Abstract
Objectives: Fanconi anaemia (FA) is a cancer‐prone chromosome instability syndrome characterized by hypersensitivity to DNA cross‐linking agents, such as diepoxybutane (DEB). Previous studies have shown that normal red blood cells (RBC) can protect cultured lymphocytes against chromosomal breaks induced by DEB. The present study was designed to analyse influence of RBCs from normal individuals on frequency of DEB‐induced chromosome breaks in lymphocyte cultures from FA patients.
Materials and methods: A comparative study was performed between DEB‐induced chromosome breaks in cultures of FA lymphocytes with either autologous or heterologous RBCs. A further comparative study was carried out between whole blood cultures from FA patients performed on two occasions, before and 1 week after transfusion of RBCs.
Results: It was observed that normal RBCs compared to FA RBCs, partially reduced chromosome breaks in cultured FA lymphocytes. A significant reduction in DEB‐induced breaks was also observed in FA cultured lymphocytes obtained 1 week after transfusion of RBCs, in comparison to those observed in the same patients before RBC transfusion.
Conclusions: This study shows that DEB‐induced chromosome instability in FA lymphocytes is partially reduced by normal RBCs. This effect may have some clinical relevance in vivo, whenever FA patients receive a RBC transfusion.
Introduction
Fanconi anaemia (FA) is a recessively inherited disorder clinically characterized by progressive bone marrow failure, several congenital malformations and increased predisposition to cancer, particularly acute myelogenous leukaemia (1, 2, 3, 4). At present, the haematological complications can only be treated by haematopoietic stem cell transplantation (5). Thirteen complementation groups have been characterized in FA and in all of them the identified genes (FANCA, ‐B, ‐C, ‐D1, ‐D2, ‐E, ‐F, ‐G, I, J, L, M and N) appear to function in maintenance of genomic stability (6). Given high variability in the phenotype and onset of disease, a correct diagnosis based on clinical manifestations is very difficult, and may be delayed or even missed. However, hypersensitivity of FA cells to clastogenic effect of DNA cross‐linking agents, in particular to diepoxybutane (DEB), provides a unique marker for diagnosis. Thus, cytogenetic analysis for detection of DEB‐induced chromosome aberrations (CA) is presently the gold standard test in diagnosis of FA (7, 8).
Besides the hypersensitivity to cross‐linking agents, FA cells are also hypersensitive to oxygen (9), pointing to an important function of FA genes in defence against reactive oxygen species (ROS). In 1981, Joenje and co‐workers described for the first time the correlation between chromosome breakage and oxygen tension in FA cells (10). Since then, intensive research is being performed concerning the role of FA proteins in protection against oxidative damage. Direct association of oxidative stress with the primary genetic defect in FA was suggested through interaction of FANCC protein with NADPH cytochrome P450 reductase and glutathione S‐transferase (GST). These two activities are involved in detoxifying reactive intermediates, including xenobiotics and ROS (11, 12). FANCA and FANCG proteins form a nuclear complex in response to oxidative stress (13). In summary, it has been hypothesized that FA proteins act directly (via FANCC and FANCG) and indirectly (via FANCA, BRCA2 and FANCD2) with cellular defence mechanisms against oxidative stress (14).
Toxicity of the cross‐linking agent DEB is redox‐related and oxygen dependent (15). Consequently, cell protective systems against oxidative stress are involved in DEB detoxification, with red blood cells (RBC), or some of its components in particular, playing an important role. It is well established that glutathione S‐transferase gene GSTT1 (expressed in RBC) is involved in determining sensitivity of lymphocytes to DEB‐induced sister chromatid exchanges (SCE) and chromosome aberrations (CA) (16, 17, 18, 19, 20). In a previous study, we have shown that RBCs can protect cultured lymphocytes against chromosomal breaks induced by DEB (21). To test the hypothesis that normal RBCs could protect against DEB‐induced genotoxicity in FA, we tested the effect of normal heterologous RBCs on frequency of DEB‐induced chromosome breaks, in lymphocyte cultures from FA patients.
