Skip to main content
Antimicrobial Agents and Chemotherapy logoLink to Antimicrobial Agents and Chemotherapy
. 2019 Apr 25;63(5):e02434-18. doi: 10.1128/AAC.02434-18

Comparative Analysis of blaKPC Expression in Tn4401 Transposons and the Tn3-Tn4401 Chimera

Jiansheng Huang a,#, Xiaolei Hu a,#, Yunan Zhao a, Yang Shi a, Hui Ding a, Rongzhen Wu a, Zhigang Zhao a,✉, Jiansong Ji a,✉
PMCID: PMC6496108  PMID: 30833426

Two basic structures that carry the blaKPC gene, the Tn4401 transposon and the Tn3-Tn4401 chimera, have been identified within and outside China. However, the different blaKPC expression levels and promoter activities of these two structures are not completely understood.

KEYWORDS: Tn3-Tn4401, Tn4401, blaKPC, gene expression, promoters

ABSTRACT

Two basic structures that carry the blaKPC gene, the Tn4401 transposon and the Tn3-Tn4401 chimera, have been identified within and outside China. However, the different blaKPC expression levels and promoter activities of these two structures are not completely understood. We constructed Tn4401a, Tn4401b, and Tn3-Tn4401 chimera recombinants and found that the imipenem (IPM) and meropenem (MEM) MICs for the Escherichia coli transformants carrying the chimera were 2-fold higher than for those carrying Tn4401b but 2-fold lower than for those carrying Tn4401a. In addition to the promoter P1, we characterized a novel potential promoter sequence (PX) in the chimera using 5′ rapid amplification of cDNA ends (5′ RACE), of which the −35 and −10 sequences were TTCAAA and TGAGACAAT, respectively. Although mutation of P1, P2, or PX significantly downregulated blaKPC mRNA expression in each structure (P < 0.05), the P2 mutation resulted in 2- and 3-fold greater decreases than the P1 mutation in Tn4401a and Tn4401b, respectively. Similarly, despite no significant difference in the PX and P1 mutations in the chimera, the carbapenem MIC and Klebsiella pneumoniae carbapenemase (KPC) production resulting from P2 mutations were significantly lower than those of P1 (P < 0.01) in the Tn4401 transposons. These studies indicate that the Tn3-Tn4401 chimera contains a novel potential blaKPC promoter, PX, and that its carbapenem resistance falls in between those of Tn4401a and Tn4401b.

INTRODUCTION

Klebsiella pneumoniae carbapenemases (KPCs) are among the most powerful enzymes that can hydrolyze nearly all of the beta-lactams (1). The blaKPC gene, which was first discovered in K. pneumoniae in America, has been identified in multiple genera and species (2–8). In China, nationwide surveillance of carbapenem-resistant Enterobacteriaceae (CRE) strains revealed that 58% were KPC producers, which severely threatened public health (7, 8).

Outside China, the blaKPC gene is normally found in Tn4401, a 10-kb transposon that has been reported as the genetic structure mediating original blaKPC acquisition, with the gene order of Tn4401-tnpA, Tn4401-tnpR, ISKpn7, blaKPC, and ISKpn6 (9, 10). Because of the diversity in the intervening sequence (IVS) between the ISKpn7 and blaKPC genes, a total of eight unique Tn4401 isoforms (a to h) have been characterized (11, 12), with Tn4401a and Tn4401b being the most widespread (11). In the IVS, Tn4401b harbored promoters P1, P3, and P2, while Tn4401a harbored P1 and P2 (9). In China, however, nearly all of the blaKPC genes were located in the Tn3-Tn4401 chimera in which the genetic context immediately upstream of the blaKPC gene was Tn3-tnpA, Tn3-tnpR, and ISKpn8 (13–16). The considerable differentiation of the genetic structure indicates a distinct expression mechanism of the blaKPC gene in the Tn3-Tn4401 chimera, though little is known about it.

In addition, the promoters P1 and P2 in the Tn4401 transposon have been previously reported to contribute to the expression of the blaKPC gene, while P3 may act as an obstacle (2, 10, 12, 17). However, Cheruvanky and colleagues recently raised concerns about the putative promoter P1 because it is nonfunctional in the lacZ reporter system (12).

