Skip to main content
NCBI home page
Cell Proliferation logoLink to Cell Proliferation
. 2014 Mar 25;47(3):231–240. doi: 10.1111/cpr.12102

Quercetin ameliorates tunicamycin‐induced endoplasmic reticulum stress in endothelial cells

N Suganya 1, E Bhakkiyalakshmi 1, S Suriyanarayanan 2, R Paulmurugan 3, K M Ramkumar 4,✉
PMCID: PMC6496885  PMID: 24666891

Abstract

Objective

Endothelial dysfunction highlights that it is a potential contributor in the pathogenesis of vascular complications arising from endoplasmic reticulum stress (ER stress) and has been emerging as a main causative factor in vascular failure. Here, we hypothesize that the natural flavonoid, quercetin plays an effective role in reducing ER stress in human umbilical vein endothelial cells.

Materials and methods

Human umbilical vein endothelial cells were pre‐treated with different concentrations of quercetin (0–100 μm) before inducing ER stress using tunicamycin (TUN) (0.75 μg/ml); cytotoxicity was assessed by MTT assay. Expression levels of ER stress responsive genes, antioxidant enzymes and apoptotic markers were assessed by qRT‐PCR, while roles of caspase‐3 and PARP cleavage were measured by western blot analysis.

Results

Quercetin pre‐treatment at 25 and 50 μm had a cytoprotective effect on cells against TUN‐induced toxicity. Quercetin administration modulated expression level of ER stress genes coding for glucose‐regulated protein 78 (GRP78) and C/EBP‐homologous protein (CHOP), and antioxidant enzymes such as superoxide dismutase and catalase, along with free radical generation assessed by malondialdehyde assay. Induction of apoptosis was prevented with reduction in expression level of Bax, and concomitant increase in Bcl‐2 levels, thus proving its potential against ER stress.

Conclusion

The current study indicates that quercetin modulated stress responsive genes GRP78 and CHOP, helping endothelial cells prevent TUN‐induced ER stress.

Introduction

Endothelial dysfunction is a multifaceted disorder which results in massive alteration in endothelial cell phenotype, resulting in systemic disturbance in vascular homoeostasis. This, in turn, contributes to development and clinical expression of pathological inflammatory processes and vascular diseases 1. Consequences of endothelial dysfunction arise as a secondary disorder in diabetes, atherosclerosis, hypertension and hypercholesterolemia 2, due to dysregulation of endothelium‐derived NO, vasoconstriction, thrombosis and activation of transcription factors, such as NFκB, protein kinase cascades and adhesion molecules as well as overexpression of growth factors 3. In addition to oxidative stress, several other factors contribute to endothelial dysfunction, including endoplasmic reticulum stress (ER stress), triggered under hyperglycaemic, hypoxic and shear stress conditions 4.

Induced ER stress elicits unfolded protein response (UPR), which functions adaptively and initiates the outcome by accumulation of misfolded proteins, leading to induction of a molecular chaperone, glucose‐regulated protein 78 (GRP78). Under ER stress, GRP78 is released from ER transmembrane signal transducers, leading to sequential activation of ER‐localized transmembrane proteins, including inositol‐requiring enzyme 1α (IRE1α) and PKR‐like ER kinase (PERK), and activating transcription factor 6 (ATF6) 5. These activated proteins in turn instigate UPR through launch of inflammatory and stress signalling pathways and finally lead to cell damage 6. Perturbations in ER function uphold induction of apoptosis by transcriptional activation of C/EBP‐homologous protein (CHOP) 7. Several studies have documented that it negatively regulates cell population growth and endorses ER stress‐induced apoptosis 8, 9. Targeted disruption of CHOP has been shown to delay ER stress response, thereby promoting cytoprotection against oxidative injury 10. CHOP‐deficient proximal tubular cells of diabetic mice have been reported to be resistant to ER stress‐induced cell death 11. Similarly, CHOP over expressing cells have shown increased susceptibility to apoptosis mediated by ER stress 12, 13. Identification of stress‐associated ER protein expression gains importance in potential therapeutic targeting for ER stress‐provoked disease. Furthermore, experimental ER stress responses have been induced using pharmacological agents such as thapsigargin, A23187 and brefeldin A, with upregulated levels of GRP78 and CHOP 14. One typical agent, tunicamycin (TUN), induces ER stress by interfering with N‐linked protein glycosylation in ER 15.

Study of protection of endothelial cells by natural polyphenols is needed and has been demonstrated in both in vitro and in vivo models 16. Many plant polyphenolic compounds have beneficial effects against various diseases and disorders; their ameliorating properties on vascular homoeostasis, antiplatelet and anti‐inflammatory activities, have been validated 17, 18. Resveratrol, a polyphenol found in red wine, protects against oxidized LDL‐induced cytotoxicity in endothelial cells 19. Schroeder et al. documented beneficial effects of cocoa flavanol (−)‐epicatechin, in murine aortic endothelial cells 20. Chronic intake of red‐wine polyphenols has been reported to prevent aging‐induced endothelial dysfunction in rats 16.

