The rapid development of the biodiesel industry has led to tremendous crude glycerol generation. Due to the presence of complex impurities, crude glycerol has low value for industry without costly purification. Obtaining novel microorganisms capable of direct and efficient bioconversion of crude glycerol to value-added products has great economic potential for industrial application. In this work, we characterized a newly isolated strain, Klebsiella pneumoniae 2e, with the capacity to efficiently produce 1,3-propanediol (1,3-PDO) from crude glycerol and demonstrated its adaptation to crude glycerol. Our work provides insights into the molecular mechanisms of K. pneumoniae 2e adaptation to crude glycerol and the expression patterns of its genes involved in 1,3-PDO biosynthesis, which will contribute to the development of industrial 1,3-PDO production from crude glycerol.
KEYWORDS: 1,3-propanediol; Klebsiella pneumoniae 2e; adaptability; crude glycerol; impurities
ABSTRACT
Crude glycerol is largely generated as the main by-product of the biodiesel industry and is unprofitable for industrial application without costly purification. The direct bioconversion of crude glycerol into 1,3-propanediol (1,3-PDO) by microorganisms is a promising alternative for effective and economic utilization. In this study, Klebsiella pneumoniae 2e was newly isolated for the conversion of crude glycerol into 1,3-PDO. Batch fermentation analysis confirmed that crude glycerol and its main impurities had slight impacts on the growth, key enzyme activity, and 1,3-PDO production of K. pneumoniae 2e. The 1,3-PDO yield from crude glycerol by K. pneumoniae 2e reached 0.64 mol 1,3-PDO/mol glycerol, which was higher than that by most reported 1,3-PDO-producing Klebsiella strains. Genomic profiling revealed that K. pneumoniae 2e possesses 30 genes involved in glycerol anaerobic metabolism and 1,3-PDO biosynthesis. Quantitative real-time PCR analysis of these genes showed that the majority of the genes encoding the key enzymes for glycerol metabolism and 1,3-PDO biosynthesis were significantly upregulated during culture in crude glycerol relative to that in pure glycerol. Further comparative genomic analysis revealed a novel glycerol uptake facilitator protein in K. pneumoniae 2e and a higher number of stress response proteins than in other Klebsiella strains. This work confirms the adaptability of a newly isolated 1,3-PDO-producing strain, K. pneumoniae 2e, to crude glycerol and provides insights into the molecular mechanisms involved in its crude glycerol tolerance, which is valuable for industrial 1,3-PDO production from crude glycerol.
IMPORTANCE The rapid development of the biodiesel industry has led to tremendous crude glycerol generation. Due to the presence of complex impurities, crude glycerol has low value for industry without costly purification. Obtaining novel microorganisms capable of direct and efficient bioconversion of crude glycerol to value-added products has great economic potential for industrial application. In this work, we characterized a newly isolated strain, Klebsiella pneumoniae 2e, with the capacity to efficiently produce 1,3-propanediol (1,3-PDO) from crude glycerol and demonstrated its adaptation to crude glycerol. Our work provides insights into the molecular mechanisms of K. pneumoniae 2e adaptation to crude glycerol and the expression patterns of its genes involved in 1,3-PDO biosynthesis, which will contribute to the development of industrial 1,3-PDO production from crude glycerol.
INTRODUCTION
Biodiesel is regarded as one of the most promising alternative and sustainable fuels, and its production has largely increased in recent years (1). However, great quantities of crude glycerol are generated alongside the production of biodiesel as the main by-product (10% [wt/wt]) (2). Apart from glycerol, a large number of impurities such as inorganic salts, methanol, and residual free fatty acids are contained in biodiesel-derived crude glycerol, which limits its application as a feedstock requiring low-cost purification pretreatment (3, 4). Moreover, the costly disposal of surplus crude glycerol becomes a heavy burden for biodiesel plants. Therefore, further exploration is urgently needed to rationalize crude glycerol utilization. Among the reported applications of crude glycerol, its direct bioconversion into 1,3-propanediol (1,3-PDO) is desirable as a feedstock for the cosmetics, food packaging, polymer, and pharmaceutical industries (4–6). The increasing demand for 1,3-PDO suggests the economic sustainability of the crude glycerol bioconversion industry (1).
