughes C, Kopen GC, Phinney DG (2003) Characterization of mesenchymal stem cells isolated from murine bone marrow by negative selection. J. Cell. Biochem. 89, 1235–1249. [DOI] [PubMed] [Google Scholar]
  • 3. Politz JC, Polena I, Trask I, Bazett‐Jones DP, Pederson T (2005) A nonribosomal landscape in the nucleolus revealed by the stem cell protein nucleostemin. Mol. Biol. Cell 16, 3401–3410. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Jafarnejad SM, Mowla SJ, Matin MM (2008) Knocking‐down the expression of nucleostemin significantly decreases rate of proliferation of rat bone marrow stromal stem cells in an apparently p53‐independent manner. Cell Prolif. 41, 28–35. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Kermani AJ, Fathi F, Mowla SJ (2008) Characterization and genetic manipulation of human umbilical cord vein mesenchymal stem cells: potential application in cell‐based gene therapy. Rejuvenation Res. 11, 379–386. [DOI] [PubMed] [Google Scholar]
  • 6. Yaghoobi MM, Mowla SJ, Tiraihi T (2005) Nucleostemin, a coordinator of self‐renewal, is expressed in rat marrow stromal cells and turns off after induction of neural differentiation. Neurosci. Lett. 390, 81–86. [DOI] [PubMed] [Google Scholar]
  • 7. Siddiqi S, Gude N, Hosoda T, Muraski J, Rubio M, Emmanuel G, Fransioli J, Vitale S, Parolin C, D’Amario D, Schaefer E, Kajstura J, Leri A, Anversa P, Sussman MA (2008) Myocardial induction of nucleostemin in response to postnatal growth and pathological challenge. Circ. Res. 103, 89–97. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Fan Y, Liu Z, Zhao S, Lou F, Nilsson S, Ekman P, Xu D, Fang X (2006) Nucleostemin mRNA is expressed in both normal and malignant renal tissues. Br. J. Cancer 94, 1658–1662. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Tjwa M, Dimmeler S (2008) A nucleolar weapon in our fight for regenerating adult hearts: nucleostemin and cardiac stem cells. Circ. Res. 103, 4–6. [DOI] [PubMed] [Google Scholar]
  • 10. Sijin L, Ziwei C, Yajun L, Meiyu D, Hongwei Z, Guofa H, Siguo L, Hong G, Zhihong Z, Xiaolei L, Yingyun W, Yan X, Weide L (2004) The effect of knocking‐down nucleostemin gene expression on the in vitro proliferation and in vivo tumorigenesis of HeLa cells. J. Exp. Clin. Cancer Res. 23, 529–538. [PubMed] [Google Scholar]
  • 11. Ma H, Pederson T (2007) Depletion of the nucleolar protein nucleostemin causes G1 cell cycle arrest via the p53 pathway. Mol. Biol. Cell 18, 2630–2635. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Dai MS, Sun XX, Lu H (2008) Aberrant expression of nucleostemin activates p53 and induces cell cycle arrest via inhibition of MDM2. Mol. Cell. Biol. 28, 4365–4376. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Liu RL, Zhang ZH, Zhao WM, Wang M, Qi SY, Li J, Zhang Y, Li SZ, Xu Y (2008) Expression of nucleostemin in prostate cancer and its effect on the proliferation of PC‐3 cells. Chin. Med. J. 121, 299–304. [PubMed] [Google Scholar]
  • 14. Beekman C, Nichane M, De Clercq S, Maetens M, Floss T, Wurst W, Bellefroid E, Marine JC (2006) Evolutionarily conserved role of nucleostemin: controlling proliferation of stem/progenitor cells during early vertebrate development. Mol. Cell. Biol. 26, 9291–9301. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Zhu Q, Yasumoto H, Tsai RY (2006) Nucleostemin delays cellular senescence and negatively regulates TRF1 protein stability. Mol. Cell. Biol. 26, 9279–9290. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Liu SJ, Cai ZW, Liu YJ, Dong MY, Sun LQ, Hu GF, Wei YY, Lao WD (2004) Role of nucleostemin in growth regulation of gastric cancer, liver cancer and other malignancies. World J. Gastroenterol. 10, 1246–1249. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Cada Z, Boucek J, Dvorankova B, Chovanec M, Plzak J, Kodets R, Betka J, Pinot GL, Gabius HJ, Smetana K Jr (2007) Nucleostemin expression in squamous cell carcinoma of the head and neck. Anticancer Res. 27, 3279–3284. [PubMed] [Google Scholar]
