Skip to main content
Cell Proliferation logoLink to Cell Proliferation
. 2015 Sep 2;48(5):593–599. doi: 10.1111/cpr.12207

miR‐372 suppresses tumour proliferation and invasion by targeting IGF2BP1 in renal cell carcinoma

Xuan Huang 1, Mingjie Huang 2, Lingbao Kong 2, Yong Li 1,
PMCID: PMC6496015  PMID: 26332146

Abstract

Objectives

MicroRNAs (miRNAs) are endogenous small non‐coding RNAs that regulate proteins and mRNAs for degradation or translational suppression. Up to now, the role of miR‐372 in renal cell carcinoma has remained unknown; in this study, we have aimed to reveal its functional importance in this tumour.

Materials and methods

qRT‐PCR was performed to measure expression levels of miR‐372 in renal cell carcinoma cell lines and tissues. CCK‐8 and an invasion assay were performed to measure its functional role. Luciferase assays, qRT‐PCR and western blotting were performed to discover miR‐372′s target gene.

Results

We demonstrated that miRNA‐372 was down‐regulated in renal cell carcinoma cell lines and tissue specimens; its over‐expression inhibited cell proliferation and invasion. Moreover, we showed that miRNA‐372 repressed insulin‐like growth factor 2 mRNA‐binding protein 1 (IGF2BP1) expression by directly interacting with its putative binding site at the 3′‐UTR. Furthermore, ectopic expression of IGF2BP1 significantly reversed suppression of cell proliferation and invasion caused by miR‐372 over‐expression.

Conclusions

Our data indicated that miR‐372 seemed to function as a tumour suppressor in renal cell carcinoma progression by inhibiting the IGF2BP1 expression.

Introduction

Renal cell carcinoma (RCC), third most common urological cancer, is the most common neoplasm of the adult kidney, but has the highest mortality, at over 40% 1, 2, 3. Clear cell RCC (ccRCC) is their most common subtype and accounts for approximately 70% of them 4, 5. Neither radiotherapy nor chemotherapy are effective in treatment of advanced RCC 6, 7. Molecular mechanisms involved in initiation and progression of the disease are not well understood 1, 8, 9, thus, identification of new therapeutic targets need to be emphasized.

MicroRNAs (miRNAs) are short endogenous non‐coding RNAs that negatively regulate protein expression by interacting with the 3′‐UTRs of their target gene mRNAs 10, 11, 12, 13. They play important roles in diverse biological cell processes, such as cell development, proliferation, differentiation, invasion, migration and apoptosis 14, 15, 16, 17, 18. Numbers of studies have demonstrated that miRNAs can act as oncogenes or tumour suppressors in various malignancies including gastric, bladder, breast and carcinomas as well as osteosarcoma 19, 20, 21, 22. However, expressions and functions of the majority of miRNAs in RCC are still unknown.

Previous studies have suggested that miR‐372 can act as a tumour suppressor or as an oncogene in various human malignancies such as those of the brain, stomach, colorectum and glioma 23, 24, 25, 26, 27, and it has also been found that it is up‐regulated while playing an oncogenic role. However, its function in RCC has remained unknown. In our study, we found miR‐372 was down‐regulated in RCC tissues and cell lines and its over‐expression could repress RCC cell proliferation and invasion. Furthermore, we identified insulin‐like growth factor 2 mRNA‐binding protein 1 (IGF2BP1) as a direct and functional target of miR‐372. These data strongly reveal a possible tumour suppressor role of miR‐372 in RCC development.

Materials and methods

Ethics statement

All patients included agreed to participate in the study and provided written informed consent. Both study and consents were approved by the Ethical Board of Nanchang University and complied with the Declaration of Helsinki.

Tissue samples and cell lines

ccRCC and adjacent normal tissues were collected from 30 patients undergoing surgery at our hospital. Samples were immediately snap‐frozen in liquid nitrogen until protein or RNA extraction. Human renal carcinoma cell lines 769‐P, 786‐O, A498, SN12‐PM6, and one normal renal cell line, HK‐2, were purchased from the Cell Bank of the Chinese Academy of Sciences (Beijing, China). Lines were maintained in Dulbecco's modified Eagle's medium (DMEM) with 10% foetal bovine serum (FBS), 100 units/ml penicillin and 100 μg/ml streptomycin, in a humidified atmosphere of 5% CO2 at 37 °C (all from Sigma‐Aldrich, St Louis, MO, USA).