Quercetin, a well‐known antioxidant found abundantly in fruits and vegetables, has been reported to have a wide range of biological functions including anti‐carcinogenic, anti‐inflammatory, anti‐ulcer and anti‐viral as well as to inhibit platelet aggregation and capillary permeability 21. In spite of its antioxidant potential, high doses of quercetin administration have elicited pro‐oxidant effects in rats 22, due to auto‐oxidation, which yields hydroxyl radicals within the cell, thereby inducing cytotoxicity. Previous studies have revealed protective effects of quercetin in vitro against apoptosis mediated by high glucose, H2O2 and oxidized LDL, in endothelial cells 23, 24, 25 by reversing cellular and nuclear damage induced by modulating anti‐apoptotic potential of the cell. Moreover, evidence upholds that quercetin modulates ER stress provoked by calcium dynamic dysregulation in intestinal epithelial cells 14 and was found to modulate the ER stress. Hence, in view of the significance of ER stress in endothelial dysfunction, our current study has aimed to ascertain the protective nature of quercetin against TUN‐induced ER stress by modulating proapoptotic UPR and CHOP in human umbilical vein endothelial cells (HUVECs).

Materials and methods

Cell culture

Human umbilical vein endothelial cells were grown in EGM‐2 (Clonetics; Lonza Ltd, Basel, Switzerland) containing vascular endothelial growth factor, basic fibroblast growth factor, insulin‐like growth factor‐1, epidermal growth factor, hydrocortisone, heparin, gentamicin sulphate, amphotericin B, 1% ascorbic acid and 2% foetal bovine serum (FBS), at 37 °C in a humidified atmosphere with 5% CO2.

Cell viability assay

Cell viability was assessed using the MTT assay. HUVECs (1 × 104 cells/well) were cultured in 96‐well plates at 37 °C for 24 h then pre‐treated with different concentrations of quercetin (0–100 μm) for 24 h, followed by TUN (0.75 μg/ml) for 24 h. Spent medium was removed and 10 μl MTT solution (5 mg/ml) was added to 100 μl of respective growth medium without phenol red, and plates were incubated at 37 °C for 4 h in a humidified 5% CO2 atmosphere. Then, formazan crystals formed by mitochondrial reduction of MTT were solubilized in dimethyl sulphoxide (100 μl/well) and absorbance was read at 540 nm using a microplate reader (BioRad, Hercules, CA, USA). Percent inhibition of cytotoxicity was calculated as a fraction of control (without quercetin) and expressed as percentage of cell viability 26.

Determination of malondialdehyde (MDA)

Human umbilical vein endothelial cells (1 × 106 cells/well) were seeded in 6‐well culture plates and allowed to proliferate for 24 h, then were treated with quercetin (25 and 50 μm) for 24 h at 37 °C, followed by TUN (0.75 μg/ml) for 24 h. At the end of the experimental period, cells were centrifuged at 1000 g for 5 min 27 and pellets were homogenized according to the manufacturer's recommendations; they were then assayed for MDA using an MDA assay kit (Oxis Research, Portland, OR, USA).

Quantitative reverse transcriptase polymerase chain reaction (qRT‐PCR)

A variety of polymerase chain reaction (PCR) primers was designed based on the NCBI human mRNA and genome DNA sequence database. DNA fragments of PCR products were designed to amplify within 200 bp length. Forward and reverse primers were primarily designed from different exons to reduce background noise from genomic DNA contamination. Primer sequences are listed in Table 1. Cells were treated with 25 and 50 μm of quercetin for 24 h followed by TUN (0.75 μg/ml) for further 24 h, and qRT‐PCR was performed following the manufacturer's protocol. Briefly, each reaction contained 2 μl of cDNA (0.1 μg of RNA equivalent), 0.8 μl primer (containing 100 pm forward and reverse primers), 2.2 μl of H2O, and 5 μl of Sofast EvaGreen supermix. qRT‐PCR was performed (Bio‐Rad) in a three‐step program (95 °C for 15 s, 60 °C for 30 s and 72 °C for 45 s for 50 cycles). qRT‐PCR data were analysed by CFX manager software (BioRad, Hercules, CA, USA). Gene expression fold change was obtained by dividing treated group signal by that of base expression level signal of corresponding genes in untreated cells. Results were normalized using qRT‐PCR signal from β‐actin of respective samples.

Table 1.

q‐PCR primer sequences for validated targets

Gene name Short name Forward primer 5′–3′ Reverse primer 5′–3′
Glucose regulated protein 78 GRP78 TCTGCTTGATGTGTGTCCTCTT GTCGTTCACCTTCGTAGACCT
CCAAT‐enhancer‐binding protein homologous protein CHOP GGAGAAGGAGCAGGAGAATGA AGACAGACAGGAGGTGATGC
Superoxide dismutase1 SOD1 GAAGGTGTGGGGAAGCATTA ACATTGCCCAAGTCTCCAAC
Catalase CAT TCATGACATTTAATCAGGCA GTGTCAGGATAGGCAAAAAG
B‐cell lymphoma 2 BCl‐2 GCTGAGGCAGAAGGGTTATG GCCCCCTTGAAAAAGTTCAT
Bcl‐2 associated X protein BAX AGGGTTTCATCCAGGATCGAGCAG ATCTTCTTCCAGATGGTGAGCGAG
Actin‐ Beta ACT GGCGGACTATGACTTAGTTG AAACAACAATGTGCAATCAA
Open in a new tab

