Skip to main content
NCBI home page
Cell Proliferation logoLink to Cell Proliferation
. 2002 Jul 31;35(4):237–245. doi: 10.1046/j.1365-2184.2002.00244.x

The expression of HIV‐1 tat and nef genes induces cell‐specific changes in growth properties and morphology of different types of rat cells

Irina Shugurova 1, Irina Bobrisheva 1, Irina Surkova 1, Igor Grivennikov 1, Vyacheslav Tarantul 1,✉
PMCID: PMC6496306  PMID: 12153615

Abstract

Abstract.  Among the viral regulatory genes the tat and nef genes of HIV‐1 encode the proteins playing a central role in viral replication and exerting pleiotropic effects on the survival and growth of the cells. These effects differ in various cell types, possibly due to the use of genes from different HIV‐1 isolates. In this work, we studied the effects of the tat and nef genes on three types of cultured rat cells: primary embryo fibroblasts, pseudonormal Rat‐2, and pheochromocytoma PC12. Both genes affected growth properties and morphology of cells, the effects being cell‐specific. The proliferative activity of both Rat‐2 and PC12 cells was considerably increased after transfection with the tat gene. In primary rat embryo fibroblasts the tat gene induced multilayered foci. More importantly, it was shown that the efficiency of transformation was higher in cells coexpressing tat and nef. The nef gene caused considerable suppression of Rat‐2 cell proliferation, but no changes in their morphology. The nef gene transfection of PC12 cells also led to suppression of their proliferative activity. In addition, cellular agglomerates which were morphologically similar to multinuclear syncytial cells were detected in these cells for the first time.

INTRODUCTION

Human immunodeficiency virus (HIV), the etiological agent of AIDS, is a complex retrovirus which contains several structural and accessory (regulatory) genes. Among viral regulatory genes the tat and nef genes encode the proteins playing a central role in viral replication and exerting pleiotropic effects on the survival and growth of different cell types (Cullen 1998).

The HIV Tat protein is a pleiotropic factor that influences cellular physiology by affecting the expression of cellular genes (Westendorp et al. 1994; Rautonen et al. 1994; Rasty et al. 1996; Sastry et al. 1996). Apart from its function as a transactivator, the Tat protein is known to induce some pathologies associated with AIDS (Vogel et al. 1988; Kim et al. 1992; Corrallini et al. 1993; Gavriil et al. 1999). Extensive research has been carried out in order to understand the action of the tat gene on cell proliferation and apoptosis. However, the data obtained are contradictory (Ensoli et al. 1993; Campioni et al. 1995; Zauli et al. 1995; Patki et al. 1996; Sastry et al. 1996). Campioni et al. (1995) showed that the Tat protein stimulated cell proliferation in transgenic mice and protected them from apoptosis in conditions of serum starvation. Zauli et al. (1995) observed apoptosis inhibition by Tat in Jurkat T‐cell lines and primary PBMC. In contrast, Sastry et al. (1996) showed that T‐lymphocytes transfected with constitutively‐expressed tat gene resulted in rapid apoptosis when grown under serum‐free conditions. According to data reported by Patki and Lederman (1996), the HIV‐1 Tat protein induced apoptosis and inhibited lymphocyte proliferative responses. Several reports have provided evidence that the tat gene has oncogenic potential (Vogel et al. 1988; Corrallini et al. 1993; Kim et al. 1992). Moreover, Tat suppressed butyric acid‐induced differentiation in the haemopoietic progenitor cell line K562 (Mondal & Agrawal 1996).