A deep understanding of the impact of genetic variability in noncoding and/or promoter regions on blaKPC expression and its relation to antibiotic susceptibility will be helpful for sequencing-based precision clinical diagnostics and treatment (10, 12). In this study, we comparatively analyzed the carbapenem susceptibilities of the strains carrying the Tn4401 transposon or Tn3-Tn4401 chimera, described a novel promoter initiating the blaKPC gene in the chimera, and further determined the role of promoters P1 and P2 in blaKPC expression.

RESULTS

Bacterial strains, blaKPC genetic structure, and promoter.

Among the 77 KPC-producing isolates, with the exception of 1 strain of Citrobacter freundii, all of the other 76 strains were K. pneumoniae. Evaluation of the genetic environment of the blaKPC gene revealed that 76 of them carried the Tn3-Tn4401 chimera, as in K. pneumoniae KP048 (16), while 1 K. pneumoniae isolate harbored a deficient isoform of the chimera. Two purified plasmids (pLSH-KPN148-1 and pLSH-KPN153) were acquired by chemical transformation, and one plasmid (pLSH-KPN148-1) was completely sequenced successfully using the next-generation sequencing (NGS) approach. Plasmid pLSH-KPN148-1 (accession no. MK396843) belongs to the IncFIB/IncFII group and is 227,415 bp in size. As in pKP048 (16), a single copy of the blaKPC-2 gene embedded in a typical Tn3-Tn4401 chimera was detected in pLSH-KPN148-1. Compared with Tn4401b, only a 2,070-bp sequence (corresponding to positions 7774 to 9843 of Tn4401b) that contained the promoter P1, the blaKPC gene, and a partial ISKpn6-like element was observed in the Tn3-Tn4401 chimera (Fig. 1A). The promoters P2 and P3, which are present in the Tn4401 transposons, were absent in the chimera. Instead, bioinformatics analysis indicated a potential promoter, named PX, between ISKpn8 and blaKPC gene, with a linear discriminant function (LDF) value of 2.85. According to BPROM, the −10 and −35 sequences of PX were TGAGACAAT and TTCAAA, respectively, and they were immediately downstream of the sites of transcription factors fnr (ATTTGTTT) and argR2 (TTTATTTT) (Fig. 1). Considering the TGN motif, the distance between the −10 and −35 consensus sequences was ideally 17 bp.

FIG 1.

FIG 1

(A) Schematic structures surrounding the blaKPC gene in Tn4401b, Tn4401a, and the Tn3-Tn4401 chimera. Genes and their encoding orientations are indicated by horizontal arrows. Gray sequence bars denote areas of 100% identity to the reference Tn4401b (GenBank accession no. EU176013). Promoters of the blaKPC gene are indicated by triangles and rectangles above the sequences. (B) Nucleotide sequences illustrating variations of the intervening sequence (IVS) immediately upstream of the blaKPC genes in Tn4401a, Tn4401b, and the Tn3-Tn4401 chimera. Highlighted regions include the putative −35 and −10 regions of the four different promoters, including the previously reported P1, P2, and P3 (2, 17) and the newly discovered PX. Bold, italic nucleotides in gray boxes indicate mutation sites in construction promoter mutants. The TSS (+1) of each promoter, the putative ribosome binding site (RBS), and the blaKPC start codon (ATG) are also indicated as before (17).

In the 5′rapid amplification of cDNA ends (RACE) experiments, consistent results were obtained in the K. pneumoniae clinical isolates KPN148 and KPN153 and E. coli transformant CTB, and products of the transcription start site (TSS) were detected 39 bp and 145 bp upstream of the blaKPC translational start codon (Fig. 1B). The shorter product corresponded to the one described by Yigit et al. (2) and Naas et al. (17) and was the TSS of the P1 promoter. The larger product that started with guanine was exactly 7 bp downstream of the extended −10 sequence (TGAGACAAT) of the putative promoter PX.

By targeting promoters P1, P2, and PX, a total of 11 recombined plasmids, i.e., pTn4401A (promoters 1 and 2 [pro1,2]), pTn4401B (pro1,2,3), and pCTB (pro1,X), and their mutants, pM1Tn4401A (promoters 1 and 2 with mutation in promoter 1 [pro1,2-Mut1]), pM2Tn4401A (pro1,2-Mut2), pM1Tn4401B (pro1,2,3-Mut1), pM2Tn4401B (pro1,2,3-Mut2), pM1CTB (pro1,X-Mut1), pMXCTB (pro1,X-MutX), pPXCT (proX), and pSDKPC, were then constructed systematically (Table 1).

TABLE 1.

