Skip to main content
Infection and Drug Resistance logoLink to Infection and Drug Resistance
. 2019 Apr 10;12:795–804. doi: 10.2147/IDR.S194740

First investigation of the presence of SPATE genes in Shigella species isolated from children with diarrhea infection in Ahvaz, southwest Iran

Mojtaba Moosavian 1,2, Gholam Hossein Ghaderiyan 2, Mojtaba Shahin 2, Tahereh Navidifar 2,✉
PMCID: PMC6497838  PMID: 31114261

Abstract

Background: SPATE (serine protease autotransporters of enterobacteriaceae) genes are considered as a group of the main virulence factors of Shigella species This study aimed to investigate for the first time the distribution of SPATE genes among Shigella spp. isolated from children with diarrhea infection in Ahvaz, Iran.

Methodology: In this study, a total of 74 Shigella isolates were collected between August 2016 and June 2017 from feces of children with diarrhea and identified by biochemical and molecular methods for Shigella species. The frequency distribution of the SPATE genes, including pic, pet, sat, sigA and sepA, was evaluated using PCR. The genetic relationship of all isolates was evaluated by enterobacterial repetitive intergenic consensus-PCR.

Results: The most common species of Shigella was S. flexneri, followed by S. sonnei and S. boydii. In total, 95.94% of Shigella isolates had at least one of the SPATE genes. The presence of pic, pet, sat, sigA and sepA genes was confirmed among 35.13%, 27%, 47.29%, 58.1% and 39.18% of Shigella isolates, respectively. Of these SPATE genes, the sat and sigA genes were recognized as the most common autotransporters among S. flexneri and S. sonnei isolates, respectively. Also, either S. flexneri or S. sonnei isolates belonging to a same clone type had similar SPATE genes profile.

Conclusion: Our results revealed that the high distribution of SPATE genes among Shigella isolates in our region. Hence, this study highlights a need for epidemiological programs to monitor the distribution of SPATE genes locally for prevention from further dissemination of the Shigella isolates harboring them.

Keywords: SPATE genes, Shigella spp., PCR, antibiotic resistance

Introduction

Shigellosis is one of the main agents of diarrheal infections in developing countries especially among children <5 years of age. Shigella spp. isolates are the causative agents of 5–15% of all diarrheal infections worldwide1 that have involved approximately 80–165 million cases, with over 600,000 deaths occurring each year.2 The infection dose of Shigella spp. is as low as 10–100 organisms and over 80% of infections are due to person-to-person transmission.3 Shigellosis infection is associated with the colonization of four Shigella spp. – S. dysenteriae, S. flexneri, S. boydii and S. sonnei – that among them S. flexneri and S. sonnei are frequently isolated from Iran4 and other developing countries.5 Many reports have also demonstrated a relatively high prevalence of shigellosis among children with diarrheal infections.6–8

The first step for the successful colonization of Shigella spp. in the intestine is the disruption of mucus integrity that can be facilitated by several virulence factors produced by Shigella spp. such as SPATE (serine protease autotransporters of enterobacteriaceae) genes.9 The SPATEs were first identified as autotransporters secreted by diarrheagenic E. coli and Shigellaspp.; however, these genes are now detected in other members of the Enterobacteriaceae family. In Shigellaspp., the SPATE genes were classified phylogenetically into two main classes, including the class I SPATEs that comprised of Shigella IgA-like protease homologue (sigA), secreted autotransporter toxin (sat) and plasmid-encoded toxin (pet) which are directly cytotoxic for epithelial cells, as well as the class 2 SPATEs, including Shigella extracellular protein A (sepA) and protease involved in intestinal colonization (pic), which facilitate the intestinal inflammation and colonization. Overall, Shigella isolates harboring these genes are able to induce the inflammation and extensive mucosal damages in intestinal infections, especially when these isolates encode more than one the SPATE gene.10 Hence, the understanding of the distribution of SPATE genes in Shigella isolates in the epidemiologic and local researches can be useful gene targets for other researchers who are designing new antimicrobial therapies against them.

The aim of this study was to investigate for the first time the presence of the genes encoding SPATEs among clinical isolates of Shigellaspp. from children with diarrheal infection in Ahvaz, southwest, Iran.

Materials and methods

The collection of samples

We collected 3,254 stool culture of children <16 years of age with diarrheal infections referred to Golestan and Abuzar Hospitals during a period of 10 months from August 2016 to June 2017. The study design was approved by the Research Ethics Committee of Ahvaz Jundishapur University of Medical Sciences, Iran (IR.AJUMS.REC.1395.427). These samples were inoculated into Gram-negative (GN) Broth tubes as an enrichment medium as a part of the routine hospital laboratory procedure and then immediately transferred to the Laboratory of Microbiology Department of Medicine School of Ahvaz, Iran. From each patient, only one Shigella isolate in the diarrheal phase was included in this study. The GN Broth tubes were incubated at 37°C for 4–6 hrs and then streaked on Xylose Lysine Deoxycholate Agar and Eosin Methylene Blue Agar (Merck-Germany). All plates were incubated at 37°C for 24–48 hrs. The suspected colonies were biochemically identified as Shigellaspp. using Lysine Decarboxylase Agar, Sulfide-indole-motility, Triple-sugar iron Agar, Urea Agar and Simmons citrate Agar (Merck-Germany).11