The nef gene encodes a protein with structural features of a signal transducing molecule of the ras family, whose functions, however, remain unknown. Data are gradually accumulating that point to the role of the nef gene, not only in the regulation of expression of HIV‐1 genes and in the replication of the virus (Kestler et al. 1991; Jamieson et al. 1994), but also in the repression of individual cellular gene expression (Garcia et al. 1991; De et al. 1998). Besides, the effect of the nef gene on the endocytosis of some cellular membrane‐localised proteins (Schwartz et al. 1996) and its regulatory effect in the formation of syncytia of T‐lymphocytes and macrophages (Meylan et al. 1998) were reported. The changes in lymphocyte proliferation were observed in transgenic mice containing the nef gene (Mudrik et al. 1992; Skowronski et al. 1993). The Nef protein significantly reduced the proliferative response to platelet‐derived growth factor (Graziani et al. 1996), but induced proliferation of human peripheral blood mononuclear cells (Torres et al. 1996). Stable expression of the nef gene in human astrocytes changes growth properties and activation state of these cells (Kohleisen et al. 1999).

Thus, the data available provide evidence of the multifunctional action of HIV‐1 tat and nef genes on cells from different tissues. However, the role of these genes in the development of pathologies in HIV‐infected patients has not been elucidated to the full. Transfection of different nonpermissive cultured cells with these viral genes can provide an approach to be used to study the function of individual regulatory genes of HIV‐1.

Materials and METHODS

Plasmids

To construct a tat gene‐containing pMT‐tat plasmid, the pRIP7 plasmid (kindly provided by Dr. S. Kim from the USA) (Kim et al. 1989) bearing HIV‐1 provirus (isolate HXB‐2) was used. A 2.7 kb pRIP7 EcoRI/BamHI‐fragment containing two translated exons of the tat gene were subcloned in the pBS vector (plasmid pBStat). Then a 1.75 kb BglII/XbaI‐fragment from pRIP7 containing a part of HIV‐1 LTR (regions R and U5) and its flanking human DNA genome region (plasmid pBStatLTR) were inserted into pBStat. After deletion of a part of the flanking region (the 1.4 kb PstI‐fragment) a 0.84 kb EcoRI/SalGI‐fragment containing the murine metallothioneine gene (MT) promoter was inserted into the resulting plasmid. The recombinant plasmid pNef with the nef gene under the control of cytomegalovirus (CMV) promoter and the control plasmid pNef‐fs with a frame‐shift mutation in the nef gene were kindly provided by Dr. S. Hammes (Hammes et al. 1989). Plasmids containing the c‐Ha‐ras1[pEJ6.6 (Shih & Weinberg 1982)], c‐myc[pSVc‐myc‐1 (Land et al. 1983)] and neo r[pSV2neo (Southern & Berg 1982)] genes were also used.

Cell cultures

A pseudonormal line Rat‐2 of rat fibroblast cells, primary fibroblasts of 16‐ and 17‐d‐old rat embryos and rat pheochromocytoma PC12 cells were used in experiments. Rat‐2 cells were grown in Eagle's medium with 10% fetal bovine serum (FBS). Primary rat embryo fibroblasts were cultured in Dulbecco's Modified Eagle Medium (DMEM) with 10% FBS. PC12 cells capable of neuronal differentiation under the action of NGF (Green & Tischler 1976) were grown in RPMI‐1640 medium with the addition of 5% horse serum and 10% FBS.

