Skip to main content
Cell Proliferation logoLink to Cell Proliferation
. 2012 Feb 13;45(2):91–100. doi: 10.1111/j.1365-2184.2012.00811.x

Derivation of male germ cells from induced pluripotent stem cells in vitro and in reconstituted seminiferous tubules

S Yang 1,†, J Bo 1,†, H Hu 1, X Guo 2, R Tian 1, C Sun 1, Y Zhu 1, P Li 1, P Liu 1, S Zou 1, Y Huang 1, Z Li 1,✉
PMCID: PMC6496715  PMID: 22324506

Abstract

Objectives

Previous studies have demonstrated that mouse‐ and human‐induced pluripotent stem (iPS) cells can differentiate into primordial germ cells in vitro. However, up to now it is not known whether iPS cells would be able to differentiate into male germ cells in vivo. The aim of this study was to explore differentiation potential of iPS cells to male germ cells in vitro and in vivo.

Materials and methods

In this study, approaches using in vitro retinoic acid induction and in vivo ectopic transplantation were combined to induce iPS cells to become male germ cells.

Results

RT‐PCR showed that expression of pre‐meiotic and meiotic germ cell‐specific genes was enhanced in iPS cell‐derived embryoid bodies (EBs) compared to mRNA transcripts of iPS cells. Immunofluorescence analysis revealed that iPS cell‐derived EBs positively expressed germ‐cell markers VASA, c‐Kit and SCP3. Furthermore, iPS cell‐derived cells dissociated from EBs were injected with testicular cells into dorsal skin of mice. Histological examination showed that iPS cell‐derived cells could reconstitute seminiferous tubules, and meanwhile, iPS cell‐derived germ cells could settle at basement membranes of reconstituted tubules.

Conclusion

Our results suggest that iPS cells are able to differentiate into male germ cells in vitro and that reconstituted seminiferous tubules may provide a functional niche for exogenous iPS cell‐derived male germ cells. Derivation of male germ cells from iPS cells has potential application for treating male infertility and provides an ideal platform for elucidating molecular mechanisms of male germ‐cell development.

Introduction

Low number and poor quality of human male germ cells are the main causes of infertility in married couples 1. Previous studies have shown that pluripotent stem cells such as embryonic stem (ES) cells are able to differentiate into germ cells in vitro 2, 3, 4; however, there are ethical problems concerned with the use of human ES cells and sources of human ES cells are limited. Thus, human ES cells are not an ideal cell source for producing germ cells. One of the major breakthroughs in stem‐cell biology is establishment of induced pluripotent stem (iPS) cells from somatic cells by retroviral transduction of one or several pluripotent genes, including Oct4, Sox2, c‐Myc and Klf4 5, 6. iPS cells are very similar to ES cells in many aspects 7, 8, 9, and notably, iPS cells have some advantages over human ES cells: (i) there are fewer ethical issues using human iPS cells; (ii) sources for human iPS cells are abundant; (iii) mature cells derived from patient iPS cells can be used for patient‐specific cell therapy without immunorejection; and (iv) it may be feasible to obtain male germ cells from iPS cells derived from a patient with azoospermia to treat male infertility. Recent studies have reported that iPS cells can generate germ cells by transmitting the germ line to the next generation 10, 11 while Park et al. and Imamura et al. have both demonstrated that iPS cells can generate germ cells in vitro 12, 13. Furthermore, Eguizabal et al. have induced differentiation of human iPS cells to post‐meiotic cells and consistently obtained haploid cells from human iPS cells 14. However, to our knowledge, there are few studies on derivation of iPS cells into male germ cells both in vitro and in vivo.

Mammalian spermatogenesis mainly takes place in seminiferous tubules, which provide a functional microenvironment (the niche) for male germ cells 15. Thus, it is essential to establish a stem‐cell niche in which to differentiate iPS cells into male germ cells. More recently, several studies have reported that ectopic grafting of dissociated testicular cells from neonatal donors could rearrange and form testis‐like grafts under the dorsal skin of mice 15, 16, 17. Moreover, mouse germline stem cells co‐engrafted with testicular cells might integrate into reconstituted seminiferous tubules and differentiate beyond meiosis and into spermatids 15. Immature testicular cells may reorganize and reconstitute seminiferous tubules to provide a supportive microenvironment for spermatogenesis.