Antimicrobial susceptibility testing

Determination of antimicrobial susceptibility was performed by Kirby-Bauer-disc diffusion method according to the guidelines of the Clinical and Laboratory Standards Institute.13 The antibiotic discs used were ceftriaxone (CRO; 30 µg), ciprofloxacin (CIP; 5 µg), trimethoprim/sulfamethoxazole (SXT; 1.25/23.75 µg), nalidixic acid (NA;30 µg), amikacin (AK; 30 µg), gentamycin (GM; 10 µg), ceftazidime (CAZ; 30 µg) and tetracycline (TE; 30 µg). All of these plates were incubated for an overnight at 35°C and the clear zones of bacterial growth inhibition were measured with an accuracy of ±0.1 mm.12

DNA extraction

The whole genome DNA was extracted using boiling method as described previously.13

Multiplex PCR assay for molecular identification of Shigella spp

The Tetraplex PCR assay was setup using whole genome DNA of the reference Shigella strains, including S. flexneri ATCC 12022, S. sonnei ATCC 9290, S. boydii ATCC 9207 and S. dysenteriae PTCC 1188 as the positive control strains along with water as the negative control. A multiplex PCR reaction was prepared in the final volume of 25 µL, including 1 U of AmpliTaq DNA polymerase, 2 μL of genomic DNA, 1X PCR buffer, 1.5 mM MgCl2, 200 µM dNTPs and distilled water up to the final volume of 25 μL. In this study, all primers were synthesized by Cinna gene Company, Iran. The primer concentrations were as follows: 0.2 Pmol/µL of primers SflexDF1 and SflexDR1; 0.35 Pmol/µL of primers SsonDF1 and SsonDR1; 0.15 Pmol/µL of primers SdysDF1 and SdysDR1; and 0.4 Pmol/µL of primers SboyDF1 and SboyDR1. The sequences and sizes of the primers are shown in Table 1.14,15 The amplification process was performed in Mastercycler Nexus Thermal Cycler Gradient (Eppendorf, Hamburg, Germany) with one cycle of initial denaturation at 94°C for 5 mins, followed by 35 cycles of 30 s at 94°C, 30 s at 55°C and 60 s at 72°C, with a final extension for 7 mins at 72°C.15 All PCR products were electrophoresed on 1% agarose gel stained with ethidium bromide and their images were visualized by Gel Documentation (Vilber Company, Germany).

Table 1.

Primers used for identifying each species with their sequences sizes

Name Primer sequence (5ʹ to 3ʹ) Length Target gene Target
identity
Ref
SflexDF1
SflexDR1
F- TTT ATG GCT TCT TTG TCG GC
R-CTG CGT GAT CCG ACC ATG
570 bp rfc S. flexneri 14
SsonDF1 SsonDR1 F-TCT GAA TAT GCC CTC TAC GCT
R-GAC AGA GCC CGA AGA ACC G
430 bp wbgZ S. sonnei 14
SdysDF1 SdysDR1 F-TCT CAA TAA TAG GGA ACA CAG C
R-CAT AAA TCA CCA GCA AGG TT
211 bp rfpB S. dysenteriae 14
SboyDF1 SboyDR1 F- GAGCA CGGAA ACAGA GAGCGCC
R- GGTGC GTTCT TCCGG TGTTC TG
240bp Hypothetical protein S. boydii 15
SgenDF1
SgenDR1
F- TGC CCA GTT TCT TCA TAC GC
R- GAA AGTAGCTCC CGAAATGC
870 bp invc Shigella genus 14

Amplification of SPATE genes

The amplifications of SPATEs including the pet, sat, pic, sigA and sepA genes were performed on the whole genome, as previously described.10 All reactions were established using the primers and PCR conditions described in Table 2. The PCR products were electrophoresed on 1% agarose gel stained with ethidium bromide and their images were visualized by Gel Documentation (Vilber Company, Germany).

Table 2.

Primer used for the amplifications of qnr determinants and SPATE genes

Gene Primer sequence (5ʹ to 3ʹ) bp Condition PCR Ref
pic F- ACTGGATCTTAAGGCTCAGGAT
R-GACTTAATGTCACTGTTCAGCG
572 94°C, 15 mins; 94°C, 30 s; 58°C, 45 s; 72°C, 45 s (35 cycles) 11
pet F- GGCACAGAATAAAGGGGTGTTT
R-CCTCTTGTTTCCACGACATAC
302
sepA F- GCAGTGGAAATATGATGCGGC
R-TTGTTCAGATCGGAGAAGAACG
794
sigA F- CCGACTTCTCACTTTCTCCCG
R-CCATCCAGCTGCATAGTGTTTG
430
sat F- TCAGAAGCTCAGCGAATCATTG
R-CCATTATCACCAGTAAAACGCACC
930 94°C, 15 mins; 94°C, 30 s; 59°C, 45 s; 72°C, 45 s (35 cycles)