Materials and methods
Subjects
Nine FA patients (two men and seven women), diagnosed with certainty on the basis of clinical features and cytogenetic findings, were included in this study. The spontaneous chromosomal instability characteristic of FA was observed in untreated lymphocyte cultures from each of the patients at time of diagnosis. In addition, the induced chromosome instability characteristic of FA was observed in DEB‐treated lymphocyte cultures from each of the patients at diagnosis (Table 1). Each culture condition performed in patients at diagnosis was compared with parallel control cultures from nine healthy blood donors (see also Table 1). For experiments comparing the effect of autologous versus heterologous RBCs, all except one patient was studied (results in Table 2). In three patients, DEB‐induced chromosome breaks were tested before and 1 week after transfusion of RBCs (results in Table 3). All procedures were carried out with the informed consent of the participants.
Table 1.
Chromosome breakage studies in spontaneous and DEB‐treated peripheral blood lymphocytes from nine Fanconi anaemia patients at diagnosis and simultaneous studies with normal controls (C)
| Spontaneous breakage | DEB‐induced breakage (0.05 μg/ml) | |||||
|---|---|---|---|---|---|---|
| n | % abcel | n | % abcel | Brks/cell | Brks/abcel | |
| Patients | ||||||
| FA 1 | (81) | 4.9 | (38) | 63.2 | 7.07 | 13.1 |
| FA 2 | (53) | 11.0 | (25) | 92.0 | 9.00 | 10.0 |
| FA 3 | (34) | 14.7 | (25) | 80.0 | 5.52 | 6.9 |
| FA 4 | (100) | 4.0 | (50) | 94.0 | 10.34 | 11.0 |
| FA 5 | n. o. | (30) | 100.0 | 13.80 | 13.8 | |
| FA 6 | (90) | 11.1 | (60) | 83.3 | 2.70 | 3.3 |
| FA 7 | (42) | 9.5 | (40) | 55.0 | 4.20 | 9.5 |
| FA 8 | (38) | 18.4 | (30) | 100.0 | 15.00 | 15.0 |
| FA 9 | (35) | 22.9 | (35) | 74.3 | 2.14 | 2.9 |
| Mean ± SD | 12.1 ± 6.4 | 82.4 ± 16.0 | 7.75 ± 4.64 | 9.5 ± 4.4 | ||
| Controls | ||||||
| C 1 | (100) | 0.0 | (40) | 10.0 | 0.10 | 1.0 |
| C 2 | (100) | 0.0 | (50) | 4.0 | 0.04 | 1.0 |
| C 3 | (100) | 0.0 | (40) | 20.0 | 0.25 | 1.3 |
| C 4 | (100) | 0.0 | (100) | 2.0 | 0.03 | 1.5 |
| C 5 | (100) | 0.0 | (100) | 4.0 | 0.05 | 1.3 |
| C 6 | (100) | 0.0 | (55) | 18.2 | 0.20 | 1.1 |
| C 7 | (100) | 0.0 | (100) | 1.0 | 0.01 | 1.0 |
| C 8 | (100) | 0.0 | (100) | 5.0 | 0.07 | 1.4 |
| C 9 | (100) | 0.0 | (80) | 3.8 | 0.05 | 1.3 |
| Mean ± SD | 0.0 ± 0.0 | 7.6 ± 7.0 | 0.09 ± 0.08 | 1.2 ± 0.19 | ||
IFAR classification of FA and non‐FA: FA: DEB‐treated mean breaks/cell 1.10–23.9; non‐FA: DEB‐treated mean breaks/cell 0.00–0.36.
Simultaneous experiments in FA and C are identified by identical code numbers.
n, number of cells analysed; SD, standard deviation; FA, Fanconi anaemia; % abcel, percentage of aberrant cells; Brks/cell, number of breaks/ cell; Brks/abcel, number of breaks/aberrant cell.
Table 2.