Western blotting

Expression of caspase‐3 was measured by western blot analysis as previously described 28, with modifications. HUVECs were treated with 25 and 50 μm quercetin for 24 h followed by TUN 0.75 μg/ml for a further 24 h. Then, cells were harvested, washed once in ice‐cold phosphate‐buffered saline, gently lysed in ice‐cold lysis buffer (250 mm sucrose, 1 mm EDTA, 0.05% digitonin, 25 mm Tris, pH 6.8, 1 mm dithiothreitol, 1 μg/ml leupeptin, 1 μg/ml pepstatin, 1 μg/ml aprotinin, 1 mm benzamidine and 0.1 mm phenylmethylsulphonyl fluoride) for 30 min, and centrifuged at 12 000 g at 4 °C. Protein concentration was measured using BioRad Bradford protein assay reagent 29, and subjected to SDS‐PAGE. Proteins were transferred to polyvinylidene fluoride membranes and incubated successively in 5% bovine serum albumin in Tris‐buffered saline – Tween 20 buffer (TTBS) (25 mmol/L Tris, pH 7.5, 150 mmol/L NaCl and 0.1% Tween 20) for 1 h, then incubated overnight at 4°C with Caspase‐3 antibody (Cell Signalling Technology, Danvers, MA, USA) or PARP antibody (Santa Cruz Biotechnology, Santa Cruz, CA, USA), followed by reaction with horseradish peroxidase‐labelled secondary antibody (Santa Cruz Biotechnology) for 1 h. After each incubation, membranes were washed extensively in TTBS and the immunoreactive band was detected using ECL‐detecting reagents.

Statistical analysis

Results are presented as mean ± SD of three independent experiments. Statistical analysis was performed using one‐way ANOVA followed by Duncan's multiple range test; P < 0.05 was taken to indicate significant difference between groups.

Results

Effect of quercetin on TUN‐induced cytotoxicity in HUVECs

To evaluate cytoprotective effect of quercetin against TUN‐induced apoptosis, we performed the MTT assay. TUN at 0.75 μg for 24 h exposure reduced cell viability by up to 60%. However, quercetin pre‐treatment (5–100 μm) for 24 h before TUN (0.75 μg) showed quercetin concentration‐dependent increase in viability in the order of 73%, and 79% at 25 and 50 μm concentrations respectively (Fig. 1). This illustrates the protective effect of quercetin against TUN‐induced cell death. As the effect was predominant at 25 and 50 μm, we restricted concentrations up to 50 μm.

Figure 1.

Figure 1

Open in a new tab

Cytoprotective effect of quercetin on human umbilical vein endothelial cells against tunicamycin ( TUN )‐induced toxicity. Data are presented as mean ± SD of three independent experiments. Significance compared to control, *P < 0.05, and compared to control + TUN group, # P < 0.05 determined by one‐way ANOVA followed by Duncan's multiple range test.

Effect of quercetin on MDA level

To determine the role of free‐radicals on induction of ER stress, we measured levels of MDA, an end product of lipid peroxidation was used as an indirect index of oxidative injury. As shown in Fig. 2, TUN‐induced free‐radical generation was markedly suppressed in a concentration‐dependent manner by pre‐treatment with quercetin (25 and 50 μm) for 24 h.

Figure 2.

Figure 2

Open in a new tab

Effect of quercetin on levels of malondiadehyde in human umbilical vein endothelial cells. Data are presented as mean ± SD of three independent experiments. Significance compared to control, *P < 0.05, and compared to control + TUN group, # P < 0.05 determined by one‐way ANOVA followed by Duncan's multiple range test.

Effect of quercetin on ER stress marker

To confirm the protective effect of quercetin against TUN‐induced ER stress in HUVECs, we assessed expression of ER stress markers GRP78 and CHOP by qRT‐PCR. TUN upregulated expression of GRP78 and CHOP, confirming induction of ER stress. Pre‐treatment with quercetin (25 and 50 μm) reduced expression of GRP78 and CHOP in TUN‐induced cells (Fig. 3a,b) and at 50 μm this was at its maximum effect compared to 25 μm. Quercetin alone had no modulation in expression level of CHOP even after 24‐h exposure. On the other hand, treatment with different concentrations of quercetin alone (25 and 50 μm) induced GRP78 expression.

Figure 3.

Figure 3

Open in a new tab

Effect of quercetin on (a) GRP78 and (b) CHOP expression levels in human umbilical vein endothelial cells. Significance compared to control, *P < 0.05, and compared to control + TUN group, # P < 0.05 determined by one‐way ANOVA followed by Duncan's multiple range test.

Effect of quercetin on antioxidant gene expression

To study effects of quercetin on antioxidant genes, such as those coding for superoxide dismutase 1 (SOD1) and catalase (CAT), we assessed mRNA expression levels by qRT‐PCR. Upon TUN treatment, expression of SOD1 and CAT were found to be downregulated, and quercetin pre‐treatment (25 and 50 μm) effectively modulated its expression levels up to near normal (Fig. 4a,b). In untreated control cells, quercetin treatment increased expression of SOD1 and CAT, proving its antioxidant property.

Figure 4.

Figure 4

Open in a new tab

Effect of quercetin on (a) SOD1 and (b) CAT expression levels in human umbilical vein endothelial cells. Significance compared to control, *P < 0.05, and compared to control + TUN group, # P < 0.05 determined by one‐way ANOVA followed by Duncan's multiple range test.

Anti‐apoptotic effect of quercetin on TUN‐treated HUVEC cells

Bcl‐2 and Bax are major regulatory proteins associated with apoptosis. As depicted in Fig. 5a and 5b, Bcl‐2, an apoptotic suppressor, was markedly lower after treatment with TUN for 24 h. In contrast, Bax, a pro‐apoptotic protein, expression was significantly higher after treatment with TUN. However, TUN‐induced Bcl‐2 reduction and Bax increase were reversed in a concentration‐dependent manner by pre‐treatment with quercetin for 24 h. As shown in Fig. 5c, ratio of Bax and Bcl‐2 was reduced by pre‐treating with quercetin in TUN‐induced HUVECs.