ERIC-PCR typing and analysis

The genetic relationship of S. flexneri and S. sonnei isolates was evaluated by the enterobacterial repetitive intergenic consensus-PCR (ERIC-PCR) using primers of ERIC-F (5′-ATGTAAGCTCCTGGGGATTCAC-3′) and ERIC-R (5′AAGTAAGTGACTGGGGTGA GCG-3′).16 The PCR reaction was performed in the final volume of 20 µ as follows: 1U Taq DNA polymerase, 1.5 mM MgCl2, 200 μM dNTPs, 0.20 μM of each primer, 10x PCR buffer, 3 μL of template DNA and distilled water up to a final volume of 20 μL. The amplification process was performed in Mastercycler Nexus Thermal Cycler Gradient (Eppendorf, Hamburg, Germany) with one cycle of initial denaturation at 94°C for 5 mins, followed by 35 cycles of denaturation at 94°C for 60 s, annealing at 55°C for 60 s, extension at 72°C for 90 s, with a cycle of final extension at 72°C for 10 mins. The amplified products were resolved on agarose gel 1.5%, stained with ethidium bromide 0.5 µg/mL. The data analyses were performed using the Gel Compare II software version 6.6 (Applied Math, Sint-Martens-Latem, Belgium). The similarity pattern was calculated using the Unweighted-Pair Group Method/the Dice similarity coefficient with a position tolerance of 1.5%. Isolates with more than 90% similarity were considered an as clonal type.

Statistical analysis

The descriptive statistic tests were performed in SPSS version 16.00.

Results

Identification of Shigella spp. and determination of antibiotic susceptibility

In our study, of 3,254 stool samples, 74 (2.27%) were positive for Shigella species using bacterial culture. Of those, 736 samples (22.6%) belong to children <2 years of age, 435 (13.4%) samples in the age group between 2 and 5 years, 1,095 (33.6%) samples in the age group between 6 and 10 years and 988 (30.36%) samples in the age group between 11 and 15 years. According to PCR results, the most common Shigella species was S. flexneri (36 isolates; 48.6%), followed by S. sonnei (33 isolates; 46.6%) and S. boydii (five isolates; 6.7%). The distribution of Shigellaspp. isolates in different age groups is shown in Table 3. According to our study findings, both S. sonnei and S. fexneri were more prevalent in the age group of 6–10 years of age than other groups.

Table 3.

Distribution of Shigella spp. isolates in different age groups

Age groups <24 months
N=736 (%)
2–5 years
N=435(%)
6–10 years
N=1095(%)
11 to <15 years
N=988(%)
S.flexneri N=36 0 5 (13.8) 19 (52.7) 12 (33.33)
S.sonnei N=33 0 1 (3.03) 22 (66.6) 10 (30.3)
S.boydii N=5 0 0 4 (80) 1 (20)

The results of antibiotic susceptibility assay demonstrated that the majority of these isolates were resistant to trimethoprim/sulfamethoxazole (87.8%) and tetracycline (67.6%), followed by ceftriaxone (51.5%), nalidixic acid (28.4%) and ceftazidime (20.3%). However, the rates of resistance to gentamycin (2.7%), amikacin (2.7%) and ciprofloxacin (6.7%) were low. The frequency rates of antibiotic resistance of all strains are shown in Table 4. According to these results, all S. boydii strains were resistant to TMP-SXT.

Table 4.

The distribution pattern of antibiotic resistance based on species

Antibiotic AK
n (%)
GM
n (%)
CIP
n (%)
NA
n (%)
CAZ
n (%)
CRO
n (%)
TMP –SXT
n (%)
TET
n=(%)
S. flexneri N=36 1 (2.7) 1 (2.7) 4 (11.11) 16 (44.44) 9 (25) 20(55.5) 32(88.80 27(75)
S. sonnei N=33 1 (3.03) 1 (3.03) 1 (3.03) 4 (12.12) 5 (27.27) 16(48.4) 21(63.60 28(84.84)
S. boydii N=5 0 0 0 1 (20) 1 (20) 2(40) 5(100) 3(60)

Abbreviations: AK, amikacin; GM, gentamycin; CIP, ciprofloxacin; NA, nalidixic acid; CAZ, ceftazidime; TMP-SMX, trimethoprim/sulfamethoxazole; CRO, ceftriaxone; TET, tetracycline.

Frequency of class 1 and 2 SPATEs

We screened the presence of class 1 and 2 SPATEs among Shigellaspp. (Table 5). Moreover, among 36S. flexneri isolates, 12 (33.33%) harbored only class 1 and 24 (66.66%) harbored both of class 1 and 2 SPATE genes while any strain did not harbor only class 2 SPATEs. On the other hand, of 33 S. sonnei isolates, 11 (33.33%) harbored only class 1, 2 (6.06%) harbored only class 2 and 19 (57.57%) harbored both of class 1 and 2 SPATE genes, while only one S. sonnei strain harbored neither of class 1 nor class 2 SPATEs. Also, of five S. boydii strains, only one strain harbored the sigA gene, one harbored the sepA gene and one harbored both the sigA and sepA genes.