Chromosome breakage in DEB‐treated (0.05 μg/ml) peripheral blood lymphocyte cultures (LC) from eight Fanconi anaemia patients. Comparative study between cultures with autologous and heterologous red blood cells (RBC)
| Patients | LC with autologous RBC | LC with heterologous RBC | ||||
|---|---|---|---|---|---|---|
| n | % abcel | Brks/abcel | n | % abcel | Brks/abcel | |
| FA 1* | (38) | 63.2 | 13.1 | (70) | 35.7 | 8.5 |
| FA 2* | (25) | 92.0 | 10.0 | (37) | 83.8 | 4.9 |
| FA 3 | (100) | 93.0 | 8.1 | (99) | 82.8 | 6.1 |
| FA 4* | (50) | 94.0 | 11.0 | (50) | 82.0 | 3.9 |
| FA 5* | (30) | 100.0 | 13.8 | (53) | 71.7 | 11.2 |
| FA 6 | (66) | 54.5 | 1.9 | (95) | 25.3 | 1.6 |
| FA 7 | (35) | 57.1 | 9.7 | (34) | 47.1 | 4.9 |
| FA 8 | (25) | 96.0 | 10.4 | (25) | 84.0 | 8.5 |
| Mean | 81.2 (a) | 9.8 (b) | 64.1 (c) | 6.2 (d) | ||
| SD | 19.3 | 3.7 | 24.2 | 3.1 | ||
Paired t‐test: (a) versus (c), P < 0.001; (b) versus (d), P = 0.001.
n, number of cells analysed; % abcel, percentage of aberrant cells; Brks/abcel, number of breaks/aberrant cell; SD, standard deviation; FA, Fanconi anaemia.
*Experiments with these patients were performed at the time of diagnosis (see data on Table 1).
Table 3.
Chromosome breakage in DEB‐treated (0.05 μg/ml) whole blood cultures from three Fanconi anaemia (FA) patients analysed in two different times: before RBC transfusion (−RBC transfusion), and 1 week after RBC transfusion (+ RBC transfusion)
| Patients | −RBC transfusion | +RBC transfusion | ||||||
|---|---|---|---|---|---|---|---|---|
| n | Hct (%) | % abcel | Brks/abcel | n | Hct (%) | % abcel | Brks/abcel | |
| FA 2 | (25) | 14.9 | 92.0 | 10.0 | (55) | 18.9 | 76.4 | 5.3 |
| FA 3 | (100) | 19 | 93.0 | 8.1 | (85) | 28.8 | 85.9 | 3.2 |
| FA 9 | (30) | 14.7 | 100.0 | 8.5 | (82) | 22.4 | 75.6 | 4.0 |
| FA3a | (25) | 20.6 | 100.0 | 9.1 | (35) | 27.6 | 91.4 | 5.5 |
| Mean | 96.3 (a) | 8.9 (b) | 82.3 (c) | 4.5 (d) | ||||
| SD | 4.3 | 0.8 | 7.6 | 1.1 | ||||
Paired t‐test: (a) versus (c), P < 0.01; (b) versus (d), P < 0.001.
n, number of cells analysed; Hct, haematocrit; %abcel, percentage of aberrant cells; Brks/abcel, number of breaks/aberrant cell; SD, standard deviation
Cells and cell cultures
From each patient, 10 ml of heparinized blood was collected by venipuncture. Lymphocyte cultures were set up in RPMI complete medium supplemented with 15% FCS and antibiotics. Cultures were stimulated with 5 μg/ml of phytohaemagglutinin (PHA; Gibco, Invitrogen Corporation, Grand Island, NY, USA) and placed in an incubator at 37 °C in 5% CO2 atmosphere for 72 h (except in the simultaneous experiments from two patients where the time of incubation was 96 h). DEB ((±)‐1,2:3,4‐diepoxybutane, [298–18–0], D‐7019 Lot 34H3683; Sigma Chemicals Co., St Louis, USA), at final concentration in the medium of 0.05 μg/ml, was added to cultures 24 h after their initiation. As DEB is a suspected carcinogen with unknown risk, appropriate precautions were taken. Cultures were handled using gloves, and all culture procedures and the first part of the harvest were performed in a vertical laminar flow hood. As DEB is rapidly inactivated by concentrated hydrochloric acid (HCl), all disposable culture bottles and pipettes were rinsed with HCl before being discarded.
For experiments comparing the effect of autologous versus heterologous RBCs, patients’ lymphocyte cultures were set up either with whole blood or with samples where whole blood was depleted of RBCs by gravity sedimentation and heterologous RBCs (from normal blood donors) were added to obtain a final haematocrit equivalent to that observed in the respective patient. With this procedure, we aimed to obtain a RBC–leucocyte ratio equivalent to that observed in whole blood of the patients (to avoid influence of RBC concentration on chromosome breakage studies). RBC isolates were obtained from whole blood of normal controls by centrifugation at 335 g and rinsed twice with RPMI medium. Purity of RBC preparations was tested in the first three FA lymphocyte cultures performed. For this purpose, added heterologous RBCs were obtained from controls of the opposite sex and sex chromosomes were identified, confirming that lymphocytes analysed for chromosome breaks were in fact from the patient and not contaminating normal lymphocytes. All comparative cultures with autologous versus heterologous RBCs were performed simultaneously.