Isolation of stable transformed polyclonal cell cultures

The standard electroporation procedure was used in all transfection experiments. Cell cultures at the log phase of growth (106 cells per chamber) were suspended in 60 µl of 1 × HEBS buffer (25 mM HEPES, 140 mM NaCl, 0.75 mM Na2HPO4, pH 7.1) and were treated with 11 µg plasmid DNA. The following parameters were used for different cell cultures: impulse duration, 1.5 ms, voltage 500 V for primary fibroblasts, 600 V for Rat‐2 cells and 450 V for PC12 cells. Each of the plasmids pMT‐tat, pNef and pNef‐fs was cotransfected with the plasmid pSV2neo in a 10:1 ratio. The control transfection was performed with the pSV2neo plasmid (1 µg/106 cells). After the treatment cells were seeded at 2–3 × 105 cells per dish (d = 60 mm) in standard media. The selection of transformed cells was performed by the addition of G418 (0.5 mg/ml) to the culture medium after 24 h past electroporation. In order to obtain polyclonal stable transformed cultures, the pooled colonies were harvested after two weeks of growth in selective medium. To test the presence of the transgene in cells and its expression, PCR and RT‐PCR were performed. For this purpose, in all the cases, at least 10 single colonies were used which were isolated and cultivated under G418 selective pressure. Polymerase chain reaction (PCR) and Reverse transcriptase‐PCR (RT‐PCR) was performed with the following oligonucleotide pairs: 5′‐GAGCCAGTAGATCCTAGACTAGAGC‐3′ and 5′‐TCTGATGAGCTCTTCGTCGCTGTC‐3′ for the tat gene and 5′‐GGTGGCAAGTGGTCAAAAAGTAGTG‐3′ and AATCAGGGAAGTAGCCTTGTGTGTG‐3′ for the nef gene. PCR on cDNA and genomic DNA was performed using a DNA thermal cycler (Perkin‐Elmer Cetus Norwalk, Connecticut, USA), 50 ng of each primer, and an annealing temperature of 55 °C. In all cases, > 90% of isolated G418‐resistant colonies consisted of transgene. The transgene expression was detected in more than 60% G418‐resistent single colonies.

Cell proliferation rate and differentiation assay

Cell proliferation rate was estimated from the number of cells every 2 days during a week by the optical density indices with the use of MTT (3‐(4,5‐dimethylthiasole‐2il)‐2,5‐diphenyltetrasolium bromide) (Shearman et al. 1994). For the induction of the tat gene expression from MT promoter, ZnSO4 was added to the culture medium to a final concentration of 0.2 mM.

In order to examine neuronal differentiation of PC12 cells 100 ng/ml NGF was added to the culture medium every 3 days for 10 days.

Results

Effects of the HIV‐1 tat gene

Polyclonal cultures of the tat‐transfected Rat‐2 and PC12 cells were characterised in terms of growth properties (proliferation, focus formation) and morphology.

Tat‐expressing cells revealed a considerably higher proliferative activity compared with control cells (Fig. 1). Most differences were detected in the presence of an inductor (ZnSO4) of metallothioneine promoter of the tat gene. Addition of 0.2 mM ZnSO4 to the medium of control cells did not effect their proliferation.

Figure 1.

Figure 1

Open in a new tab

Growth rate of tat‐transformed polyclonal cell cultures. The number of PC12 (squares) and Rat‐2 (circles) cells was counted in control pSV2 neo ‐transfected variants (open symbols) and in pMT‐ tat /pSV2 neo ‐transfected variants in the presence of ZnSO 4 ‐inductor (x‐centre symbols) and in its absence (solid symbols). The graph represents the results of three independent experiments; standard deviations are indicated by bars.

Tat ‐transfected Rat‐2 cells formed multilayer colonies, and the morphology of these cells was noticeably changed as compared with the control cells ( Fig. 2 ). However, the morphology of PC12 cells transfected by the tat gene remained unchanged. Cultivation of tat ‐containing PC12 cells in conditions leading to neuronal cell differentiation (addition of NGF) revealed no statistically reliable effect of the HIV‐1 tat gene on either the process of their neuronal differentiation or cell proliferation rate (data not shown).

Figure 2.

Figure 2

Open in a new tab

Morphology of (a) Rat‐2 cells transfected with pMT‐ tat /pSV2 neo and (b) control Rat‐2 cells transfected with pSV2 neo . Magnification × 320.