In this study, we have hypothesized that iPS cells can differentiate into male germ cells in reconstituted seminiferous tubules. To study the potential of iPS differentiation to male germ cells in vitro and in vivo, iPS cells were induced using retinoic acid (RA) to generate male germ cells, and then iPS cell‐derived germ cells and immature testicular cells were transplanted into nude mice by subcutaneous injection.

Materials and methods

iPS cells and EB culture

Mouse iPS cells (Tg‐EGFP‐miPS11.1) were a gift from Prof. Yin Jin of Shanghai Institute of Health Sciences. As previously described, the iPS cells were generated from neural progenitor cells of EGFP transgenic C57BL/6J mice by retroviral transfer of human transcriptional factors Oct4/Sox2/Klf4/C‐Myc; notably, this cell line has been demonstrated to be germline‐competent 18. iPS cells were cultured on mouse embryonic fibroblast (MEFs) feeder layers inactivated by mitomycin C (Sigma, St. Louis, MO, USA). They were cultured in DMEM (Hyclone, Logan, UT, USA) containing 15% foetal bovine serum (FBS; Hyclone, Logan, UT, USA), 100 mg/ml leukaemia inhibiting factor (LIF; ESGRO; Mlipore, Billerica, MA, USA), 100 U/ml penicillin plus 100 mg/ml streptomycin (Gibco, Grand Island, NY, USA), 2 mmol/l l‐glutamine (Gibco), 0.1 mmol/l β‐mercaptoethanol (Gibco) and 0.1 mmol/l non‐essential amino acids (NEAA; Gibco). Cells were passaged every 2–3 days and re‐plated on fresh feeders. Cell culture was maintained at 37 °C in a humidified incubator with 5% CO2.

EBs were formed by hanging drop and suspension culture as follows: iPS cells were aggregated in a hanging drop for 2 days and then transferred to suspension cultures for 3 days. During this 5‐day culture process, LIF was removed from the medium. Thereafter, EBs were exposed to 2 μmol/l RA (Sigma), or no treatment for 5 days.

RT‐PCR analysis

Upon termination of EB culture, total RNA was extracted from EBs using TRIzol (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. After DNase treatment to remove potential contamination with genomic DNA, two micrograms of total RNA was transcribed into cDNA using M‐MLV reverse transcriptase (Promega, Madison, WI, USA). RT‐PCR was performed using primers shown in Table 1. PCR products were separated on a 1.5% agarose gel, stained with ethidium bromide and photographed.

Table 1.

List of gene primers for RT‐PCR

Genes Sequences of gene primers (5′‐to‐3′) References
Stella F: GACGCTTTGGATGATACAGACG 24
R: GGTCTTTCAGCACCGACAACA
Vasa F: ATTCTTGGAAGTCAGAAGCAGAAG 25
R: CTGGTTGACCAATTCTCGAGT
Dazl F: AATGTTCAGTTCATGATGCTGCTC 26
R: TGTATGCTTCGGTCCACAGAC
Stra8 F: CAACCTGCAAGATGGGAATC 28
R: CTTCAGCATCTGGTCCAACA
c‐kit F: CCCGACGCAACTTCCTTA 27
R: CGCTTCTGCCTGCTCTTC
Scp3 F: TGCAGAAAGCTGAGGAACAA 28
R: TGCTGCTGAGTTTCCATCAT
Haprin F: CCAGAACATGAGACAGAGAG 28
R: AGCAACTTCCTGAGCATACC
Tnp1 F: CAGCCGCAAGCTAAAGAC 27
R: AAGACCACCAGGGCAGAG
Prm1 F: AGCAAAAGCAGGAGCAGATG 28
R: CTTGCTATTCTGTGCATCTAG
Zp1 F: GAGTGACTGTGTTGCCATAG 4
R: GCCACACTGGTCTCACTACG
Zp2 F: GCTACACACATGACTCTCAC 4
R: GGTGACTCACAGTGGCACTC
β‐actin F: ACCAACTGGGACGATATGGAGAAG 28
R: CTCTTTGATGTCACGCACGATTTC

Flow cytometric analysis

iPS cell‐derived EBs were digested using 0.25% trpsin‐EDTA (Gibco) to obtain single iPS cell suspensions. Cells were stained with PE anti‐ mouse SSEA1 (Biolegend, San Diego, CA, USA) for 30 min at 4 °C, then cells were washed twice in phosphate‐buffered saline (PBS) and analysed using the FACSCalibur system (Becton Dickinson, San Jose, CA, USA). For each sample analysed, an aliquot of cells was labelled with mouse IgG conjugated to PE as isotype control.