Cytogenetic analysis
After 3 days culture, cells were harvested after 1 h incubation with colchicine (4 μg/ml) followed by hypotonic treatment with 75 mm KCl and fixation in 1:3 solution of acetic acid:methanol. Chromosome preparations were made by the air drying method.
Analysis of chromosome aberrations was performed by one scorer on 25–100 Giemsa‐stained metaphases from coded slides. Minimum of 25 metaphases was counted only when the mitotic index was very low and rate of chromosome breakage was very high. To avoid bias in cell selection, consecutive metaphases, which appeared intact with sufficient well‐defined chromosome morphology, were selected for study. Each cell was scored for chromosome number (sex chromosome constitution in three experiments, as already mentioned) and number and types of structural abnormalities. Achromatic areas less than a chromatid in width were scored as gaps, while those wider than a chromatid were scored as breaks. Chromatid exchange configurations (such as triradial and tetraradial figures), dicentric and ring chromosomes, were scored as rearrangements. Gaps were excluded in the calculation of chromosome breakage frequencies, and rearrangements were scored as two breaks. Cells in which instability was so high that did not permit counting number of breaks were classified as pulverized cells. DEB‐induced chromosome breakage parameters (% aberrant cells, no. of breaks/cell and no. of breaks/aberrant cell) were determined according to the IFAR protocol (8).
DNA extraction
Coded blood samples from all patients and two controls were collected in 10 ml heparinized tubes and stored at −20 °C until use. Genomic DNA was obtained from 250 μl of whole blood, using a commercially available kit according to the manufacturer’s instructions (QIAamp DNA extraction kit; Qiagen, Hilden, Germany). Each DNA sample was stored at −20 °C until analysis.
GSTT1 genotyping
GSTT1 genotyping for gene deletions was carried out using multiplex PCR, as described by Lin et al. (22) with minor modifications. DNA samples were amplified using primers 5′‐TCACCGGATCATGGCCAGCA‐3′ (upstream) and 5′‐TTCCTTACTGGTCCTCACATCTC‐3′ (downstream) for GSTT1, which produced a 459 bp product in the absence of polymorphic deletion. Amplification of albumin gene using primers 5′‐GCCCTCTGCTAACAAGTCCTAC‐3′ (upstream) and 5′‐GCCCTAAAAAGAAAATCCCCAATC‐3′ (downstream) was used as an internal control and produced a 350 bp product. PCR was performed in a final volume of 50 μl, consisting of DNA (0.1 μg) dNTP (0.2 mm each) (Perkin Elmer Corp) MgCl2 (2.5 mm), each primer (0.3 and 0.2 μm for GSTT1 and albumin respectively), AmplitaqGold polymerase (1.25 units) (Perkin Elmer Corp), reaction buffer and 2% DMSO. Amplification was performed with initial denaturation at 95 °C for 7 min, followed by 35 cycles of amplification performed at 94 °C for 1 min, 62 °C for 1 min and 72 °C for 1 min and final extension at 72 °C for 10 min, using a GeneAmp 9600 thermal cycler (Perkin Elmer Corp, Foster City, CA, USA). Amplified products were visualized on ethidium bromide‐stained 1.5% agarose gel. All genotype determinations were carried out twice in independent experiments; all inconclusive samples were reanalysed, and conclusive results were obtained. Considering that GSTT1 gene expressed in RBCs modulates levels of genetic lesions induced by DEB, all patients studied were GSTT1 genotyped. Only two patients (FA6 and FA8) were ‘null’ individuals. In leucocyte cultures from these ‘null’ individuals, heterologous RBCs added were isolated from whole blood of GSTT1‘null’ individual controls.
Statistical analysis
Group mean values were compared using paired Student’s t‐test. Results were considered significant for P‐values <0.05. Data were analysed using statgraphics software (Statgraphics Statistical Graphics System, version 4.0, Warrenton, Virginia, USA).
