Skip to main content
PMC home page
Cell Proliferation logoLink to Cell Proliferation
. 2008 Jul 9;41(5):803–812. doi: 10.1111/j.1365-2184.2008.00542.x

Identification of osteo–adipo progenitor cells in fat tissue

Y F Lin 1,2, W Jing 2, L Wu 2, X Y Li 2, Y Wu 2, L Liu 2, W Tang 2, J Long 2, W D Tian 1,2, X M Mo 3
PMCID: PMC6496656  PMID: 18616697

Abstract

Abstract.  Objectives: In this study, a group of cells that expressed both osteogenic and adipogenic characters was identified from murine adipose stromal cells. Materials and methods: These cells could be enriched in the Sca‐1−1 population and express both osteogenic and adipogenic genes. Osteogenic induction enhanced expression of osteogenic genes and inhibited expression of adipogenic genes, while adipogenic induction enhanced expression of adipogenic genes and inhibited expression of osteogenic genes. These cells have been called osteo–adipo progenitors (OAPs). Results: OAPs expressed transcription factor runt‐related transcription factor 2 (RUNX2) and peroxisome proliferator‐activated receptor‐γ (PPAR‐γ) proteins in cytoplasm. When OAPs were cultured in adipogenic medium, PPAR‐γ moved to the nucleus and the cells differentiated into adipocytes, while the RUNX2 remained in the cytoplasm. In contrast, when OAPs were cultured in osteogenic medium, RUNX2 moved to the nucleus and the cells differentiated to osteocytes, while the PPAR‐γ remained in the cytoplasm. Conclusions: These experiments suggest that osteoblasts and adipocytes share a common predecessor, the OAP, in murine adipose stromal cells.

INTRODUCTION

In the clinic, reciprocal decrease of osteogenesis and increase in adipogenesis in bone marrow is associated with ageing (Moerman et al. 2004; Pei & Tontonoz 2004). Previous studies have suggested that osteoblasts and adipocytes share a common progenitor found in multipotential mesenchymal stem cells in bone marrow (Thomson et al. 1998; Jiang et al. 2002). However, cellular mechanisms of the reciprocal relationship are still not clear; this study has investigated the relationship between osteogenesis and adipogenesis in relation to adipose stromal cells.

Several key transcription factors during adipogenesis have been identified, the core factor is PPAR‐γ (peroxisome proliferator‐activated receptor‐γ) (Dang et al. 2003; Wang et al. 2006). PPAR‐γ expression in the adipogenesis process is activated by peroxisome proliferators (of the thiazolidinedione class of antidiabetic agents) and long‐chain fatty acids. It has been proven that embryonic stem cells from mice lacking PPAR‐γ were unable to differentiate into adipocytes and overexpression of PPAR‐γ in fibroblast cell lines can initiate adipogenesis (Duque et al. 2004). According to these pieces of work, PPAR‐γ is requisite and plays an important role in regulation of adipogenesis.

RUNX2 (runt‐related transcription factor 2) is a master regulatory transcription factor for osteogenesis (Yoshida et al. 2002; Barnes et al. 2003; Pockwinse et al. 2006). It belongs to the runt‐domain gene family, members of which have a unique DNA‐binding domain that is homologous to the Drosophila pair‐rule gene runt (Kundu et al. 2002; Pockwinse et al. 2006). Previous findings indicate that deficiency of RUNX2 results in a complete lack of bone formation due to maturation arrest of osteoblasts, and RUNX2 overexpression enhances osteogenic differentiation in adipose‐derived stem cells in vitro and in vivo (Zhang et al. 2006); these results show that RUNX2 is an essential transcription factor for osteoblast differentiation (Enomoto et al. 2004).

In addition, recent studies indicate that RUNX2 regulates reciprocal differentiation of osteoblasts and adipocytes (Choi et al. 2001; Zaidi et al. 2001). At the same time, PPAR‐γ can inhibit osteogenesis through stimulation of adipogenesis in bone marrow stromal cells (Akune et al. 2004; Wang et al. 2006). Many experiments have confirmed the existence of a reciprocal relationship between adipogenesis and osteogenesis (Cheng et al. 2003; Heim et al. 2004; Song et al. 2007), but the reason for it is still not well known.