A number of microorganisms belonging to the genera Citrobacter, Clostridium, Klebsiella, and Bacillus have been found to be capable of 1,3-PDO production from glycerol fermentation (7). However, the fermentation studies with these strains were conducted using pure glycerol as opposed to crude glycerol (5, 8). Moreover, only a small fraction of the bacterial strains reported are able to utilize crude glycerol as a substrate for 1,3-PDO fermentation (5). Although the utilization of crude glycerol as a feedstock for 1,3-PDO production is more economical, the complexity resulting from impurities gives rise to microbial fermentation complications (8). 1,3-PDO-producing bacterial strains with tolerance to crude glycerol impurities would be promising candidates for industrial application. Several bacterial strains, such as Klebsiella pneumoniae ATCC 8724, Clostridium perfringens GYL, and Lactobacillus brevis N1E9.3.3, have been demonstrated to efficiently ferment crude glycerol to 1,3-PDO (9–11). Despite efforts to optimize the fermentation conditions of these strains, knowledge of the mechanisms of their adaptation to crude glycerol and the expression patterns of the genes involved in 1,3-PDO biosynthesis is lacking. Strains able to utilize crude glycerol as a carbon source and for 1,3-PDO production may possess distinct adaptive mechanisms to counteract the effects of the complex impurities present in crude glycerol (12, 13). The elucidation of the genomic information and expression patterns of genes in response to crude glycerol will be beneficial for understanding the mechanisms of adaptation to this substrate and provide avenues for possible enhancement for industrial production of 1,3-PDO from crude glycerol.
In this study, we characterized a new strain, Klebsiella pneumoniae 2e, isolated from biodiesel-derived waste-contaminated soil. To confirm the bioconversion ability, the batch fermentation properties of K. pneumoniae 2e in the presence of crude glycerol and its main impurities were investigated. To elucidate genomic traits, we sequenced the complete genome of K. pneumoniae 2e and analyzed candidate genes associated with 1,3-PDO production. In addition, genome-specific traits were used as criteria for comparative genomic analysis to investigate possible correlations between K. pneumoniae 2e and four other Klebsiella 1,3-PDO-producing strains. Furthermore, the expression levels of the genes identified were monitored in response to crude glycerol.
RESULTS
1,3-PDO-producing microorganism isolation and identification.
To obtain the 1,3-PDO-producing strain, 11 strains in total were isolated from biodiesel-derived waste-contaminated soil samples after an initial enrichment. Of these isolates, strain 2e was found to yield the highest concentration of 1,3-PDO (10.16 g/liter), which was much higher than the second highest concentration (7.84 g/liter) from another strain during the initial screening. Moreover, strain 2e grew faster than other isolates in screening cultures. Hence, this strain was selected for further study. Physiological and biochemical test results showed that strain 2e is Gram negative and positive for nitrate reduction, H2S production, and arginine hydrolysis, with the ability to utilize citrate, sucrose, lactose, and mannose (see Table S1 in the supplemental material). The 16S rRNA sequence analysis using the NCBI BLAST algorithm revealed that strain 2e had a 99% similarity to Klebsiella pneumoniae SDWH02 (GenBank accession KX636139.1). 16S rRNA gene-based phylogenetic tree analysis also concluded that the strain fell within the Klebsiella pneumoniae species (see Fig. S1). According to the above-described results, strain 2e was identified as a strain of Klebsiella pneumoniae. This strain has since been deposited in the China General Microbiological Culture Collection Centre (CGMCC) with the number CGMCC 15520.
Characterization of the batch fermentation properties of K. pneumoniae 2e with the crude glycerol substrate.
To further evaluate 1,3-PDO production by K. pneumoniae 2e, an analysis of its batch fermentation properties (strain growth, corresponding enzyme activities, and metabolic products) was conducted using crude glycerol as the substrate, while pure glycerol was used as the control. As shown in Fig. 1, slightly slower bacterial growth coincided with slightly lower activities of 1,3-propanediol oxidoreductase (PDOR) and glycerol dehydrogenase (GDH) observed during culture in crude glycerol than in pure glycerol. In contrast, glycerol dehydratase (GDHt) activity values in both substrates were similar during the incubation period. Correspondingly, as listed in Table 1, the glycerol consumption, 1,3-PDO concentration, and production yield obtained in crude glycerol substrate reached 19.44 ± 0.46 g/liter, 10.28 ± 0.75 g/liter, and 0.64 mol 1,3-PDO/mol glycerol, respectively, after 12 h of fermentation, results that were comparable to those in pure glycerol substrate. In addition to 1,3-PDO, fractions of other metabolites, including 2,3-butanediol, acetic acid, and lactic acid, were also detected in both substrates. The total amounts of these by-products account for less than 24% of the consumption of the carbon source. Furthermore, crude glycerol 1,3-PDO production by K. pneumoniae 2e through batch fermentation was compared with that by other previously reported Klebsiella strains. As summarized in Table 2, the production yield of 1,3-PDO by K. pneumoniae 2e was second to that by K. pneumoniae ATCC 8724 upon comparison to other Klebsiella strains. However, it should be noted that the impurity contents of the crude glycerol used for K. pneumoniae ATCC 8724 fermentation was not described (9). The impurity content is the key factor that markedly affects the product yield during the crude glycerol bioconversion (14).
FIG 1.