Results
Influence of RBCs from normal individuals on frequency of chromosome breaks in DEB‐treated lymphocyte cultures from FA patients
A comparative study was performed between DEB‐induced chromosome breaks in lymphocyte cultures of FA patients with either autologous or heterologous RBCs (see Materials and methods section). In these experiments, a RBC–leucocyte ratio equivalent to that observed in whole blood was used. Results showed that presence of heterologous RBCs significantly reduced both number of aberrant cells (P < 0.001) and number of breaks per aberrant cell (P = 0.001) (Table 2).
Influence of RBC transfusion on frequency of chromosome breaks in DEB‐treated lymphocyte cultures from FA patients
To test putative clinical relevance of the observed effect of normal heterologous RBCs on chromosome instability in FA lymphocyte cultures, we further analysed whether a previous RBC transfusion (with consequent existence of chimerism of autologous and heterologous RBCs) could have any effect on frequency of chromosome breaks. For this purpose, a comparative study was carried out between whole blood cultures from FA patients performed on two occasions: before and 1 week after RBC transfusion (without chimerism and with chimerism for heterologous RBCs respectively). As shown in Table 3, a highly significant reduction in breaks was observed in FA cells from cultures performed after RBC transfusion (P < 0.001).
Discussion
Hypersensitivity of lymphocytes from FA patients to cross‐linking agents provides a unique marker for diagnosis even before the beginning of haematological manifestations (7, 8). In the present study, we used DEB‐induced chromosome breakage test for diagnosis of FA, and confirmed that lymphocytes from the nine patients studied were significantly hypersensitive, when compared to lymphocytes from controls (Table 1).
It is known that DEB toxicity is oxygen dependent (15). Consequently, DEB detoxification involves cellular protective mechanisms against oxidative stress. It has already been demonstrated that RBCs are involved in determining sensitivity of lymphocytes to DEB‐induced SCE and CA (16, 17, 18, 19, 20, 21). Straface et al. (23) showed high rates of altered RBCs from FA patients, in a morphometric study. They hypothesized that such changes could be the result of oxidative imbalance that could lead to alterations in RBC plasticity‐ and deformation‐associated functions. To test the hypothesis that change in the protective role of RBCs from FA patients could be implicated, at least in part, in increased DEB‐induced genotoxicity typical of FA cells, in the present study, we studied the effect of normal heterologous RBCs on frequency of DEB‐induced chromosome breaks in lymphocyte cultures from FA patients. Our results showed that presence of normal heterologous RBCs significantly decreased frequency of chromosome breaks, when compared to presence of autologous RBCs (Table 2). This decrease was not related to haemoglobin content in normal RBCs, as the experiments were performed with the same concentration of both autologous and heterologous RBCs. However, this effect was not sufficient to return DEB sensitivity to the normal range, suggesting that chromosome instability in lymphocytes from FA patients can be only partially corrected by heterologous normal RBCs.
Individual GSTT1 polymorphism modulates the level of genetic lesions induced by DEB (18, 19, 20). In search for genetic modifiers of the FA phenotype, Davies et al. (24) confirmed that cell sensitivity to DEB was significantly increased in GSTT1‘null’ FA individuals compared to GSTT1‘non null’ FA individuals. In the present study, lymphocytes from GSTT1‘null’ FA patients were co‐cultured with RBCs from ‘null’ controls. Thus, inter‐individual variation in GSTT1 genotype is not a possible explanation for the highly significant variation in chromosome breaks between cultures with autologous or heterologous RBCs. Other still not clarified factors could explain observed incapacity of RBCs from FA patients to protect effectively against DEB‐induced DNA damage.
Reduction in DEB‐induced chromosome breakage was observed in lymphocyte cultures from FA patients performed 1 week after RBC transfusion, in comparison to lymphocyte cultures of the same patients performed before RBC transfusion (Table 3). This suggests that normal heterologous RBCs may also have an increased protective effect against DNA damage in vivo.
All findings described in this study can have important clinical implications as they show that normal RBCs not only recover the haematological status of FA patients after transfusion but also reduce chromosome instability, which is an important factor of disease progression, namely evolution of malignancy. Of course, any potential protective effect of RBCs does not overcome the severe clinical side effects of blood transfusion, namely secondary iron overload (25, 26, 27, 28). This is a major cause of organ dysfunction, through production of reactive oxygen species that cannot be ignored.