RNA isolation and qRT‐PCR

Total RNA was extracted from cells and frozen tissues using TRIZOL Reagent (Invitrogen, Carlsbad, CA, USA) and RNAs were subjected to real‐time qPCR with specific primers for determination of miR‐372 and IGF2BP1 mRNA expression. Primers for miR‐372 were as follows: forward, 5′‐ACACTCCAGCTGGGAAAGTGCTGCGACATTT‐3′, reverse, 5′‐GTGCAGG GTCCGAGGT‐3′. Primers for human IGF2BP1 mRNA were: forward, 5′‐CCTGCTGGCTCAGTATGGT‐3′, reverse, 5′‐GACATTCACCACTGCCGTCTC‐3′. Primers for U6 were: forward, 5′‐CTCGCTTCGGCAGCACATATACT‐3′, reverse, 5′‐ACGCTTCACGAATTTGCGTGTC‐3′. Primers for GAPDH were: forward, 5′‐AACTTTGGCATTGTGGAAGG‐3′; reverse, 5′‐ACACATTGGGGGTAGGAACA‐3′.

Transient transfection

miR‐372, miRNAs mimics and negative control (scramble) were obtained from GenePharma (GenePharma, Shanghai, China). Mimics and scramble were transfected into cells at 30 nm, using Lipofectamine 2000 (Invitrogen, Carlsbad, USA) following the manufacturer's instructions.

Cell proliferation and colony formation assay

Cell proliferation capacity was evaluated using CCK‐8 assay according to the manufacturer's instructions. Cells were seeded into 96‐well plates, CCK‐8 (10 μl) was added to each well and cells were incubated for a further 2 h at 37 °C. Optical density (OD) was measured at 450 nm using an auto‐microplate reader (infinite M200, Tecan, Männedorf, Switzerland). For colony formation experiment, cells were cultured in six‐well plates and cultured for 7 days. They were then fixed in 4% formaldehyde for 20 min and stained with 1.0% crystal violet.

Invasion assay

Cell invasion was detected using Transwell Matrigel (BD Biosciences, San Diego, CA, USA) according to the manufacturer's instructions. A total of 600 ml complete medium and 200 ml of cells after transfection were added to lower and upper compartments of chambers (BD Biosciences) respectively. After 48 h, cells migrating to lower sides of filters were fixed in 4% paraformaldehyde for 20 min at 37 °C, stained with crystal violet and then observed using a confocal microscope.

Luciferase activity assay

Cells were cultured in 24‐well plates for 24 h. One hundred nanograms pGL3‐IGF2BP1‐luciferase plasmid, plus 5 ng pRL‐TK renilla plasmid (Promega, Madison, WI, USA) were transfected into cells using Lipofectamine 2000 reagent (Invitrogen) following the protocol provided by the manufacturer. Luciferase and control signals were measured 48 h after transfection using a Dual Luciferase Reporter Assay Kit (Promega), according to the manufacturer's instructions.

Statistical analysis

Data are expressed as mean ± SD, from at least three separate experiments. Differences between groups were analysed using one‐way ANOVA or Student's t‐test. P < 0.05 was considered statistically significant.

Results

miR‐372 was down‐regulated in renal cell carcinoma cells and tissues

We detected expression of miR‐372 in all four human renal cell carcinoma cells lines, 769‐P, 786‐O, A498, SN12‐PM6 and the one normal renal cell line, HK‐2. Expression level of miR‐372 in HK‐2 was higher than levels in all the cell lines (Fig. 1a). Furthermore, we examined expression of miR‐372 in 30 clinical samples, where expression of miR‐372 was down‐regulated in 24 cases (24/30, 80%) compared to corresponding adjacent tissues (Fig. 1b). Overall, expression of miR‐372 was down‐regulated in renal cell carcinoma tissues compared to adjacent ones (Fig. 1c).

Figure 1.

Figure 1

miR‐372 was down‐regulated in renal cell carcinoma cells and tissues. (a) expression level of miR‐372 in HK‐2 was higher than levels in all renal cell carcinoma cells lines used,769‐P, 786‐O, A498, SN12‐PM6. (b) expression of miR‐372 was down‐regulated in 24 cases (24/30, 80%) compared to corresponding adjacent tissues. (c) expression of miR‐372 was down‐regulated in renal cell carcinoma tissues compared to adjacent tissues. ***P < 0.001.

miR‐372 inhibited cell proliferation in vitro

We transfected miR‐372 mimic into renal cell carcinoma cell line 786‐O, which exhibited high transfection efficiency (Fig. 2a). CCK8 assay revealed that overexpression of miR‐372 significantly suppressed proliferation of the cells (Fig. 2b). The colony formation assay revealed that foci from the miR‐372‐overexpressing 786‐O cells were less compared to with scramble‐transduced cells (Fig. 2c).

