Novel Antifungal Compound Z-705 Specifically Inhibits Protein Kinase C of Filamentous Fungi

A candidate inhibitor of filamentous fungal protein kinase C (PKC), Z-705, was identified by in silico screening. A screening system to evaluate the effects of fungal PKC inhibitors was constructed in Saccharomyces cerevisiae. Using this system, we found that Z-705 is highly selective for filamentous fungal PKC in comparison with S. cerevisiae PKC. Analysis of the AGS1 mRNA level, which is regulated by Mps1p mitogen-activated protein kinase (MAPK) via PKC, in the rice blast fungus Magnaporthe grisea revealed that Z-705 had a PKC inhibitory effect comparable to that of staurosporine. Micafungin induced hyphal melanization in M. grisea, and this melanization, which is required for pathogenicity of M. grisea, was inhibited by PKC inhibition by both Z-705 and staurosporine. The mRNA levels of 4HNR, 3HNR, and SCD1, which are essential for melanization in M. grisea, were suppressed by both PKC inhibitors.

ABSTRACT

The cell wall integrity signaling (CWIS) pathway is involved in fungal cell wall biogenesis. This pathway is composed of sensor proteins, protein kinase C (PKC), and the mitogen-activated protein kinase (MAPK) pathway, and it controls the transcription of many cell wall-related genes. PKC plays a pivotal role in this pathway; deficiencies in PkcA in the model filamentous fungus Aspergillus nidulans and in MgPkc1p in the rice blast fungus Magnaporthe grisea are lethal. This suggests that PKC in filamentous fungi is a potential target for antifungal agents. In the present study, to search for MgPkc1p inhibitors, we carried out in silico screening by three-dimensional (3D) structural modeling and performed growth inhibition tests for M. grisea on agar plates. From approximately 800,000 candidate compounds, we selected Z-705 and evaluated its inhibitory activity against chimeric PKC expressed in Saccharomyces cerevisiae cells in which the kinase domain of native S. cerevisiae PKC was replaced with those of PKCs of filamentous fungi. Transcriptional analysis of MLP1, which encodes a downstream factor of PKC in S. cerevisiae, and phosphorylation analysis of the mitogen-activated protein kinase (MAPK) Mpk1p, which is activated downstream of PKC, revealed that Z-705 specifically inhibited PKCs of filamentous fungi. Moreover, the inhibitory activity of Z-705 was similar to that of a well-known PKC inhibitor, staurosporine. Interestingly, Z-705 inhibited melanization induced by cell wall stress in M. grisea. We discuss the relationships between PKC and melanin biosynthesis.

IMPORTANCE A candidate inhibitor of filamentous fungal protein kinase C (PKC), Z-705, was identified by in silico screening. A screening system to evaluate the effects of fungal PKC inhibitors was constructed in Saccharomyces cerevisiae. Using this system, we found that Z-705 is highly selective for filamentous fungal PKC in comparison with S. cerevisiae PKC. Analysis of the AGS1 mRNA level, which is regulated by Mps1p mitogen-activated protein kinase (MAPK) via PKC, in the rice blast fungus Magnaporthe grisea revealed that Z-705 had a PKC inhibitory effect comparable to that of staurosporine. Micafungin induced hyphal melanization in M. grisea, and this melanization, which is required for pathogenicity of M. grisea, was inhibited by PKC inhibition by both Z-705 and staurosporine. The mRNA levels of 4HNR, 3HNR, and SCD1, which are essential for melanization in M. grisea, were suppressed by both PKC inhibitors.

INTRODUCTION

Cells of eumycetes, including those of baker’s yeast (Saccharomyces cerevisiae) and filamentous fungi, are covered with cell walls composed of polysaccharides, such as glucan, chitin, and mannan (1–3). Cell walls not only protect the cells and maintain their shapes but also transmit extracellular information into the cells in collaboration with cell membrane proteins. The cell wall structures and compositions in plants and prokaryotes differ from those in fungi. Thus, proteins related to biosynthesis of fungal cell walls and signal transduction pathways involved in cell wall biogenesis are potential targets for antifungal drugs (4, 5).

In both yeast and filamentous fungi, orthologous cell wall integrity signaling (CWIS) pathways are involved in cell wall construction (6, 7). The CWIS pathway is well characterized in S. cerevisiae (8, 9). It consists of several cell surface sensor proteins and signaling proteins, such as protein kinase C (PKC) and components of a mitogen-activated protein kinase (MAPK) cascade (9, 10). When cells are exposed to high temperature, low osmotic pressure, or other factors that perturb the cell wall, the sensor proteins sense and transmit signals via GDP/GTP exchange factors, Rom1p and Rom2p, to the downstream small G-protein Rho1p (9, 11). The signaling from Rho1p proceeds through Pkc1p and a MAPK cascade (9, 10). The MAPK cascade is a linear pathway composed of the MAPK Bck1p (12), a pair of redundant MAPKs, Mkk1p and Mkk2p (13), and the MAPK Mpk1p/Slt2p (13). Phosphorylated Mpk1p is translocated to the nuclei and activates the transcription factors Rlm1p and the Swi4p-Swi6p complex. These factors regulate the transcription of most genes involved in cell wall biogenesis, including those for β-1,3-glucan synthases and chitin synthases (13). In filamentous Aspergillus spp., genes encoding proteins homologous to the constituents of the yeast CWIS pathway have been identified by genome sequencing (6). However, functional analyses of individual genes revealed some differences between the CWIS pathways of yeast and filamentous fungi, e.g., in the target genes (7, 14, 15).

Among the signaling proteins, PKC plays a central role in the CWIS pathway. PKC has pleiotropic effects, including MAPK cascade activation in this pathway. Loss of Pkc1p function in S. cerevisiae results in cell lysis because of a deficiency in cell wall construction, and the Pkc1p-deficient strain grows only on osmotically supported medium (16). In filamentous fungi, no PKC deletion strains have been isolated, and thus PKC is predicted to be essential for normal growth (17–19). Because of its functional importance, PKC is a potential target of antifungal agents. PKC is essential for growth in the rice blast pathogen Magnaporthe grisea (20). Mps1p of M. grisea, a homologue of S. cerevisiae Mpk1p, is essential for pathogenicity (21). The Mps1p MAPK cascade of M. grisea regulates the transcription of the AGS1 gene, which is involved in α-1,3-glucan synthesis; this glucan is a stealth factor that conceals the cell wall of infectious hyphae and thus prevents recognition by hosts (22).

In the present study, we carried out in silico screening of a chemical library to develop a specific inhibitor of M. grisea PKC (MgPkc1p) and selected 66 out of approximately 800,000 compounds. Antifungal activities of 27 commercially available compounds of the 66 compounds were examined on plates, and the compound with the highest antifungal activity, Z-705 (Fig. 1), was selected as a candidate. To establish an in vivo evaluation system for Z-705, we used S. cerevisiae cells in which the kinase domain of native PKC was replaced with those derived from M. grisea and the model filamentous fungus Aspergillus nidulans. In this system, we analyzed the effect of Z-705 on phosphorylation levels of Mpk1p, which is phosphorylated and activated downstream of Pkc1p, and demonstrated that Z-705 is a specific inhibitor of filamentous fungal PKC. We revealed that Z-705 inhibits the growth of M. grisea and S. cerevisiae cells expressing the chimeric PKCs; the PKC inhibitory effect of Z-705 was comparable to that of staurosporine (STS), a well-known potent inhibitor of PKC.

FIG 1.

Chemical structure of Z-705.

RESULTS

In silico screening for the inhibitors of PKC of filamentous fungi.