In conclusion, the present study stresses the importance of RBCs as an important player in the complex defence system against chromosome instability. Further studies are needed to clarify why RBCs from FA patients have a lower capacity for protection against DEB‐induced chromosome damage, in comparison to normal RBCs.
Acknowledgements
The authors thank the clinicians Jorge Coutinho, Fernando Campilho, Anabela Ferrão and Sérgio Castedo who provided blood samples and clinical data from patients, and Prof. Jordi Surrallés and Graça Porto for the helpful discussions and revision of this manuscript.
The authors also acknowledge the support provided, in part, for the current research by the Fundação da Ciência e Tecnologia (FCT) and in particular the Center for Research in Human Molecular Genetics (CIGMH) Projects.
References
- 1. Fanconi G (1967) Familial constitutional panmyelocytopathy, Fanconi’s anemia (F.A.). I. Clinical aspects. Semin. Hematol. 4, 233–240. [PubMed] [Google Scholar]
- 2. Schroeder TM, Tilgen D, Kruger J, Vogel F (1976) Formal genetics of Fanconi’s anemia. Hum. Genet. 32, 257–288. [DOI] [PubMed] [Google Scholar]
- 3. Kutler DI, Singh B, Satagopan J, Batish SD, Berwick M, Giampietro PF et al. (2003) A 20‐year perspective on the International Fanconi Anemia Registry (IFAR). Blood 101, 1249–1256. [DOI] [PubMed] [Google Scholar]
- 4. Auerbach AD (2009) Fanconi anemia and its diagnosis. Mutat. Res. 668, 4–10. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Gluckman E, Auerbach AD, Horowitz MM, Sobocinski KA, Ash RC, Bortin MM et al. (1995) Bone marrow transplantation for Fanconi anemia. Blood 86, 2856–2862. [PubMed] [Google Scholar]
- 6. Moldovan GL, D’Andrea AD (2009) How the Fanconi anemia pathway guards the genome. Annu. Rev. Genet. 43, 223–249. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Auerbach AD, Adler B, Chaganti RSK (1981) Prenatal and postnatal diagnosis and carrier detection of Fanconi anemia by a cytogenetic method. Pediatrics 67, 128–135. [PubMed] [Google Scholar]
- 8. Auerbach AD, Rogatko A, Shroeder‐Kurth TM (1989) International Fanconi anemia registry: relation of clinical symptoms to diepoxybutane sensitivity. Blood 73, 391–396. [PubMed] [Google Scholar]
- 9. Saito H, Hammond AT, Moses RE (1993) Hypersensitivity to oxygen is a uniform and secondary defect in Fanconi anemia cells. Mutat. Res. 294, 255–262. [DOI] [PubMed] [Google Scholar]
- 10. Joenje H, Arwert F, Eriksson AW, Koning de H, Oostra AB (1981) Oxygen‐dependence of chromosomal aberrations in Fanconi’s anaemia. Nature 290, 142–143. [DOI] [PubMed] [Google Scholar]
- 11. Kruyt FA, Hoshino T, Liu JM, Joseph P, Jaiswal AK, Youssoufian H (1998) Abnormal microsomal detoxification implicated in Fanconi anemia group C by interaction of the FAC protein with NADPH cytochrome P‐450 reductase. Blood 92, 3050–3056. [PubMed] [Google Scholar]
- 12. Pagano G (2000) Mitomycin C and diepoxybutane action mechanisms and FANCC protein functions: further insights into the role for oxidative stress in Fanconi’s anaemia phenotype. Carcinogenesis 21, 1067–1068. [DOI] [PubMed] [Google Scholar]
- 13. Park SJ, Ciccone SL, Beck BD, Hwang B, Freie B, Clapp DW et al. (2004) Oxidative stress/damage induces multimerization and interaction of Fanconi anemia proteins. J. Biol. Chem. 279, 30053–30059. [DOI] [PubMed] [Google Scholar]
- 14. Pagano G, Youssoufian H (2003) Fanconi anaemia proteins: major roles in cell protection against oxidative damage. Bioessays 25, 589–595. [DOI] [PubMed] [Google Scholar]