Figure 2.

Figure 2

miR‐372 inhibited cell proliferation in vitro. (a) expression level of miR‐372 was determined using RT‐PCR. (b) CCK8 assay revealed that overexpression of miR‐372 significantly suppressed 786‐O cell proliferation. (c) colony formation assay revealed that overexpression of miR‐372 significantly suppressed 786‐O cell colony formation. **P < 0.01, ***P < 0.001.

miR‐372 inhibited cell invasion in vitro

The invasion assay was carried out to detect effects of miR‐372 on invasion of renal cell carcinoma cells. Our results indicated that miR‐372 up‐regulation significantly repressed invasive ability of 786‐O cells (Fig. 3).

Figure 3.

Figure 3

miR‐372 inhibited cell invasion in vitro. Invasion assay revealed that overexpression of miR‐372 significantly suppressed 786‐O cell invasion. ***P < 0.001.

miR‐372 targeted IGF2BP1 in renal cell carcinoma cells

By using TargetScan (Whitehead Institute for Biomedical Research, Cambridge, MA, USA) IGF2BP1 was discovered to be the putative target of miR‐372 (Fig. 4a). Luciferase reporter assay was used to examine functionality of the miR‐372 binding site. Our results show that luciferase reporter activity decreased by approximately 66% in 786‐O cells containing IGF2BP1 wild‐type 3′UTR fragment (Fig. 4b). Furthermore, we found that overexpression of miR‐372 suppressed IGF2BP1 protein level in the cells (Fig. 4c).

Figure 4.

Figure 4

miR‐372 targets IGF 2 BP 1 in renal cell carcinoma cell. (a) IGF2BP1 was found to be the putative target of miR‐372 using TargetScan. (b) Luciferase reporter assay showed that luciferase reporter activity decreased approximately 66% in the 786‐O cells containing the IGF2BP1 wild‐type 3′UTR fragment. (c) Overexpression of miR‐372 suppressed IGF2BP1 protein level in 786‐O cells using western blotting. **P < 0.01.

IGF2BP1 was involved in regulation of cell proliferation and invasion by miR‐372

We performed a rescue experiment to further confirm that miR‐372 inhibited proliferation and invasion of renal cell carcinoma cells by regulating IGF2BP1 directly. Overexpression of IGF2BP1 by IGF2BP1 plasmids enhanced IGF2BP1 protein expression (Fig. 5a); we restored its expression by transfecting IGF2BP1 plasmids. CCK8 proliferation assay showed that overexpression of IGF2BP1 promoted 786‐O cell proliferation (Fig. 5b). Furthermore, invasion ability of miR‐372‐overexpressing 786‐O cells were partially increased after IGF2BP1 transfection (Fig. 5c).

Figure 5.

Figure 5

IGF 2 BP 1 was involved in regulation of cell proliferation and invasion by miR‐372. (a) IGF2BP1 protein expression was detected using western blotting. (b) Proliferation abilities of miR‐372 overexpressing 786‐O cells were partially increased after IGF2BP1 transfection. (c) Invasion of miR‐372 overexpressing 786‐O cells was partially increased after IGF2BP1 transfection. *P < 0.05 and ***P < 0.001.

Discussion

Despite considerable developments in anti‐cancer therapy, major limitations still exist in treating RCC. However, increasing evidence proves that miRNAs play important roles in cancer biology 28, 29, 30, 31, 32. In our study, we have shown that miR‐372 was down‐regulated in RCC and its over‐expression repressed RCC cell proliferation and invasion in vitro. Furthermore, IGF2BP1 was identified as a direct and functional target of miR‐372. Moreover, ectopic expression of IGF2BP1 significantly reversed suppression of cell proliferation and invasion, caused by miR‐372 overexpression. These data strongly reveal a possible tumour suppressor role for miR‐372 in RCC development.

Previous studies have suggested that miR‐372 can act as tumour suppressor or as an onogene in various human malignancies as mentioned above 23, 24, 25, 26, 27. However, a further two studies by Tan et al. and Tian et al. indicated that miR‐372 is downexpressed and acts as tumour suppressor in nasopharyngeal and cervical carcinomas 33, 34. Here, we found that expression of miR‐372 was significantly down‐regulated in RCC, both lines and tissues. Functional assays confirmed that overexpression of miR‐372 repressed cell proliferation and invasion. These data demonstrated that miR‐372 plays an important role in inhibiting carcinogenesis of RCC.