To determine whether the tat gene could transform primary rat embryo fibroblasts, we used a standard focus‐formation assay (Table 1). We used expression plasmids, single and in combination, containing the following DNA sequences: the tat gene, the cellular oncogene Harvey rat sarcoma viral oncogene homologue (c‐Ha‐ras1) and the c‐myc oncogene. We assessed transformation by monitoring the appearance of foci 10–14 d after transfection. The tat gene alone induced the formation of foci. Also, cotransfection of tat and c‐Ha‐ras1 genes increased the number of foci. The increase was statistically significant (P < 0.05) after cotransfection of c‐Ha‐ras1 and c‐myc. The number of multilayer colonies was also observed to be remarkably increased after cotransfection of tat and c‐myc genes.

Table 1.

Foci formation in rat embryo fibroblasts after transfection with different plasmids

Transfected DNA Number of foci per 1.5 × 105 cells* Efficiency of transformation × 10−5
mock‐transfection  0 0
pMTtat  6.5 ± 1.0 0.43
pMTtat+ pEJ6.6 13.2 ± 2.1 0.88
pMTtat+ pSVc‐myc‐1  9.0 ± 1.9 0.60
pMTtat+ pNef  9.3 ± 1.7 0.62
pnef  0 0
pSVc‐myc‐1  0 0
pEJ6.6  0 0
pEJ6.6 + pSVc‐myc‐1 15.1 ± 1.5 1.00
Open in a new tab
*

The average of four independent experiments.

Effects of HIV‐1 nef gene

After transfection of Rat‐2 cells with the nef gene or with the plasmid carrying the nef gene with a frame‐shift mutation (control), the proliferation of the normal nef gene containing cells was found to be considerably lower than that of the control cells (Fig. 3).

Figure 3.

Figure 3

Open in a new tab

Growth rate of nef‐transformed Rat‐2 polyclonal cell cultures. The number of cells was counted in pNef/pSV2 neo ‐transfected variant (solid circles) and in two control variants: transfected with pSV2 neo (open circles) and with pNef‐fs/pSV2 neo (+‐centre circles). The graph represents the results of three independent experiments; standard deviations are indicated by bars.

Transfection of rat embryo fibroblasts with the nef gene gave no multilayer foci formation (Table 1). However, the number of multilayer foci was somewhat higher after cotransfection of tat and nef than that observed after transfection of the tat gene alone.

The morphology of rat embryo fibroblasts and Rat‐2 cells transfected with the nef gene did not differ from control pSV2 neo‐transfected cells. At the same time, the morphology of the nef containing PC12 cells appeared to be considerably changed as compared with the control. Formation of large structures similar to the syncytium (multinuclear cells) were observed in the light microscope (Fig. 4). The aggregates were viable and their size increased during 14 to 20 d of cultivation without replating. Parallel to this effect, the visually observed number of cells grew very slowly, which is probably due either to the decrease in the proliferative activity of the cells, or to the formation of a syncytia, which subsequently were lost during cultivation. After replating, practically all syncytial aggregates perished and the number of cells capable of morphological transformation was reduced from passage to passage. The estimation of the proliferative activity of nef‐transfected cells after a number of replating procedures showed practically no difference in the growth parameters as compared with control (data not shown). PCR analysis of a cellular line cultivated during a month revealed the absence of the HIV‐1 nef gene.

Figure 4.

Figure 4

Open in a new tab

Syncytium‐like structures in the pNef/pSV2 neo ‐transfected PC12 cells. Magnification × 320.

Discussion

The pathogenic manifestation of HIV‐1‐induced AIDS observed in different tissues include impaired hematopoiesis, immunopathology, cytopathology in the central nervous system, myopathy and different types of malignancy. Investigations of the effects of the tat and nef genes suggest that they play an important role in HIV pathogenesis.

To study the effect(s) of HIV regulatory genes we used various rat cell lines and not human cells usually infected by this virus. This choice was determined by the intention to discriminate between universal and specific mechanisms of action of the tat and nef gene products on cells of various species and types. It should be noted that some rat‐derived cells, including Rat2, are able to produce infectious HIV‐1 and support substantial levels of HIV‐1 genes expression (Keppler et al. 2001).