Promoter mutations designed in this studya

Plasmid Promoter(s) Mutant promoter Wild-type sequence Mutant sequence
pTn4401B P1, P2, P3 n
pM1Tn4401B P1M, P2, P3 P1 TAATCCCAGCTGTAGCGGCCTGATTACAT CGAGCCAGCTGCAGCGGCCTGATGCCGC
pM2Tn4401B P1, P2M, P3 P2 TTGACACCGGCGTACCCTCGGTGCTATCTT ACGTCGCCGGCGTACCCTCGGTGCGCACGA
pTn4401A P1, P2 n
pM1Tn4401A P1M, P2 P1 TAATCCCAGCTGTAGCGGCCTGATTACAT CGAGCCAGCTGCAGCGGCCTGATGCCGC
pM2Tn4401A P1, P2M P2 TTGACACCGGCGTACCCTCGGTGCTATCTT ACGTCGCCGGCGTACCCTCGGTGCGCACGA
pCTB P1, PX n
pM1CTB P1M, PX P1 TAATCCCAGCTGTAGCGGCCTGATTACAT CGAGCCAGCTGCAGCGGCCTGATGCCGC
pMXCTB P1, PXM PX TTCAAATATGTATCCGCTCATGAGACAAT TGCACGTATGTATCCGCTCACGAGCCAGG
pPXCTB PX n
pSDKPC N n
a

The −35 and −10 sequences of each promoter are indicated by underlining. Bold, italic nucleotides indicate mutations of the promoters. Superscript M, mutation; N, no blaKPC promoter available; n, no mutation.

Susceptibility and MIC testing.

For the 11 E. coli transconjugants, no significant difference in blaKPC gene copy number was detected by quantitative PCR (qPCR) (see Fig. S2 in the supplemental material). Among these isolates, Tn4401A, M1Tn4401A, Tn4401B, M1Tn4401B, CTB, M1CTB, MXCTB, and PXCT were resistant to imipenem (IPM), meropenem (MEM), cefepime (FEP), ceftaxidime (CAZ), piperacillin-taxobactam (TZP), and aztreonam (ATM); however, M2Tn4401A and M2Tn4401B were susceptible to all the agents tested in this study (Table 2). For the three isolates that harbored wild-type promoters, Tn4401A was the most resistant strain, Tn4401B was the least resistant strain, while CTB was in the middle, with MICs of 16, 16, 32, and 128 (μg/ml) for IPM, MEM, FEP, and CAZ, respectively. Compared with the wild-type strains Tn4401A and Tn4401B, slightly lower MICs of IPM, MEM, FEP, and CAZ were detected in the P1 mutant M1Tn4401A, and no significant difference was observed in M1Tn4401B. However, severe downregulation of the MICs resulted from mutation of promoter P2. Both M2Tn4401A and M2Tn4401B were susceptible to IPM, MEM, FEP, CAZ, TZP, and ATM and exhibited MICs identical to those of the control strain SDKPC. Compared with Tn4401A and Tn4401B, mutation of P1 as well as PX significantly decreased the resistance of CTB. The M1CTB and MXCTB strains exhibited similar susceptibilities to each other and demonstrated 4-fold or greater reductions in MICs to IPM, MEM, FEP, and CAZ compared with those of the CTB strain. In addition, PXCT was less resistant than CTB, and the MICs of the 4 β-lactamases were slightly higher than those for the M1CTB strain.

TABLE 2.

MICs of the recombined strainsa

Strain Plasmid Promoter(s) MIC (μg/ml)
IPM MEM FEP CAZ TZP ATM
Tn4401A pTn4401A P1, P2 64 32 ≥256 ≥256 ≥1,024 ≥256
M1Tn4401A pM1Tn4401A P1M, P2 32 16 32 128 ≥1,024 ≥256
M2Tn4401A pM2Tn4401A P1, P2M ≤0.5 ≤0.5 ≤1 ≤1 ≤4 ≤1
Tn4401B pTn4401B P1, P2, P3 8 8 32 64 ≥1,024 ≥256
M1Tn4401B pM1Tn4401B P1M, P2, P3 8 8 32 64 ≥1,024 ≥256
M2Tn4401B pM2Tn4401B P1, P2M, P3 ≤0.5 ≤0.5 ≤1 ≤1 ≤4 ≤1
CTB pCTB P1, PX 16 16 32 128 ≥1,024 ≥256
M1CTB pM1CTB P1M, PX 4 2 4 16 128 64
MXCTB pMXCTB P1, PXM 4 4 4 16 512 128
PXCT pPXCT PX 8 8 8 32 512 128
SDKPC pSDKPC N ≤0.5 ≤0.5 ≤1 ≤1 ≤4 ≤1
Trans1-T1 ≤0.5 ≤0.5 ≤1 ≤1 ≤4 ≤1
a