Animals

ICR nude mice (BALB/c‐nu/nu) were purchased from Shanghai Laboratory Animal Center of Chinese Academy. All experiments with animals were performed according to guidelines for the care and use of laboratory animals (NIH Publication #85‐23 Rev. 1996).

Transplantation of iPS cell‐derived cells and testicular cells

Donor cells for transplantation were prepared from testes of mice in neonatal periods (1–2 days old). To harvest single cells from the tubules, they were digested using two‐step enzymatic treatment 19. Briefly, testicular tissue was first treated with 1.5 mg/ml collagenase type II (Sigma) in DMEM at 37 °C for 20 min, then with digestion solution containing type II collagenase (1.5 mg/ml), hyaluronidase (1.5 mg/ml) and 0.25% trpsin‐EDTA (Gibco) in DMEM at 37 °C for 20 min.

At the end of cell culture, EBs were digested using 0.25% trypsin‐EDTA to obtain single‐cell suspensions, then single‐cell suspension was mixed with digested testicular cells. Cell number ratio of iPS cells to testicular cells was 1:3–5 and mixed cell suspension was added to the same volume of Matrigel Matrix (MGM; Becton Dickinson Labware, Bedford, MA, USA). In the region of 0.1–0.5 × 106 iPS cells and 0.5–1.5 × 106 testicular cells in MGM were injected into backs of anaesthetized nude mice and animals were then castrated, incisions being closed using Michel clips (7.5 mm; Miltex, York, PA, USA).

Histological and immunofluorescence analyses

Xenografts were dissected at 4, 6, 8 and 12 weeks, respectively. After fixation in Bouin's solution, xenografts were embedded in paraffin wax and cut at 4‐ to 8‐μm thickness. Sections were stained with haematoxylin and eosin and observed by light microscopy for structure of seminiferous tubules. EB cells or frozen sections of xenografts were fixed in 4% paraformaldehyde in PBS and permeabilized with 0.4% Triton/X‐100 in PBS. Blocking was performed with 1% bovine serum albumin (BSA, Sigma) for 1 h prior to incubation with primary antibodies. Specimens were incubated with anti‐ VASA, c‐Kit and SCP3 rabbit polyclonal antibodies (Abcam, Cambridge, UK) for 2 h at room temperature, and goat anti‐rabbit Alexa Fluor 594 (red)‐labelled secondary antibody (A11072, Invitrogen) for 1 h. Replacement of primary antibodies with PBS was used as negative controls. DAPI was used to label cell nuclei and images were captured using confocal fluorescence microscopy (Leica, Mannheim, Germany).

Results

iPS cells differentiated into male germ cells in vitro by RA induction

EB formation is a common approach for differentiation of embryonic stem cells 20 and RA has been reported to promote differentiation of primordial germ cells (PGCs) and male gamates from embryonic stem cells 21, 22. In this study, RA was used to treat EB for derivation of germ cells from iPS cells. EBs were formed by the hanging drop and suspension culture method. After 5 days’ culture, EBs were formed, and then they were treated by 2 μmol/l RA, or no treatment, for 5 days.

To detect germ cells derived from iPS cells, expression patterns of germ cell‐specific genes in iPS cells, untreated EBs, and RA‐treated EBs were compared by RT‐PCR. As shown in Fig. 1, expression of Stella, a definitive marker of PGCs 23, 24, was observed in both untreated EBs and RA‐treated EBs. Expression of germ cell‐specific genes Vasa 25 and Dazl 26 was enhanced in untreated EBs and RA‐treated EBs compared to gene transcripts of iPS cells. Expression of c‐kit, a hallmark of differentiating spermatogonia 27, was clearly upregulated in RA‐treated EBs compared to gene transcripts of iPS cells and untreated EBs. Expression of Scp3 28, 29 and Haprin 28, 30, markers of meiotic germ cells and haploid germ cells, respectively, was also induced in EBs with RA treatment. Meanwhile, Stra8, an RA‐responsive gene expressed in pre‐meiotic mouse germ cells 28, 31, was upregulated in RA‐induced EBs. In contrast, there were no detectable expression of post‐meiotic markers transition protein 1 (Tnp1) 27 and protamine 1 (Prm1) 21, 28 in iPS cells, untreated EBs and RA‐treated EBs. Interestingly, expression of female germ‐cell markers Zp1 and Zp2 4 were detected in untreated EBs, suggesting that iPS could differentiate into female germ cells spontaneously.