  • 18. Mitra AP, Datar RH, Cote RJ (2006) Molecular pathways in invasive bladder cancer: new insights into mechanisms, progression, and target identification. J. Clin. Oncol. 24, 5552–5564. [DOI] [PubMed] [Google Scholar]
  • 19. Schulz WA (2006) Understanding urothelial carcinoma through cancer pathways. Int. J. Cancer 119, 1513–1518. [DOI] [PubMed] [Google Scholar]
  • 20. Grimm MO, Jurgens B, Schulz WA, Decken K, Makri D, Schmitz‐Drager BJ (1995) Inactivation of tumor suppressor genes and deregulation of the c‐myc gene in urothelial cancer cell lines. Urol. Res. 23, 293–300. [DOI] [PubMed] [Google Scholar]
  • 21. Florl AR, Schulz WA (2003) Peculiar structure and location of 9p21 homozygous deletion breakpoints in human cancer cells. Genes Chromosomes Cancer 37, 141–148. [DOI] [PubMed] [Google Scholar]
  • 22. Swiatkowski S, Seifert HH, Steinhoff C, Prior A, Thievessen I, Schliess F, Schulz WA (2003) Activities of MAP‐kinase pathways in normal uroepithelial cells and urothelial carcinoma cell lines. Exp. Cell Res. 282, 48–57. [DOI] [PubMed] [Google Scholar]
  • 23. Southgate J, Hutton KA, Thomas DF, Trejdosiewicz LK (1994) Normal human urothelial cells in vitro: proliferation and induction of stratification. Lab. Invest. 71, 583–594. [PubMed] [Google Scholar]
  • 24. Hoffmann MJ, Muller M, Engers R, Schulz WA (2006) Epigenetic control of CTCFL/BORIS and OCT4 expression in urogenital malignancies. Biochem. Pharmacol. 72, 1577–1588. [DOI] [PubMed] [Google Scholar]
  • 25. Janssen K, Pohlmann S, Janicke RU, Schulze‐Osthoff K, Fischer U (2007) Apaf‐1 and caspase‐9 deficiency prevents apoptosis in a Bax‐controlled pathway and promotes clonogenic survival during paclitaxel treatment. Blood 110, 3662–3672. [DOI] [PubMed] [Google Scholar]
  • 26. Gildea JJ, Golden WL, Harding MA, Theodorescu D (2000) Genetic and phenotypic changes associated with the acquisition of tumorigenicity in human bladder cancer. Genes Chromosomes Cancer 27, 252–263. [DOI] [PubMed] [Google Scholar]
  • 27. Van Bokhoven A, Varella‐Garcia M, Korch C, Miller GJ (2001) TSU‐Pr1 and JCA‐1 cells are derivatives of T24 bladder carcinoma cells and are not of prostatic origin. Cancer Res. 61, 6340–6344. [PubMed] [Google Scholar]
  • 28. Rieger KM, Little AF, Swart JM, Kastrinakis WV, Fitzgerald JM, Hess DT, Libertino JA, Summerhayes IC (1995) Human bladder carcinoma cell lines as indicators of oncogenic change relevant to urothelial neoplastic progression. Br. J. Cancer 72, 683–690. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Tirone F (2001) The gene PC3 (TIS21/BTG2), prototype member of the PC3/BTG/TOB family: regulator in control of cell growth, differentiation, and DNA repair? J. Cell. Physiol. 187, 155–165. [DOI] [PubMed] [Google Scholar]
  • 30. Lim IK (2006) TIS21 (/BTG2/PC3) as a link between ageing and cancer: cell cycle regulator and endogenous cell death molecule. J. Cancer Res. Clin. Oncol. 132, 417–426. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Ryu MS, Lee MS, Hong JW, Hahn TR, Moon E, Lim IK (2004) TIS21/BTG2/PC3 is expressed through PKC‐δ pathway and inhibits binding of cyclin B1‐Cdc2 and its activity, independent of p53 expression. Exp. Cell Res. 299, 159–170. [DOI] [PubMed] [Google Scholar]
  • 32. Markl ID, Jones PA (1998) Presence and location of TP53 mutation determines pattern of CDKN2A/ARF pathway inactivation in bladder cancer. Cancer Res. 58, 5348–5353. [PubMed] [Google Scholar]
  • 33. Knowles MA (2007) Tumor suppressor loci in bladder cancer. Front. Biosci. 12, 2233–2251. [DOI] [PubMed] [Google Scholar]
  • 34. Steinhoff C, Prior A, Reichmann G, Seifert HH, Schulz WA (2002) Activity of E2F‐dependent promoters in bladder carcinoma cells and their use for tumour‐specific targeting of p53‐induced apoptosis. Int. J. Oncol. 21, 1033–1040. [PubMed] [Google Scholar]

Articles from Cell Proliferation are provided here courtesy of Wiley

RESOURCES