Trans1-T1, competent cell of E. coli DH5α that was used as the recipient strain in this study. IPM, imipenem; MEM, meropenem; TZP, piperacillin-tazobactam; FEP, cefepime; CAZ, ceftazidime; ATM, aztreonam. Superscript M, mutation; N, no blaKPC promoter available.

mRNA expression of the blaKPC gene.

The relative blaKPC mRNA expression levels of the Tn4401A, CTB, and Tn4401B strains were 1.06 ± 0.11, 1.00, and 0.32 ± 0.04, respectively (Fig. 2; Table S1). In comparison with these three strains, strains with mutation of promoter P1 showed significantly decreased mRNA expression levels of up to 50.0%, 34.4%, and 58.8% (P < 0.05), respectively. In particular, mutation of promoter P2 nearly abolished blaKPC expression in strains M2Tn4401A and M2Tn4401B (P < 0.01). However, mutation of the promoter PX still preserved 52.0% (P < 0.01) of the blaKPC transcription in strain MXCTB, and this transcription was even slightly higher than that in M1CTB. However, blaKPC mRNA expression in the PXCT strain, which harbored only the PX promoter, was up to 79.2% (P < 0.05) of that of the CTB strain and was 2-fold greater than that of the Tn4401B strain.

FIG 2.

FIG 2

Relative mRNA expression of the blaKPC gene. The blaKPC mRNA expression of each isolate was normalized to 16S rRNA and is shown relative to that of the CTB strain. Total RNA was extracted after culture in LB broth for 4 h. Mean values were calculated after three repeats. *, P < 0.05; **, P < 0.01 (t test).

KPC production in different isolates.

Consistent with the mRNA expression, Tn4401A (1.44 ± 0.18) produced the highest level of KPC protein, followed by CTB (1.00) and Tn4401B (0.65 ± 0.07) (Fig. 3; Table S1). Mutation of P1 may downregulate KPC production in M1Tn4401A (P < 0.05), although no significant differences were observed between Tn4401B and M1Tn4401B. However, mutation of P2 dramatically decreased KPC production by 87.5% (P < 0.01) and 81.5% (P < 0.01) in M2Tn4401A and M2Tn4401B, respectively. In comparison, mutation of either P1 or PX halved KPC production (P < 0.05), and no significant difference was observed between the M1CTB and MXCTB isolates. Relative KPC production in PXCT was 0.62 (P < 0.05) compared to that of CTB.

FIG 3.

FIG 3

KPC protein production of isolates carrying different promoters. (A) Relative KPC production of each isolate detected by evaluation of the coexpressed Flag tag and normalized to DnaK. (B) Representative Western blot results. Total proteins were extracted after culturing in LB broth for 6 h. Mean values were calculated after three repeats. *, P < 0.05; **, P < 0.01 (t test).

DISCUSSION

KPC-type carbapenemase can efficiently hydrolyze carbapenems, which are thought to be the last effective agents against severe infections caused by Gram-negative bacteria (1, 18). Previous studies have shown that both blaKPC copy number and deletions in the IVS may affect KPC production (12, 17, 19). Two basic genetic environments surrounding the blaKPC gene, the Tn4401 transposon, which is distributed worldwide, and the Tn3-Tn4401 chimera, which is found in China, have been identified (9, 10, 13). As reported in other studies (13, 14, 16), until now, no typical Tn4401 transposon has been detected in any of the clinical strains isolated in our hospital.