Figure 1.

Figure 1

Expression of germ cell‐specific genes in undifferentiated i PS cells (i PS ), untreated EB s ( EB ) and RA ‐treated EB s ( EB + RA ). Positive controls and negative controls used templates extracted from testis of 8‐week‐old ICR mice and mouse embryonic fibroblasts (MEF), respectively.

To further examine expression of germ‐cell markers in iPS cell‐derived cells, iPS cell‐derived EBs with RA treatment were stained with anti‐ VASA, c‐Kit and SCP3. Confocal images indicated VASA and c‐Kit positive cells found in iPS cell‐derived EBs (Figs 2,3a), suggesting that iPS cells could be induced into germ cells. SCP3, a marker expressed in spermatocytes from leptotene to late meiotic stages 29, was also observed in RA‐treated EBs, which indicated that iPS cells had differentiated into spermatocytes (Fig. 3b). For negative controls, sections were processed without primary antibody, and no signals were detected (data not shown).

Figure 2.

Figure 2

Co‐localization of EGFP and VASA in undifferentiated i PS and i PS cell‐derived EB s with RA treatment (arrow). (a) iPS. (b) RA‐treated EBs. (c) High magnification of (b). Scale bars = 75 μm (a, b), 25 μm (c).

Figure 3.

Figure 3

Co‐localization of EGFP and germ cell‐specific markers in i PS cell‐derived EB s with RA treatment (arrow). (a) c‐Kit. (b) SCP3. Scale bars = 50 μm (a), 25 μm (b).

To quantify germ cells derived from iPS cells, percentages of SSEA1+ cells of iPS, untreated EBs and RA‐treated EBs were detected by flow cytometry. SSEA‐1 is considered to be both a mouse pluripotency marker 4 and a putative PGC marker 32. As shown in Fig. 4, SSEA1 was highly expressed in iPS cells. However, percentages of SSEA1+ cells obviously decreased in differentiated EBs derived from iPS cells (Fig. 4B). Mean percentage of SSEA1+ cells of RA‐treated EBs (35.06 ± 10.87%) was significantly higher than that of untreated EBs (13.19 ± 6.10%) (P < 0.05) (Fig. 4B), suggesting that RA could stimulate proliferation of PGCs.

Figure 4.

Figure 4

Flow cytometric analysis of SSEA 1 + cells, i PS cells, untreated EB s and RA ‐treated EB s. (A) Example of flow cytometry of SSEA1+ cells. (B) Percentage SSEA1+ cells, iPS cells, untreated EBs and RA‐treated EBs. a P < 0.05, compared to iPS cells; b P < 0.05, compared to untreated EBs.

Reconstitution of seminiferous tubules of mice transplanted with iPS cell‐derived male germ cells and testis cells

Testes harvested from neonatal mice were made into single‐cell suspension and mixed with iPS cell‐derived male germ cells and cell mixtures were then injected into backs of nude mice. Grafts were observed 3 weeks after transplantation, and diameters reached to around 6–10 mm during the subsequent observation period (Fig. 5a). At different time points post‐transplantation, xenografts were dissected from mice. Most xenografts grew into a testis‐like tissue with rich blood supply (Fig. 5b). As shown in Fig. 6, grafts dissected at 4, 6, 8 and 12 weeks all have similar histological structure of seminiferous tubules with germ cells arranged in an ordered sequence from the basement membrane to the lumen. Then reconstituted tubules were characterized by immunostaining with the germ cell‐specific marker VASA and meiotic‐specific marker SCP3. Immunohistochemical analysis confirmed that the reconstituted tubules of both 4‐week and 12‐week grafts had germ cells associated (Fig. 7). However, spermatocytes were only observed in seminiferous tubules of 12‐week grafts (Fig. 6d). Confocal images indicate that SCP3 positive cells were negative for EGFP (Fig. 8), which indicated that these spermatocytes in reconstituted tubules were derived from testicular cells of the neonatal mice. For negative controls, sections were processed without primary antibody; no staining was observed.

Figure 5.