Figure 5.

Figure 5

Open in a new tab

Effect of quercetin on (a) Bcl‐2 and (b) Bax expression levels (c) Bax/Bcl‐2 ratio in human umbilical vein endothelial cells. Significance compared to control, *P < 0.05, and compared to control + TUN group, # P < 0.05 determined by one‐way ANOVA followed by Duncan's multiple range test.

Western blot analysis of caspase expression and PARP cleavage

To gain insight into mechanisms of antiapoptotic effects of quercetin in TUN‐induced cells, we examined levels of caspase‐3 and PARP cleavage, using western blot analysis. PARP plays an important role in DNA repair but can also lead to cell death by depleting the cell NAD pool. To investigate whether the mechanism of action by quercetin may depend on modulation of PARP activity, we carried out western blot analysis to detect cleaved products of PARP. We found that exposure of cells to TUN resulted in PARP cleavage and activation of caspase‐3. Further quercetin pre‐treatment in TUN‐induced cells resulted in significant reduction in caspase‐3 levels and indicated reduction in cleavage of PARP (Fig. 6a,b).

Figure 6.

Figure 6

Open in a new tab

Effect of quercetin on caspase‐3 and PARP cleavage. (a) Western blot analysis of caspase‐3 and PARP cleavage. (b) Corresponding histogram of caspase‐3 protein expression in western blot analysis. Significance compared to TUN group, *P < 0.05, and compared to control group, # P < 0.05 determined by one‐way ANOVA followed by Duncan's multiple range test. (Lane 1: Control; Lane 2: Quercetin – 50 μm; Lane 3: TUN – 0.75 μg; Lane 4: TUN + Quercetin – 25 μm; Lane 5: TUN + Quercetin – 50 μm).

Discussion

Loss of balance between endothelial cell apoptosis and regeneration results in discontinuity of endothelial layers, which favours initiation and progression of micro‐ and macrovascular complications 30. Increased production of oxidative stress in diseased states, such as hyperglycaemia, relates to endothelial dysfunction and has been reported in both in vitro and in vivo models 31, 32. In addition, metabolically active endothelial cells inclined by various pathological conditions resulted in ER stress. 33. Disruption of ER function has been linked to development of several disorders including Alzheimer's disease, Huntington's disease and Parkinson's disease, type‐1 diabetes mellitus and hepatic steatosis 34, 35, 36, 37, 38. In the case of diabetes mellitus, endothelial cells fail to overcome the hyperglycaemic state induced by ER stress. Kassan et al. 39 reported that inhibition of ER stress improves vascular endothelial function in type 1 diabetic mice.

The study described here contemplated possible involvement of ER stress in endothelial dysfunction that arbitrates vascular complications and demonstrated by TUN‐induced ER stress in model systems. TUN is a nucleotide sugar analogue and a naturally occurring antibiotic produced mainly by Streptomyces species. TUN has been reported to inhibit first steps of N‐linked protein glycosylation catalysed by DPAGT1 (UDP‐GlcNAc: dolichol phosphate N‐acetylglucosamine‐1‐phosphotransferase) by targeting the major facilitator domain containing the 2A (MFSD2A) transporter 40. This causes extensive protein misfolding and activation of UPR, thereby inducing apoptosis 41. TUN has also been reported to increase intracellular calcium levels in bovine aortic endothelial cells 42.

Here, we observed concentration‐dependent cytoprotective effects of quercetin against TUN‐induced toxicity in HUVEC cells. Furthermore, the effect of quercetin on activation of ER stress markers was studied, to attain a precise aspect to ameliorate the ER stress response. Under ER stress conditions, GRP78 rescues cells from effects of accumulated proteins, but in acute unresolved ER stress, this may lead to pathology by inducing cell death. GRP78 has been reported to be increased in endothelial cells in diabetic conditions 43 and also with an ER stress inducer, thapsigargin 33. We found elevated expression of GRP78 by TUN treatment, which is supported by previous reports, for example, of Natsume et al. 14. This revealed that upregulation of GRP78 in intestinal epithelial cells by ER stressors, including TUN, results in induction of genes, such as PERK, ATF6 and IRE1α, which coordinately regulate ER stress responses. Pre‐treatment with quercetin in TUN reduced up‐regulated GRP78 mRNA in HUVECs, thus re‐establishing ER homoeostasis.

C/EBP‐homologous protein, a mediator of ER stress‐induced apoptosis was considered to be minimal and was undetectable under normal conditions 44. Following GRP78 induction, ER stress signals lead to activation of CHOP and has been reported to sensitize cells to apoptosis 45. Elevated expression of CHOP has been observed in both in vitro and in vivo models such as in cystic fibrosis bronchial epithelial cells 46 and in retinitis pigmentosa 47. In the present study, TUN treatment was found to elevate expression of CHOP mRNA comparably as reported for other ER stress inducers such as A23187, thapsigargin and brefeldin A 14. Downregulation of CHOP and cells lacking CHOP, was significantly protected from lethal ER stress 48. One such report demonstrated that inhibition of ER stress CHOP‐signalling pathway protects macrophages from ox‐LDL‐induced apoptosis 49. We found the reduction in CHOP gene expression arbitrated by quercetin, which might be a reason for anti‐apoptotic effects in HUVECs. Effect of quercetin to restrain expression of GRP78 and CHOP was concurrent with suppression of ER stress in epithelial cells 14. As quercetin prevents expression of GRP78 and CHOP induction, mediated by calcium dynamics, it was also found to inhibit the PI3K pathway, thereby ameliorating ER stress. The effect of quercetin in HUVECs was comparable with that of other polyphenols, such as kaempferol 50, vaticanol B 51 and methoxyflavones 52; these compounds have been reported to regulate expression of ER stress proteins GRP78 and CHOP and also to improve the ER homoeostasis and restore ER membrane integrity.