Our results, obtained for three different types of rat cell cultures, point in all cases to cell proliferation enhancement under the action of HIV‐1 tat gene. This fact correlates with the data published by other authors (Ensoli et al. 1993; Lotz et al. 1994; Campioni et al. 1995; 1993, 1995; Seve et al. 1999). Even though the tat gene suppresses apoptosis (Zauli et al. 1995), it can not appreciably affect the results obtained as the content of apoptotic cells in growing cell cultures does not exceed 5%.

In contrast to a previous report about an important role of Tat in abrogating erythroid differentiation in K562 cells (Mondal & Agrawal 1996), we have no evidence for any effect of the tat gene on PC12 neuronal differentiation induced by NGF. At the same time, the expression of a pMT‐tat plasmid in mouse embryonic stem cells disturbs the formation of embryoid bodies (our unpublished data). These findings suggest that, similar to proliferation, the effect of the tat gene on differentiation varies in different types of cells.

Besides, in our experiments the oncogenic potential of the tat gene was demonstrated on rat embryo fibroblasts. Malignant transformation induced by the tat gene in cell cultures and in transgenic mice had been observed earlier (Vogel et al. 1988; Corrallini et al. 1993; Kim et al. 1992).

In the light of published and our own data, one may believe that the oncogenic potential of the tat gene is realised by the proliferative activity enhancement in cells and elimination of apoptosis. The data presented allow us both to conclude that the effect of the tat gene is different in different types of cells and indicate the multifunctional character of this gene's product.

In addition, the cooperative effect of tat and nef genes on the neoplastic transformation was detected for the first time (Table 1). Recently a cooperative effect was observed between the nef and the hck genes (Briggs et al. 2000). This may prove that the nef gene is able to induce the oncogenic activity of some genes. Moreover, the results recently obtained for stable nef‐transfected human astrocytes have demonstrated the oncogenic potential of nef gene alone (Kohleisen et al. 1999). These data indicate that oncogenic effect of HIV‐1 nef gene is probably cell type and/or species‐specific, as was shown for HIV‐1 vpr and vpx genes (Chang et al. 2000).

The effect of the nef gene on Rat‐2 and PC12 cell proliferation is on the whole contrary to the effect of the tat gene. Our results correlate with the data showing that the nef gene product decreases the proliferative response to the action of the platelet‐derived growth factor (Graziani et al. 1996) and reduces the lymphocytes proliferative activity (Greenway et al. 1995). This effect is opposite to the ability of the exogenous Nef protein to stimulate the proliferation of the peripheral blood mononuclear cells (Quaranta et al. 1999). Obviously the effect of the nef gene, as that of the tat gene, is different in different cell types and depends on the target cell's metabolism.

In experiments with PC12 cells, direct indication of the involvement of the nef gene in the mechanism of multinuclear syncytium formation, which generally appears after HIV‐1 infection of human T‐lymphocytes and macrophages was obtained for the first time. Data describing the regulatory effect of the nef gene on syncytium formation are scarce and contradictory (Otake et al. 1994; Meylan et al. 1998). Different effects on syncytium formation in CD4+ T‐lymphocytes by the nef genes of different HIV‐1 isolates was observed (Meylan et al. 1998). However, the syncytium forming action of the nef gene from the same HIV‐1 isolate may obviously depend on the type of cells subjected to its action, as this effect was observed in PC12 cells only.

Thus, the results reported for three different rat cell lines demonstrate the pleiotropic but basically different action of the regulatory nef and tat genes of HIV‐1 on rat cells of different tissue origin. Moreover, the results obtained show that each particular tat or nef gene taken from one viral isolate exerts various effects on different rat cell types. Therefore, the regulatory effects of HIV‐1 accessory genes are cell‐specific.

Acknowledgements

We thank Dr. Nina B. Varshaver for careful reading of the manuscript and helpful discussions. This work was supported by the Russian Ministry of Science and Technology, the Russian Fund for Basic Investigation (Grant N 00‐04‐55055), the Russian Federal Program ‘Integration’ (Grant N 194) and a Grant from the Moscow Government (N 1.2.39).