Figure 5

Observation of xenografts 6 weeks after transplantation. (a) Nude mice with xenografts beneath the dorsal skin; (b) Testis‐like grafted tissue dissected from mice showing blood vessels (arrow). Scale bar = 1 mm.

Figure 6.

Figure 6

Histological observations of grafts at various time points post‐grafting. (a) 4 weeks, (b) 6 weeks, (c) 8 weeks and (d) 12 weeks. Spermatocytes indicated by arrows. Scale bars = 40 μm (a–c), 80 μm (d).

Figure 7.

Figure 7

Characterization of reconstituted tubules from grafts by immunostaining with VASA at various time points post‐grafting. (a) 4 weeks and (b) 12 weeks post‐grafting, by immunostaining with VASA. (c) Seminiferous tubules of 8‐week‐old mouse testis were used as positive control. Scale bars = 50 μm (a, b), 75 μm (c).

Figure 8.

Figure 8

Characterization of reconstituted tubules from grafts at 12 weeks post‐grafting, by immunostaining with SCP 3. (a) SCP3 immunostaining in reconstituted tubules. (b) Higher magnification of (a). SCP3 positive cells indicated by arrows. Scale bars = 50 μm (a), 10 μm (b).

Co‐localization of EGFP and male germ cell‐specific markers in reconstituted tubules

To investigate whether iPS cell‐derived germ cells would be able to integrate and continue differentiating in reconstituted tubules, they were mixed with testicular cells and co‐engrafted beneath dorsal skin of nude mice. Twelve weeks after transplantation, sections of xenografts were examined by immunostaining. Among three such sections stained with anti‐VASA antibody, six EGFP‐positive germ cells were observed in 3 of 21 reconstituted tubules with germ cells. As shown in Fig. 9, EGFP‐positive cells were located near basement membranes of tubules, indicating that iPS cell‐derived germ cells could integrate there. Confocal micrographs demonstrate the co‐localization (Fig. 9), indicating that reconstituted tubules could provide a supportive niche for iPS cell‐derived germ cells. Furthermore, all EGFP‐positive germ cells had a single nucleus, excluding the possibility of EGFP‐positive iPS cell fusion with germ cells from testicular cells. However, EGFP‐positive germ cells were negative for SCP3 (data not shown), a meiosis‐specific marker, indicating that iPS cell‐derived germ cells did not differentiate into meiotic cells.

Figure 9.

Figure 9

Co‐localization of EGFP ‐positive cells with VASA in reconstituted tubules of xenografts (arrow). Scale bar = 50 μm.

Discussion

iPS cells, which are generated by transduction of transcription factors of somatic cells 11, have the same pluripotential ability to differentiate into all cell lineages, as ES cells. Numerous previous studies have demonstrated that ES cells can differentiate into primordial germ cells and early gametes 32, 33 and recently, it has been reported that mouse iPS cells could be induced into PGCs 13. Park et al. and Panula et al. have also reported that human iPS cells can differentiate into PGCs in vitro 12, 34. However, many attempts have been made to induce iPS cells to become germ cells in vitro, but as yet it is not known whether they would be able to differentiate into germ cells in vivo. Moreover, our understanding so far of iPS cells’ potential to generate germ cells in vitro and in vivo remains very limited.

Transplantation into seminiferous tubules of infertile recipients is widely applied to induce spermatogenesis from germ cells 35, however, this orthotopic grafting technique still has many disadvantages including low efficiency in most species except mice, and detrimental pre‐treation to the recipients 36. Thus, ectopic grafting, which rearranges reconstituted tubules in testis‐like grafts in mice, has become a useful model to induce spermatogenesis.

In the present study, in vitro differentiation and ectopic grafting of iPS cell‐derived germ cells with testicular cells were combined to induce derivation of male germ cells from iPS cells. First, expression of germ‐cell genes of different stages in iPS cells, untreated EBs and RA‐treated EBs were compared, to analyse germ‐cell differentiation at the molecular level. Results of RT‐PCR demonstrated that both untreated and RA‐treated EBs expressed early germ‐cell marker gene Stella and germ cell‐specific genes Vasa, Dazl and Stra8. However, expression of differentiating spermatogonia marker gene c‐kit, meiotic gene Scp3 and post‐meiotic gene Haprin were clearly enhanced in RA‐treated EBs compared to untreated EBs. Previous studies have reported that RA signalling controls entry of germ cells into meiosis in mice and humans 37, 38. Our results have confirmed that RA can act as a meiosis‐inducing factor in differentiation of iPS cells into male germ cells. Moreover, no expression of post‐meiotic genes Tnp1 nor Prm1 was detected in either untreated or RA‐treated EB. These results suggested that in vitro differentiation of RA‐treated EBs remained in pre‐meiotic and meiotic stages, consistent with previous investigation 13. In addition, expression of oocyte‐specific markers Zp1 and Zp2 was observed in untreated EBs, which suggested that iPS could spontaneously differentiate into female germ cells.

Secondly, phenotypes of iPS cell‐derived EBs were confirmed by immunostaining and flow cytometry. Immunofluorescence revealed that iPS cell‐derived EB expressed VASA, c‐Kit and SCP3, indicating that iPS cells could differentiate into meiotic germ cells during EB formation and RA induction. Flow cytometry showed that RA‐treated EBs contained more SSEA1+ cells than untreated EBs, but less SSEA1+ cells than iPS cells, which is consistent with previous work showing that RA can rapidly cause differentiation of ES cells while supporting proliferation of PGCs 4. Finally, to induce differentiation into germ cells in vivo, iPS cell‐derived cells dissociated from EBs were injected into mice together with testicular cells. Histological examination confirmed that immature testicular cells could reconstitute seminiferous tubules and furthermore, iPS cell‐derived germ cells settled in at basement membranes of reconstituted tubules. Results of the study are consistent with previous findings that reconstituted tubules can provide a functional niche for exogenous germ cells 15.

We also found that no further differentiation of iPS cell‐derived germ cells was observed in reconstituted seminiferous tubules, indicating that the tubules did not provide a totally suitable microenvironment for in vivo differentiation. This may be due to initially deficient germ cells and/or impaired meiotic and post‐meiotic differentiation 39, or immature testicular cells not containing appropriate proportions of the various cell types, or else lack of specific environmental input 40. Thus, it was necessary to improve ectopic grafting method to provide a stable niche to induce complete spermatogenesis.

In summary, we have demonstrated that male germ cells could be derived from iPS cells both in vitro and in vivo. Moreover, the system of using ectopic grafting can be applied for inducing exogenous germ‐cell differentiation in vivo.

Acknowledgements

The authors would like to thank Prof. Ying Jin for her kindly donation of the iPS cell line. Authors also thank Prof. Chen Xu and Dr. Heng Cai for their support concerning iPS differentiation. This work was supported by grants from the Key Project of Shanghai Municipal Education Commission (No. 10ZZ700), China National Key Project (No. 2010CB945200), and Nature Founding from Shanghai Jiao Tong University School of Medicine (No. 2008XJ017).

References

  • 1. Kee K, Angeles VT, Flores M, Nguyen HN, Reijo Pera RA (2009) Human DAZL, DAZ and BOULE genes modulate primordial germ‐cell and haploid gamete formation. Nature 462, 222–225. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Hubner K, Fuhrmann G, Christenson LK, Kehler J, Reinbold R, De La Fuente R et al (2003) Derivation of oocytes from mouse embryonic stem cells. Science 300, 1251–1256. [DOI] [PubMed] [Google Scholar]
  • 3. Toyooka Y, Tsunekawa N, Akasu R, Noce T (2003) Embryonic stem cells can form germ cells in vitro. Proc. Natl. Acad. Sci. USA 100, 11457–11462. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Geijsen N, Horoschak M, Kim K, Gribnau J, Eggan K, Daley GQ (2004) Derivation of embryonic germ cells and male gametes from embryonic stem cells. Nature 427, 148–154. [DOI] [PubMed] [Google Scholar]
  • 5. Takahashi K, Yamanaka S (2006) Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126, 663–676. [DOI] [PubMed] [Google Scholar]
  • 6. Aoi T, Yae K, Nakagawa M, Ichisaka T, Okita K, Takahashi K et al (2008) Generation of pluripotent stem cells from adult mouse liver and stomach cells. Science 321, 699–702. [DOI] [PubMed] [Google Scholar]
  • 7. Kang L, Wang J, Zhang Y, Kou Z, Gao S (2009) iPS cells can support full‐term development of tetraploid blastocyst‐complemented embryos. Cell Stem Cell 5, 135–138. [DOI] [PubMed] [Google Scholar]
  • 8. Yamanaka S (2008) Pluripotency and nuclear reprogramming. Philos. Trans. R Soc. Lond. B Biol. Sci. 363, 2079–2087. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Suaudeau J (2011) From embryonic stem cells to iPS – an ethical perspective. Cell Prolif. 44(Suppl. 1), 70–84. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Zhao XY, Li W, Lv Z, Liu L, Tong M, Hai T et al (2009) iPS cells produce viable mice through tetraploid complementation. Nature 461, 86–90. [DOI] [PubMed] [Google Scholar]
  • 11. Okita K, Yamanaka S (2010) Induction of pluripotency by defined factors. Exp. Cell Res. 316, 2565–2570. [DOI] [PubMed] [Google Scholar]
  • 12. Park TS, Galic Z, Conway AE, Lindgren A, van Handel BJ, Magnusson M et al (2009) Derivation of primordial germ cells from human embryonic and induced pluripotent stem cells is significantly improved by coculture with human fetal gonadal cells. Stem Cells 27, 783–795. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Imamura M, Aoi T, Tokumasu A, Mise N, Abe K, Yamanaka S et al (2010) Induction of primordial germ cells from mouse induced pluripotent stem cells derived from adult hepatocytes. Mol. Reprod. Dev. 77, 802–811. [DOI] [PubMed] [Google Scholar]
  • 14. Eguizabal C, Montserrat N, Vassena R, Barragan M, Garreta E, Garcia‐Quevedo L et al (2011) Complete meiosis from human induced pluripotent stem cells. Stem Cells 29, 1186–1195. [DOI] [PubMed] [Google Scholar]
  • 15. Kita K, Watanabe T, Ohsaka K, Hayashi H, Kubota Y, Nagashima Y et al (2007) Production of functional spermatids from mouse germline stem cells in ectopically reconstituted seminiferous tubules. Biol. Reprod. 76, 211–217. [DOI] [PubMed] [Google Scholar]
  • 16. Honaramooz A, Megee SO, Rathi R, Dobrinski I (2007) Building a testis: formation of functional testis tissue after transplantation of isolated porcine (Sus scrofa) testis cells. Biol. Reprod. 76, 43–47. [DOI] [PubMed] [Google Scholar]
  • 17. Arregui L, Rathi R, Megee SO, Honaramooz A, Gomendio M, Roldan ER et al (2008) Xenografting of sheep testis tissue and isolated cells as a model for preservation of genetic material from endangered ungulates. Reproduction 136, 85–93. [DOI] [PubMed] [Google Scholar]
  • 18. Li C, Yu H, Ma Y, Shi G, Jiang J, Gu J et al (2009) Germline‐competent mouse‐induced pluripotent stem cell lines generated on human fibroblasts without exogenous leukemia inhibitory factor. PLoS One 4, e6724. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Honaramooz A, Megee SO, Dobrinski I (2002) Germ cell transplantation in pigs. Biol. Reprod. 66, 21–28. [DOI] [PubMed] [Google Scholar]
  • 20. Marani E, van Oers JW, Tetteroo PA, Poelmann RE, van der Veeken J, Deenen MG (1986) Stage specific embryonic carbohydrate surface antigens of primordial germ cells in mouse embryos: FAL (S.S.E.A.‐1) and globoside (S.S.E.A.‐3). Acta Morphol. Neerl. Scand. 24, 103–110. [PubMed] [Google Scholar]
  • 21. Nayernia K, Nolte J, Michelmann HW, Lee JH, Rathsack K, Drusenheimer N et al (2006) In vitro‐differentiated embryonic stem cells give rise to male gametes that can generate offspring mice. Dev. Cell 11, 125–132. [DOI] [PubMed] [Google Scholar]
  • 22. Kerkis A, Fonseca SA, Serafim RC, Lavagnolli TM, Abdelmassih S, Abdelmassih R et al (2007) In vitro differentiation of male mouse embryonic stem cells into both presumptive sperm cells and oocytes. Cloning Stem Cells 9, 535–548. [DOI] [PubMed] [Google Scholar]
  • 23. Hayashi K, Surani MA (2009) Self‐renewing epiblast stem cells exhibit continual delineation of germ cells with epigenetic reprogramming in vitro. Development 136, 3549–3556. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Yu Z, Ji P, Cao J, Zhu S, Li Y, Zheng L et al (2009) Dazl promotes germ cell differentiation from embryonic stem cells. J. Mol. Cell Biol. 1, 93–103. [DOI] [PubMed] [Google Scholar]
  • 25. Yamauchi K, Hasegawa K, Chuma S, Nakatsuji N, Suemori H (2009) In vitro germ cell differentiation from cynomolgus monkey embryonic stem cells. PLoS One 4, e5338. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Silva C, Wood JR, Salvador L, Zhang Z, Kostetskii I, Williams CJ et al (2009) Expression profile of male germ cell‐associated genes in mouse embryonic stem cell cultures treated with all‐trans retinoic acid and testosterone. Mol. Reprod. Dev. 76, 11–21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. He Z, Jiang J, Hofmann MC, Dym M (2007) Gfra1 silencing in mouse spermatogonial stem cells results in their differentiation via the inactivation of RET tyrosine kinase. Biol. Reprod. 77, 723–733. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. West JA, Park IH, Daley GQ, Geijsen N (2006) In vitro generation of germ cells from murine embryonic stem cells. Nat. Protoc. 1, 2026–2036. [DOI] [PubMed] [Google Scholar]
  • 29. Yano A, Suzuki K, Yoshizaki G (2008) Flow‐cytometric isolation of testicular germ cells from rainbow trout (Oncorhynchus mykiss) carrying the green fluorescent protein gene driven by trout vasa regulatory regions. Biol. Reprod. 78, 151–158. [DOI] [PubMed] [Google Scholar]
  • 30. Kitamura K, Tanaka H, Nishimune Y (2003) Haprin, a novel haploid germ cell‐specific RING finger protein involved in the acrosome reaction. J. Biol. Chem. 278, 44417–44423. [DOI] [PubMed] [Google Scholar]
  • 31. Tedesco M, La Sala G, Barbagallo F, De Felici M, Farini D (2009) STRA8 shuttles between nucleus and cytoplasm and displays transcriptional activity. J. Biol. Chem. 284, 35781–35793. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Tilgner K, Atkinson SP, Golebiewska A, Stojkovic M, Lako M, Armstrong L (2008) Isolation of primordial germ cells from differentiating human embryonic stem cells. Stem Cells 26, 3075–3085. [DOI] [PubMed] [Google Scholar]
  • 33. Clark AT, Bodnar MS, Fox M, Rodriquez RT, Abeyta MJ, Firpo MT et al (2004) Spontaneous differentiation of germ cells from human embryonic stem cells in vitro. Hum. Mol. Genet. 13, 727–739. [DOI] [PubMed] [Google Scholar]
  • 34. Panula S, Medrano JV, Kee K, Bergstrom R, Nguyen HN, Byers B et al (2011) Human germ cell differentiation from fetal‐ and adult‐derived induced pluripotent stem cells. Hum. Mol. Genet. 20, 752–762. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Kanatsu‐Shinohara M, Ogonuki N, Inoue K, Miki H, Ogura A, Toyokuni S et al (2003) Long‐term proliferation in culture and germline transmission of mouse male germline stem cells. Biol. Reprod. 69, 612–616. [DOI] [PubMed] [Google Scholar]
  • 36. Watanabe T, Hayashi H, Kita K, Kubota Y, Ogawa T (2009) Ectopic porcine spermatogenesis in murine subcutis: tissue grafting versus cell‐injection methods. Asian J. Androl. 11, 317–323. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Ohta K, Lin Y, Hogg N, Yamamoto M, Yamazaki Y (2010) Direct effects of retinoic acid on entry of fetal male germ cells into meiosis in mice. Biol. Reprod. 83, 1056–1063. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Niederreither K, Dolle P (2008) Retinoic acid in development: towards an integrated view. Nat. Rev. Genet. 9, 541–553. [DOI] [PubMed] [Google Scholar]
  • 39. Rathi R, Honaramooz A, Zeng W, Schlatt S, Dobrinski I (2005) Germ cell fate and seminiferous tubule development in bovine testis xenografts. Reproduction 130, 923–929. [DOI] [PubMed] [Google Scholar]
  • 40. Gassei K, Schlatt S, Ehmcke J (2006) De novo morphogenesis of seminiferous tubules from dissociated immature rat testicular cells in xenografts. J. Androl. 27, 611–618. [DOI] [PubMed] [Google Scholar]

Articles from Cell Proliferation are provided here courtesy of Wiley

RESOURCES