As reported by Naas and colleagues (17), the IPM MIC of the recombined E. coli strain containing the promoter combination of P1, P2, and P3 (Tn4401B) was 8 μg/ml. Consistently, the IPM MIC for Tn4401A (64 μg/ml), which contained promoters P1 and P2, was much higher than that for Tn4401B (9, 12, 17, 19). However, except for TZP and ATM, the IPM, MEM, FEP, and CAZ MICs for CTB were higher than that for Tn4401B but lower than that for Tn4401A. In addition, previous studies have shown that the ertapenem and FEP MICs for the E. coli transformants bearing wild-type plasmids with the Tn3-Tn4401 chimera were the same as those for the corresponding strains transformed with plasmids containing Tn4401a but were much higher than those for the transformants containing Tn4401b or Tn4401h (12, 20). Further evaluation revealed that the blaKPC mRNA expression of Tn4401A was 3-fold (P < 0.01) higher than that of Tn4401B, which is consistent with the results of a previous study (17). Similar to Tn4401A, the blaKPC mRNA expression of CTB was 3-fold higher than that of Tn4401B (P < 0.01). For comparison with Tn4401A and Tn4401B, intermediate KPC protein production of CTB was also observed by Western blotting. Taken together, these results indicate that the strains carrying a Tn3-Tn4401 chimera may have intermediate carbapenem resistance that falls between those of strains carrying Tn4401a and Tn4401b.

Subsequently, we explored the promoter elements that may affect blaKPC expression in the chimera. Canonically, the ideal 17-bp spacer separating the consensus sequences of the primary σ factor of E. coli, σ70, is initially assigned as sequences TTGACA (–35 box) and TATAAT (–10 box) or an extended TGNTATAAT (–10 box) at an appropriate distance from the +1 TSS (17, 21). Either of the promoters with quality matches to the –10/–35 sequences, which do not require the TGN motif, or with an excellent match to the extended –10 sequence, which does not require a −35 sequence, are typical σ70-dependent promoters (21). Thus, PX should be a strong σ70-dependent promoter consisting of a consensus –35 box (TTCAAA) and an extended −10 box (TGAGACAAT). This finding is further supported by the fact that the transformant with a single promoter PX (PXCT) efficiently expressed the blaKPC gene and exhibited high resistance to β-lactams in this study. Consequently, compared with the Tn4401 transposon, the Tn3-Tn4401 chimera harbors the controversial promoter P1 and a novel PX but lacks promoters P2 and P3.

Next, we further analyzed the impact of promoters P1, P2, and PX on KPC production in the different structures. Consistent with the view that promoters P1 and P2 contribute to KPC production (2, 17), mutation of the two promoters, as well as PX, can significantly downregulate blaKPC mRNA expression (P < 0.05). However, the impacts differed considerably in different genetic structures. In Tn4401a, although mutation of either P1 (M1Tn4401A) or P2 (M2Tn4401A) can significantly reduce the carbapenem MICs and KPC mRNA and protein expression levels (P < 0.05), the degrees of the M2Tn4401A mutation showed 6-, 2-, and 2.2-fold greater decreases (P < 0.01), respectively, than M1Tn4401A. In Tn4401b, similar to the results described by Cheruvanky et al. (12), no significant reduction in the MICs or KPC production was observed to result from the P1 mutation (M1Tn4401B), although mutation of P2 (M2Tn4401B) resulted in 4- and 5.9-fold (P < 0.01) reductions of the MICs and protein expression, respectively. Compared with the Tn4401 transposons, in the Tn3-Tn4401 chimera, mutation of P1 (M1CTB) and PX (MXCTB) showed similar results of a 4-fold decrease in the carbapenems MICs and a proximal 50% reduction of mRNA and protein production (P < 0.05). Therefore, although promoter P1 contributed to blaKPC gene expression in all three structures (17), P2 may act as a core promoter in the Tn4401a and Tn4401b transposons. Additionally, given that mutation of P1 has a stronger effect on blaKPC mRNA expression than on carbapenem MICs, one possible explanation is that the stable RNA structure of the intervening promoter sequences (17) in Tn4401b resulted in greater KPC translation, which in turn reduced the impact of the P1 mutation.

In summary, we show here that blaKPC expression and resistance of isolates carrying the Tn3-Tn4401 chimera were higher than those carrying Tn4401b but lower than those carrying Tn4401a. In addition, the novel blaKPC promoter PX was identified upstream of the controversial promoter P1 in the Tn3-Tn4401 chimera. Based on the levels of MIC, mRNA expression, and KPC production, we found that P1 and PX account for similar activities in the Tn3-Tn4401 chimera; however, promoter P2 is more active than P1 in the Tn4401a and Tn4401b transposons.

MATERIALS AND METHODS

Bacterial strains, blaKPC gene context evaluation, and cloning.