Target prediction algorithms identified binding sites for miR‐372 in the 3′‐UTR of IGF2BP1. Our data obtained from gain‐of‐function approaches confirmed that IGF2BP1 is a direct target gene of miR‐372. Ectopic expression of miR‐372 inhibited relative luciferase activity of WT vector containing IGF2BP1 3′UTR. Moreover, overexpression of miR‐372 repressed protein expression of IGF2BP1. IGF2BP1, one of the VICKZ proteins, is a member of the RNA‐binding IGF2BP protein family containing three members, IGF2BP1/2 and 3 17, 35, 36. Recent data have shown that expression of IGF2BP1 correlates to overall poor prognosis of various cancers and acts as a potent oncogenic factor 37, 38, 39, 40. Increasing studies have also reported that re‐expression of IGF2BP1 enhanced cell proliferation and invasion 37, 41, 42. In our study, we also demonstrated that overexpression of IGF2BP1 promoted 786‐O cell invasion and proliferation, and IGF2BP1 was involved in regulation of cell proliferation and invasion by miR‐372.

In conclusion, we demonstrated that there is significant low expression of miRNA‐372 in RCC lines and tissues. Moreover, we showed that miR‐372 inhibited RCC cell proliferation and invasion by targeting IGF2BP1, a functional target of miR‐372. This is the first study to demonstrate that miRNA‐372 inhibits RCC cell proliferation and invasion, indicating therapeutic potential of miRNA‐372 in treatment of RCC.

Acknowledgements

This work was supported by the grants from the National Nature Science Foundation of China (81301964), the Postgraduate Student Foundation for New Teacher from the Ministry of Education of China (20133601120013), the Foundation from Department of Education of Jiangxi Province (GJJ14215, GJJ14194), the Province National Natural Science Foundation of Jiangxi (20151BAB215023) and the Foundation for Post‐Doctor Research Project of Jiangxi Province, China.