Although multilineage differentiation of adipose stromal cells (ASCs) has been well described, the relationship of diverse differentiation has not been fully elucidated (Lin et al. 2006a,b). Thus, the interesting question is to illustrate the cellular mechanisms during trans‐differentiation. Combined with previous work, we have tried here to explore the reciprocal relationship between osteogenic and adipogenic differentiation of the ASCs (Lin et al. 2007; Wu et al. 2007). An inverse relationship between osteogenic and adipogenic differentiation has been observed, and decrease of osteoblasts found correlates with increase of adipocytes. These results suggest that adipocytes are generated at the expense of osteoblasts, so adipocytes and osteoblasts may come from the same progenitor. This hypothesis is supported by proof that single cell clones can differentiate into either adipocyte or osteoblast (Cowan et al. 2004; Hicok et al. 2004).

In the present study, we have identified a group of cells derived from ASCs that express both osteogenic and adipogenic progenitor characteristics. These cells can be enriched in the Sca‐1− population by fluorescence‐activated cell sorting (FACS), and express RUNX2 and PPAR‐γ proteins in the same cell. When cultured in adipogenic medium, PPAR‐γ moves to the nucleus and the cells differentiate into adipocytes. In contrast, when they were cultured in osteogenic medium, RUNX2 moved to the nucleus and the cells turned into osteocytes.

MATERIALS AND METHODS

Isolation and culture of adipose stromal cells

One hundred and twenty‐nine 5‐week‐old mice were used, in line with the International Guiding Principles for Animal Research. All surgical procedures were performed under anaesthesia with Nembutal at 0.1 mg/100 g. Inguinal fat pads were harvested and were washed extensively with sterile phosphate‐buffered saline (PBS). These tissues were excised into small masses of around 0.1 mm3. The masses were then adhered to culture dishes and control medium (Table 1) was added carefully to submerge them. These small pieces of tissue were cultured in a humidified atmosphere of 5% CO2 at 37 °C. When the cells were confluent, they were digested and passaged three times prior to multilineage differentiation. Medium was then replaced by adipogenic, osteogenic and chondrogenic inducing medium, respectively (also see Table 1). When induced cells were confluent the different lineages were analysed by respective methods.

Table 1.

Lineage‐specific differentiation induced by medium supplementation

Lineage Medium Serum Supplementation
Adipogenesis α‐minimal essential medium (MEM) Foetal bovine serum (FBS) (10%) 1 µm dexamethasone, 10 µm insulin, 200 µm indomethacin, 0.5 mm isobutyl‐methylxanthine, 1% antibiotic/antimycotic
Osteogenesis α‐MEM FBS (10%) 50 µm ascorbate‐2‐phosphate, 10 mmβ‐glycerophosphate, 0.01 µm 1,25‐dihydroxyvitamin D3, 1% antibiotic/antimycotic
Chondrogenesis α‐MEM FBS (10%) 10 ng/mL TGF‐β1, 100 nm dexamethasone, 6.25 µg/mL insulin, 50 nm ascorbate‐2‐phosphate, 110 mg/L sodium pyruvate, 1% antibiotic/antimycotic
Control α‐MEM FBS (10%) 1% antibiotic/antimycotic
Open in a new tab

Histochemical staining

Adipogenic cells were assessed using Oil Red O staining. First slides were rinsed in PBS and cells were fixed in 4% paraformaldehyde for 15 min, then stained with 1% Oil Red O for 10 min. Preparations were differentiated with 60% isopropanol and washed in 70% ethanol.

Mineralized nodules in osteogenic lineages were stained with alizarin red‐S (AR‐S). Cells on slides were rinsed in PBS and incubated with 40 mm AR‐S (pH 4.2) with rotation for 10 min. They were then rinsed with PBS and observed microscopically.

After ASCs were placed in chondrogenic medium for 7 days, cells were digested, pelleted by centrifugalization at 1200 g for 5 min, and then cultured as small masses for a further 2 weeks. Cell sections were stained with toluidine blue for 10 s and were washed in water and differentiated in 0.2% uranyl nitrate until the background appeared colourless.