From 2015 to 2017, a total of 77 nonrepetitive KPC-producing Enterobacteriaceae strains were collected from Zhejiang University Lishui Hospital. Bacterial species were initially identified with the VITEK2 Compact system (bioMérieux Vitek, USA) and further confirmed by the automated mass spectrometry microbial identification system (matrix-assisted laser desorption ionization–time of flight [MALDI-TOF]; Bruker, USA). Genetic environments of the blaKPC gene were initially detected by PCR with specific primers described in our previous study (20) and further confirmed by Sanger sequencing. DNA fragments containing the promoter region and blaKPC gene (complement sequence corresponding to positions 19105 to 21715 of pKP048 [16]) were amplified and cloned into pET28X (a modified pET28a vector with T7 promoter deletion [Fig. S1]) to produce recombinant plasmid pCTB. In addition, corresponding blaKPC genetic structures in Tn4401a and Tn4401b were cloned into the pET28X vector as described before (17), which resulted in plasmids pTn4401A and pTn4401B, respectively.

Susceptibility and MIC testing.

Because copy number may also affect gene expression (19), relative qPCR assays were initially performed to detect the blaKPC copy numbers in each E. coli transconjugant. The MICs of imipenem (IPM), meropenem (MEM), piperacillin-tazobactam (TZP), cefepime (FEP), ceftazidime (CAZ), and aztreonam (ATM) were then determined by the broth microdilution method and interpreted according to the guidelines of the Clinical and Laboratory Standards Institute (CLSI) (22). E. coli ATCC 25922 was adopted as the quality control.

Promoter identification and mutation.

The putative promoter regions in the intervening sequence (IVS) between ISKpn8 and the blaKPC gene (complement sequence corresponding to positions 20460 to 20734 of pKP048 [16]) of the Tn3-Tn4401 chimera were initially predicted by using online software BPROM (Softberry) with an LDF threshold of 0.2. Then, 5′ rapid amplification of cDNA ends (5′ RACE) (catalog no. 634859; Clontech, USA) was performed to determine the transcription start site (TSS) of the blaKPC gene in wild-type K. pneumoniae strains KPN148 and KPN153 (harboring the Tn3-Tn4401 chimera) and transconjugant E. coli strain CTB (plasmid pCTB harboring promoters P1 and PX). According to the manufacturer’s instructions, 1 μg of total RNA was initially tailed with adenosines using poly(A) polymerase (catalog no. 2181; TaKaRa, Japan) and was subsequently reverse transcribed and amplified with primers UPM and GSPK (5′-GATTACGCCAAGCTTCATCGCGTACACACCGATGG-3′).

To further evaluate the transcription activities of P1, P2, and PX, these promoters in the three different structures were mutated individually. Mutants targeting the −10 and −35 boxes of each promoter (Table 1) were constructed by overlap PCR or single primer-mediated circular (SPC) PCR (23). pSDKPC, in which only a ribosome binding site (RBS) structure was present upstream of the blaKPC gene, was used as a negative control (17). E. coli Trans1-T1 strains were used as recipients.

qRT-PCR analysis of blaKPC mRNA expression.

To determine mRNA expression, total RNA was extracted from E. coli transformants containing parent plasmids pTn4401A, pTn4401B, and pCTB and their mutants using the EasyPure RNA kit (catalog no. ER101; Transgen Biotech, China). Approximately 1 μg of total RNA was then added, and cDNA was synthesized by using the PrimeScript RT reagent kit (catalog no. RR047; TaKaRa, Japan) according to the manufacturer’s guidelines. Finally, qPCR was performed on an ABI 7500 real-time PCR system (Applied Biosystems, USA) with TransStart green qPCR supermix (catalog no. AQ101; Transgen Biotech, China). The blaKPC mRNA levels were standardized relative to the level of the 16S rRNA gene (17). Specific primers targeting the E. coli 16S rRNA designed by Primer Premier 6 software were F-5′-CAGAGATGGATTGGTGCCTTC-3′ and R-5′-ATGAGGTCCGCTTGCTCTC-3′ and generated an amplicon of 276 bp in size.

Western blot analysis of KPC production.

A copy of the Flag tag sequence was cloned immediately downstream of the blaKPC gene. Recombined plasmids were constructed with the Flag tag and transformed into the E. coli Trans1-T1 strains. Total proteins were extracted with a bacterial protein extraction kit (catalog no. C600596; Sangon Biotech, China) in accordance with the manufacturer’s instructions. KPC production was evaluated via Flag tag expression by Western blot analysis. Immunoblotting experiments were performed in triplicate, and the results were normalized to the constitutively expressed housekeeping protein DnaK.

Data availability.