References

  • 1. Hidaka H, Seki N, Yoshino H, Yamasaki T, Yamada Y, Nohata N et al (2012) Tumor suppressive microRNA‐1285 regulates novel molecular targets: aberrant expression and functional significance in renal cell carcinoma. Oncotarget 3, 44–57. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Xiang W, He J, Huang C, Chen L, Tao D, Wu X et al (2015) miR‐106b‐5p targets tumor suppressor gene SETD2 to inactive its function in clear cell renal cell carcinoma. Oncotarget 28, 4066–4079. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Liang J, Zhang Y, Jiang G, Liu Z, Xiang W, Chen X et al (2013) MiR‐138 induces renal carcinoma cell senescence by targeting EZH2 and is downregulated in human clear cell renal cell carcinoma. Oncol. Res. 21, 83–91. [DOI] [PubMed] [Google Scholar]
  • 4. Chen Z, Tang ZY, He Y, Liu LF, Li DJ, Chen X (2014) miRNA‐205 is a candidate tumor suppressor that targets ZEB2 in renal cell carcinoma. Oncol. Res. Treat. 37, 658–664. [DOI] [PubMed] [Google Scholar]
  • 5. Kim D, Li R, Dudek SM, Wallace JR, Ritchie MD (2015) Binning somatic mutations based on biological knowledge for predicting survival: an application in renal cell carcinoma. Pac. Symp. Biocomput. 20, 96–107. [PMC free article] [PubMed] [Google Scholar]
  • 6. Wu X, Weng L, Li X, Guo C, Pal SK, Jin JM et al (2012) Identification of a 4‐microRNA signature for clear cell renal cell carcinoma metastasis and prognosis. PLoS ONE 7, e35661. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Gao Y, Zhao H, Lu Y, Li H, Yan G (2014) MicroRNAs as potential diagnostic biomarkers in renal cell carcinoma. Tumour Biol. 35, 11041–11050. [DOI] [PubMed] [Google Scholar]
  • 8. Redova M, Poprach A, Besse A, Iliev R, Nekvindova J, Lakomy R et al (2013) MiR‐210 expression in tumor tissue and in vitro effects of its silencing in renal cell carcinoma. Tumour Biol. 34, 481–491. [DOI] [PubMed] [Google Scholar]
  • 9. Yuan HX, Zhang JP, Kong WT, Liu YJ, Lin ZM, Wang WP et al (2014) Elevated microRNA‐185 is associated with high vascular endothelial growth factor receptor 2 expression levels and high microvessel density in clear cell renal cell carcinoma. Tumour Biol. 35, 12757–12763. [DOI] [PubMed] [Google Scholar]
  • 10. Li Z, Yu X, Shen J, Jiang Y (2015) MicroRNA dysregulation in uveal melanoma: a new player enters the game. Oncotarget 6, 4562–4568. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Li Z, Yu X, Wang Y, Shen J, Wu WK, Liang J et al (2014) By downregulating TIAM1 expression, microRNA‐329 suppresses gastric cancer invasion and growth. Oncotarget 6, 17559–17569. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  • 12. Yu X, Li Z, Shen J, Wu WK, Liang J, Weng X et al (2013) MicroRNA‐10b promotes nucleus pulposus cell proliferation through RhoC‐Akt pathway by targeting HOXD10 in intervetebral disc degeneration. PLoS ONE 8, e83080. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  • 13. Luo X, Dong Z, Chen Y, Yang L, Lai D (2013) Enrichment of ovarian cancer stem‐like cells is associated with epithelial to mesenchymal transition through an miRNA‐activated AKT pathway. Cell Prolif. 46, 436–446. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Li Z, Lei H, Luo M, Wang Y, Dong L, Ma Y et al (2015) DNA methylation downregulated mir‐10b acts as a tumor suppressor in gastric cancer. Gastric Cancer 18, 43–54. [DOI] [PubMed] [Google Scholar]
  • 15. Yu X, Li Z (2014) MicroRNAs regulate vascular smooth muscle cell functions in atherosclerosis (review). Int. J. Mol. Med. 34, 923–933. [DOI] [PubMed] [Google Scholar]
  • 16. Li Z, Yu X, Shen J, Wu WK, Chan MT (2015) MicroRNA expression and its clinical implications in Ewing's sarcoma. Cell Prolif. 48, 1–6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Ohdaira H, Sekiguchi M, Miyata K, Yoshida K (2012) MicroRNA‐494 suppresses cell proliferation and induces senescence in A549 lung cancer cells. Cell Prolif. 45, 32–38. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Fu LL, Zhao X, Xu HL, Wen X, Wang SY, Liu B et al (2012) Identification of microRNA‐regulated autophagic pathways in plant lectin‐induced cancer cell death. Cell Prolif. 45, 477–485. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Fu LL, Yang Y, Xu HL, Cheng Y, Wen X, Ouyang L et al (2013) Identification of novel caspase/autophagy‐related gene switch to cell fate decisions in breast cancers. Cell Prolif. 46, 67–75. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Hirata H, Ueno K, Shahryari V, Tanaka Y, Tabatabai ZL, Hinoda Y et al (2012) Oncogenic miRNA‐182‐5p targets Smad4 and RECK in human bladder cancer. PLoS ONE 7, e51056. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Zhao G, Cai C, Yang T, Qiu X, Liao B, Li W et al (2013) MicroRNA‐221 induces cell survival and cisplatin resistance through PI3K/Akt pathway in human osteosarcoma. PLoS ONE 8, e53906. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Furuta M, Kozaki K, Tanimoto K, Tanaka S, Arii S, Shimamura T et al (2013) The tumor‐suppressive miR‐497‐195 cluster targets multiple cell‐cycle regulators in hepatocellular carcinoma. PLoS ONE 8, e60155. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Chen X, Hao B, Han G, Liu Y, Dai D, Li Y et al (2014) miR‐372 regulates glioma cell proliferation and invasion by directly targeting PHLPP2. J. Cell. Biochem. 116, 225–232. [DOI] [PubMed] [Google Scholar]