Table 5.

Distribution of the SPATE genes in Shigella isolates

Class 1 Class 2
Species Strain Pet sat sigA sepA pic
S. flexneri SF01 - + + - -
SF02 + + + - +
SF03 - + - + +
SF04 - + + + +
SF05 - + + + -
SF06 + - - - -
SF07 - + - - -
SF08 - + + - +
SF09 - + + - +
SF10 - - + - -
SF11 + + + + -
SF12 - + - + -
SF13 - + - + +
SF14 - + + - +
SF15 - + - - +
SF16 + - - - -
SF17 - + + - -
SF18 - + + + -
SF19 - + + - +
SF20 - + - - -
SF21 - + + - +
SF22 - + + + -
SF23 + - + - -
SF24 - - + - -
SF25 - + + - +
SF26 - + - + -
SF27 - + + + -
SF28 - - + - -
SF29 + - + - +
SF30 - + + + +
SF31 - + + - -
SF32 - - + - -
SF33 - + - - -
SF34 - + + + -
SF35 + - + + +
SF36 - + - - -
Total 7 27 25 13 14
S. sonnei SN01 - - - + -
SN02 + + - - +
SN03 + - + + +
SN04 - - + + +
SN05 + - + - -
SN06 - - - - -
SN07 + - - + +
SN08 + - - + -
SN09 - + - - +
SN10 + - - - -
S. sonnei SN11 + + + - -
SN12 - - + + +
SN13 + - - + -
SN14 - + - - -
SN15 - - + - +
SN16 - - + - -
SN17 - - + + -
SN18 - - - + -
SN19 - - + - -
SN20 - - + - -
SN21 + - + - -
SN22 - - + + +
SN23 - + - + -
SN24 - - + - -
SN25 - + - - +
SN26 + - - + +
SN27 + - + - +
SN28 + - + - -
SN29 - - + - -
SN30 - + + + +
SN31 - + - + -
SN32 - - - - -
SN33 + - - - -
Total 13 8 17 14 12
S. boydii SB01 - - + - -
SB02 - - - + -
SB03 - - + + -
SB04 - - - - -
SB05 - - - - -
Total 0 0 2 2 0

Abbreviations: SF, S. flexneri; SS, S. sonnei, SB, S.boydii.

Of 36 S. flexneri isolates, the genes encoding pet, sat, sigA, sepA and pic were detected among 7 (19.44%), 27 (75%), 25 (69.44%), 13 (36.11%) and 14 (38.88%) isolates, respectively. Also, of 33 S. sonnei isolates, the genes encoding pet, sat, sigA, sepA and pic were detected among as well as 13 (39.39%), 8 (24.24%), 17 (51.51%), 14 ( 42.42%) and 12 (36.36%), respectively.

Genetic diversity of S. flexneri and S. sonnei isolates

In our study, 36 S. flexneri isolates were categorized into 7 clone types and 8 single types using ERIC-PCR (Figure 1A). Also, 33 S. sonnei isolates were clustered into 10 clone types and 3 single types (Figure 1B). According to the results demonstrated in Figure 1 and Table 5, either S. flexneri or S. sonnei isolates belonging to a same clone type had similar SPATE genes profile.

Figure 1.

Figure 1

Dendrograms of 36 S. flexneri isolates (A) and 33 S. sonnei (B) isolates by ERIC-PCR fingerprinting.

Abbreviations: SF, S. flexneri; SN, S. sonnei; CT, clonal type; ST, single type; A, Abuzar Hospital; B, Golestan Hospital.

Discussion

The local epidemiology of Shigellaspp. is changing over time.17 In our study, the prevalence rate of Shigellaspp. in diarrheal infection was 2.27% and S. flexneri was recognized as the dominant species. In consistent with our results, in a previous study in our region by Jomezadeh et al18 during June 2011–May 2013, S. flexneri was the most common Shigellaspp. among the pediatric age group. However, the frequency rate of Shigellaspp. in their study was higher than our study (5.1% vs 2.27%) that may reflect the increasing hygiene levels in our region than that reported by Jomezadeh et al. Nevertheless, the frequency rate of Shigellaspp. in our study was higher than those reported in other reports,19,20 but was comparable to a previous study in Iran.17

According to data obtained from most researches conducted in Iran, S. flexneri was diagnosed as the main agent of shigellosis17,18,21,22 whereas in a few studies, S. sonnei has been found as the dominant species.4,23 In our study, the frequency of S. flexneri (36 isolates) was relatively similar to S. sonnei (33 isolates), indicating that S. flexneri may be replaced locally with S. sonnei. We also found a few S. boydii isolates which was in accordance with some other studies conducted in Iran, 4,17,18,20,21however, in the research conducted by Mashoof et al in Tabriz,24 S. sonnei had the lowest frequency. S. boydii was first detected in India and is still relatively prevalent in Indian subcontinent.25 However, many researchers in other regions of the world have reported the lower frequencies of S. boydii than India subcontinent.26–30

In this study, most isolates were resistant to TMP-SXT and tetracycline (more than 67%) that are in agreement with other studies reported in Iran and some other countries.17,18,21,25,31 In our study, S. fexneri isolates were more resistant to TMP-SXT than S. sonnei (88.9% vs 63.6%; p>0.05). TMP-SXT and tetracycline were previously used as two first-line antibiotics for the treatment of bacterial diarrheas such as shigellosis.32 However, because of the increasing prevalence of tetracycline or TMP-SXT-resistant Shigella strains, the use of these antibiotics is only limited to some regions where the resistance rates still are low.30

In this study, the resistance to gentamicin and amikacin was much low, as reported in other studies by Orrett et al30 in Trinidad and Peirano et al33 in Brazil. Overall, Shigellaspp. isolates are usually susceptible to aminoglycoside agents in vitro, but these agents are ineffective in vivo,14,34 hence do not recommend for shigellosis treatment.

The results of our study implied that the resistance rate to ciprofloxacin was much low. In contrast to our results, Jomezadeh et al,18 Hosseini Naveh et al,21 Özmert et al35 and Ghosh et al25 documented a relatively high prevalence of resistance to ciprofloxacin and nalidixic acid among Shigella isolates. It is suggested that the cross-resistance to nalidixic acid or/and the excessive use of these antibiotics may have been contributed to the high prevalence of fluoroquinolone-resistant isolates.34

The SPATE genes as an expanding family of secreted autotransporters in GN bacteria have various functions such as protease or mucinase that directly or indirectly can be toxic for the intestine cells.36 There is limited available information on the distribution of the SPATE genes in Shigella isolates, so that more research is needed to fully understand the distribution of these genes among Shigellaspp. isolates. In this current study, the distribution of five SPATE genes was determined by PCR. According to our data, most S. flexneri and S. sonnei isolates harbored two or more than two SPATE genes, as described in other studies by Hosseini Naveh et al37 and Boisen et al10 Moreover, Hosseini Naveh et al37 in Iran showed that 11 of 31 S. flexneri isolates and 6 of 7 S.boydii isolates were positive for four SPATE genes. According to the evidences obtained from the study of Boisen et al,10 the numbers of SPATE genes in the bacterial pathogens had the direct relationship with the virulence of the organisms and subsequently the severity of tissue damages. Also, these researchers showed that Shigella isolates commonly had encoded more than one SPATE gene rather than diarrheal E. coli pathotypes (EAEC, EIAC, ETEC, DAEC and EPEC), therefore, clinically, Shigellaspp. are more virulent than E. Coli pathotypes.10

In this study, the sat gene was recognized as the most common SPATE gene among S. flexneri isolates. In agreement with our study, Hosseini Naveh et al, Fan et al and Ruiz et al found the high rates of this gene among S. flexneri rather than other Shigella species.37,38,39 The sat gene was first studied in uropathogenic E. coli strains;36 however, recently several studies showed the presence of this gene in the Enteroaggregative Escherichia Coli clinical strains.40,41 The in vitro experiments indicated that sat can induce the cytoskeletal derangement in intestinal epithelium directly although cleaving spectrin proteins.42

We also showed a high prevalence of the sigA gene among both S. flexneri (24 of 36) and S. sonnei (17 of 31) isolates. In consistent with our results, Hosseini Naveh et al37 showed the presence of the sigA gene among all S. sonnei isolates while in contrast to our results, they detected a relatively low frequency of this gene in S. flexneri isolates. Also, Fan et al38 showed a high frequency of the sigA gene in the majority of S. flexneri serotypes. The sigA gene was initially reported as a part of chromosomal pathogenicity island in a S. flexneri clinical strain.35 Later, studies on the action mechanism of this gene by Al-Hasani et al43 revealed that the sigA gene induced the fluid accumulation in intestine and cleaved intracellular fodrin (an analog of spectrin) in situ that resulted in the derangement of the cytoskeleton during the pathogenesis of shigellosis.43 In addition Shigella isolates, some other studies indicated the high distribution of the sigA gene in Enteroinvasive Escherichia coli (EIEC)10,44 than other pathotypes of E. coli.40,41 Moreover, Boisen et al10 found that sixof ten EIEC isolates were positive for the amplification of the sigA gene as only the SPATE gene, suggesting that sigA may play an important role in the pathogenesis of EIEC, as well as Shigella isolates.

We indicated that class 2 SPATE genes (sepA and pic) were relatively common among Shigella isolates: 35.13% of the isolates were positive for the pic gene and 39.18% were positive for the sepA gene. Moreover, the frequency rates of the class 2 SPATE genes were relatively similar in S. flexneri and S. sonnei strains. In agreement with our results, Fan et al38 and Boisen et al10 showed the distribution of the class 2 SPATEs in different serotypes of S. flexneri, as well as Hosseini Naveh et al37 in Iran that reported the presence of the class 2 SPATE genes in both S. flexneri and S. boydii isolates.

pic initially was reported in a clinical strain of S. flexneri 2a, mediates the serum resistance through the degradation of one of the components of the complement system along with a mucinase activity, resulting in the successful intestinal colonization of Shigella isolates.

sepA also was originally described in S. flexneri 2a, induces the intestinal inflammation together with the fluid accumulation and mucosal atrophy by an unknown mechanism.36

In our study, S. boydii isolates had the low rates of SPATE genes (sepA and sigA) that is in contrast to findings of Hosseini Naveh et al37 in Iran who reported the high frequencies of the SPATE genes except to the sat gene among S. boydii isolates.

Molecular typing methods are used to establish the clonal relationships between isolates and confirm the clinical or epidemiological data, as well as the spread of an infectious agent in community.45 ERIC-PCR is a rapid and low-cost method that has differentiated closely related strains of bacteria from each other.46 In this present study, S. flexneri and S. sonnei isolates were clustered in 7 clonal types and 10 clonal types, respectively. Also, either S. flexneri or S. sonnei isolates belonging to a same clone type had similar SPATE genes profile, indicating that ERIC-PCR has high discriminatory power.

Conclusion

In this current study, we showed that the frequency rates of S. flexneri and S. sonnei were relativity similar. Also, we indicated the high distribution of the SPATE genes among Shigella isolates especially in S. flexneri. Hence, this study highlights a need for the epidemiological programs to monitor the distribution of SPATE genes locally for prevention from further dissemination of the Shigella isolates harboring them.

Acknowledgments

This study was a part of the M. Sc. thesis of Gholam Hossein Ghaderiyan, which obtained research approval from and was financially supported by the vice chancellor of Research Affairs of Infectious and Tropical Diseases Research Center, Health Research Institute, Jundishapur University of Medical Sciences, Ahvaz, Iran (Grant No. OG-95120). The authors also thank Doctor Haghighi of Bushehr University of Medical Sciences, for the donation of reference Shigella strains.

Disclosure

The authors report no conflict of interests in this work.

References

  • 1.Schroeder GN, Hilbi H. Molecular pathogenesis of Shigella spp.: controlling host cell signaling, invasion, and death by type III secretion. Clin Microbiol Rev. 2008;21(1):134–156. doi: 10.1128/CMR.00032-07 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Kweon MN. Shigellosis: the current status of vaccine development. Curr Opin Infect Dis. 2008;21(3):313–318. doi: 10.1097/QCO.0b013e3282f88b92 [DOI] [PubMed] [Google Scholar]
  • 3.Gupta A, Polyak CS, Bishop RD, Sobel J, Mintz ED. Laboratory-confirmed shigellosis in the United States, 1989-2002: epidemiologic trends and patterns. Clin Infect Dis. 2004;38(10):1372–1377. doi: 10.1086/386326 [DOI] [PubMed] [Google Scholar]
  • 4.Ranjbar R, Soltan Dallal MM, Talebi M, Pourshafie MR. Increased isolation and characterization of Shigella sonnei obtained from hospitalized children in Tehran, Iran. J Health Popul Nutr. 2008;26(4):426–430. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Niyogi SK. Increasing antimicrobial resistance–an emerging problem in the treatment of shigellosis. Clin Microbiol Infect. 2007;13(12):1141–1143. doi: 10.1111/j.1469-0691.2007.01829.x [DOI] [PubMed] [Google Scholar]
  • 6.Centers for Disease Control and Prevention (CDC). National Shigella Surveillance Annual Report, 2012. Atlanta: US Department of Health and Human Services; CDC; 2014. [Google Scholar]
  • 7.European Centre for Disease Prevention and Control. Annual Epidemiological Report Reporting on 2011 Surveillance Data and 2012 Epidemic Intelligence Data. Stockholm: ECDC; 2013. [Google Scholar]
  • 8.von Seidlein L, Kim DR, Ali M, et al A multicentre study of Shigella diarrhoea in six Asian countries: disease burden, clinical manifestations, and microbiology. PLoS Med. 2006;3(9):e353. doi: 10.1371/journal.pmed.0030353 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Mattock E, Blocker AJ. How do the virulence factors of shigella work together to cause disease? Front Cell Infect Microbiol. 2017;7:64. doi: 10.3389/fcimb.2017.00517 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Boisen N, Ruiz-Perez F, Scheutz F, Krogfelt KA, Nataro JP. Short report: high prevalence of serine protease autotransporter cytotoxins among strains of enteroaggregative Escherichia coli. Am J Trop Med Hyg. 2009;80(2):294–301. [PMC free article] [PubMed] [Google Scholar]
  • 11.Walker KE, Horneman AJ, Mahon CJ, et al Enterobacteriaceae In: Mahon CR, Lehman DC, Manuselis G, editors. Textbook of Diagnostic Microbiology. Maryland Heights, Mo: Saunders/Elsevier; 2011:427–470. [Google Scholar]
  • 12.CLSI. M100-S28. Performance Standards for Antimicrobial Susceptibility Testing. Twenty-eight informational supplement M100. Wayne: Clinical and Laboratory Standards Institute; 2018. [Google Scholar]
  • 13.Li P, Niu W, Li H, et al. Rapid detection of Acinetobacter baumannii and molecular epidemiology of carbapenem-resistant A. baumannii in two comprehensive hospitals of Beijing, China. Front Microbiol. 2015;6:997. doi: 10.3389/fmicb.2015.00997 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Ojha SC, Yean Yean C, Ismail A, Singh KK. A pentaplex PCR assay for the detection and differentiation of Shigella species. Biomed Res Int. 2013;2013:412370. doi: 10.1155/2013/412370 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Kim HJ, Ryu JO, Song JY, Kim HY. Multiplex polymerase chain reaction for identification of Shigellae and four Shigella species using novel genetic markers screened by comparative genomics. Foodborne Pathog Dis. 2017;14(7):400–406. doi: 10.1089/fpd.2016.2221 [DOI] [PubMed] [Google Scholar]
  • 16.Kosek M, Yori PP, Gilman RH, et al. Facilitated molecular typing of Shigella isolates using ERIC-PCR. Am J Trop Med Hyg. 2012;86(6):1018–1025. doi: 10.4269/ajtmh.2012.11-0671 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Pourakbari B, Mamishi S, Mashoori N, et al. Frequency and antimicrobial susceptibility of Shigella species isolated in Children Medical Center Hospital, Tehran, Iran, 2001-2006. Braz J Infect Dis. 2010;14(2):153–157. [DOI] [PubMed] [Google Scholar]
  • 18.Jomezadeh N, Babamoradi S, Kalantar E, Javaherizadeh H. Isolation and antibiotic susceptibility of Shigella species from stool samples among hospitalized children in Abadan, Iran. Gastroenterol Hepatol Bed Bench. 2014;7(4):218–223. [PMC free article] [PubMed] [Google Scholar]
  • 19.Urvashi SS, Dutta R. Antimicrobial resistance pattern of Shigella species over five years at a tertiary-care teaching hospital in north India. J Health Popul Nutr. 2011;29(3):292–295. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Ashkenazi S, Levy I, Kazaronovski V, Samra Z. Growing antimicrobial resistance of Shigella isolates. J Antimicrob Chemother. 2003;51(2):427–429. [DOI] [PubMed] [Google Scholar]
  • 21.Hosseini Nave H, Mansouri S, Sadeghi A, Moradi M. Molecular diagnosis and anti-microbial resistance patterns among Shigella spp. isolated from patients with diarrhea. Gastroenterol Hepatol Bed Bench. 2016;9(3):205–210. [PMC free article] [PubMed] [Google Scholar]
  • 22.Jafari F, Garcia-Gil LJ, Salmanzadeh-Ahrabi S, et al. Diagnosis and prevalence of enteropathogenic bacteria in children less than 5 years of age with acute diarrhea in Tehran children’s hospitals. J Infect. 2009;58(1):21–27. doi: 10.1016/j.jinf.2008.10.013 [DOI] [PubMed] [Google Scholar]
  • 23.Farshad S, Sheikhi R, Japoni A, Basiri E, Alborzi A. Characterization of Shigella strains in Iran by plasmid profile analysis and PCR amplification of ipa genes. J Clin Microbiol. 2006;44:2879–2883. doi: 10.1128/JCM.00310-06 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Mashouf RY, Moshtaghi AA, Hashemi SH. Epidemiology of Shigella species isolated from diarrheal children and drawing their antibiotic resistance pattern. Iran J Clin Infect Dis. 2006;1(3):149–155. [Google Scholar]