The complete sequence of pLSH-KPN148-1 has been deposited in GenBank under the accession number MK396843.

Supplementary Material

Supplemental file 1
AAC.02434-18-s0001.pdf (352.6KB, pdf)

ACKNOWLEDGMENTS

This work was supported by the National Natural Science Foundation of China (81802044), the Medical and Health Technological Project of Zhejiang Province of China (2018KY935), and the Major Research and Development Project of Lishui City of China (2017ZDYF13).

Footnotes

Supplemental material for this article may be found at https://doi.org/10.1128/AAC.02434-18.

REFERENCES

  • 1.Nordmann P, Cuzon G, Naas T. 2009. The real threat of Klebsiella pneumoniae carbapenemase-producing bacteria. Lancet Infect Dis 9:228–236. doi: 10.1016/S1473-3099(09)70054-4. [DOI] [PubMed] [Google Scholar]
  • 2.Yigit H, Queenan AM, Anderson GJ, Domenech-Sanchez A, Biddle JW, Steward CD, Alberti S, Bush K, Tenover FC. 2001. Novel carbapenem-hydrolyzing beta-lactamase, KPC-1, from a carbapenem-resistant strain of Klebsiella pneumoniae. Antimicrob Agents Chemother 45:1151–1161. doi: 10.1128/AAC.45.4.1151-1161.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Chen L, Hu H, Chavda KD, Zhao S, Liu R, Liang H, Zhang W, Wang X, Jacobs MR, Bonomo RA, Kreiswirth BN. 2014. Complete sequence of a KPC-producing IncN multidrug-resistant plasmid from an epidemic Escherichia coli sequence type 131 strain in China. Antimicrob Agents Chemother 58:2422–2425. doi: 10.1128/AAC.02587-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Cai JC, Zhou HW, Zhang R, Chen GX. 2008. Emergence of Serratia marcescens, Klebsiella pneumoniae, and Escherichia coli isolates possessing the plasmid-mediated carbapenem-hydrolyzing beta-lactamase KPC-2 in intensive care units of a Chinese hospital. Antimicrob Agents Chemother 52:2014–2018. doi: 10.1128/AAC.01539-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Robledo IE, Aquino EE, Sante MI, Santana JL, Otero DM, Leon CF, Vazquez GJ. 2010. Detection of KPC in Acinetobacter spp. in Puerto Rico. Antimicrob Agents Chemother 54:1354–1357. doi: 10.1128/AAC.00899-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Poirel L, Nordmann P, Lagrutta E, Cleary T, Munoz-Price LS. 2010. Emergence of KPC-producing Pseudomonas aeruginosa in the United States. Antimicrob Agents Chemother 54:3072. doi: 10.1128/AAC.00513-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Zhang Y, Wang Q, Yin Y, Chen H, Jin L, Gu B, Xie L, Yang C, Ma X, Li H, Li W, Zhang X, Liao K, Man S, Wang S, Wen H, Li B, Guo Z, Tian J, Pei F, Liu L, Zhang L, Zou C, Hu T, Cai J, Yang H, Huang J, Jia X, Huang W, Cao B, Wang H. 2018. Epidemiology of carbapenem-resistant Enterobacteriaceae infections: report from the China CRE Network. Antimicrob Agents Chemother 62:e01882-17. doi: 10.1128/AAC.01882-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Zhang R, Liu L, Zhou H, Chan EW, Li J, Fang Y, Li Y, Liao K, Chen S. 2017. Nationwide surveillance of clinical carbapenem-resistant Enterobacteriaceae (CRE) strains in China. EBioMedicine 19:98–106. doi: 10.1016/j.ebiom.2017.04.032. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Naas T, Cuzon G, Villegas MV, Lartigue MF, Quinn JP, Nordmann P. 2008. Genetic structures at the origin of acquisition of the beta-lactamase bla kPC gene. Antimicrob Agents Chemother 52:1257–1263. doi: 10.1128/AAC.01451-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Cuzon G, Naas T, Nordmann P. 2011. Functional characterization of Tn4401, a Tn3-based transposon involved in blaKPC gene mobilization. Antimicrob Agents Chemother 55:5370–5373. doi: 10.1128/AAC.05202-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Munoz-Price LS, Poirel L, Bonomo RA, Schwaber MJ, Daikos GL, Cormican M, Cornaglia G, Garau J, Gniadkowski M, Hayden MK, Kumarasamy K, Livermore DM, Maya JJ, Nordmann P, Patel