To identify the M. grisea gene for PKC, the M. grisea genome database was searched using BLASTN with A. nidulans pkcA (AN0106) (17). The MGG_08689.6 gene (GenBank accession no. XM_003719244) showed the highest sequence identity and was designated Mgpkc1. The putative protein (1,160 amino acid residues) encoded by Mgpkc1 showed considerable sequence similarity to the C-terminal (catalytic) domain of human PKCθ (Pro362 to the C terminus; Fig. 2A). We regarded the corresponding region of MgPkc1p (Pro839 to the C terminus) as the catalytic domain (CD; Fig. 2A). Next, we modeled the structure of the MgPkc CD on the basis of the three-dimensional (3D) structures of human PKCβII, human PKCθ, and human PKCι and then performed in silico screening for MgPkc1p inhibitors (Fig. 2B). For candidates, we considered compounds that could bind to the ATP-binding pocket of MgPkc1p in docking simulations (Fig. 2B). Among 800,000 compounds, 66 structurally different compounds were selected, and the 27 of them that were commercially available were used in a growth inhibition test against M. grisea. Z-705 was most effective, with a growth inhibition rate of 54.9% at 50 μg/ml (Fig. S1). We also evaluated Z-705 binding to the purified recombinant kinase domain of human PKCα, which is classified, together with PKCβII, as a classical PKC, whereas PKCθ is classified as a novel PKC, and PKCι as an atypical PKC (23). Since PKCα is inhibited by STS, its activity can be easily evaluated. STS increased the fluorescence polarization (FP) values in a concentration-dependent manner, indicating inhibition of PKCα activity (Fig. S2). Z-705 did not affect FP values and thus did not inhibit PKCα activity (Fig. S2). No inhibitory effect of Z-705 against rice blast fungus on rice leaves was observed (Table S1). Therefore, it seemed necessary to improve Z-705 activity by its structural modification and also to develop a high-throughput screening system to evaluate the inhibitory effects of the compounds.

FIG 2.

In silico screening of fungal PKC inhibitors. (A) Alignment of the amino acid sequences of MgPkc1p and human PKCθ. Asterisk, identical residue; colon, highly similar residue; period, weakly similar residue; hyphen, deletion. (B) Three-dimensional model with ligands docked to MgPkc1p. Red, α-helix; cyan, β-sheet; white, random structure. Magenta sticks indicate seven ligands. Ligands bind along the right antiparallel β-sheet.

Construction of yeast strains expressing yeast-filamentous fungal chimeric PKC.

In comparison with S. cerevisiae, filamentous fungi usually grow slowly; it is more difficult to genetically modify them, and they have higher efficiencies of drug excretion. Therefore, we decided to construct an evaluation system using S. cerevisiae, which is, together with filamentous fungi, classified as a eumycete. We constructed S. cerevisiae strains expressing chimeric yeast-filamentous fungal PKC (YF-PKC strains), in which the kinase domain of yeast PKC was substituted with that of PKC from filamentous fungi (Fig. 3A). The yeast strains that harbored the kinase domains derived from A. nidulans, M. grisea, and S. cerevisiae were named YF-PKC_AN, YF-PKC_MG, and YF-PKC_SC, respectively. Although the YF-PKC_SC strain had the wild-type yeast PKC sequence, it was used as a control for chimeric PKCs with the same construction elements.

FIG 3.

Sensitivity of the S. cerevisiae wild-type and yeast-filamentous fungal chimeric PKC (YF-PKC) strains to Z-705. (A) Construction of YF-PKC cassettes. KanMX, Geneticin resistance marker. (B) Sensitivity to Z-705 of the S. cerevisiae wild-type (WT; strain BY4741) and YF-PKC strains (SC, MG, and AN) on plate cultures. Serial 10-fold dilutions of cell suspensions were spotted onto synthetic galactose minimal medium (SG; Gal 1%) plates containing or not containing dimethyl sulfoxide (DMSO) or Z-705, and the plates were incubated at 30°C for 60 h. (C) Sensitivity to Z-705 of the S. cerevisiae wild-type and YF-PKC strains in liquid cultures. Cells were inoculated into SG liquid medium (Gal 1%) containing DMSO or Z-705 and incubated at 30°C for 96 h. In panel C, the optical density at 660 nm (OD₆₆₀) was measured every 6 h (24 h to 96 h).

The correct integration of the cassettes was confirmed by PCR (Fig. S3A) and Southern blot analysis (Fig. S3B and C). PCR with a primer set corresponding to the upstream and downstream regions of the integrated cassette amplified a 4.5-kb fragment from the wild-type (WT; strain BY4741) genome and 6.3-kb fragments from the genomes of the YF-PKC_SC, YF-PKC_MG, and YF-PKC_AN strains (Fig. S3A-a). PCR with primers designed from the ScPkc1 gene amplified 3.5-kb fragments from the WT and YF-PKC_SC strains, but no bands were detected in the YF-PKC_MG and YF-PKC_AN strains (Fig. S3A-b). This result indicated the absence of residual ScPkc1 in YF-PKC_MG and YF-PKC_AN. PCR with primers specific to the kinase domains of M. grisea or A. nidulans amplified 3.5-kb fragments in YF-PKC_MG (Fig. S3A-c) and YF-PKC_AN (Fig. S3A-d), but not in WT or YF-PKC_SC (Fig. S3A-c and A-d).

Southern blot analysis with probe 1 (Fig. S3B) detected 6.3-kb fragments in the YF-PKC_SC, YF-PKC_MG, and YF-PKC_AN strains, but not in the WT strain (Fig. S3C, upper panel). Probe 2 (Fig. S3B) detected a 4.3-kb fragment in the WT strain (Fig. S3C, lower panel, lane 1) but 6.3-kb fragments in YF-PKC_SC, YF-PKC_MG, and YF-PKC_AN strains (Fig. S3C, lower panel, lanes 2 to 4). Unexpectedly, all strains contained 8.3-kb fragments, consistent with the presence in each genome of a region with sequence similarity to probe 2 (Fig. S3C). In addition, the correct concatenation of the integrated DNA region was confirmed by sequencing (data not shown). Taken together, the data confirmed that the cassettes for the chimeric PKCs were correctly integrated into the S. cerevisiae genome.

Test for sensitivity of the YF-PKC expressing strains to Z-705.

To assess the inhibitory effects of Z-705 on fungal PKCs in vivo, we used the WT yeast strain and the YF-PKC strains in plate and liquid cultures. In plate culture, the growth of the YF-PKC_MG and YF-PKC_AN strains was inhibited more severely by Z-705 (15.5 to 124 μM; 6.25 to 50 μg/ml) than that of the WT and YF-PKC_SC strains (Fig. 3B and S4), whereas no differences were detected between WT and the YF-PKC strains on the medium containing dimethyl sulfoxide (DMSO), which was the solvent for Z-705 (Fig. 3B and S4). Similarly, in liquid culture, the YF-PKC_MG and YF-PKC_AN strains were inhibited more severely by Z-705 in comparison with the WT and YF-PKC_SC strains, whereas no differences were detected between the WT and YF-PKC strains in the medium containing DMSO (Fig. 3C and S5).

Effect of Z-705 on mRNA level of the downstream PKC target, MLP1, in S. cerevisiae expressing YF-PKCs.

To elucidate the specific inhibitory effect of Z-705 on fungal PKCs, we used the YF-PKC strains to analyze the mRNA levels of a gene whose transcription is under the control of CWIS downstream of PKC. In the CWIS pathway of S. cerevisiae, Pkc1p regulates the mRNA level of MLP1, which encodes a paralog of the MAPK Mpk1p (9). The mRNA level of S. cerevisiae MLP1 is also upregulated by treatment with the β-1,3-glucan synthase inhibitor micafungin (MCFG) (7). When the mRNA level of MLP1 is increased by cell wall stress (7), MLP1 mRNA level should be decreased if PKC activity is inhibited by Z-705. Thus, we used the mRNA levels of MLP1 as a proxy for the effect of Z-705 on chimeric PKCs. Quantitative reverse transcription-PCR (qRT-PCR) analysis revealed that treatment with 1% DMSO, which was used as the solvent for both MCFG and Z-705, increased the MLP1 mRNA level (Fig. S6A and B) regardless of the 5 μg/ml MCFG treatment (Fig. S6B). Therefore, we concluded that DMSO induces cell wall stress and stimulated the cells with DMSO. The MLP1 mRNA levels were increased by treatment with 1% DMSO for 30 min; the increase was greater in the WT and YF-PKC_SC strains than in the YF-PKC_MG and YF-PKC_AN strains (Fig. S6A). The addition of 124 μM Z-705 suppressed the DMSO-dependent increase in MLP mRNA levels in all four strains (Fig. S6A). When the cells were treated with 5% DMSO, the increased levels of MLP1 mRNA were similar in all four strains (Fig. 4). The addition of 15.5 μM Z-705 significantly suppressed the DMSO-dependent upregulation of the MLP1 mRNA in only the YF-PKC_MG and YF-PKC_AN strains (Fig. 4). This result suggested that Z-705 specifically inhibited the activity of filamentous fungal chimeric PKCs, suppressing DMSO-dependent upregulation of the MLP1 mRNA.

FIG 4.

Inhibition of MLP1 mRNA level by Z-705. Induction of the MLP1 transcript by cell wall stress is inhibited by Z-705. The wild-type (WT; BY4741) and YF-PKC (SC, MG, and AN) strains were incubated in SG (Gal 1%) containing 5% DMSO or 15.5 μM Z-705 for 30 min. The mRNA levels were determined by quantitative reverse transcription-PCR (RT-PCR) using specific primers (Table 2). Each value represents the ratio of MLP1 expression relative to that of RPL28S in each strain. *, P < 0.05; **, P < 0.01 (Student's t test).

Effect of Z-705 on phosphorylation levels of MAPK Mpk1p in the YF-PKC strains.

To evaluate the effect of Z-705 on the downstream signaling pathway of PKC, we analyzed the phosphorylation levels of Mpk1p. In the CWIS pathway of S. cerevisiae, Mpk1p acts downstream of PKC, and Mpk1p phosphorylation is regulated by PKC activation (9). In addition, the levels of Mpk1p phosphorylation in S. cerevisiae are increased after treatment with Congo red (CR), indicating that CR activates the CWIS pathway (24–26). We analyzed the levels of Mpk1p phosphorylation in yeast cells expressing chimeric PKCs by Western blot analysis with anti-phospho-p44/42 antibody. CR treatment increased the levels of phosphorylated Mpk1p in the WT and in all YF-PKC strains (Fig. 5A, left panel). Z-705 (7.77 μM; 3.125 μg/ml) suppressed the CR-induced hyper-activation of Mpk1p only in the YF-PKC_MG and YF-PKC_AN strains (Fig. 5A, right panel), suggesting that Z-705 specifically inhibited the activity of the filamentous fungal PKC and suppressed Mpk1p activation.

FIG 5.

Inhibition of Mpk1p phosphorylation by Z-705 and STS. (A) Mpk1p phosphorylation is inhibited by Z-705. The wild-type (WT; BY4741) and YF-PKC (SC, MG, and AN) strains were incubated in yeast extract-peptone-dextrose (YPD) medium containing 1% DMSO (solvent for Z-705) or 7.77 μM Z-705 for 30 min and then transferred for 60 min to YPD medium containing 100 μg/ml Congo red (CR). Mpk1p phosphorylation was detected by immunoblotting with anti-phospho-p44/42 MAPK antibody; anti-Mpk1p antibody was used to detect Mpk1p regardless of phosphorylation (loading control); H2A, histone H2A. Ctrl indicates the standard sample, which was obtained from the WT treated with CR and used throughout this study. (B) Mpk1p phosphorylation is inhibited by STS. Cells were incubated in YPD medium containing 1% DMSO (solvent for STS) or 6.70 μM STS at 30°C for 30 min and then transferred for 60 min to YPD medium containing 100 μg/ml Congo red (CR). Mpk1p phosphorylation was detected as described above.

Effect of staurosporine on Mpk1p phosphorylation in the YF-PKC strains.

We compared the effects of Z-705 and STS, which inhibits a wide range of PKCs (from eukaryotic microorganisms to humans [27–29]), on Mpk1p phosphorylation in yeast strains treated with CR to stimulate CWIS. Phosphorylation of Mpk1p in the wild-type strain and all YF-PKC strains was suppressed by STS (6.70 μM; 3.125 μg/ml; Fig. 5B), whereas lower concentrations of STS had no such effect (Fig. S7).

Effect of Z-705 and STS on mRNA levels of the AGS1 gene in M. grisea.

To evaluate whether Z-705 inhibits PKC of M. grisea in vivo, we assessed mRNA levels of the AGS1 gene in M. grisea cells treated with Z-705. This gene encodes α-1,3-glucan synthase and is regulated via the Mps1p (an ortholog of Mpk1p of S. cerevisiae and MpkA of A. nidulans) MAPK cascade in the CWIS pathway (22). Because MCFG induces cell wall stress and increases the mRNA level of A. nidulans agsB, which is an ortholog of AGS1 of M. grisea (7, 30), we treated M. grisea mycelia with MCFG and analyzed the AGS1 mRNA level by qRT-PCR. Treatment with MCFG (0.01 μg/ml for 24 h) markedly upregulated the AGS1 mRNA levels (Fig. 6A, left panel); surprisingly, it also clearly induced melanization of mycelia (Fig. 6B). Cotreatment with Z-705 (62.2 or 124 μM) and MCFG (0.01 μg/ml) for 24 h decreased the levels of the AGS1 mRNA by one-half or two-thirds, respectively (Fig. 6A, left panel). MCFG-induced melanization was suppressed by 124 μM Z-705 (Fig. 6B). Likewise, the induction of the AGS1 mRNA and melanization induced by MCFG were suppressed by STS at 107 μM but not 53.6 μM (Fig. 6).

FIG 6.

Inhibitory effects of Z-705 and STS on AGS1 gene expression and hyphal melanization in M. grisea, induced by cell wall stress. (A) Mycelia of the wild-type strain (Guy11) were incubated in complete medium (CM) containing 0 (−) or 0.01 (+) μg/ml MCFG (MCFG), with or without 1% DMSO or with or without the indicated concentration of Z-705 or STS for 24 h. AGS1 mRNA levels were determined by quantitative RT-PCR using specific primers (Table 2). (B) Melanization in the wild-type M. grisea Guy11 strain in liquid culture. Cells were cultured in CM in the absence or presence of 0.01 μg/ml MCFG, with or without 1% DMSO, or with 1% DMSO and the indicated concentrations of Z-705 or STS, for 24 h.

Effect of Z-705 and STS on mRNA levels of the genes involved in melanin biosynthesis in M. grisea.

Genes encoding 1,3,6,8-tetrahydroxy-naphthalene reductase (4HNR), trihydroxy-naphthalene reductase (3HNR), and scytalone dehydratase (SCD1) are involved in the biosynthesis of 1,8-dihydroxynaphthalene (DHN) melanin in several plant pathogens, including M. grisea (31–34), and are regulated by orthologs of Mps1p (21, 31). We hypothesized that the 4HNR, 3HNR, and SCD1 transcripts are under the control of the PKC pathway in M. grisea, and we used qRT-PCR to analyze their levels in mycelia treated with or without Z-705 or STS. The mRNA levels of the three genes were upregulated by MCFG (Fig. 7). Cotreatment with MCFG (0.01 μg/ml) and Z-705 (62.2 or 124 μM) or STS (53.6 or 107 μM) for 24 h significantly suppressed the mRNA levels of the three genes (Fig. 7).

FIG 7.

Expression of the melanin biosynthesis genes SCD1, 3HNR, and 4HNR in M. grisea. Mycelia of the wild-type strain (Guy11) were incubated in CM containing 0.01 μg/ml MCFG and 1% DMSO, without or with the indicated concentrations of Z-705 or STS for 24 h. The mRNA levels were determined by quantitative RT-PCR using specific primers (Table 2). Expression is shown relative to that of the ACTIN gene under each condition. *, P < 0.05; **, P < 0.01 (Tukey’s multiple-comparison test).

Effect of Z-705 on mRNA levels of genes involved in α-1,3-glucan and melanin biosynthesis in A. nidulans.

To evaluate whether Z-705 inhibits PKC of A. nidulans in vivo, we treated A. nidulans mycelia with MCFG (0.01 μg/ml for 24 h) and analyzed the agsB mRNA level by qRT-PCR. Surprisingly, this treatment reduced the agsB mRNA level (Fig. S8A), whereas cotreatment with MCFG and Z-705 (62.2 or 124 μM) restored it (Fig. S8A).

Magnaporthe grisea produces DHN-melanin, whereas A. nidulans produces 3,4-dihydroxyphenylalanine (DOPA) melanin (35). Tyrosinase encoded by melB is involved in the biosynthesis of DOPA-melanin in Aspergillus oryzae (36). We used qRT-PCR to evaluate whether Z-705 affects the mRNA level of the melB ortholog in A. nidulans (AN7060). The mRNA level of the gene was increased by MCFG but reduced by cotreatment with MCFG and Z-705 (15.5 to 124 μM) for 24 h (Fig. S8B).

DISCUSSION

In the present study, using S. cerevisiae cells expressing yeast-filamentous fungal chimeric PKCs, we demonstrated that Z-705 (Fig. 1), a candidate antifungal compound, selectively inhibited PKCs of filamentous fungi. The inhibitory effect of Z-705 was comparable to that of STS. The lack of differences in the growth rate among the S. cerevisiae wild type and three YF-PKC strains in the medium containing DMSO (Fig. 3B and C) indicated that YF-PKCs complemented PKC of S. cerevisiae. Z-705 inhibited the growth of the strains YF-PKC_MG (kinase domain from M. grisea) and YF-PKC_AN (kinase domain from A. nidulans) more strongly than that of the WT and YF-PKC_SC strains (Fig. 3B and C), suggesting that Z-705 was selective against PKCs from filamentous fungi. Z-705 delayed the entry to exponential growth of the strains YF-PKC_MG and YF-PKC_AN but had no obvious effect on growth rate in the exponential phase or on cell density (Fig. 3C). Although the reason why Z-705 does not strongly inhibit growth is unknown, there may be a mechanism to overcome the inhibition of PKC by Z-705. Further study of the relationship between PKC inhibition by Z-705 and its effect on growth is needed.

We found that the solvent DMSO induced cell wall stress and increased the levels of MLP1 mRNA (Fig. 4 and S6A), which encodes a downstream effector of PKC. Even a low concentration of Z-705 (15.5 μM) suppressed the increased MLP1 mRNA level in the YF-PKC_MG and YF-PKC_AN strains only (Fig. 4). This suggests that Z-705 has a greater affinity for the kinase domain derived from the filamentous fungi than for that from S. cerevisiae. The analysis of Mpk1p phosphorylation also revealed that Z-705 was selective against strains harboring YF-PKCs (Fig. 5A). The effective concentration of Z-705 was lower in the Mpk1p phosphorylation analysis than in the analysis of MLP1 mRNA levels, possibly because the activation of the MAPK cascade (Bck1p-Mkk1/2p-Mpk1p) is directly regulated by PKC (9) and is particularly susceptible to the effects of PKC inhibition.

Although both Z-705 and STS inhibited fungal PKCs, Z-705 was selective against PKCs from filamentous fungi. The amino acid sequence identity between the kinase domains of M. grisea MgPkc1p and A. nidulans PkcA is approximately 90%, and that between the kinase domains of S. cerevisiae Pkc1p and those of PKCs of filamentous fungi is approximately 70%. These differences in the primary structure, in particular in the ATP-binding pocket, may cause the difference in affinity for Z-705.

In M. grisea, the β-1,3-glucan synthase inhibitor MCFG increased the mRNA level of AGS1, which encodes an α-1,3-glucan synthase (Fig. 6A). This effect indicated that MCFG induced cell wall stress and activated the CWIS pathway, which increased the level of the AGS1 mRNA via the Mps1p MAPK cascade. The MCFG-induced upregulation of the AGS1 mRNA was suppressed by treatment with Z-705 (62.2 or 124 μM) or STS (53.6 or 107 μM) (Fig. 6A). These results suggest that the inhibitory effect of Z-705 on PKC activity in M. grisea is comparable to that of STS, and that PKC regulates the Mps1p MAPK cascade in M. grisea. The inhibitory concentration of Z-705 for PKC activity in M. grisea was approximately 4 times that required to suppress the DMSO-induced upregulation of the MLP1 mRNA in S. cerevisiae YF-PKC strains. Comprehensive transcriptomic analysis of M. grisea cells using RNA sequencing revealed that Z-705 upregulated the transcripts of many genes encoding drug efflux transporters and cytochrome p450 oxidoreductases, which are likely involved in detoxification (Table S2). The exposure of hyphae to Z-705 may induce drug efflux and detoxification systems; consequently, the inhibitory effect of Z-705 might be lower in filamentous fungi in vivo than in S. cerevisiae expressing chimeric PKCs.

MCFG transiently upregulates the mRNA level of agsB (an A. nidulans gene for α-1,3-glucan synthase), which returns to the basal level by 120 min after the onset of MCFG treatment (7). Long-term (24 h) treatment of A. nidulans with MCFG decreased the agsB mRNA level (Fig. S8A), probably because of the potent growth inhibition by MCFG. For an unknown reason, Z-705 prevented this decrease (Fig. S8A). Further study of the relationship between agsB expression and PKC inhibition by Z-705 is necessary. MCFG-induced upregulation of the mRNA level of AN7060 (Fig. S8B), which is likely involved in DOPA-melanin biosynthesis in A. nidulans (35, 36), was also suppressed by Z-705 (Fig. S8B), suggesting that inhibition of PKC by Z-705 would affect melanization in A. nidulans, as it does in the case of M. grisea.

Melanization of the appressorium is required for pathogenicity of M. grisea (37). In the present study, we observed the induction of hyphal melanization by MCFG treatment in M. grisea and the suppression of this effect by high concentrations of Z-705 or STS (Fig. 6B). To elucidate the relationships between PKC inhibition and the suppression of melanization, we analyzed the mRNA levels of 4HNR, 3HNR, and SCD1, which are involved in melanin biosynthesis in plant-pathogenic fungi (31–33). We found that the MCFG-dependent upregulation of the three mRNA levels was suppressed by both Z-705 and STS (Fig. 7). The expression of melanin biosynthetic genes is regulated by the transcription factor Pig1p via Mps1p MAPK (32). On the basis of this previous report and our results, we hypothesized that PKC activates the Mps1p MAPK cascade and that the expression of 4HNR, 3HNR, and SCD1 is regulated by Pig1p via Mps1p. A signaling model is shown in Fig. 8. Cell wall α-1,3-glucan acts as a stealth factor in M. grisea by blocking host recognition of fungal invasion and is required for infection of live rice cells (22, 38). The transcription of the AGS1 gene, which encodes α-1,3-glucan synthase, is regulated by the transcription factor Rlm1p via the MAPK Mps1p, and upstream MAPK signaling in the CWIS pathway is regulated by PKC in M. grisea (Fig. 8; 22, 38). Because PKC regulates both melanization and α-1,3-glucan biosynthesis via the MAPK cascade, PKC is directly or indirectly associated with pathogenicity in this fungus. In conclusion, PKC is a promising target for antifungal drugs, and Z-705, which inhibits PKC activity, is a candidate fungicide for agricultural use. Improvement of antifungal activity of Z-705 by chemical modification is necessary and is under way.

FIG 8.

Model of cell wall integrity signaling in M. grisea. Pkc1 activates the Mps1 MAPK cascade, and the expression of the 4HNR, 3HNR, and SCD1 genes is regulated by the transcription factor Pig1 via Mps1 (31). 4HNR, 3HNR, and SCD1 are involved in melanin biosynthesis and are essential for infection (37). The expression of the AGS1 gene is predicted to be regulated by the transcription factor Rlm1 via Mps1. Ags1p synthesizes α-1,3-glucan, which acts as a stealth factor in M. grisea by blocking host recognition of fungal invasion and is required for fungal infection of live rice cells (22, 38). The fact that expression of both melanin and α-1,3-glucan biosynthetic genes is regulated by PKC in M. grisea suggests that PKC is directly or indirectly associated with the pathogenicity of this fungus (see details in the Discussion).

MATERIALS AND METHODS

Strains, media, and growth conditions.

Saccharomyces cerevisiae BY4741 (MATa; his3Δ1; leu2Δ0; met15Δ0; ura3Δ0) was used as the wild-type strain (a kind gift from Kentaro Furukawa, University of Gothenburg, Sweden). All chimeric-PKC strains were derived from BY4741. All S. cerevisiae strains were grown in yeast extract-peptone-dextrose (YPD; 1% yeast extract, 2% bactopeptone, and 2% glucose) or in synthetic galactose minimal medium (SG; 0.17% yeast nitrogen base without amino acids or ammonium sulfate, 0.5% ammonium sulfate, 0.07% drop-out mix supplement, and 1% galactose) at 30°C. Magnaporthe grisea Guy11 (a kind gift from Marie Nishimura, National Agriculture and Food Research Organization, Japan) was used as a wild-type strain (39) and was grown in complete medium (CM, [40]) at 24°C in constant darkness. A wild-type A. nidulans strain (FGSC A4) was obtained from the Fungal Genetics Stock Center and was grown in Czapek-Dox medium (7). To test the growth-inhibitory effect of the chemicals, including Z-705, against M. grisea, potato dextrose agar medium (PDA; Becton, Dickinson and Company, Sparks, MD) was used.

In silico screening.

The model of the three-dimensional structure of MgPkc1p CD was constructed by using the PDFAMS Ligand and Complex modules (In-Silico Sciences, Inc.) on the basis of the crystal structures of the A chain of human PKCβII complexed with a bisindolylmaleimide inhibitor (Protein Data Bank [PDB] identifier [ID] 2I0E), the A chain of the kinase domain of human PKCθ in complex with NVP-XAA228 at a 2.32-Å resolution (PDB ID 2JED), and the A chain of the kinase domain of atypical human PKCι (PDB ID 1ZRZ) as the templates. The model constructed using the A chain of 2JED, which has fewer atomic contacts between the ligand and the protein than in the other templates, was used for in silico screening. In silico prescreening using the ChooseLD method was run for 7,806 drugs in the Comprehensive Medicinal Chemistry database (2007 edition; http://www.akosgmbh.de/accelrys/databases/cmc-3d.htm), using seven ligands as fingerprints. Then, we selected the predicted docking structures of 36 drugs that were estimated to fit best into the active site without short contact (close and repulsive contact) between one atom of the ligand and another atom of the PKC receptor. Using the docking structures of LG8_A_1701 in 2JED_A and the 36 drugs as fingerprints, in silico screening by the ChooseLD method was run for 19,743 compounds with a Tanimoto coefficient of 60% or more and a molecular weight (MW) of 350 to 600 that were selected from the approximately 800,000 compounds in the Available Chemicals Directory database (2008, 2nd edition; http://www.akosgmbh.de/accelrys/databases/acd.htm). As a result, 66 compounds with high fingerprint alignment scores (numbers of collision atoms less than 2.0 Å ≤ 1, less than 2.2 Å ≤ 3, and less than 2.4 Å ≤ 5; 400 ≤ molecular weight [MW] ≤ 600; 0 ≤ logP (partition coefficient) ≤ 5; 2 ≤ number of rings ≤ 10; 0 ≤ number of donor atoms per hydrogen bond ≤ 5; 0 ≤ number of accepting atoms per hydrogen bond) ≤ 10; total Lennard-Jones potential ≤ 1.0E+02; presence of nitrogen or oxygen atoms within 1.5 Å from atomic coordinates LG8L_5#O2 and LG8L_5#O1 and within 2.5 Å from LG8L_5#N2) were selected. The antifungal activities of 27 compounds that were commercially available were evaluated against the rice blast fungus. Among them, the compound with the highest inhibitory effect on growth was Z-705.

Evaluation of the control value of Z-705.

Rice seedlings at 4-leaf stage grown in 7.5-cm pots were sprayed with the tested agents (50 μg/ml, diluted from a 5-mg/ml stock solution in DMSO) supplemented with 0.033% spreader (Kumiten; Kumiai Chemical Industry Co., Ltd., Tokyo, Japan). Seedlings sprayed with DMSO solution (1%) were used as untreated controls. BEAMzol (tricyclazole wettable powder; Kumiai Chemical Industry Co., Ltd.) was used as the control agent. After air drying, a liquid conidial suspension of M. grisea (1 × 10⁵ cells/ml supplemented with 0.02% Kumiten) was used to spray the seedlings. The inoculated plants were incubated in a chamber with high humidity (100%) at 25°C in the dark for 24 h and then transferred to a greenhouse with high humidity (100%) and incubated for 5 days. Then, the lesions on 10 leaves per pot were counted, and the control value, which was used to express the disease inhibitory activity, was calculated using the following equation:

$$\text{control value}\left(\%\right)\hspace{0.17em}=\hspace{0.17em}\left(1–\frac{\text{average number of lesions on treated plants}}{\text{average number of lesions on untreated plants}}\right)\times 100$$

Synthesis of Z-705.

Initially, Z-705 was obtained from Peakdale Molecular, Ltd. (Peakdale Science Park, Manchester, UK), but its production was suspended during our study. Therefore, we synthesized Z-705 via the following three steps.

(i) Synthesis of compound 2, (1-(2-(trifluoromethyl)-1,6-naphthyridin-5-yl)piperidin-4-yl)methanol.

To a stirred solution of 5-chloro-2-(trifluoromethyl)-1,6-naphtidine (compound 1, Fig. S9) (83.0 mg, 0.357 mmol, prepared by using a reported procedure [41]) and 4-piperidinemethanol (61.7 mg, 0.536 mmol) in dry 1,4-dioxane (2.5 ml) was added N,N-diisopropylethylamine (91.9 μl, 68.9 mg, 0.533 mmol) at room temperature under nitrogen atmosphere. After 3 h of refluxing, the mixture was cooled to room temperature and poured into water. The resulting aqueous phase was extracted with ethyl acetate (EtOAc), and the extract was dried over sodium sulfate and filtered. The filtrate was concentrated by evaporation. The residue was purified by silica gel column chromatography (hexane:EtOAc, 1:1) to give 87.8 mg (79%) of compound 2 (Fig. S9).

(ii) Synthesis of compound 3, 5-(4-(bromomethyl)piperidin-1-yl)-2-(trifluoromethyl)-1,6-naphthyridine.

To a stirred solution of compound 2 (Fig. S9) (5.00 g, 16.1 mmol) in dry dichloromethane (80 ml) were successively added carbon tetrabromide (10.6 g, 32.1 mmol) and triphenylphosphine (8.47 g, 32.3 mmol) at 0°C under nitrogen atmosphere. The mixture was stirred overnight at room temperature and was then poured into water. The resulting aqueous phase was extracted with ethyl acetate, and the extract was washed with saturated aqueous sodium chloride, dried over magnesium sulfate, and filtered. The filtrate was concentrated by evaporation. The residue was purified by silica gel column chromatography (hexane:EtOAc, 10:1) to give 3.87 g (64%) of compound 3 (Fig. S9).

(iii) Synthesis of compound 4, Z-705.

To a stirred suspension of sodium hydride (2.00 g, 50.0 mmol; 60% dispersion in liquid paraffin) in dry dimethylformamide (DMF) (160 ml) was added N-methyl-2-aminopyrimidine (8.00 g, 73.3 mmol) at 0°C under nitrogen atmosphere; the mixture was then stirred at room temperature. After 45 min, compound 3 (Fig. S9) (14.0 g, 37.4 mmol) was added to the mixture at 0°C, and then the mixture was warmed to 50°C, stirred for 2 h at 50°C, and poured into cold water. The resulting aqueous phase was extracted with ethyl acetate, and the extract was washed with saturated aqueous sodium chloride, dried over magnesium sulfate, and filtered. The filtrate was concentrated by evaporation. The residue was purified by silica gel column chromatography (hexane:EtOAc, 1:1) to give 5.40 g (36%) of Z-705 (Fig. 1 and Fig. S9, compound 4).

Testing Z-705 by in vitro kinase assay of human PKCα.

The reaction mixture (10 μl) contained 1 μl (0.1 ng) human PKCα (Invitrogen, Carlsbad, CA) in FP buffer (10 mM HEPES, 5 mM dithiothreitol (DTT), 0.01% CHAPS [3-[(3-cholamidopropyl)-dimethylammonio]-1-propanesulfonate]; pH 7.4), 1 μl of 1 μM PKC peptide substrate (RFARKGSLRQKNV; Invitrogen), 2 μl of 0.5 mg/ml phosphatidylserine (Sigma-Aldrich, Steinheim, Germany) in PS buffer (for dissolving phosphatidyl serine; 10 mM HEPES, 0.3% Triton X-100; pH 7.4), 2 μl of staurosporine (PKCα inhibitor; 0.01 ng/ml to 100 μg/ml) or Z-705, 2 μl of 5 × kinase buffer (100 mM HEPES, 4.25 mM MgCl₂, 0.5 mM CaCl_2, 0.1% Brij35; pH 7.4), and 2 μl of 25 μM ATP. The mixture was incubated for 1 h at 24°C, and the reaction was stopped with 10 mM EDTA. Then, 5 μl of anti-pSer(PKC) antibody (Invitrogen), 2 μl of PKC Far Red tracer (Invitrogen), and 3 μl of FP buffer were added. The mixture was incubated for 1 h at 24°C and transferred to 384-well glass-bottomed plates. The FP values were measured by fluorescence intensity distribution analysis-polarization (FIDA-PO) using a single-molecule fluorescence detection system, MF-20 (Olympus, Tokyo, Japan).

Isolation of genomic DNA from S. cerevisiae.

Genomic DNA was extracted from S. cerevisiae cells frozen in liquid nitrogen. Frozen cells were resuspended in 2 ml of solution I (1 M sorbitol, 100 mM EDTA; pH 8.0) containing 10 mg/ml Zymolyase (Nacalai Tesque, Kyoto, Japan), incubated at 37°C for 30 to 60 min, and centrifuged at 16,873 × g for 1 min. The pellet was resuspended in 2 ml of solution II (50 mM Tris-HCl, 20 mM EDTA; pH 8.0) and 200 μl of 10% SDS solution, and the suspension was incubated at 65°C for 30 min. Then, 800 μl of 5 M CH₃COOK was added, and the mixture was incubated on ice for 30 to 60 min and centrifuged at 16,873 × g for 10 min. A 1/10 volume of 3 M CH₃COONa and an equal volume of 2-propanol were added to the supernatant. After 5 min at room temperature, the mixture was centrifuged at 16,873 × g at 4°C for 20 min. The pellet was rinsed with 80% ethanol, dried, and dissolved in Tris-EDTA (TE) buffer (10 mM Tris-HCl, 1 mM EDTA; pH 8.0).

Construction of yeast-filamentous fungal chimeric (YF-chimeric) PKC cassettes.

We followed a modular cloning strategy (42). DNA fragments were amplified from yeast or filamentous fungal DNA or plasmid DNA by PCR with PrimeSTAR hot-start (HS) DNA polymerase (TaKaRa, Tokyo, Japan) and the primers listed in Table 1. First, we constructed the following fragments. A fragment containing the entire PKC open reading frame was amplified from genomic DNA of S. cerevisiae using the primers KpnI-ScPkc1-F and ScPkc1-SphI-R (Fig. 3A, fragments A and B). Fragments corresponding to the regulatory domain of PKC, which overlap the kinase domains of M. grisea PKC and A. nidulans PKC (fragment A, Fig. 3A), were amplified from genomic DNA of S. cerevisiae using the primers KpnI-ScPkc1-F and ScPkc1-MgPkc1kinase-R or ScPkc1-AnPkcAkinase-R. Fragments containing the kinase domains of M. grisea PKC and A. nidulans PKC (fragment B, Fig. 3A) were amplified, respectively, from the plasmid pYES2-MgPkc1 using the primers ScPkc1-MgPkc1kinase-F and MgPkc1-NotI-R and from the plasmid pYES2-AnPkcA using the primers ScPkc1-AnPkcAkinase-F and PkcA-XhoI-R. Fragments containing the ADH1 terminator-KanMX6 cassette (fragment C, Fig. 3A) were amplified from the plasmid pFA6A-3HA-kanMX6 (a kind gift from Takahiro Shintani, Tohoku University) using the primer sets ScPkc1-KanMX6-F and ScPkc1-KanMX6-R, MgPkc1-KanMX6-F and ScPkc1-KanMX6-R, or AnPkcA-KanMX6-F and ScPkc1-KanMX6-R (Table 1). The 3′-flanking region (500 bp downstream from the PKC1 stop codon) of the S. cerevisiae PKC (fragment D, Fig. 3A) was amplified from genomic DNA using the primers KanMX6-3FL-F and ScPkc1-R (Table 1). To connect the regulatory domain of S. cerevisiae PKC (fragment A) and the kinase domain of PKC of M. grisea or A. nidulans (fragment B), fusion PCR was used with the primers KpnI-ScPkc1-F and ScPkc1-MgPkc1kinase-R or ScPkc1-AnPkcAkinase-R, respectively. Similarly, fragments C and D were fused by PCR using the primer sets ScPkc1-KanMX6-F and ScPkc1-R, MgPkc1-KanMX6-F and ScPkc1-R, or AnPkcA-KanMX6-F and ScPkc1-R. The resulting fragments AB and CD were fused by PCR using the primers SacI-ScPkc1-F and ScPkcI-NotI-R. The resulting chimeric PKC cassettes were subcloned into pYES2, and the sequences were confirmed. The cassettes were amplified by PCR from the plasmids using the primers SacI-ScPkc1-F and ScPkcI-NotI-R, and were introduced into S. cerevisiae BY4741 by the lithium acetate method (43). The transformants in which the native PKC locus was replaced with the chimeric PKC cassettes were selected on YPD agar containing G418 at 30°C for 5 days.

TABLE 1.

Primers used for construction of YF-PKC strains

Primer no.	Primer name	Sequence (5′ to 3′)
1	KpnI-ScPkc1-F	CCCGGTACCATGAGTTTTTCACAATTGGAG
2	ScPkc1-SphI-R	ATGTGCATGCTCATAAATCCAAATCATCTGG
3	ScPkc1-MgPkc1kinase-R	GCCAAGAAGTTGAAGTGGTCAAGTGAAACCTTACGACGTTTAGCCG
4	ScPkc1-AnPkcAkinase-R	AGCAAGGAAGTTGAAGTGGTCCAGTGAAACCTTACGACGTTTAGCCG
5	ScPkc1-MgPkc1kinase-F	CGGCTAAACGTCGTAAGGTTTCACTTGACCACTTCAACTTCTTGGC
6	MgPkc1-NotI-R	TTTTCCTTTTGCGGCCGCTCAATCAAAGTCTGCCGTG
7	ScPkc1-AnPkcAkinase-F	CGGCTAAACGTCGTAAGGTTTCACTGGACCACTTCAACTTCCTTGCT
8	PkcA-XhoI-R	CCGCTCGAGCTAAGCAAAATCCGCGGTG
9	ScPkc1-KanMX6-F	GCCAGATGATTTGGATTTATGAGGCGCGCCACTTCTAAATAAG
10	ScPkc1-KanMX6-R	CATGGCATGACCTTTTCTCAGTATAGCGACCAGCATTC
11	MgPkc1-KanMX6-F	CGTACACGGCAGACTTTGATTGAGGCGCGCCACTTCTAAATAAG
12	AnPkcA-KanMX6-F	CGTACACCGCGGATTTTGCTTAGGGCGCGCCACTTCTAAATAAG
13	KanMX6-3FL-F	GAATGCTGGTCGCTATACTGAGAAAAGGTCATGCCATG
14	ScPkc1-R	GTCCATTTATGCCGTATGTG
15	SacI-ScPkc1-F	GCGGAGCTCAGACCGCTCAACAAAGTCAG
16	ScPkcI-NotI-R	TTTTCCTTTTGCGGCCGCACTCTCGCGGATTTGATAGC
17	probe1-F	GAGGCCGCGATTAAATTCCAAC
18	probe1-R	CATGGCATGACCTTTTCTCAGTATAGCGACCAGCATTC
19	probe2-F	GGTAAACTGATTCACGCTAGAAG
20	probe2-R	CCGATATTACTATTCATGATTGCG

Correct integration of each cassette was confirmed by Southern blot analysis. Genomic DNA of each chimeric strain was digested with XbaI. Fragments were separated on agarose gels and transferred onto membranes, which were then hybridized with digoxigenin-labeled specific probes (Fig. S4B); the probes were amplified by PCR using the primers listed in Table 1 and were labeled by using a digoxigenin (DIG)-High Prime DNA labeling and detection starter kit I (Roche Applied Science, Mannheim, Germany).

Testing sensitivity to Z-705 on solid medium.

Wild-type BY4741 and S. cerevisiae strains expressing YF-chimeric PKC (YF-PKC_SC, YF-PKC_MG, and YF-PKC_AN strains) were precultured to an optical density at 660 nm (OD₆₆₀) of 0.7 to 0.8 in 5 ml of YPD or YPD with G418 (final concentration 200 μg/ml) liquid medium at 30°C with shaking at 160 rpm. Cells were inoculated in 50 ml of YPD liquid medium and were grown to an OD₆₆₀ of 0.8 at 30°C with shaking at 160 rpm, collected by centrifugation, and washed with SG liquid medium. Ten-fold serial dilutions of cell suspensions starting at the indicated concentrations (10² to 10⁵ cells/ml; Fig. 3B and S4) were prepared in sterile SG medium. Each cell suspension was spotted onto SG medium and SG medium supplemented with DMSO (final concentration, 1%) or Z-705 (final concentrations, 3.89 to 124 μM). Z-705 was added to media from 100-fold concentrated stock solutions in DMSO. Although Z-705 is not soluble at 124 μM and the medium becomes cloudy, Z-705 is soluble at 62.2 μM and lower concentrations. The addition method was the same regardless of whether solid or liquid medium was used. The plates were incubated at 30°C for 60 h.

Testing sensitivity to Z-705 in liquid medium.

The BY4741, YF-PKC_SC, YF-PKC_MG, and YF-PKC_AN strains were precultured, inoculated, grown, collected, and washed as above. Suspensions were diluted to 2 × 10² cells/μl with SG; 5 μl of each suspension (1 × 10³ cells in total) was added to 200 μl of SG medium with DMSO (final concentration, 1%) or Z-705 (final concentrations, 3.89 to 124 μM) in a 96-well microplate. The plate was incubated at 30°C for 96 h, and OD₆₆₀ was measured every 6 h.

Preparation of total RNA from S. cerevisiae.

The BY4741, YF-PKC_SC, YF-PKC_MG, and YF-PKC_AN strains were precultured, inoculated, grown, collected, and washed as above. Cells were suspended to an OD₆₆₀ of 2.0 in SG liquid medium. Each suspension (5 ml) was added to 5 ml SG with DMSO (final concentration, 1% or 5%) or Z-705 (final concentrations, 3.89 to 124 μM). Each culture was grown at 30°C with shaking at 160 rpm for 30 min. The cells were then collected and immediately frozen in liquid nitrogen. Cells of each strain were obtained from three independent cultures and were used for RNA isolation and subsequent cDNA synthesis (three biological replicates). Total RNA was extracted from frozen cells according to Collart and Oliviero (44).

Preparation of total RNA from M. grisea.

Magnaporthe grisea mycelia were precultured in 5 ml liquid CM at 24°C with shaking at 125 rpm for 24 h. Mycelia were homogenized with a hand mixer (Braun Household, Hampshire, UK), inoculated in 100 ml of CM, and cultured at 24°C with shaking at 125 rpm for 24 h. Mycelia were filtered through Miracloth (EMD Millipore Corp., Billerica, MA) and divided into 14 equal parts, and wet weight was measured. Then, the mycelia were transferred to liquid CM containing 0.01 μg/ml MCFG and 15.5 to 124 μM Z-705 or 13.4 to 107 μM STS or 0.1% DMSO and grown at 24°C with shaking at 125 rpm for 24 h. Mycelia were filtered through Miracloth, blotted with filter paper to remove excess medium, frozen in liquid nitrogen, and ground into a fine powder with a mortar and pestle chilled with liquid nitrogen. Mycelia obtained from three independent cultures were used for RNA isolation and subsequent cDNA synthesis (three biological replicates). Total RNA was isolated from the powdered mycelia using Sepasol-RNA I Super (Nacalai Tesque).

Preparation of total RNA from A. nidulans.

Conidia (5 × 10⁷ cells) of the A. nidulans wild-type strain (FGSC A4) were inoculated into 100 ml of liquid Czapek–Dox medium and were cultured at 37°C with shaking at 160 rpm for 24 h. Mycelia were filtered through Miracloth (EMD Millipore), and wet weight was measured. Then, the mycelia (100 mg wet weight) were transferred to 50 ml of liquid Czapek-Dox medium containing 0.01 μg/ml MCFG and 15.5 to 124 μM Z-705 or 0.1% DMSO and were grown at 37°C with shaking at 160 rpm for 24 h. Mycelia were filtered through Miracloth, blotted with filter paper to remove excess medium, frozen in liquid nitrogen, and ground into a fine powder with a mortar and pestle chilled with liquid nitrogen. Mycelia obtained from two independent cultures were used for RNA isolation and subsequent cDNA synthesis (two biological replicates). Total RNA from the powdered mycelia was isolated using Sepasol-RNA I Super (Nacalai Tesque).

Quantitative reverse transcription-PCR.

Total RNA (2 μg) from S. cerevisiae, M. grisea, and A. nidulans was reverse transcribed by using a high-capacity cDNA reverse transcription kit (Thermo Fisher Scientific, Waltham, MA) according to the manufacturer’s instructions. The RPL28S (S. cerevisiae), ACTIN (M. grisea), and histone H2B (A. nidulans) genes were used to standardize the mRNA levels of the target genes. Quantitative reverse transcription-PCR analysis was performed as described previously (45) with KOD SYBR quantitative PCR (qPCR) mix (Toyobo, Osaka, Japan) in a MiniOpticon real-time PCR system (Bio-Rad Laboratories, Hercules, CA). qRT-PCR analysis was then performed three times for each cDNA sample (three technical replicates). Primer sequences are listed in Table 2.

TABLE 2.

Primers for quantitative RT-PCR

Primer no.	Primer name	Sequence (5′ to 3′)	Target gene
1	MLP1-RT-F	GGCTGTATCTTGGCCGAAC	MLP1 of S. cerevisiae
2	MLP1-RT-R	CCTCAGGTGGTGTTCCAAG	MLP1 of S. cerevisiae
3	RPL28-RT-F	GACTAGAAAGCACAGAGGTC	RPL28S of S. cerevisiae
4	RPL28-RT-R	GTCCAAGTTCAAGACTGG	RPL28S of S. cerevisiae
5	RTActin-F	CAACTCGATCATGAAGTGCGATGT	ACTIN of M. grisea
6	RTActin-R	GCTCTCGTCGTACTCCTGCTT	ACTIN of M. grisea
7	RTAGS1-F	CCTTTGTCGCGCCGTTTG	AGS1 of M. grisea
8	RTAGS1-R	CCGTCCTTGGTCGTAGTGAG	AGS1 of M. grisea
9	RTSCD1-F	GACAGCTACGACTCCAAGGACT	SCD1 of M. grisea
10	RTSCD1-R	CTCGGACACCTTCTCCCAGC	SCD1 of M. grisea
11	RT3HNR-F	CGACAAGGTCTTCAACCTCAACAC	3HNR of M. grisea
12	RT3HNR-R	AGTTCTCGTCAAACATGTCGGTC	3HNR of M. grisea
13	RT4HNR-F	CGTGTCTTTACCATCAACACCCG	4HNR of M. grisea
14	RT4HNR-R	CAGACTGCATGGTACATATCGGTC	4HNR of M. grisea
16	AnH2B-RT-F	CACCCGGACACTGGTATCTC	Histone H2B gene of A. nidulans
17	AnH2B-RT-R	GAATACTTCGTAACGGCCTTGG	Histone H2B gene of A. nidulans
18	AnagsB-RT-F	ATCGGACACTACCTTCCCTG	agsB of A. nidulans
19	AnagsB-RT-R	GACTTGGCTGACGATCAACG	agsB of A. nidulans
20	AN7060-RT-F	GCAACTGCAGTGCAGACCAC	AN7060 of A. nidulans
21	AN7060-RT-R	TCTGGGGCTTGCTTTCCATG	AN7060 of A. nidulans

Preparation of S. cerevisiae cell extracts and immunoblot analysis.

The BY4741, YF-PKC_SC, YF-PKC_MG, and YF-PKC_AN strains were precultured, inoculated, grown, collected, and washed as above, and suspended to an OD₆₆₀ of 2.0 in YPD liquid medium. Then, 5 ml of the suspension was added to 5 ml YPD medium with DMSO (final concentration, 1%) or Z-705 (final concentration, 7.77 μM) and incubated at 30°C with shaking at 160 rpm. After 30 min, CR (final concentration 100 μg/ml) was added and incubation continued for 60 min. The cells were then collected and quickly frozen in liquid nitrogen. The frozen cells were suspended in five times the weight of protein extraction buffer containing protease and phosphatase inhibitors (50 mM Tris-HCl [pH 8.0], 1% sodium deoxycholate, 1% Triton X-100, 0.1% SDS, 50 mM NaF, 5 mM sodium pyrophosphate decahydrate, 0.1 M sodium vanadate, and a protease inhibitor cocktail [Roche]) and were immediately crushed with 0.5-mm diameter zirconia beads (ZB-05; Tomy, Tokyo, Japan) in a Micro Smash MS-100R cell disruptor (Tomy). The suspension was centrifuged; the supernatant (total protein solution) was then collected and immediately boiled for 10 min with an appropriate amount of sample buffer for sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Cell debris were removed by centrifugation for 10 min at 16,873 × g. Protein concentration of the supernatant was determined using a Pierce BCA protein assay kit–reducing agent compatible (Pierce, Rockford, IL). Each sample (30 μg of protein) was subjected to SDS-PAGE and transferred onto a polyvinylidene difluoride (PVDF) membrane.

The membrane was blocked with an ECL Prime blocking reagent (GE Healthcare UK, Ltd., Buckinghamshire, UK). Dual phosphorylation of Mpk1p was detected using an antibody against phospho-p44/42 MAPK (Cell Signaling Technology, Inc., Beverly, MA). To detect Mpk1p regardless of its phosphorylation, we used anti-Mpk1p antibody (Santa Cruz Biotechnology, Santa Cruz, CA). To detect histone H2A, we used an antibody from Active Motif (Carlsbad, CA). Antibody binding was visualized using horseradish peroxidase-conjugated secondary antibody (Thermo Fisher Scientific) and a SuperSignal West Pico PLUS chemiluminescent substrate (Thermo Fisher Scientific).

RNA sequencing analysis.

Sample libraries were prepared from 0.5 μg of total RNA using a KAPA RNA HyperPrep kit for Illumina platform (KAPA Biosystems, Wilmington, MA) according to standard protocols. Briefly, each total RNA sample was enriched for mRNA by using oligo(dT) beads and for fragmentation by using a nuclease. Library construction involved cDNA synthesis, A-tailing, adapter ligation, and amplification. The mean fragment length in each library was 352 to 416 bp. Sequencing was performed in a single-end 50-bp mode on a HiSeq 1500 system (Illumina).

The expression level of each gene was analyzed using CLC Genomics Workbench (CLC Bio, Aarhus, Denmark). Sequence reads were trimmed and mapped to the M. grisea genome data, which were retrieved from the National Center for Biotechnology Information (https://www.ncbi.nlm.nih.gov/). From the mapping data, fragments per kilobase of exon per million reads mapped (FPKM) values were calculated using a program in CLC Genomics Workbench. The FPKM value for mycelia treated with Z-705 for 24 h was compared with that for mycelia treated for 24 h with DMSO.