RNA isolation and reverse transcription–polymerase chain reaction

Total RNA was extracted from all specimens using TRIzol reagent (Life Technologies, Carlsbad, CA, USA), according to the protocol provided. Around 1 µg of total RNA was reversed transcribed using a first strand cDNA synthesis kit (Fermentas, Vilnius, Lithuania) and polymerase chain reaction (PCR) amplification of target message RNA was performed using TaKaRa PCR kit (TaKaRa, Tokyo, Japan). PCR oligonucleotide primers and annealing temperature are listed in Table 2. All primers were determined through established GenBank sequences and amplification of glyceraldehyde phosphate dehydrogenase (GAPDH) was used as control for assessing PCR efficiency. Products were electrophoresed on 1.5% agarose gels, stained with ethidium bromide and visualized using Quantity One software (Bio‐Rad, Hercules, CA, USA). Three independent sets of experiments were performed, each being run three or more times.

Table 2.

Specific primers for polymerase chain reaction amplification with expected fragment size and optimal annealing temperature

Gene Primers Fragment (bp) Annealing temperature (°C) GenBank No.
RUNX2 Forward: 5′‐GTGCCCAGGCGTATTTCA‐3′
Reverse: 5′‐CAGCGTCAACACCATCATTC‐3′ 487 56 NM_009820
BSP Forward: 5′‐ATGGCTATGAAGGCTACGAGGGT‐3′
Reverse: 5′‐CGGAAATCACTCTGGGGCTGTAG‐3′ 199 54 NM_008318
TAZ Forward: 5′‐GCAGACATCTGCTTCACCAA‐3′
Reverse: 5′‐TTCCCTTCTGGGAAGATGTG‐3′ 158 60 NM_181516
OSX Forward: 5′‐ACCAGGTCCAGGCAACAC‐3′
Reverse: 5′‐GCAGTCGCAGGTAGAACG‐3′ 373 57 NM_130458
PPAR‐γ Forward: 5′‐GACCACTCGCATTCCTTT‐3′
Reverse: 5′‐CCACAGACTCGGCACTCA‐3′ 266 52 NM 005037
C/EBP‐α Forward: 5′‐TAGGTTTCTGGGCTTTGTGG‐3′
Reverse: 5′‐AGCATAGACGTGCACACTGC‐3′ 241 60 NM_007678
LPL Forward: 5′‐AGGGTGAGGAATCTAATG‐3′
Reverse: 5′‐CAGGTGTTTCAACCGCTA‐3′ 270 50 NM 000237
GAPDH Forward: 5′‐ACCACAGTCCATGCCATCAC‐3′
Reverse: 5′‐TCCACCACCCTGTTGCTGTA‐3′ 492 58 NM_001001303
Open in a new tab

Analysis of immunofluorescence

Monolayer slides of adipogenic or osteogenic differentiated ASCs were prepared for immunofluorescence analysis, fixed in 4% buffered paraformaldehyde. Slides were incubated in 3% hydrogen peroxide in methanol for 30 min to inhibit endogenous peroxidase activity. After washes with PBS, they were blocked in 1% bovine serum albumin and 1.5% normal goat serum at room temperature for 30 min. Preparations were incubated overnight at 4 °C in goat antimouse polyclonal antibodies against RUNX2 (Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA) for osteogenic cells, rabbit antimouse polyclonal antibodies against PPAR‐γ (Abcam, Cambridge, UK) for adipogenic cells. Both antibodies were added to the non‐induced ASCs sequentially. Cells were then incubated with secondary fluorescence antibodies, respectively, including red fluorescent goat antirabbit IgG (Invitrogen, Eugene, OR, USA) and green fluorescent swine antigoat IgG (SBA, Birmingham, AL, USA). After rinsing in distilled water, specimens were coversliped prior to fluorescence microscopy.

FACS analysis

Adipose stromal cells were cultured in control medium for 72 h before FACS analysis. Cells were labelled with the following antibodies: CD34‐PE, CD43‐FITC, C‐kit‐APC and SCA‐1. Mouse isotype antibodies served as controls (BioLegend, San Diego, CA, USA). More than 10 000 labelled cells were acquired and analysed using FACS Calibur (Becton‐Dickinson, San Joes, CA, USA) apparatus.

RESULTS

To harvest ASCs, mouse fat tissue had been placed on culture dishes. Three days after adherence, they migrated away from their source (Fig. 1a). Most of them exhibited a fibroblast‐like spindle shape, similar to stromal cells of fat tissue, as described previously. They proliferated quickly and became confluent in 2 weeks.

Figure 1.

Figure 1

Open in a new tab

ASCs migrated from small fat tissue sample (a). Mineralized nodules of cells were observed using alizarin red‐S staining, when adipose stromal cells (ASCs) were cultured in osteogenic medium for 2 weeks (b). After 2 weeks adipogenic induction, the accumulation of lipid was observed by Oil Red O staining (c). After chondrogenic induction and pellet culture, toluidine blue staining of ASC pellets proved the cells to have differentiated into chondrocytes; most cells were surrounded by proteoglycans (d).

Osteogenic, adipogenic and chondrogenic induction had been performed to prove the multilineage differentiation potential of the ASCs, 5 days after. When confluent, monolayers of the cells aggregated to form three‐dimensional island‐like structures. Mineralized nodules were confirmed by AR‐S staining culture in osteogenic medium. ASCs changed from a fibroblast‐like appearance to a multilateral form indicated by the staining (Fig. 1b). To analyse adipogenesis, ASCs were transferred into adipogenic medium, and they differentiated into lipid‐laden cells after 2 weeks induction. Adipogenesis was proven by Oil Red O staining (Fig. 1c). To prove chondrogenesis, ASCs had been placed into chondrogenic medium for 7 days. Then, cells were pellet by centrifugalization and were cultured as small masses for another 2 weeks. Toluidine blue staining indicated that they had large nuclei with multiple nucleoli, similar to chondrocytes; also most of the cells were surrounded by proteoglycans (Fig. 1d).

Reverse transcription–polymerase chain reaction had been performed to determine gene expression of ASCs before and after induction. Analysis of peroxisome proliferator‐activated receptor‐γ (PPAR‐γ), CCAAT/enhancer binding protein alpha (C/EBP‐α), lipoprotein lipase (LPL), transcription factor runt‐related transcription factor 2 (RUNX2), bone Sialoprotein (BSP), tafazzin (TAZ), osterix (OSX) were performed to be able to describe adipogenesis and osteogenesis. The results showed that PPAR‐γ, C/EBP‐α, LPL, RUNX2, BSP, TAZ and OSX were detected in ASCs without any induction. Expression of PPAR‐γ, C/EBP‐α and LPL increased after adipogenic induction while RUNX2, BSP, TAZ and OSX decreased (Fig. 2a). On the other hand, expression of RUNX2, BSP, TAZ and OSX increased during osteogenic induction, while the PPAR‐γ, C/EBP‐α and LPL decreased here (Fig. 2b).

Figure 2.

Figure 2

Open in a new tab

RT‐PCR analysis of PPAR‐γ, CEBP‐α, LPL, RUNX2, BSP, TAZ and OSX performed for adipogenesis. Day 0 indicates adipose stromal cells (ASCs) cultured in control medium; days 1, 3 and 7 indicate ASCs cultured in adipogenic medium (a). RT‐PCR analysis of PPAR‐γ, CEBP‐α, LPL, RUNX2, BSP, TAZ and OSX for osteogenesis, day 0 meaning ASCs cultured in control medium, and days 1, 3 and 7 indicating ASCs cultured in osteogenic medium (b). The results showed that the ASCs expressed PPAR‐γ, CEBP‐α, LPL, RUNX2, BSP, TAZ and OSX, even without induction. Osteogenic induction enhanced expression of osteogenic genes and inhibited expression of adipogenic genes, while adipogenic induction enhanced expression of adipogenic genes and inhibited expression of osteogenic genes.

To characterize the properties of these cells, which expressed both adipogenic and osteogenic genes, ASCs were sorted by FACS; however, CD34, CD43 and C‐kit could not enrich cells that expressed both osteogenic and adipogenic genes. Only Sca‐1 could separate ASCs into two populations: a large population expressing Sca‐1+ and a small population Sca‐1− negative (Fig. 3a). The large population of ASCs expressed adipogenic genes such as PPAR‐γ, C/EBP‐α and LPL, but did not express osteogenic genes such as RUNX2, BSP, TAZ and OSX. The small population expressed both osteogenic and adipogenic genes such as RUNX2, BSP, TAZ, OSX, PPAR‐γ, C/EBP‐α and LPL (Fig. 3b).

Figure 3.

Figure 3

Open in a new tab

By FACS, ASCs could be divided into two populations: a large population Sca‐1+ and a small population Sca‐1− (a). RT‐PCR results showed that the large population expressed adipogenic genes such as PPAR‐γ, CEBP‐α and LPL but were negative for osteogenic genes such as RUNX2, BSP, TAZ and OSX. The small population expressed both adipogenic and osteogenic genes, RUNX2, BSP, TAZ, OSX, PPAR‐γ, CEBP‐α and LPL (b).

In order to identify osteogenic and adipogenic cells of the ASCs, the immunofluorescence staining had been performed. Among the ASCs, a small group of cells expressed both RUNX2 and PPAR‐γ in the cytoplasm of the same cells (Fig. 4, non‐inducted). When ASCs were transferred into adipogenic medium, PPAR‐γ was detected in nuclei of cells that expressed both PPAR‐γ and RUNX2 in the cytoplasm (Fig. 4, adipogenesis). In comparison, when the ASCs were cultured in osteogenic medium, RUNX2 was detected in nuclei of cells that expressed both PPAR‐γ and RUNX2 in the cytoplasm (Fig. 4, osteogenesis). These results indicate that there are osteo–adipo progenitors (OAPs) that express the PPAR‐γ and RUNX2 protein in the same cell. PPAR‐γ can move to the nucleus during adipogenesis when RUNX2 remains in the cytoplasm and RUNX2 can move to the nucleus during osteogenesis while PPAR‐γ remains in the cytoplasm.

Figure 4.

Figure 4

Open in a new tab

Immunofluorecsence staining performed to identify osteogenic and adipogenic cells of adipose stromal cells (ASCs). Among ASCs, a small group of cells expressed both RUNX2 and PPAR‐γ simultaneously, in the cytoplasm of the same cell (Fig. 4, uninduction). When ASCs were transferred to adipogenic medium, PPAR‐γ was detected in nuclei and cytoplasm of cells while RUNX2 existed only in the cytoplasm (Fig. 4, adipogenesis). In comparison, when the ASCs were cultured in osteogenic medium, RUNX2 was detected in nuclei and cytoplasm of cells, while PPAR‐γ remained in the cytoplasm (Fig. 4, osteogenesis).

DISCUSSION

In the clinic, age‐related osteoporosis is usually accompanied by an increase of adipose tissue and a decrease of bone tissue progenitors in bone marrow (Moerman et al. 2004). This implies a possible reciprocal relationship between osteogenesis and adipogenesis; however, the cellular mechanisms of this reciprocal relationship are not well known (Jaiswal et al. 2000). According to previous work, adipose tissue contains a supportive stroma and ASCs are easy to isolate. Among these, there are pluripotent stem cells with potential to differentiate into several musculoskeletal lineages and ASCs can differentiate into osteoblasts, adipocytes, chondrocytes and myoblasts under certain condition (Lin et al. 2006a). Osteogenic and adipogenic potential of ASCs has been well proven (Cowan et al. 2004; Lin et al. 2007), but the reciprocal relationship between osteogenesis and adipogenesis still needs further research.

Valuable studies prove the tight relationship between osteogenic and adipogenic differentiation. For example, PPAR‐γ is responsible for initiation and maintenance of the adipocyte phenotype in vivo (Tzameli et al. 2004), and PPAR‐γ insufficiency enhances osteogenesis through osteoblast formation from bone marrow progenitors (Akune et al. 2004). Most previous studies have been performed on pre‐adipocyte cell lines and have demonstrated that PPAR‐γ acts as a master conductor of the entire adipogenic programme (Guan et al. 2005; Lehrke & Lazar 2005). Previous findings indicate that depletion of RUNX2 results in decrease in the osteogenic phenotype and increase in the adipogenic phenotype (Enomoto et al. 2004). RUNX2 is an important transcription factor for osteoblast differentiation (Bae & Lee 2006), and RUNX2 deficiency in chondrocytes causes adipogenic changes in vitro (Enomoto et al. 2004). Additionally, the phytoestrogen genistein enhances osteogenesis and represses adipogenic differentiation of bone marrow stromal cells (Heim et al. 2004), and activation of Sirt1 decreases adipocyte formation during osteoblast differentiation of mesenchymal stem cells (Backesjo et al. 2006). Msx2 promotes osteogenesis and suppresses adipogenic differentiation of multipotent mesenchymal progenitors (Cheng et al. 2003).

Although these studies suggested the reciprocal relationship between osteogenesis and adipogenesis, the cellular mechanisms had not been addressed. The present study has proven that there is a subgroup of ASCs that hold bilateral differentiation potential and simultaneously express adipogenic and osteogenic characteristics; these cells were named OAPs. FACS and RT‐PCR analyses proved that the OAPs came from the Scal‐1− cell population. Osteogenic induction enhanced expression of osteogenic genes and inhibited expression of adipogenic genes, while adipogenic induction enhanced expression of adipogenic genes and inhibited expression of osteogenic genes. Immunofluorescence staining for RUNX2 and PPAR‐γ indicated presence of both in the same cell. When OAPs were cultured in adipogenic medium, PPAR‐γ moved to the nucleus and the cells differentiated into adipocytes. At the same time, RUNX2 remained in the cytoplasm. In contrast, when OAPs were cultured in osteogenic medium, RUNX2 moved to the nucleus and the cells differentiated to osteocytes, while the PPAR‐γ remained in the cytoplasm. These finding provide for us a new way to explain the reciprocal relationship between osteogenesis and adipogenesis.

ACKNOWLEDGEMENTS

This work was supported by Opening Funding of the State Key Laboratory of Oral Diseases, Sichuan University (SKLODKF200701), China Ministry of Science and Technology under Contract Preliminary Project (2002CCC00700, 2006CB708505), and Science Foundation for the Excellent Youth Scholars of Ministry of Education (2003682).

REFERENCES

  1. Akune T, Ohba S, Kamekura S, Yamaguchi M, Chung UI, Kubota N, Terauchi Y, Harada Y, Azuma Y, Nakamura K, Kadowaki T, Kawaguchi H (2004) PPARgamma insufficiency enhances osteogenesis through osteoblast formation from bone marrow progenitors. J. Clin. Invest. 113, 846–855. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Backesjo CM, Li Y, Lindgren U, Haldosen LA (2006) Activation of Sirt1 decreases adipocyte formation during osteoblast differentiation of mesenchymal stem cells. J. Bone Miner. Res. 21, 993–1002. [DOI] [PubMed] [Google Scholar]
  3. Bae SC, Lee YH (2006) Phosphorylation, acetylation and ubiquitination: the molecular basis of RUNX regulation. Gene 366, 58–66. [DOI] [PubMed] [Google Scholar]
  4. Barnes GL, Javed A, Waller SM, Kamal MH, Hebert KE, Hassan MQ, Bellahcene A, Van Wijnen AJ, Young MF, Lian JB, Stein GS, Gerstenfeld LC (2003) Osteoblast‐related transcription factors Runx2 (Cbfa1/AML3) and MSX2 mediate the expression of bone sialoprotein in human metastatic breast cancer cells. Cancer Res. 63, 2631–2637. [PubMed] [Google Scholar]
  5. Cheng SL, Shao JS, Charlton‐Kachigian N, Loewy AP, Towler DA (2003) MSX2 promotes osteogenesis and suppresses adipogenic differentiation of multipotent mesenchymal progenitors. J. Biol. Chem. 278, 45969–45977. [DOI] [PubMed] [Google Scholar]
  6. Choi JY, Pratap J, Javed A, Zaidi SK, Xing L, Balint E, Dalamangas S, Boyce B, Van Wijnen AJ, Lian JB, Stein JL, Jones SN, Stein GS (2001) Subnuclear targeting of Runx/Cbfa/AML factors is essential for tissue‐specific differentiation during embryonic development. Proc. Natl. Acad. Sci. USA 98, 8650–8655. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Cowan CM, Shi YY, Aalami OO, Chou YF, Mari C, Thomas R, Quarto N, Contag CH, Wu B, Longaker MT (2004) Adipose‐derived adult stromal cells heal critical‐size mouse calvarial defects. Nat. Biotechnol. 22, 560–567. [DOI] [PubMed] [Google Scholar]
  8. Dang ZC, Audinot V, Papapoulos SE, Boutin JA, Lowik CW (2003) Peroxisome proliferator‐activated receptor gamma (PPARgamma) as a molecular target for the soy phytoestrogen genistein. J. Biol. Chem. 278, 962–967. [DOI] [PubMed] [Google Scholar]
  9. Duque G, Macoritto M, Kremer R (2004) 1,25 (OH) 2D3 inhibits bone marrow adipogenesis in senescence accelerated mice (SAM‐P/6) by decreasing the expression of peroxisome proliferator‐activated receptor gamma 2 (PPARgamma2). Exp. Gerontol. 39, 333–338. [DOI] [PubMed] [Google Scholar]
  10. Enomoto H, Furuichi T, Zanma A, Yamana K, Yoshida C, Sumitani S, Yamamoto H, Enomoto‐Iwamoto M, Iwamoto M, Komori T (2004) Runx2 deficiency in chondrocytes causes adipogenic changes in vitro . J. Cell Sci. 117, 417–425. [DOI] [PubMed] [Google Scholar]
  11. Guan HP, Ishizuka T, Chui PC, Lehrke M, Lazar MA (2005) Corepressors selectively control the transcriptional activity of PPARgamma in adipocytes. Genes Dev. 19, 453–461. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Heim M, Frank O, Kampmann G, Sochocky N, Pennimpede T, Fuchs P, Hunziker W, Weber P, Martin I, Bendik I (2004) The phytoestrogen genistein enhances osteogenesis and represses adipogenic differentiation of human primary bone marrow stromal cells. Endocrinology 145, 848–859. [DOI] [PubMed] [Google Scholar]
  13. Hicok KC, Du Laney TV, Zhou YS, Halvorsen YD, Hitt DC, Cooper LF, Gimble JM (2004) Human adipose‐derived adult stem cells produce osteoid in vivo . Tissue Eng. 10, 371–380. [DOI] [PubMed] [Google Scholar]
  14. Jaiswal RK, Jaiswal N, Bruder SP, Mbalaviele G, Marshak DR, Pittenger MF (2000) Adult human mesenchymal stem cell differentiation to the osteogenic or adipogenic lineage is regulated by mitogen‐activated protein kinase. J. Biol. Chem. 275, 9645–9652. [DOI] [PubMed] [Google Scholar]
  15. Jiang Y, Jahagirdar BN, Reinhardt RL, Schwartz RE, Keene CD, Ortiz‐Gonzalez XR, Reyes M, Lenvik T, Lund T, Du Blackstad MJ, Aldrich S, Lisberg A, Low WC, Largaespada DA, Verfaillie CM (2002) Pluripotency of mesenchymal stem cells derived from adult marrow. Nature 418, 41–49. [DOI] [PubMed] [Google Scholar]