  • 24. Cho WJ, Shin JM, Kim JS, Lee MR, Hong KS, Lee JH et al (2009) miR‐372 regulates cell cycle and apoptosis of ags human gastric cancer cell line through direct regulation of LATS2. Mol. Cells 28, 521–527. [DOI] [PubMed] [Google Scholar]
  • 25. Yamashita S, Yamamoto H, Mimori K, Nishida N, Takahashi H, Haraguchi N et al (2012) MicroRNA‐372 is associated with poor prognosis in colorectal cancer. Oncology 82, 205–212. [DOI] [PubMed] [Google Scholar]
  • 26. Li G, Zhang Z, Tu Y, Jin T, Liang H, Ciu G et al (2013) Correlation of microRNA‐372 upregulation with poor prognosis in human glioma. Diagn. Pathol. 8, 1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Wang J, Liu X, Wu H, Ni P, Gu Z, Qiao Y et al (2010) CREB up‐regulates long non‐coding RNA, HULC expression through interaction with microRNA‐372 in liver cancer. Nucleic Acids Res. 38, 5366–5383. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Li Z, Yu X, Shen J, Chan MT, Wu WK (2015) MicroRNA in intervertebral disc degeneration. Cell Prolif. 48, 278–283. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Fei B, Wu H (2012) MiR‐378 inhibits progression of human gastric cancer MGC‐803 cells by targeting MAPK1 in vitro. Oncol. Res. 20, 557–564. [DOI] [PubMed] [Google Scholar]
  • 30. Fei B, Wu H (2013) MiR‐378 inhibits progression of human gastric cancer MGC‐803 cells by targeting MAPK1 in vitro. Oncol. Res. 20, 557–564. [DOI] [PubMed] [Google Scholar]
  • 31. Zhang WH, Gui JH, Wang CZ, Chang Q, Xu SP, Cai CH et al (2012) The identification of miR‐375 as a potential biomarker in distal gastric adenocarcinoma. Oncol. Res. 20, 139–147. [DOI] [PubMed] [Google Scholar]
  • 32. Wang K, Jia Z, Zou J, Zhang A, Wang G, Hao J et al (2013) Analysis of hsa‐miR‐30a‐5p expression in human gliomas. Pathol. Oncol. Res. 19, 405–411. [DOI] [PubMed] [Google Scholar]
  • 33. Tan JK, Tan EL, Gan SY (2014) Elucidating the roles of miR‐372 in cell proliferation and apoptosis of nasopharyngeal carcinoma TW01 cells. Exp. Oncol. 36, 170–173. [PubMed] [Google Scholar]
  • 34. Tian RQ, Wang XH, Hou LJ, Jia WH, Yang Q, Li YX et al (2011) MicroRNA‐372 is down‐regulated and targets cyclin‐dependent kinase 2 (CDK2) and cyclin A1 in human cervical cancer, which may contribute to tumorigenesis. J. Biol. Chem. 286, 25556–25563. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Gu G, Sederberg MC, Drachenberg MR, South ST (2014) IGF2BP1: a novel IGH translocation partner in B acute lymphoblastic leukemia. Cancer Genet. 207, 332–334. [DOI] [PubMed] [Google Scholar]
  • 36. Faye MD, Beug ST, Graber TE, Earl N, Xiang X, Wild B et al (2014) IGF2BP1 controls cell death and drug resistance in rhabdomyosarcomas by regulating translation of cIAP1. Oncogene, 34, 1532–1541. [DOI] [PubMed] [Google Scholar]
  • 37. Stohr N, Kohn M, Lederer M, Glass M, Reinke C, Singer RH et al (2012) IGF2BP1 promotes cell migration by regulating MK5 and PTEN signaling. Genes Dev. 26, 176–189. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Stohr N, Huttelmaier S (2012) IGF2BP1: a post‐transcriptional “driver” of tumor cell migration. Cell Adh. Migr. 6, 312–318. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Zhou X, Zhang CZ, Lu SX, Chen GG, Li LZ, Liu LL et al (2015) miR‐625 suppresses tumour migration and invasion by targeting IGF2BP1 in hepatocellular carcinoma. Oncogene 34, 965–977. [DOI] [PubMed] [Google Scholar]
  • 40. Wang RJ, Li JW, Bao BH, Wu HC, Du ZH, Su JL et al (2015) MiRNA‐873 inhibits glioblastoma tumorigenesis and metastasis by suppressing the expression of IGF2BP1. J. Biol. Chem. 290, 8938–8948. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Manieri NA, Drylewicz MR, Miyoshi H, Stappenbeck TS (2012) Igf2 bp1 is required for full induction of Ptgs2 mRNA in colonic mesenchymal stem cells in mice. Gastroenterology 143(110–121), e110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42. Mahaira LG, Katsara O, Pappou E, Iliopoulou EG, Fortis S, Antsaklis A et al (2014) IGF2BP1 expression in human mesenchymal stem cells significantly affects their proliferation and is under the epigenetic control of TET1/2 demethylases. Stem Cells Dev. 23, 2501–2512. [DOI] [PubMed] [Google Scholar]

Articles from Cell Proliferation are provided here courtesy of Wiley

RESOURCES