Treatment with quercetin alone induced GRP78 expression; meanwhile, no modulation was observed in expression level of CHOP in HUVECs. One possible mechanism is that quercetin strengthened cell's defence by upregulating chaperone GRP78, which plays an important role in cell adaptation and survival. Our results are supported by previous reports explaining that quercetin induces GRP78 mRNA expression but does not alter expression of CHOP in a concentration and time‐dependent manner 14. Quercetin had similar effects in HUVECs, which clarify that quercetin alone does not play a role in ER stress induction.

The mechanism of cell death triggered as the result of ER stress is distinct. Although proapoptotic CHOP targets activation of numerous genes, including those which code for Bcl‐2, GADD34, endoplasmic reticulum oxidoreductin 1 and Tribbles‐related protein 3 in apoptosis induction, Bcl‐2 is the main downstream target gene of CHOP 45. CHOP is known to represses the promoter of Bcl‐2, thus downregulating anti‐apoptotic events and rendering the cell more sensitive to pro‐apoptotic signals 53. Studies have reported that overexpression of Bcl‐2 can block CHOP‐mediated apoptosis 13. Also, overexpression of CHOP is known to be associated with activation and mitochondrial translocation of Bax. In our study, TUN treatment increased expression of pro‐apoptotic Bax and reduced Bcl‐2 in HUVECs, and significant alteration was noticed with quercetin pre‐treatment, which correlated well with findings reported previously in macrophages 54.

Next, our study showed that the ER‐CHOP pathway activated caspase‐3, leading to caspase‐dependent PARP cleavage and, consequently initiating apoptosis. PARP, which is considered to be the endpoint of a number of cell signalling pathways, is known to be involved in DNA repair, transcription, and DNA methylation. It also controls many physiological and pathological outcomes, and is a key component of immunity and inflammation 55. In a Parp‐1 −1− knockout mouse model resistance to various modes of inflammation has been revealed. 56. Reduction in induction of caspase‐3 and PARP cleavage in quercetin pre‐treatment indicates their role in protecting cells from ER stress response.

Under normal physiological conditions, antioxidant systems balance reactive oxygen species (ROS) production and prevent oxidative damage encountered by cells. In particular, enzymatic antioxidants such as SOD, CAT and glutathione peroxidase play main roles in neutralizing ROS produced in pathological conditions. Cells responding to various diseased conditions and ER stressors accumulate ROS with impaired antioxidant responses. However, maintaining balance is essential for homoeostasis of the cell. In particular, SOD catalyses breakdown of superoxide (O2·−) to oxygen (O2) and hydrogen peroxide (H2O2), preventing formation of OH•, and thus, is an essential defence against toxicity induced by free radicals. ROS scavenging activity of SOD is more effective with actions of other enzymes, such as CAT. Our results indicate reduced levels of SOD1 and CAT after TUN administration and were found to be normalized upon quercetin pre‐treatment. Concurrently, quercetin has been acknowledged as being a scavenger of peroxynitrite and superoxide radicals in various model systems 57, 58.

Increased oxidative stress was reflected with increased MDA level 59. MDA, a final product of lipid peroxidation, marker for oxidative stress and antioxidant status of cells, was found to be elevated in our study, after TUN administration. In contrast, quercetin tended to reduce TUN‐induced MDA level. Quercetin had a comparable effect to that found in a previous report, in which reduced glutathione reduced MDA level in palmitate‐mediated ER stress response, in hepatocytes 60. In addition, role of quercetin on carbonyl pathway has been documented in vitro metal‐catalysed oxidation of myofibrillar proteins 61. Protein oxidation resulted in lower antioxidant functions with reduction in levels of glutathione peroxidase and ascorbic acid, as reported by Altomare et al. 62. Recent studies have demonstrated that quercetin scavenges peroxynitrite and prevents sarcoendoplasmic reticulum calcium ATP‐ase carbonylation 63.

In conclusion, exposure of HUVECs to TUN lead to apoptosis through activation of ER stress in vitro. We also demonstrated concentration‐dependent protective effects of quercetin on TUN‐induced apoptosis. Thus, with an antioxidant property, protective effects of quercetin against ER stress is considered important, and it appears to be a potent regulatory element in TUN‐evoked apoptotic signalling pathways (Fig. 7). Furthermore, PARP may at least in part, mediate protective effects of quercetin in HUVECs. Further pre‐clinical studies will be required to explore potential efficacy of quercetin against development and progression of conditions associated with ER stress.

Figure 7.

Figure 7

Open in a new tab

Hypothetical scheme representing the protective effect of quercetin against endoplasmic reticulum stress‐ induced endothelial dysfunction.

Acknowledgements

One of the authors, N. Suganya is thankful to Council of Scientific and Industrial Research (CSIR), New Delhi, India for awarding Senior Research Fellowship.