Comparison of K. pneumoniae 2e fermented in pure glycerol and crude glycerol substrates. The growth of K. pneumoniae 2e (a) and its glycerol dehydratase (GDHt), 1,3-propanediol oxidoreductase (PDOR), and glycerol dehydrogenase (GDH) activities (b) during the whole batch fermentation period. Data points indicate the mean values from three replicates with the standard deviations (SDs).
TABLE 1.
Comparison of batch fermentation by K. pneumoniae 2e in the pure glycerol and crude glycerol substrates after 12 h batch fermentation
| Substrate | Glycerol consumption (g/liter) | 1,3-PDO |
2,3-Butanediol (g/liter) | Acetic acid (g/liter) | Lactic acid (g/liter) | |
|---|---|---|---|---|---|---|
| Concn (g/liter) | Yield (mol 1,3-PDO/mol glycerol) | |||||
| Pure glycerol | 21.27 ± 0.19 | 12.16 ± 0.94 | 0.71 | 2.3 ± 0.17 | 1.42 ± 0.11 | 1.29 ± 0.13 |
| Crude glycerol | 19.44 ± 0.46 | 10.28 ± 0.75 | 0.64 | 2.06 ± 0.57 | 0.87 ± 0.28 | 1.57 ± 0.52 |
TABLE 2.
1,3-PDO production yields by different Klebsiella strains using crude glycerol as the substrate in batch fermentation
Effects of the main impurities of crude glycerol on 1,3-PDO production in K. pneumoniae 2e.
To further assess the adaptability of K. pneumoniae 2e to crude glycerol, the impacts of the main impurities (NaCl, methanol, oleic acid, and linoleic acid) of crude glycerol on fermentation were individually investigated. These fermentation studies were conducted within the estimated reasonable range based on the concentrations present in the crude glycerol used as the source. As illustrated in Fig. 2, the effect on fermentation by different of concentrations of NaCl (2.0% to 8.0% [wt/wt]) (Fig. 2a), methanol (7.5% to 15.0% [wt/wt]) (Fig. 2b), and oleic acid (0.6% to 1.2% [wt/wt]) (Fig. 2c) was negligible, with no significant decline in cell growth, glycerol consumption, and 1,3-PDO production relative to that of the control. The introduction of different concentrations of linoleic acid (0.6% to 1.2% [wt/wt]), even at low concentrations (0.6%), significantly reduced cell growth, glycerol consumption, and 1,3-PDO production (P ≤ 0.01) compared to that of the control (Fig. 2d). As expected, the effects of these impurities correlated directly with the corresponding enzyme (GDHt, PDOR, and GDH) activities of K. pneumoniae 2e (see Fig. S2) during fermentation.
FIG 2.
Effects of different concentrations of NaCl (a), methanol (b), oleic acid (c), and linoleic acid (d) on glycerol consumption, 1,3-PDO production and growth of K. pneumoniae 2e after 12 h fermentation. Bars indicate the mean values from three replicates with the standard deviations (SDs). **, P < 0.01; ***, P < 0.001 versus control.
Complete genome sequencing of K. pneumoniae 2e.
The complete genome sequence of K. pneumoniae 2e (GenBank accession numbers CP028478 to CP028480) was obtained by single-molecule real-time (SMRT) sequencing technology. The complete genomic circular map of K. pneumoniae 2e is shown in Fig. 3. The genome comprises a total of 5,439,580 bp with 5,125 protein-coding sequences (CDS), 24 rRNA operons, 86 rRNA genes, 2 plasmids, and an average G+C content of 58.66% (detailed information is listed in Table S2). The complete genome sequencing analysis further confirmed that strain 2e belongs to the species K. pneumoniae.
FIG 3.
Circular genomic map of K. pneumoniae 2e. Circles from outside to the inside: circles 1 and 2 show CDS predicted on the forward and reverse strands; various functions of predicted CDS assigned different colors according to function categories of COG (circles 3 and 4), KEGG (circles 5 and 6), and GO (circles 7 and 8); circle 9 indicates tRNAs and rRNAs; circle 10 denotes G+C content; circle 11 shows GC skew (G-C/G+C). The scales indicate the location in megabase pairs, starting with the initial coding region.
Identification of genes involved in glycerol anaerobic metabolism and 1,3-PDO production in K. pneumoniae 2e.
The genes potentially associated with glycerol anaerobic metabolism and 1,3-PDO synthesis were identified according to the gene function annotation listed in Table 3. Of these genes, 15 genes encoding putative proteins, including dihydroxyacetone kinase (DhaK), glycerol dehydrogenase (DhaD), glycerol dehydratase (DhaB), glycerol dehydratase reactivation factor (DhaG and DhaF), 1,3-propanediol oxidoreductase (DhaT), regulatory protein (DhaR), and glycerol uptake facilitator protein (DhaF), were organized as a cluster, i.e., the dha cluster (see Fig. S3), which is a group of coregulated genes (15).