References

  1. Briggs SD, Lerner EC, Smithgall TE. (2000) Affinity of src family kinase SH3 domains for HIV nef in vitro does not predict kinase activation by nef in vivo . Biochemistry, 39, 489. [DOI] [PubMed] [Google Scholar]
  2. Campioni D, Corallini A, Zauli G, Possati L, Altavilla G, Barbanti‐Brodano G. (1995) HIV type 1 extracellular protein stimulates growth and protects cell of BK virus/tat transgenic mice from apoptosis. AIDS Res. Hum. Retrovir., 11, 1039. [DOI] [PubMed] [Google Scholar]
  3. Chang L‐J, Chen C‐H, Urlacher V, Lee T‐F. (2000) Differential apoptosis effect of primate lentiviral Vpr and Vpx in mammalian cells. J. Biomed. Sci., 7, 322. [DOI] [PubMed] [Google Scholar]
  4. Corrallini A, Altavilla G, Pozzi L, Bignozzi L, Negrini M, Rimessi P, Gualandi F, Barbanti‐Brodano G. (1993) Systemic expression of HIV‐1 tat gene in transgenic mice induced endothelial proliferation and tumors of different histo types. Cancer Res., 53, 5569. [PubMed] [Google Scholar]
  5. Cullen BR. (1998) HIV‐1 auxiliary proteins: making connections in a dying cell. Cell, 93, 685. [DOI] [PubMed] [Google Scholar]
  6. De SK, Venkateshan CN, Seth P, Gajdusek DC, Gibbs CJ. (1998) Adenovirus‐mediated human immunodeficiency virus‐1 Nef expression in human monocytes/macrophages and effect of Nef on downmodulation of Fc receptor and expression of monokines. Blood, 91, 2108. [PubMed] [Google Scholar]
  7. Ensoli B, Buonaguro L, Barillari G, Fiorelli V, Gendelman R, Morgan RA, Wingfield P, Gallo RC. (1993) Release, uptake, and effects of extracellular human immunodeficiency virus type 1 Tat protein on cell growth and viral transactivation. J. Virol., 67, 277. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Garcia JV, Miller AD. (1991) Serine physphorylation‐independent downregulation of cell‐surface CD4 by nef . Nature, 350, 508. [DOI] [PubMed] [Google Scholar]
  9. Gavriil ES, Cooney R, Weeks BS. (1999) Tat mediated apoptosis in vivo in the rat central nervous system. Biochem. Biophys. Res. Commun., 267, 252. [DOI] [PubMed] [Google Scholar]
  10. Graziani L, Galimi F, Medico E, Cottone E, Gramaglia D, Boccaccio C, Comoglio PM. (1996) The HIV‐1 Nef protein interferes with phosphatidylinosol 3‐kinase activation. J. Biol. Chem., 271, 6590. [DOI] [PubMed] [Google Scholar]
  11. Green LA, Tischler AS. (1976) Establishment of a noradrenergic clonal line of rat adrenal pheochromocytoma cells which respond to nerve growth factor. Proc. Natl Acad. Sci. USA, 73, 2424. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Greenway A, Azad A, Mcphee D. (1995) Human immunodeficiency virus type 1 Nef protein inhibits activation pathways in peripheral blood mononuclear cells and T‐cell lines. Virology, 69, 1842. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Hammes SR, Dixon EP, Malim LH, Cullen BR, Greene WC. (1989) Nef protein of human immunodeficiency virus type 1: evidence against its role as a transcriptional inhibitor. Proc. Natl Acad. Sci. USA, 86, 9549. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Jamieson BD, Aldrovandi GM, Planelles V, Jowett JB, Gao L, Bloch LM, Chen IS, Zack JA. (1994) Requirement of human immunodeficiency virus type 1 nef for in vivo replication and pathogenicity. J. Virol., 68, 3478. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Keppler OT, Yonemoto W, Welte FJ, Patton KS, Iacovides D, Atchiso A, Ngo T, Hirschberg DL, Speck RF, Goldsmith MA. (2001) Susceptibility of rat‐derived cells to replication by human immunodeficiency virus type 1. J. Virol., 75, 8063. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Kestler HW III, Ringler DJ, Mori K, Panicali DL, Sehgal PK, Daniel MD, Desrosiers RC. (1991) Importance of the nef gene for maintenance of high virus loads and for development of AIDS. Cell, 65, 651. [DOI] [PubMed] [Google Scholar]
  17. Kim S, Ikeuchi K, Byrn R. (1989) Lack of a negative influence on viral growth by the nef gene of human immunodeficiency virus type 1. Proc. Natl. Acad. Sci. USA, 86, 9544. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Kim CM, Vogel J, Gay GR, Rhim JS. (1992) The HIV‐tat gene transforms human keratinocytes. Oncogene, 7, 1525. [PubMed] [Google Scholar]
  19. Kohleisen B, Shumay E, Sutter G, Foerster R, Brack‐Werner R, Nuesse M, Erfle V. (1999) Stable expression of HIV‐1 Nef induces changes in growth properties and activation state of human astrocytes. AIDS, 13, 2331. [DOI] [PubMed] [Google Scholar]
  20. Land H, Parada LF, Weinberg RA. (1983) Tumorogenic conversion of primary embryo fibroblasts requires at least two cooperating oncogenes. Nature, 304, 596. [DOI] [PubMed] [Google Scholar]
  21. Lotz M, Clark‐Lewis I, Ganu V. (1994) HIV‐1 transactivator protein Tat induces proliferation and TGF beta expression in human articular chondrocytes. J. Cell. Biol., 124, 365. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Meylan PR, Baumgartner M, Ciuffi A. (1998) The nef gene controls syncytium formation in primary human lymphocytes and macrophages infected by HIV type 1. AIDS Res. Hum. Retrovir., 14, 1531. [DOI] [PubMed] [Google Scholar]
  23. Mondal D, Agrawal KC. (1996) Effect of HIV‐1 Tat protein on butyric acid‐induced differentiation in a hematopoietic progenitor cell line. AIDS Res. Hum. Retrovir., 12, 1529. [DOI] [PubMed] [Google Scholar]
  24. M Udrik NN, Andreeva LE, Dubovaia VI, Mukhoian IA, Tarantul VZ. (1992) Effect of HIV‐1 nef gene on the relationship of cells in bone marrow and peripheral blood in transgenic mice. Dokl. Russian Akad. Nauk, 325, 606. [PubMed] [Google Scholar]
  25. Otake K, Fujii Y, Nakaya T, Nishino Y, Zhong Q, Fujinaga K, Kameoka M, Ohki K, Ikuta K. (1994) The carboxyl‐terminal region of HIV‐1 Nef protein is a cell surface domain that can interact with CD4+ T cells. J. Immunol., 153, 5826. [PubMed] [Google Scholar]
  26. Patki AH, Lederman MM. (1996) HIV‐1 Tat protein and its inhibitor Ro 24‐7429 inhibit lymphocyte proliferation and induce apoptosis in peripheral blood mononuclear cells from healthy donors. Cell Immunol., 169, 40. [DOI] [PubMed] [Google Scholar]
  27. Quaranta MG, Camponeschi B, Straface E, Malorni W, Viora M. (1999) Induction of interleukin‐15 production by HIV‐1 Nef protein: a role in the proliferation of uninfected cells. Exp. Cell Res., 250, 112. [DOI] [PubMed] [Google Scholar]