References

  • 1. Kolluru GK, Bir SC, Kevil CG (2012) Endothelial dysfunction and diabetes: effects on angiogenesis, vascular remodeling, and wound healing. Int. J. Vasc. Med. 2012, 918267. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Cai H, Harrison DG (2000) Endothelial dysfunction in cardiovascular diseases: the role of oxidant stress. Circ. Res. 87, 840–844. [DOI] [PubMed] [Google Scholar]
  • 3. Pacher P, Beckman JS, Liaudet L (2007) Nitric oxide and peroxynitrite in health and disease. Physiol. Rev. 87, 315–424. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Seimon T, Tabas I (2009) Mechanisms and consequences of macrophage apoptosis in atherosclerosis. J. Lipid Res. 50(Suppl), S382–S387. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Lee AS (2005) The ER chaperone and signaling regulator GRP78/BiP as a monitor of endoplasmic reticulum stress. Methods 35, 373–381. [DOI] [PubMed] [Google Scholar]
  • 6. Hotamisligil GS (2010) Endoplasmic reticulum stress and the inflammatory basis of metabolic disease. Cell 140, 900–917. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Sato N, Urano F, Yoon Leem J, Kim SH, Li M, Donoviel D et al (2000) Upregulation of BiP and CHOP by the unfolded‐protein response is independent of presenilin expression. Nat. Cell Biol. 2, 863–870. [DOI] [PubMed] [Google Scholar]
  • 8. Ohoka N, Yoshii S, Hattori T, Onozaki K, Hayashi H (2005) TRB3, a novel ER stress‐inducible gene, is induced via ATF4‐CHOP pathway and is involved in cell death. EMBO J. 24, 1243–1255. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Gery S, Park DJ, Vuong PT, Chih DY, Lemp N, Koeffler HP (2004) Retinoic acid regulates C/EBP homologous protein expression (CHOP), which negatively regulates myeloid target genes. Blood 104, 3911–3917. [DOI] [PubMed] [Google Scholar]
  • 10. Oyadomari S, Koizumi A, Takeda K, Gotoh T, Akira S, Araki E et al (2002) Targeted disruption of the Chop gene delays endoplasmic reticulum stress‐mediated diabetes. J. Clin. Invest. 109, 525–532. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Wu J, Zhang R, Torreggiani M, Ting A, Xiong H, Striker GE et al (2010) Induction of diabetes in aged C57B6 mice results in severe nephropathy: an association with oxidative stress, endoplasmic reticulum stress, and inflammation. Am. J. Pathol. 176, 2163–2176. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Zinszner H, Kuroda M, Wang X, Batchvarova N, Lightfoot RT, Remotti H et al (1998) CHOP is implicated in programmed cell death in response to impaired function of the endoplasmic reticulum. Genes Dev. 12, 982–995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. McCullough KD, Martindale JL, Klotz LO, Aw TY, Holbrook NJ (2001) Gadd153 sensitizes cells to endoplasmic reticulum stress by down‐regulating Bcl2 and perturbing the cellular redox state. Mol. Cell. Biol. 21, 1249–1259. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Natsume Y, Ito S, Satsu H, Shimizu M (2009) Protective effect of quercetin on ER stress caused by calcium dynamics dysregulation in intestinal epithelial cells. Toxicology 258, 164–175. [DOI] [PubMed] [Google Scholar]
  • 15. Xu C, Bailly‐Maitre B, Reed JC (2005) Endoplasmic reticulum stress: cell life and death decisions. J. Clin. Invest. 115, 2656–2664. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Dal‐Ros S, Zoll J, Lang AL, Auger C, Keller N, Bronner C et al (2011) Chronic intake of red wine polyphenols by young rats prevents aging‐induced endothelial dysfunction and decline in physical performance: role of NADPH oxidase. Biochem. Biophys. Res. Commun. 404, 743–749. [DOI] [PubMed] [Google Scholar]
  • 17. Scalbert A, Johnson IT, Saltmarsh M (2005) Polyphenols: antioxidants and beyond. Am. J. Clin. Nutr. 81, 215S–217S. [DOI] [PubMed] [Google Scholar]
  • 18. Vita JA (2005) Polyphenols and cardiovascular disease: effects on endothelial and platelet function. Am. J. Clin. Nutr. 81, 292S–297S. [DOI] [PubMed] [Google Scholar]
  • 19. Ou HC, Chou FP, Sheen HM, Lin TM, Yang CH, Huey‐Herng Sheu W (2006) Resveratrol, a polyphenolic compound in red wine, protects against oxidized LDL‐induced cytotoxicity in endothelial cells. Clin. Chim. Acta 364, 196–204. [DOI] [PubMed] [Google Scholar]
  • 20. Schroeder P, Klotz LO, Buchczyk DP, Sadik CD, Schewe T, Sies H (2001) Epicatechin selectively prevents nitration but not oxidation reactions of peroxynitrite. Biochem. Biophys. Res. Commun. 285, 782–787. [DOI] [PubMed] [Google Scholar]
  • 21. Kelly GS (2011) Quercetin. Monograph. Altern. Med. Rev. 16, 172–194. [PubMed] [Google Scholar]
  • 22. Choi EJ, Chee KM, Lee BH (2003) Anti‐ and prooxidant effects of chronic quercetin administration in rats. Eur. J. Pharmacol. 482, 281–285. [DOI] [PubMed] [Google Scholar]