JB, Paterson DL, Pitout J, Villegas MV, Wang H, Woodford N, Quinn JP. 2013. Clinical epidemiology of the global expansion of Klebsiella pneumoniae carbapenemases. Lancet Infect Dis 13:785–796. doi: 10.1016/S1473-3099(13)70190-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Cheruvanky A, Stoesser N, Sheppard AE, Crook DW, Hoffman PS, Weddle E, Carroll J, Sifri CD, Chai W, Barry K, Ramakrishnan G, Mathers AJ. 2017. Enhanced Klebsiella pneumoniae carbapenemase expression from a novel Tn4401 deletion. Antimicrob Agents Chemother 61:e00025-17. doi: 10.1128/AAC.00025-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Shen P, Wei Z, Jiang Y, Du X, Ji S, Yu Y, Li L. 2009. Novel genetic environment of the carbapenem-hydrolyzing beta-lactamase KPC-2 among Enterobacteriaceae in China. Antimicrob Agents Chemother 53:4333–4338. doi: 10.1128/AAC.00260-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Li G, Wei Q, Wang Y, Du X, Zhao Y, Jiang X. 2011. Novel genetic environment of the plasmid-mediated KPC-3 gene detected in Escherichia coli and Citrobacter freundii isolates from China. Eur J Clin Microbiol Infect Dis 30:575–580. doi: 10.1007/s10096-010-1124-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Zheng B, Huang C, Xu H, Yu X, Zhang J, Wang X, Jiang X, Xiao Y, Li L. 2018. Complete nucleotide sequences of two KPC-2-encoding plasmids from the same Citrobacter freundii isolate. J Antimicrob Chemother 73:531–533. doi: 10.1093/jac/dkx381. [DOI] [PubMed] [Google Scholar]
  • 16.Jiang Y, Yu D, Wei Z, Shen P, Zhou Z, Yu Y. 2010. Complete nucleotide sequence of Klebsiella pneumoniae multidrug resistance plasmid pKP048, carrying blaKPC-2, blaDHA-1, qnrB4, and armA. Antimicrob Agents Chemother 54:3967–3969. doi: 10.1128/AAC.00137-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Naas T, Cuzon G, Truong HV, Nordmann P. 2012. Role of ISKpn7 and deletions in blaKPC gene expression. Antimicrob Agents Chemother 56:4753–4759. doi: 10.1128/AAC.00334-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Cuzon G, Naas T, Truong H, Villegas MV, Wisell KT, Carmeli Y, Gales AC, Venezia SN, Quinn JP, Nordmann P. 2010. Worldwide diversity of Klebsiella pneumoniae that produce beta-lactamase blaKPC-2 gene. Emerg Infect Dis 16:1349–1356. doi: 10.3201/eid1609.091389. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Kitchel B, Rasheed JK, Endimiani A, Hujer AM, Anderson KF, Bonomo RA, Patel JB. 2010. Genetic factors associated with elevated carbapenem resistance in KPC-producing Klebsiella pneumoniae. Antimicrob Agents Chemother 54:4201–4207. doi: 10.1128/AAC.00008-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Huang J, Ding H, Shi Y, Zhao Y, Hu X, Ren J, Huang G, Wu R, Zhao Z. 2018. Further spread of a blaKPC-harboring untypeable plasmid in Enterobacteriaceae in China. Front Microbiol 9:1938–1946. doi: 10.3389/fmicb.2018.01938. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Browning DF, Busby SJ. 2004. The regulation of bacterial transcription initiation. Nat Rev Microbiol 2:57–65. doi: 10.1038/nrmicro787. [DOI] [PubMed] [Google Scholar]
  • 22.CLSI. 2017. Performance standards for antimicrobial susceptibility testing [S]; 27th informational supplement. CLSI M100-S127. Clinical and Laboratory Standards Institute, Wayne, PA. [Google Scholar]
  • 23.Huang J, Khan I, Liu R, Yang Y, Zhu N. 2016. Single primer-mediated circular polymerase chain reaction for hairpin DNA cloning and plasmid editing. Anal Biochem 500:18–20. doi: 10.1016/j.ab.2015.12.022. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental file 1
AAC.02434-18-s0001.pdf (352.6KB, pdf)

Data Availability Statement

The complete sequence of pLSH-KPN148-1 has been deposited in GenBank under the accession number MK396843.


Articles from Antimicrobial Agents and Chemotherapy are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES