Skip to main content
Diabetes, Metabolic Syndrome and Obesity logoLink to Diabetes, Metabolic Syndrome and Obesity
. 2019 Mar 21;12:377–382. doi: 10.2147/DMSO.S201523

Increase in mast cell marker expression in the synovium of obese patients with osteoarthritis of the knee

Kentaro Uchida 1,✉, Shotaro Takano 1, Gen Inoue 1, Dai Iwase 1, Jun Aikawa 1, Ken Takata 1, Ryo Tazawa 1, Ayumu Kawakubo 1, Hiroyuki Sekiguchi 2, Masashi Takaso 1
PMCID: PMC6497865  PMID: 31114272

Abstract

Purpose: While research suggests that obesity is a risk factor for knee osteoarthritis (KOA), the mechanisms are not fully understood. Mast cell (MC) numbers are increased in the osteoarthritic synovium and in the adipose tissue of obese individuals. We hypothesized that MC numbers are increased in the synovium of obese KOA patients. This study investigated MC marker and MC-generated cytokine/growth factor expression in the synovium of obese KOA patients.

Patients and methods: Patients radiographically diagnosed with KOA (male: 38, female: 132) were allocated to three groups based on their body mass index (BMI): normal (<25 kg/m2), overweight (25–29.99 kg/m2) and obese (≥30 kg/m2), according to the World Health Organization BMI classification. We used real-time polymerase chain reaction to compare the expression of MC markers (CD117, CD203c) and growth factors/cytokines (FGF2, VEGFA, TNFA, and IL8) in patients’ synovium among the groups.

Results: CD117 expression was significantly higher in the obese group than in the normal and overweight groups. CD203c and FGF2 expression were higher in the obese group than in the normal group. FGF2 expression levels were significantly correlated with those of CD117 (ρ=0.487) and CD203c (ρ=0.751).

Conclusion: MC markers CD117 and CD203c, and FGF2 were highly expressed in the synovium of obese KOA patients. Further investigations are needed to reveal the role of MCs in the relationship between obesity and osteoarthritis pathology.

Keywords: mast cells, obese, synovium, osteoarthritis

Introduction

Several reports have suggested that obesity is a risk factor for osteoarthritis (OA), especially knee osteoarthritis (KOA).1–5 Previous studies have suggested that an obese level of body mass results in excess joint loading and increased risk of OA.6,7 Interestingly, reports have also suggested that altered metabolic factors as a result of obesity affect the production of cytokines and growth factors that are associated with OA pathology.8,9 Moreover, the fact that OA is observed in non-weight-bearing joints of obese patients10,11 implies that mechanical loading may not be the sole contributor, and that other factors may additionally play a role in OA progression. However, these mechanisms are not well established.

Mast cells (MCs) can be found in the synovial tissue, and increased MC numbers have been observed in KOA and rheumatoid arthritis patients, where they are thought to contribute to both acute and chronic inflammatory processes.12 Recent studies suggest that MCs are associated with the severity of radiographic KOA.13 Interestingly, increased MC numbers have also been observed in the adipose tissue of obese individuals, where they are thought to contribute to inflammation.14 However, whether MC numbers are increased in the synovium of obese KOA patients remains to be determined.

Previous studies have implicated several inflammatory cytokines and growth factors in KOA pathology, including tumor necrosis factor (TNF)-ɑ,15 interleukin-8 (IL8),16 fibroblast growth factor-2 (FGF2),17 and vascular endothelial growth factor (VEGF).18 Activated MCs synthesize TNF-ɑ,19–21 IL8,22,23 FGF224,25 and VEGF.26–28 However, the relationship between obesity and the expression of inflammatory cytokines and growth factors is not well understood.

Here, we investigated MC marker and MC-generated cytokine/growth factor expression in the synovium of obese KOA patients.

Patients and methods

Patients

All subjects underwent total knee arthroplasty (TKA) at our hospital between January 2015 and October 2018. Synovial tissue was extracted during TKA from the subjects (male: 38, female: 132), who were diagnosed with radiographic KOA (unilateral Kellgren/Lawrence grade 3: n=59/170, 34.8%; and grade 4: n=111/170, 65.2%). A portion of each synovial sample was snap frozen in liquid nitrogen and placed in a −80 °C freezer prior to RNA extraction.

This protocol was approved by the Ethics Review Board of Kitasato University (approval number: KMEO B13–113). Participants provided written informed consent to participate in this study and for the removal and use of their synovial tissue one day prior to surgery. This study was conducted in accordance with the Declaration of Helsinki.

Real-time (RT)-polymerase chain reaction (PCR) analysis

All subjects were allocated to three groups based on their body mass index (BMI): normal (<25 kg/m2), overweight (25–29.99 kg/m2) and obese (≥30 kg/m2), according to the World Health Organization (WHO) BMI classification. Patients’ clinical characteristics by group are summarized in Table 1.

Table 1.

Patients’ clinical characteristics by body mass index group

Normal (n=65) Overweight (n=71) Obese (n=34) P-value
Age (years) 75.5±7.9 72.6±6.7 69.6±8.4a,b 0.004
Male/Female, n 10/55 27/44 6/28 0.077
KL (3/4), n 20/45 27/44 12/22 0.679
BMI (kg/m2) 22.2±1.7 27.5±1.4a 32.8±2.2a,b <0.001

Notes: Data are mean ± SD unless otherwise indicated. aStatistical difference between normal and obese groups. bStatisitcal difference between overweight and obese groups.

Abbreviations: KL, Kellgren/Lawrence grade; BMI, body mass index.

We evaluated MC markers (CD117, CD203c) inflammatory cytokines (TNFA, IL8) and growth factors (VEGFA, FGF2) on the basis of previous studies which reported that these markers were elevated in OA patients15–18 and were produced by MC.19–28 RNA extraction, cDNA synthesis and RT-PCR were performed using methods reported previously.29 Primers used for RT-PCR are listed in Table 2. We used RT-PCR to compare the expression of CD117, CD203c, FGF2, VEGFA, TNFA, and IL8 in the synovium among the groups.

Table 2.

Sequences of primers used in this study

Primer Sequence (5ʹ–3ʹ) Product size (bp)
CD117-F TGACTTACGACAGGCTCGTG 126
CD117-R CCACTGGCAGTACAGAAGCA
CD203c-F CGACTGCACTATGCCAAGAA 164
CD203c-R GGTCCATGTGCCAGAAAGAT
FGF2-F AGAGCGACCCTCACATCAAG 80
FGF2-R ACGGTTAGCACACACTCCTT
VEGFA-F TTGCCTTGC TGCTCTACCTC 104
VEGFA-R AGCTGCGCTGATAGACATCC
TNFA-F CTTCTGCCTGCTGCACTTTG 118
TNFA-R GTCACTCGGGGTTCGAGAAG
IL8-F ACACTGCGCCAACACAGAAA 89
IL8-R ACCTCGTGGAGACGCTTTAC
GAPDH-F TGCCACTCAGAAGACTGTGG 129
GAPDH-R TTCAGCTCTGGGATGACCTT

Statistical analysis

SPSS 25.0 was used for statistical analysis. Continuous variables were compared using one-way analysis of variance followed by Fisher’s least significant difference test as a post-hoc test.30 Meanwhile, categorical variables were compared using the Fisher exact test. Spearman’s correlation coefficient was used to evaluate the relationship between the expression of FGF2 and MC markers (CD117 and CD203c). Statistical significance was defined by P<0.05.

Results

Clinical characteristics of patients in normal, overweight, and obese groups

Patients were allocated to three WHO BMI classification groups: normal, overweight and obese. Patients in the obese group were significantly younger than those in the normal and overweight groups (Table 1). Male/female ratio and Kellgren/Lawrence grade 3/4 ratio were similar among the groups (Table 1).

Expression of MC markers in normal, overweight, and obese groups

To determine whether MC numbers are increased in obese OA patients, we examined the expression level of MC markers in the synovium of KOA patients. CD117 expression was significantly elevated in the obese group compared to the normal (P=0.038) and overweight groups (P=0.031), but was comparable between the normal and overweight groups (P=0.944) (Figure 1A). CD203c expression was significantly elevated in the obese group compared to the normal group (P=0.046) but was comparable with the overweight group (P=0.136) (Figure 1B).

Figure 1.

Figure 1

Effect of obesity on mast cell marker expression in synovial tissue. CD117 (A) and CD203c expression (B) in normal, overweight, and obese groups. *P<0.05.

Expression of MC-generated cytokines and growth factors in normal, overweight, and obese groups

FGF2 expression was significantly elevated in the obese group compared to the normal group (P=0.029) but was comparable to the overweight group (P=0.207) (Figure 2A). VEGFA, TNFA, and IL8 expression were similar among the three groups (VEGFA, P=0.389; TNFA, P=0.552; IL8, P=0.232; Figure 2B–D).

Figure 2.

Figure 2

Effect of obesity on the expression of inflammatory cytokines and growth factors in synovial tissue. FGF2 (A), VEGFA (B), TNFA (C), and IL8 (D) expression in normal, overweight, and obese groups.*P<0.05.

Correlation between MC markers and FGF2 expression

Given that MC markers CD117 and CD203c and the MC-generated growth factor FGF2 were elevated in the obese group, we examined the correlation between the expression of CD117 and FGF2, and CD203c and FGF2. FGF2 expression levels were significantly correlated with those of CD117 (ρ=0.487, P<0.001; Figure 3A) and CD203c (ρ=0.751, P<0.001; Figure 3B).

Figure 3.

Figure 3

Correlation between the mRNA levels of CD203c, CD117 and FGF2 in synovial tissue. Relationship between FGF2 and CD117 (A) and CD203c (B) in synovial tissue.

Discussion

A number of studies have reported a strong link between the development of KOA and obesity.1,31,32 One study showed that obese KOA patients are 6.8 times more likely to experience KOA progression that those of normal weight.1 Another study reported that the odds ratio for obese individuals developing KOA was 2.6 relative to normal-weight subjects.32 In our study, we found that obese KOA patients underwent TKA at a younger age than normal-weight and overweight patients. Together with previous studies,1,30,31 our findings suggest that obesity is associated with KOA progression.

Studies have reported increased MC numbers in patients with obesity-related glomerulopathy33 and skin tags,34 and obese patients.14 The number of MCs in patients with obesity-related glomerulopathy is significantly and positively correlated with BMI.33 Obese patients with skin tags have significantly more MCs than overweight patients.34 MC numbers are also increased in the adipose tissue of obese patients, where they are thought to contribute to inflammation in white adipose tissue.14 In this study, the synovium of obese KOA patients showed higher expression levels of the MC marker CD117 than that of normal-weight and overweight KOA patients. A recent study showed that there is a relationship between KOA severity and the number of MCs.13 Further investigations are needed to reveal the role of MCs in the relationship between obesity and osteoarthritis pathology.

MCs produce several mediators that contribute to the inflammation process. FGF2 is one growth factor produced by MCs in the inflammatory state.24,25 In our study, FGF2 expression was higher in the synovium of obese KOA patients than that of normal-weight KOA patients, and was correlated with the expression of MC markers CD117 and CD203c. FGF2 promotes matrix metalloprotease-13 production in articular chondrocytes.35,36 FGF2 concentrations in synovial fluid and plasma are correlated with the Kellgren/Lawrence grade.17 Together, our findings and those of previous studies suggest that FGF2 elevation may be associated with increased MC numbers in the synovium of obese KOA patients. However, it is unclear whether FGF2 elevation in obese KOA patients contributes to OA pathology.

Several limitations of the present study warrant mention. First, the inclusion of a non-KOA population is needed to confirm whether MC numbers are increased in obese individuals and if this directly contributes to OA progression. Second, the mechanism by which MCs contribute to OA pathology remains to be determined. Finally, it remains unclear whether the evaluated biomarkers are of sufficient significance to warrant assessment in KOA patients. Other biomarkers should be evaluated in the future.

In conclusion, MC markers CD117 and CD203c, and FGF2 are highly expressed in the synovium of obese KOA patients. Further investigations are needed to reveal the role of MCs in the relationship between obesity and osteoarthritis pathology.

Acknowledgments

This investigation was supported by JSPS KAKENHI Grant No. 18K09119. We thank DMC Corp. (www.dmed.co.jp) for editing drafts of this manuscript.

Disclosure

The authors report no conflicts of interest in this work.

References

  • 1.Coggon D, Reading I, Croft P, McLaren M, Barrett D, Cooper C. Knee osteoarthritis and obesity. Int J Obes Relat Metab Disord. 2001;25:622–627. doi: 10.1038/sj.ijo.0801585 [DOI] [PubMed] [Google Scholar]
  • 2.Felson DT. Relation of obesity and of vocational and avocational risk factors to osteoarthritis. J Rheumatol. 2005;32:1133–1135. [PubMed] [Google Scholar]
  • 3.Hart DJ, Spector TD. The relationship of obesity, fat distribution and osteoarthritis in women in the general population: the Chingford Study. J Rheumatol. 1993;20:331–335. [PubMed] [Google Scholar]
  • 4.Lachance L, Sowers M, Jamadar D, Jannausch M, Hochberg M, Crutchfield M. The experience of pain and emergent osteoarthritis of the knee. Osteoarthritis Cartilage. 2001;9:527–532. doi: 10.1053/joca.2000.0429 [DOI] [PubMed] [Google Scholar]
  • 5.Runhaar J, Koes BW, Clockaerts S, Bierma-Zeinstra SM. A systematic review on changed biomechanics of lower extremities in obese individuals: a possible role in development of osteoarthritis. Obes Rev. 2011;12:1071–1082. doi: 10.1111/j.1467-789X.2011.00916.x [DOI] [PubMed] [Google Scholar]
  • 6.Felson DT. Does excess weight cause osteoarthritis and, if so, why? Ann Rheum Dis. 1996;55:668–670. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Powell A, Teichtahl AJ, Wluka AE, Cicuttini FM. Obesity: a preventable risk factor for large joint osteoarthritis which may act through biomechanical factors. Br J Sports Med. 2005;39:4–5. doi: 10.1136/bjsm.2004.011841 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Aspden RM. Obesity punches above its weight in osteoarthritis. Nat Rev Rheumatol. 2011;7:65–68. doi: 10.1038/nrrheum.2010.123 [DOI] [PubMed] [Google Scholar]
  • 9.Griffin TM, Guilak F. Why is obesity associated with osteoarthritis? Insights from mouse models of obesity. Biorheology. 2008;45:387–398. [PMC free article] [PubMed] [Google Scholar]
  • 10.Grotle M, Hagen KB, Natvig B, Dahl FA, Kvien TK. Obesity and osteoarthritis in knee, hip and/or hand: an epidemiological study in the general population with 10 years follow-up. BMC Musculoskelet Disord. 2008;9:132. doi: 10.1186/1471-2474-9-87 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Oliveria SA, Felson DT, Cirillo PA, Reed JI, Walker AM. Body weight, body mass index, and incident symptomatic osteoarthritis of the hand, hip, and knee. Epidemiology. 1999;10:161–166. [PubMed] [Google Scholar]
  • 12.Nigrovic PA, Lee DM. Synovial mast cells: role in acute and chronic arthritis. Immunol Rev. 2007;217:19–37. doi: 10.1111/j.1600-065X.2007.00506.x [DOI] [PubMed] [Google Scholar]
  • 13.de Lange-Brokaar BJ, Kloppenburg M, Andersen SN, Dorjee AL, Yusuf E, Herb-van TL, Kroon HM, Zuurmond AM, Stojanovic-Susulic V, Bloem JL, Nelissen RG, Toes RE, Ioan-Facsinay A. Characterization of synovial mast cells in knee osteoarthritis: association with clinical parameters. Osteoarthritis Cartilage. 2016;24:664–671. doi: 10.1016/j.joca.2015.11.011 [DOI] [PubMed] [Google Scholar]
  • 14.Divoux A, Moutel S, Poitou C, Lacasa D, Veyrie N, Aissat A, Arock M, Guerre-Millo M, Clement K. Mast cells in human adipose tissue: link with morbid obesity, inflammatory status, and diabetes. J Clin Endocrinol Metab. 2012;97:E1677–E1685. doi: 10.1210/jc.2012-1532 [DOI] [PubMed] [Google Scholar]
  • 15.Orita S, Koshi T, Mitsuka T, Miyagi M, Inoue G, Arai G, Ishikawa T, Hanaoka E, Yamashita K, Yamashita M, Eguchi Y, Toyone T, Takahashi K, Ohtori S. Associations between proinflammatory cytokines in the synovial fluid and radiographic grading and pain-related scores in 47 consecutive patients with osteoarthritis of the knee. BMC Musculoskelet Disord. 2011;12:144. doi: 10.1186/1471-2474-12-181 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Valcamonica E, Chighizola CB, Comi D, De LO, Pisoni L, Murgo A, Salvi V, Sozzani S, Meroni PL. Levels of chemerin and interleukin 8 in the synovial fluid of patients with inflammatory arthritides and osteoarthritis. Clin Exp Rheumatol. 2014;32:243–250. [PubMed] [Google Scholar]
  • 17.Honsawek S, Yuktanandana P, Tanavalee A, Saetan N, Anomasiri W, Parkpian V. Correlation between plasma and synovial fluid basic fibroblast growth factor with radiographic severity in primary knee osteoarthritis. Int Orthop. 2012;36:981–985. doi: 10.1007/s00264-011-1435-z [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Saetan N, Honsawek S, Tanavalee A, Yuktanandana P, Meknavin S, Ngarmukos S, Tanpowpong T, Parkpian V. Relationship of plasma and synovial fluid vascular endothelial growth factor with radiographic severity in primary knee osteoarthritis. Int Orthop. 2014;38:1099–1104. doi: 10.1007/s00264-013-2192-y [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Bischoff SC, Lorentz A, Schwengberg S, Weier G, Raab R, Manns MP. Mast cells are an important cellular source of tumour necrosis factor alpha in human intestinal tissue. Gut. 1999;44:643–652. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Ierna MX, Scales HE, Saunders KL, Lawrence CE. Mast cell production of IL-4 and TNF may be required for protective and pathological responses in gastrointestinal helminth infection. Mucosal Immunol. 2008;1:147–155. doi: 10.1038/mi.2007.16 [DOI] [PubMed] [Google Scholar]
  • 21.Nakae S, Ho LH, Yu M, Monteforte R, Iikura M, Suto H, Galli SJ. Mast cell-derived TNF contributes to airway hyperreactivity, inflammation, and TH2 cytokine production in an asthma model in mice. J Allergy Clin Immunol. 2007;120:48–55. doi: 10.1016/j.jaci.2007.02.046 [DOI] [PubMed] [Google Scholar]
  • 22.Moller A, Lippert U, Lessmann D, Kolde G, Hamann K, Welker P, Schadendorf D, Rosenbach T, Luger T, Czarnetzki BM. Human mast cells produce IL-8. J Immunol. 1993;151:3261–3266. [PubMed] [Google Scholar]
  • 23.Salamon P, Shoham NG, Gavrieli R, Wolach B, Mekori YA. Human mast cells release Interleukin-8 and induce neutrophil chemotaxis on contact with activated T cells. Allergy. 2005;60:1316–1319. doi: 10.1111/j.1398-9995.2005.00886.x [DOI] [PubMed] [Google Scholar]
  • 24.Inoue Y, King TE, Jr, Tinkle SS, Dockstader K, Newman LS. Human mast cell basic fibroblast growth factor in pulmonary fibrotic disorders. Am J Pathol. 1996;149:2037–2054. [PMC free article] [PubMed] [Google Scholar]
  • 25.Qu Z, Liebler JM, Powers MR, Galey T, Ahmadi P, Huang XN, Ansel JC, Butterfield JH, Planck SR, Rosenbaum JT. Mast cells are a major source of basic fibroblast growth factor in chronic inflammation and cutaneous hemangioma. Am J Pathol. 1995;147:564–573. [PMC free article] [PubMed] [Google Scholar]
  • 26.Boesiger J, Tsai M, Maurer M, Yamaguchi M, Brown LF, Claffey KP, Dvorak HF, Galli SJ. Mast cells can secrete vascular permeability factor/vascular endothelial cell growth factor and exhibit enhanced release after immunoglobulin E-dependent upregulation of fc epsilon receptor I expression. J Exp Med. 1998;188:1135–1145. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Shaik-Dasthagirisaheb YB, Varvara G, Murmura G, Saggini A, Potalivo G, Caraffa A, Antinolfi P, Tete’ S, Tripodi D, Conti F, Cianchetti E, Toniato E, Rosati M, Conti P, Speranza L, Pantalone A, Saggini R, Theoharides TC, Pandolfi F. Vascular endothelial growth factor (VEGF), mast cells and inflammation. Int J Immunopathol Pharmacol. 2013;26:327–335. doi: 10.1177/039463201302600206 [DOI] [PubMed] [Google Scholar]
  • 28.Sismanopoulos N, Delivanis DA, Alysandratos KD, Angelidou A, Vasiadi M, Therianou A, Theoharides TC. IL-9 induces VEGF secretion from human mast cells and IL-9/IL-9 receptor genes are overexpressed in atopic dermatitis. PLoS One. 2012;7:e33271. doi: 10.1371/journal.pone.0033271 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Minatani A, Uchida K, Inoue G, Takano S, Aikawa J, Miyagi M, Fujimaki H, Iwase D, Onuma K, Matsumoto T, Takaso M. Activation of calcitonin gene-related peptide signaling through the prostaglandin E2-EP1/EP2/EP4 receptor pathway in synovium of knee osteoarthritis patients. J Orthop Surg Res. 2016;11:117. doi: 10.1186/s13018-016-0460-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Fisher RA. The Design of Experiments. London: Oliver and Boyd; 1935. [Google Scholar]
  • 31.Fletcher E, Lewis-Fanning E. Chronic rheumatic diseases-part IV: a statistical study of 1,000 cases of chronic rheumatism. Postgrad Med J. 1945;21:176–185. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Blagojevic M, Jinks C, Jeffery A, Jordan KP. Risk factors for onset of osteoarthritis of the knee in older adults: a systematic review and meta-analysis. Osteoarthritis Cartilage. 2010;18:24–33. doi: 10.1016/j.joca.2009.08.010 [DOI] [PubMed] [Google Scholar]
  • 33.Wang X, Chen H, Zhang M, Liu Z. Roles of mast cells and monocyte chemoattractant protein-1 in the renal injury of obesity-related glomerulopathy. Am J Med Sci. 2013;346:295–301. doi: 10.1097/MAJ.0b013e31827559f8 [DOI] [PubMed] [Google Scholar]
  • 34.Salem SA, Attia EA, Osman WM, El Gendy MA. Skin tags: a link between lesional mast cell count/tryptase expression and obesity and dyslipidemia. Indian J Dermatol. 2013;58:240. doi: 10.4103/0019-5154.110843 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Muddasani P, Norman JC, Ellman M, van Wijnen AJ, Im HJ. Basic fibroblast growth factor activates the MAPK and NFkappaB pathways that converge on Elk-1 to control production of matrix metalloproteinase-13 by human adult articular chondrocytes. J Biol Chem. 2007;282:31409–31421. doi: 10.1074/jbc.M706508200 [DOI] [PubMed] [Google Scholar]
  • 36.Im HJ, Muddasani P, Natarajan V, Schmid TM, Block JA, Davis F, van Wijnen AJ, Loeser RF. Basic fibroblast growth factor stimulates matrix metalloproteinase-13 via the molecular cross-talk between the mitogen-activated protein kinases and protein kinase Cdelta pathways in human adult articular chondrocytes. J Biol Chem. 2007;282:11110–11121. doi: 10.1074/jbc.M609040200 [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Diabetes, Metabolic Syndrome and Obesity: Targets and Therapy are provided here courtesy of Dove Press

RESOURCES