  • 23. Chao CL, Hou YC, Chao PD, Weng CS, Ho FM (2009) The antioxidant effects of quercetin metabolites on the prevention of high glucose‐induced apoptosis of human umbilical vein endothelial cells. Br. J. Nutr. 101, 1165–1170. [DOI] [PubMed] [Google Scholar]
  • 24. Choi YJ, Jeong YJ, Lee YJ, Kwon HM, Kang YH (2005) (‐)Epigallocatechin gallate and quercetin enhance survival signaling in response to oxidant‐induced human endothelial apoptosis. J. Nutr. 135, 707–713. [DOI] [PubMed] [Google Scholar]
  • 25. Jeong YJ, Choi YJ, Kwon HM, Kang SW, Park HS, Lee M et al (2005) Differential inhibition of oxidized LDL‐induced apoptosis in human endothelial cells treated with different flavonoids. Br. J. Nutr. 93, 581–591. [DOI] [PubMed] [Google Scholar]
  • 26. van Meerloo J, Kaspers GJ, Cloos J (2011) Cell sensitivity assays: the MTT assay. Methods Mol. Biol. 731, 237–245. [DOI] [PubMed] [Google Scholar]
  • 27. Satoh K (1978) Serum lipid peroxide in cerebrovascular disorders determined by a new colorimetric method. Clin. Chim. Acta 90, 37–43. [DOI] [PubMed] [Google Scholar]
  • 28. Zacks DN, Hanninen V, Pantcheva M, Ezra E, Grosskreutz C, Miller JW (2003) Caspase activation in an experimental model of retinal detachment. Invest. Ophthalmol. Vis. Sci. 44, 1262–1267. [DOI] [PubMed] [Google Scholar]
  • 29. Stoscheck CM (1990) Quantitation of protein. Methods Enzymol. 182, 50–68. [DOI] [PubMed] [Google Scholar]
  • 30. Ferrari R, Guardigli G, Ceconi C (2010) Secondary prevention of CAD with ACE inhibitors: a struggle between life and death of the endothelium. Cardiovasc. Drugs Ther. 24, 331–339. [DOI] [PubMed] [Google Scholar]
  • 31. Xu J, Zou MH (2009) Molecular insights and therapeutic targets for diabetic endothelial dysfunction. Circulation 120, 1266–1286. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Wu QD, Wang JH, Fennessy F, Redmond HP, Bouchier‐Hayes D (1999) Taurine prevents high‐glucose‐induced human vascular endothelial cell apoptosis. Am. J. Physiol. 277, C1229–C1238. [DOI] [PubMed] [Google Scholar]
  • 33. Witte I, Horke S (2011) Assessment of endoplasmic reticulum stress and the unfolded protein response in endothelial cells. Methods Enzymol. 489, 127–146. [DOI] [PubMed] [Google Scholar]
  • 34. Werstuck GH, Lentz SR, Dayal S, Hossain GS, Sood SK, Shi YY et al (2001) Homocysteine‐induced endoplasmic reticulum stress causes dysregulation of the cholesterol and triglyceride biosynthetic pathways. J. Clin. Invest. 107, 1263–1273. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Siman R, Flood DG, Thinakaran G, Neumar RW (2001) Endoplasmic reticulum stress‐induced cysteine protease activation in cortical neurons: effect of an Alzheimer's disease‐linked presenilin‐1 knock‐in mutation. J. Biol. Chem. 276, 44736–44743. [DOI] [PubMed] [Google Scholar]
  • 36. Harding HP, Zeng H, Zhang Y, Jungries R, Chung P, Plesken H et al (2001) Diabetes mellitus and exocrine pancreatic dysfunction in perk‐/‐ mice reveals a role for translational control in secretory cell survival. Mol. Cell 7, 1153–1163. [DOI] [PubMed] [Google Scholar]
  • 37. Ryu EJ, Harding HP, Angelastro JM, Vitolo OV, Ron D, Greene LA (2002) Endoplasmic reticulum stress and the unfolded protein response in cellular models of Parkinson's disease. J. Neurosci. 22, 10690–10698. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Nishitoh H, Matsuzawa A, Tobiume K, Saegusa K, Takeda K, Inoue K et al (2002) ASK1 is essential for endoplasmic reticulum stress‐induced neuronal cell death triggered by expanded polyglutamine repeats. Genes Dev. 16, 1345–1355. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Kassan M, Galan M, Partyka M, Trebak M, Matrougui K (2011) Interleukin‐10 released by CD4(+)CD25(+) natural regulatory T cells improves microvascular endothelial function through inhibition of NADPH oxidase activity in hypertensive mice. Arterioscler. Thromb. Vasc. Biol. 31, 2534–2542. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Bassik MC, Kampmann M (2011) Knocking out the door to tunicamycin entry. Proc. Natl. Acad. Sci. USA 108, 11731–11732. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Reiling JH, Clish CB, Carette JE, Varadarajan M, Brummelkamp TR, Sabatini DM (2011) A haploid genetic screen identifies the major facilitator domain containing 2A (MFSD2A) transporter as a key mediator in the response to tunicamycin. Proc. Natl. Acad. Sci. USA 108, 11756–11765. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42. Buckley BJ, Whorton AR (1997) Tunicamycin increases intracellular calcium levels in bovine aortic endothelial cells. Am. J. Physiol. 273, C1298–C1305. [DOI] [PubMed] [Google Scholar]
  • 43. Liu M, Spellberg B, Phan QT, Fu Y, Lee AS, Edwards JE Jr et al (2010) The endothelial cell receptor GRP78 is required for mucormycosis pathogenesis in diabetic mice. J. Clin. Invest. 120, 1914–1924. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44. Su N, Kilberg MS (2008) C/EBP homology protein (CHOP) interacts with activating transcription factor 4 (ATF4) and negatively regulates the stress‐dependent induction of the asparagine synthetase gene. J. Biol. Chem. 283, 35106–35117. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45. Szegezdi E, Logue SE, Gorman AM, Samali A (2006) Mediators of endoplasmic reticulum stress‐induced apoptosis. EMBO Rep. 7, 880–885. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46. Vij N, Amoako MO, Mazur S, Zeitlin PL (2008) CHOP transcription factor mediates IL‐8 signaling in cystic fibrosis bronchial epithelial cells. Am. J. Respir. Cell Mol. Biol. 38, 176–184. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47. Kroeger H, Messah C, Ahern K, Gee J, Joseph V, Matthes MT et al (2012) Induction of endoplasmic reticulum stress genes, BiP and chop, in genetic and environmental models of retinal degeneration. Invest. Ophthalmol. Vis. Sci. 53, 7590–7599. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48. Pino SC, O'Sullivan‐Murphy B, Lidstone EA, Yang C, Lipson KL, Jurczyk A et al (2009) CHOP mediates endoplasmic reticulum stress‐induced apoptosis in Gimap5‐deficient T cells. PLoS One 4, e5468. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49. Yao S, Sang H, Song G, Yang N, Liu Q, Zhang Y et al (2012) Quercetin protects macrophages from oxidized low‐density lipoprotein‐induced apoptosis by inhibiting the endoplasmic reticulum stress‐C/EBP homologous protein pathway. Exp. Biol. Med. 237, 822–831. [DOI] [PubMed] [Google Scholar]
  • 50. Kim DS, Ha KC, Kwon DY, Kim MS, Kim HR, Chae SW et al (2008) Kaempferol protects ischemia/reperfusion‐induced cardiac damage through the regulation of endoplasmic reticulum stress. Immunopharmacol. Immunotoxicol. 30, 257–270. [DOI] [PubMed] [Google Scholar]
  • 51. Tabata Y, Takano K, Ito T, Iinuma M, Yoshimoto T, Miura H et al (2007) Vaticanol B, a resveratrol tetramer, regulates endoplasmic reticulum stress and inflammation. Am. J. Physiol. Cell Physiol. 293, C411–C418. [DOI] [PubMed] [Google Scholar]
  • 52. Takano K, Tabata Y, Kitao Y, Murakami R, Suzuki H, Yamada M et al (2007) Methoxyflavones protect cells against endoplasmic reticulum stress and neurotoxin. Am. J. Physiol. Cell Physiol. 292, C353–C361. [DOI] [PubMed] [Google Scholar]
  • 53. Puthalakath H, O'Reilly LA, Gunn P, Lee L, Kelly PN, Huntington ND et al (2007) ER stress triggers apoptosis by activating BH3‐only protein Bim. Cell 129, 1337–1349. [DOI] [PubMed] [Google Scholar]
  • 54. Yao ST, Miao C, Liu QH, Li YY, Tian H, Wang YY et al (2013) Inhibitory effect of quercetin preconditioning on tunicamycin‐induced apoptosis in macrophages and its mechanism. Sheng Li Xue Bao. 65, 47–54. [PubMed] [Google Scholar]
  • 55. Cuzzocrea S (2005) Shock, inflammation and PARP. Pharmacol. Res. 52, 72–82. [DOI] [PubMed] [Google Scholar]
  • 56. Ha HC (2004) Defective transcription factor activation for proinflammatory gene expression in poly(ADP‐ribose) polymerase 1‐deficient glia. Proc. Natl. Acad. Sci. USA 101, 5087–5092. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57. Liu CM, Zheng GH, Ming QL, Sun JM, Cheng C (2013) Protective effect of quercetin on lead‐induced oxidative stress and endoplasmic reticulum stress in rat liver via the IRE1/JNK and PI3K/Akt pathway. Free Radic. Res. 47, 192–201. [DOI] [PubMed] [Google Scholar]
  • 58. Patil SL, Mallaiah SH, Patil RK (2013) Antioxidative and radioprotective potential of rutin and quercetin in Swiss albino mice exposed to gamma radiation. J. Med. Phys. 38, 87–92. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59. Gawel S, Wardas M, Niedworok E, Wardas P (2004) Malondialdehyde (MDA) as a lipid peroxidation marker. Wiad. Lek. 57, 453–455. [PubMed] [Google Scholar]
  • 60. Ning B, Bai M, Shen W (2011) Reduced glutathione protects human hepatocytes from palmitate‐mediated injury by suppressing endoplasmic reticulum stress response. Hepatogastroenterology 58, 1670–1679. [DOI] [PubMed] [Google Scholar]
  • 61. Utrera M, Estevez M (2013) Impact of trolox, quercetin, genistein and gallic acid on the oxidative damage to myofibrillar proteins: the carbonylation pathway. Food Chem. 141, 4000–4009. [DOI] [PubMed] [Google Scholar]
  • 62. Altomare E, Grattagliano I, Vendemaile G, Micelli‐Ferrari T, Signorile A, Cardia L (1997) Oxidative protein damage in human diabetic eye: evidence of a retinal participation. Eur. J. Clin. Invest. 27, 141–147. [DOI] [PubMed] [Google Scholar]
  • 63. Zizkova P, Blaskovic D, Majekova M, Svorc L, Rackova L, Ratkovska L et al (2014) Novel quercetin derivatives in treatment of peroxynitrite‐oxidized SERCA1. Mol. Cell. Biochem. 386, 1–14. [DOI] [PubMed] [Google Scholar]

Articles from Cell Proliferation are provided here courtesy of Wiley

RESOURCES