  • 25.Ghosh S, Pazhani GP, Niyogi SK, Nataro JP, Ramamurthy T. Genetic characterization of Shigella spp. isolated from diarrhoeal and asymptomatic children. J Med Microbiol. 2014;63(pt7):903–910. doi: 10.1099/jmm.0.070912-0 [DOI] [PubMed] [Google Scholar]
  • 26.Mache A. Antibiotic resistance and Sero-groups of Shigella among pediatric outpatients in Southwest Ethiopia. East Afr Med J. 2001;78(6):296–299. [DOI] [PubMed] [Google Scholar]
  • 27.Abu-Elyazeed RR, Wierzba TF, Frenck RW, et al Epidemiology of Shigella-associated diarrhea in rural Egyptian children. Am J Trop Med Hyg. 2004;71(3):367–372. [PubMed] [Google Scholar]
  • 28.Zafar A, Hasan R, Nizami SQ, et al Frequency of isolation of various subtypes and antimicrobial resistance of Shigella from urban slums of Karachi, Pakistan. Int J Infect Dis. 2009;13(6):668–672. doi: 10.1016/j.ijid.2008.10.005 [DOI] [PubMed] [Google Scholar]
  • 29.Khan S, Singh P, Asthana A, Ansari M. Magnitude of drug resistant shigellosis in Nepalese patients. Iran J Microbiol. 2013;5(4):334–338. [PMC free article] [PubMed] [Google Scholar]
  • 30.Orrett FA. Prevalence of Shigella serogroups and their antimicrobial resistance patterns in southern Trinidad. J Health Popul Nutr. 2008;26(4):456–462. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Bhattacharya D, Sugunan AP, Bhattacharjee H, et al Antimicrobial resistance in Shigella–rapid increase & widening of spectrum in Andaman Islands, India. Indian J Med Res. 2012;135:365–370. [PMC free article] [PubMed] [Google Scholar]
  • 32.Erdman SM, Buckner EE, Hindler JF. Options for treating resistant Shigella species infections in children. J Pediatr Pharmacol Ther. 2008;13(1):29–43. doi: 10.5863/1551-6776-13.1.29 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Peirano G, Souza FS, Rodrigues DP; Shigella Study Group. Frequency of serovars and antimicrobial resistance in Shigella spp. from Brazil. Mem Inst Oswaldo Cruz. 2006;101(3):245–250. [DOI] [PubMed] [Google Scholar]
  • 34.World Health Organization. Guidelines for the Control of Shigellosis, Including Epidemics Due to Shigella Dysenteriae Type 1. Geneva, Switzerland: World Health Organization Press; 2005. [Google Scholar]
  • 35.Özmert EN, İnce OT, Örün E, Yalçın S, Yurdakök K, Gür D. Clinical characteristics and antibiotic resistance of Shigella gastroenteritis in Ankara, Turkey between 2003 and 2009, and comparison with previous reports. Int J Infect Dis. 2011;15(12):e849–e53. doi: 10.1016/j.ijid.2011.08.008 [DOI] [PubMed] [Google Scholar]
  • 36.Dautin N. Serine protease autotransporters of enterobacteriaceae (SPATEs): biogenesis and function. Toxins (Basel). 2010;2(6):1179–1206. doi: 10.3390/toxins2061179 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Hosseini Nave H, Mansouri S, Emaneini M, Moradi M. Distribution of genes encoding virulence factors and molecular analysis of Shigella spp. isolated from patients with diarrhea in Kerman, Iran. Microb Pathog. 2016;92:68–71. doi: 10.1016/j.micpath.2015.11.015 [DOI] [PubMed] [Google Scholar]
  • 38.Fan W, Qian H, Shang W, et al. Low distribution of genes encoding virulence factors in Shigella flexneri serotypes 1b clinical isolates from eastern Chinese populations. Gut Pathog. 2017;9:76. doi: 10.1186/s13099-017-0222-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Ruiz J, Navia MM, Vila J, Gascón J. Prevalence of the Sat gene among clinical isolates of Shigella spp. causing travelers’ diarrhea: geographical and specific differences. J Clin Microbiol. 2002;40(4):1565–1566. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Andrade FB, Abreu AG, Nunes KO, Gomes TAT, Piazza RMF, Elias WP. Distribution of serine protease autotransporters of Enterobacteriaceae in typical and atypical enteroaggregative Escherichia coli. Infect Genet Evol. 2017;50:83–86. doi: 10.1016/j.meegid.2017.02.018 [DOI] [PubMed] [Google Scholar]
  • 41.Nezarieh R, Shakibaie MR, Nave HH, Norouzi A, Salajegheh G, Hayatbakhsh M. Distribution of virulence genes, enterotoxin and biofilm formation among enteroaggregative Escherichia coli (EAEC) strains isolated from stools of children with diarrhea in South East Iran. Arch Pediatr Infect Dis. 2015;3(3):e29745. doi: 10.5812/pedinfect [DOI] [Google Scholar]
  • 42.Guignot J, Chaplais C, Coconnier-Polter MH, Servin AL. The secreted autotransporter toxin, Sat, functions as a virulence factor in Afa/Dr diffusely adhering Escherichia coli by promoting lesions in tight junction of polarized epithelial cells. Cell Microbiol. 2007;9(1):204–221. doi: 10.1111/j.1462-5822.2006.00782.x [DOI] [PubMed] [Google Scholar]
  • 43.Al-Hasani K, Navarro-Garcia F, Huerta J, Sakellaris H, Adler B. The immunogenic SigA enterotoxin of Shigella flexneri 2a binds to HEp-2 cells and induces fodrin redistribution in intoxicated epithelial cells. PLoS One. 2009;4(12):e8223. doi: 10.1371/journal.pone.0008223 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Hosseini Nave H, Mansouri S, Taati Moghadam M, Moradi M. Virulence Gene Profile and Multilocus Variable-Number Tandem-Repeat Analysis (MLVA) of Enteroinvasive Escherichia coli (EIEC) isolates from patients with diarrhea in Kerman, Iran. Jundishapur J Microbiol. 2016;9(6):e33529. doi: 10.5812/jjm [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Sabat AJ, Budimir A, Nashev D, et al. Overview of molecular typing methods for outbreak detection and epidemiological surveillance. Euro Surveill. 2013;18(4):20380. doi: 10.2807/ese.18.04.20380-en [DOI] [PubMed] [Google Scholar]
  • 46.Ranjbar R, Tabatabaee A, Behzadi P, Kheiri R. Enterobacterial Repetitive Intergenic Consensus Polymerase Chain Reaction (ERIC-PCR) genotyping of escherichia coli strains isolated from different animal stool specimens. Iran J Pathol. 2017;12(1):25–34. [PMC free article] [PubMed] [Google Scholar]

Articles from Infection and Drug Resistance are provided here courtesy of Dove Press

RESOURCES