  28. Rasty S, Thatikunda P, Gordon J, Khalili K, Amini S, Glorioso JC. (1996) Human immunodeficiency virus tat gene transfer to the murine central nervous system using a replication‐defective herpes simplex virus vector stimulates growh factor beta 1 gene expression. Proc. Natl Acad. Sci. USA, 93, 6073. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Rautonen J, Rautonen N, Martin NL, Wara DW. (1994) HIV type 1 Tat protein induced immunoglobulin and interleukin 6 synthesis by uninfected peripheral blood mononuclear cells. AIDS Res. Hum. Retrovir., 10, 781. [DOI] [PubMed] [Google Scholar]
  30. Sastry KJ, Marin MC, Nehete PN, McConnell K, El ‐ Naggar AK, McDonnell TJ. (1996) Expression of human immunodeficiency virus type 1 tat results in down‐regulation of bcl‐2 gene and induction of apoptosis in hemapoietic cells. Oncogene, 13, 487. [PubMed] [Google Scholar]
  31. Schwartz O, Marechal V, Le Gall S, Lemonnier F, Heard J‐M. (1996) Endocytosis of major histocompatibility complex class I molecules is induced by the HIV‐1 Nef protein. Nature Medicine, 2, 338. [DOI] [PubMed] [Google Scholar]
  32. Seve M, Faiver A, Osman M, Hernandez D, Vaitaites G, Flores NC, Mccord JM, Flores SC. (1999) The human immunodeficiency virus‐1 Tat protein increases cell proliferation, alters sensitivity to zinc chelator‐induced apoptosis, and changes Sp1 DNA binding in HeLa cells. Archives Biochem. Biophys., 361, 165. [DOI] [PubMed] [Google Scholar]
  33. Shearman MS, Ragan CI, Iversen LL. (1994) Inhibition of PC12 cell redox activity is a specific, early indicator of the mechanism of beta‐amyloid mediated cell death. Proc. Natl Acad. Sci. USA, 91, 370. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Shih C, Weinberg RA. (1982) Isolation of a transforming sequence from a human bladder carcinoma cell line. Cell, 29, 161. [DOI] [PubMed] [Google Scholar]
  35. Skowronski I, Parks D, Mariani R. (1993) Altered T cell activation and development in transgenic mice expressing the HIV‐1 nef gene. EMBO J., 12 703. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Southern PJ, Berg P. (1982) Transformation of mammalian cells to antibiotic resistance with a bacterial gene under control of the SV40 early region promoter. Mol. Appl. Genet., 1, 327. [PubMed] [Google Scholar]
  37. Torres BA, Tanabe T, Johnson HM. (1996) Characterization of Nef‐induced T cell proliferation. Biochem. Biophys. Res. Commun., 225, 54. [DOI] [PubMed] [Google Scholar]
  38. Vogel J, Hinrichs SH, Reynolds RK, Luciw PA, Jay G. (1988) The HIV tat gene induces dermal lesions resembling Kaposi's sarcoma in transgenic mice. Nature, 335, 606. [DOI] [PubMed] [Google Scholar]
  39. Westendorp MO, Li‐Weber M, Frank RW, Krammer PH. (1994) Human immunodeficiency virus type 1 Tat upregulates interleukin‐2 secretion in activated T cells. J. Virol., 68, 4177. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Zauli G, Gibellini D, Milani D, Mazzoni M, Borgatti P, La Placa M, Capitani S. (1993) Human immunodeficiency virus type 1 Tat protein protects lymphoid, epithelial, and neuronal cell lines from death apoptosis. Cancer Res., 53, 4481. [PubMed] [Google Scholar]
  41. Zauli G, Gibellini D, Caputo A, Bassini A, Negrini M, Monne M, Mazzoni M, Capitani S. (1995) The human immunodeficiency virus type 1 Tat protein upregulates bcl‐2 gene expression in Jurkat T‐cell lines and primary peripheral blood mononuclear cells. Blood, 86, 3823. [PubMed] [Google Scholar]

Articles from Cell Proliferation are provided here courtesy of Wiley

RESOURCES