  16. Kundu M, Javed A, Jeon JP, Horner A, Shum L, Eckhaus M, Muenke M, Lian JB, Yang Y, Nuckolls GH, Stein GS, Liu PP (2002) Cbfbeta interacts with Runx2 and has a critical role in bone development. Nat. Genet. 32, 639–644. [DOI] [PubMed] [Google Scholar]
  17. Lehrke M, Lazar MA (2005) The many faces of PPARgamma. Cell 123, 993–999. [DOI] [PubMed] [Google Scholar]
  18. Lin Y, Chen X, Yan Z, Liu L, Tang W, Zheng X, Li Z, Qiao J, Li S, Tian W (2006a) Multilineage differentiation of adipose‐derived stromal cells from GFP transgenic mice. Mol. Cell. Biochem. 285, 69–78. [DOI] [PubMed] [Google Scholar]
  19. Lin Y, Liu L, Li Z, Qiao J, Wu L, Tang W, Zheng X, Chen X, Yan Z, Tian W (2006b) Pluripotency potential of human adipose‐derived stem cells marked with exogenous green fluorescent protein. Mol. Cell. Biochem. 291, 1–10. [DOI] [PubMed] [Google Scholar]
  20. Lin Y, Wang T, Wu L, Jing W, Chen X, Li Z, Liu L, Tang W, Zheng X, Tian W (2007) Ectopic and in situ bone formation of adipose tissue‐derived stromal cells in biphasic calcium phosphate nanocomposite. J. Biomed. Mater. Res. A 81, 900–910. [DOI] [PubMed] [Google Scholar]
  21. Moerman EJ, Teng K, Lipschitz DA, Lecka‐Czernik B (2004) Aging activates adipogenic and suppresses osteogenic programs in mesenchymal marrow stroma/stem cells: the role of PPAR‐gamma2 transcription factor and TGF‐beta/BMP signaling pathways. Aging Cell 3, 379–389. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Pei L, Tontonoz P (2004) Fat's loss is bone's gain. J. Clin. Invest. 113, 805–806. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Pockwinse SM, Rajgopal A, Young DW, Mujeeb KA, Nickerson J, Javed A, Redick S, Lian JB, Van Wijnen AJ, Stein JL, Stein GS, Doxsey SJ (2006) Microtubule‐dependent nuclear‐cytoplasmic shuttling of Runx2. J. Cell. Physiol. 206, 354–362. [DOI] [PubMed] [Google Scholar]
  24. Song HY, Jeon ES, Kim JI, Jung JS, Kim JH (2007) Oncostatin M promotes osteogenesis and suppresses adipogenic differentiation of human adipose tissue‐derived mesenchymal stem cells. J. Cell. Biochem. 101, 1238–1251. [DOI] [PubMed] [Google Scholar]
  25. Thomson JA, Itskovitz‐Eldor J, Shapiro SS, Waknitz MA, Swiergiel JJ, Marshall VS, Jones JM (1998) Embryonic stem cell lines derived from human blastocysts. Science 282, 1145–1147. [DOI] [PubMed] [Google Scholar]
  26. Tzameli I, Fang H, Ollero M, Shi H, Hamm JK, Kievit P, Hollenberg AN, Flier JS (2004) Regulated production of a peroxisome proliferator‐activated receptor‐gamma ligand during an early phase of adipocyte differentiation in 3T3‐L1 adipocytes. J. Biol. Chem. 279, 36093–36102. [DOI] [PubMed] [Google Scholar]
  27. Wang L, Shao YY, Ballock RT (2006) Peroxisome proliferator‐activated receptor‐gamma promotes adipogenic changes in growth plate chondrocytes in vitro . PPAR Res. 2006, 67297. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Wu L, Wu Y, Lin Y, Jing W, Nie X, Qiao J, Liu L, Tang W, Tian W (2007) Osteogenic differentiation of adipose derived stem cells promoted by overexpression of osterix. Mol. Cell. Biochem. 301, 83–92. [DOI] [PubMed] [Google Scholar]
  29. Yoshida CA, Furuichi T, Fujita T, Fukuyama R, Kanatani N, Kobayashi S, Satake M, Takada K, Komori T (2002) Core‐binding factor beta interacts with Runx2 and is required for skeletal development. Nat. Genet. 32, 633–638. [DOI] [PubMed] [Google Scholar]
  30. Zaidi SK, Javed A, Choi JY, Van Wijnen AJ, Stein JL, Lian JB, Stein GS (2001) A specific targeting signal directs Runx2/Cbfa1 to subnuclear domains and contributes to transactivation of the osteocalcin gene. J. Cell Sci. 114, 3093–3102. [DOI] [PubMed] [Google Scholar]
  31. Zhang X, Yang M, Lin L, Chen P, Ma KT, Zhou CY, Ao YF (2006) Runx2 overexpression enhances osteoblastic differentiation and mineralization in adipose – derived stem cells in vitro and in vivo . Calcif. Tissue Int. 79, 169. [DOI] [PubMed] [Google Scholar]

Articles from Cell Proliferation are provided here courtesy of Wiley

RESOURCES