- 15. Korkina LG, Deeva IB, De Biase A, Iaccarino M, Oral R, Warnau M et al. (2000) Redox‐dependent toxicity of diepoxybutane and mitomycin C in sea urchin embryogenesis. Carcinogenesis 21, 213–220. [DOI] [PubMed] [Google Scholar]
- 16. Wiencke JK, Christiani DC, Kelsey KT (1991) Bimodal distribution of sensitivity to SCE induction by diepoxybutane in human lymphocytes. I. Correlation with chromosomal aberrations. Mutat. Res. 248, 17–26. [DOI] [PubMed] [Google Scholar]
- 17. Wiencke JK, Pemble S, Ketterer B, Kelsey KT (1995) Gene deletion of glutathione S‐transferase theta: correlation with induced genetic damage and potential role in endogenous mutagenesis. Cancer Epidemiol. Biomarkers Prev. 4, 253–259. [PubMed] [Google Scholar]
- 18. Pelin K, Hirvonen A, Norppa H (1996) Influence of erythrocyte glutathione S‐transferase T1 on induction of sister chromatid exchange by diepoxybutane in cultured human lymphocytes. Mutagenesis 11, 213–215. [DOI] [PubMed] [Google Scholar]
- 19. Landi S, Ponzanelli I, Cipollini G, Frenzilli G, Luccini A, Sbrana CPI et al. (1997) Modulating factors of individual sensitivity to diepoxybutane: chromosome aberrations induced in vitro in human lymphocytes. Mutagenesis 12, 17–22. [DOI] [PubMed] [Google Scholar]
- 20. Landi S, Norppa H, Frenzilli G, Cipollini G, Ponzanelli I, Barale R et al. (1998) Individual sensitivity to cytogenetic effects of 1,2:3,4‐diepoxybutane in cultured human lymphocytes: influence of glutathione S‐transferase M1, P1 and T1 genotypes. Pharmacogenetics 8, 461–471. [PubMed] [Google Scholar]
- 21. Porto B, Chiecchio L, Gaspar J, Faber A, Pinho L, Rueff J et al. (2003) Role of haemoglobin in the protection of cultured lymphocytes against diepoxybutane (DEB), assessed by in vitro induced chromosome breakage. Mutat. Res. 536, 61–67. [DOI] [PubMed] [Google Scholar]
- 22. Lin D, Tang Y, Peng Q, Lu S, Ambrosone CB, Kadublar FF (1998) Susceptibility to esophageal cancer and genetic polymorphisms in glutathione‐S‐transferase T1, P1 and M1 and cytochrome P450 2E1. Cancer Epidemiol. Biomarkers Prev. 7, 1013–1018. [PubMed] [Google Scholar]
- 23. Straface E, Masella R, Príncipe DD, Franceschi C, Korkina LG, Zatterale A et al. (2000) Spectrin changes occur in erythrocytes from patients with Fanconi’s anemia and their parents. Biochem. Biophys. Res. Commun. 273, 899–901. [DOI] [PubMed] [Google Scholar]
- 24. Davies SM, Radloff GA, DeFor TE, Levran O, Batish SD, Hanenberg H et al. (2005) GST genotype may modify clinical phenotype in patients with Fanconi anaemia. Br. J. Haematol. 131, 118–122. [DOI] [PubMed] [Google Scholar]
- 25. Ozment CP, Turi JL (2008) Iron overload following red blood cell transfusion and its impact on disease severity. Biochim. Biophys. Acta 1790, 694–701. [DOI] [PubMed] [Google Scholar]
- 26. Kohgo Y, Ikuta K, Ohtake T, Torimoto Y, Kato J (2008) Body iron metabolism and pathophysiology of iron overload. Int. J. Hematol. 88, 7–15. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Di Marco V, Capra M, Gagliardotto F, Borsellino Z, Cabidi D, Barbaria F et al. (2008) Liver disease in chelated transfusion‐dependent thalassemics: the role of iron overload and chronic hepatitis C. Haematologica 93, 1243–1246. [DOI] [PubMed] [Google Scholar]
- 28. Lal A, Atamna W, Killilea DW, Suh JH, Ames BN (2008) Lipoic acid and acetyl‐carnitine reverse iron induced oxidative stress in human fibroblasts. Redox Rep. 13, 2–10. [DOI] [PubMed] [Google Scholar]