TABLE 3.
Predicted genes involved in glycerol anaerobic metabolism and 1,3-PDO biosynthesis in the K. pneumoniae 2e genome
| Locus tag | Gene | Gene annotation |
|---|---|---|
| DA795_03250 | dhaK1 | Dihydroxyacetone kinase |
| DA795_03255 | dhaM | Fused dihydroxyacetone-specific PTS enzymes |
| DA795_03260 | dhaL | Phosphoenolpyruvate-dihydroxyacetone phosphotransferase |
| DA795_03265 | dhaK2 | PEP-dependent dihydroxyacetone kinase |
| DA795_03280 | dhaD | Glycerol dehydrogenase |
| DA795_03285 | dhaR | Phosphoenolpyruvate-dihydroxyacetone phosphotransferase operon regulatory protein |
| DA795_03290 | orfW | Putative B12-related propanediol dehydrogenase protein [cob(I)yrinic acid a,c-diamide adenosyltransferase] |
| DA795_03295 | dhaG | Glycerol dehydratase reactivation factor small subunit |
| DA795_03300 | dhaT | 1,3-Propanediol oxidoreductase dehydrogenase |
| DA795_03305 | orfY | Hypothetical protein |
| DA795_03310 | dhaB1 | Glycerol dehydratase, large subunit |
| DA795_03315 | dhaB2 | Glycerol dehydratase, medium subunit |
| DA795_03320 | dhaB3 | Glycerol dehydratase, small subunit |
| DA795_03325 | dhaF | Glycerol dehydratase reactivation factor, large subunit |
| DA795_03330 | glpF1 | Glycerol uptake facilitator protein |
| DA795_03630 | yqhD | NADPH-dependent broad range alcohol dehydrogenase |
| DA795_04840 | pduG | Adenosylcobalamin-dependent diol dehydratase reactivation factor, small subunit |
| DA795_04845 | pduH | Propanediol utilization diol dehydratase reactivation protein |
| DA795_04850 | pduE | Propanediol dehydratase, small subunit |
| DA795_04855 | pduD | Propanediol dehydratase, small subunit |
| DA795_04860 | pduC | Propanediol dehydratase, large subunit |
| DA795_25500 | gldA | Glycerol dehydrogenase |
| DA795_26795 | glpF2 | Glycerol uptake facilitator protein |
| DA795_00510 | glpF3 | Glycerol uptake facilitator protein |
| DA795_04875 | glpF4 | Glycerol uptake facilitator protein |
| DA795_00505 | glpK | Glycerol kinase |
| DA795_01675 | glpR | GlpR family transcriptional regulator |
| DA795_17085 | pdh1 | Pyruvate dehydrogenase |
| DA795_21375 | pdh2 | Pyruvate dehydrogenase |
| DA795_21380 | pdh3 | Pyruvate dehydrogenase |
Apart from the dha cluster, other genes encoding putative proteins with corresponding similar functions are also included in Table 3, such as propanediol dehydratase, which functions as glycerol dehydratase with counterpart reactivation factors (16), alcohol dehydrogenase (YqhD), which exhibits 1,3-propanediol oxidoreductase-like activity (17), pyruvate dehydrogenase, which contributes to NADH generation (18), the isoenzyme of glycerol dehydrogenase GldA, and three other glycerol uptake facilitator proteins. The presence of plenty of 1,3-PDO biosynthesis pathway genes (30 genes), including the dha cluster and other functional genes, leads to the increased capacity of K. pneumoniae 2e for 1,3-PDO production.
Comparative genomic analysis of K. pneumoniae 2e with other Klebsiella strains.
To investigate specific traits of K. pneumoniae 2e, its genome sequence was compared with those of four 1,3-PDO producing Klebsiella strains: K. pneumoniae MGH 78578 (GenBank CP000647.1) (19), K. pneumoniae ATCC 8724 (GenBank CP003218) (9), K. pneumoniae ATCC 25955 (GenBank AQQH00000000) (20), and K. oxytoca M5al (GenBank AMPJ00000000) (21). Among these selected four strains, both K. pneumoniae ATCC 8724 and K. oxytoca M5al are reported to be capable of the bioconversion of crude glycerol (among the strains listed in Table 2, genome sequences of only these two strains were available from the NCBI database), while studies for the others were conducted with pure glycerol. The genome sequences of these five strains were analyzed using hierarchical classification of function by the Rapid Annotations using Subsystems Technology (RAST) server and classified into 26 subsystems according to functional groups. As shown in Fig. 4a, the numbers of proteins involved in the majority of subsystems are similar in all five strains. However, the number of proteins involved in stress response reached 224 in K. pneumoniae 2e, which is the highest among all compared strains. The stress response-related proteins generally serve a protective function in bacteria against the damages caused by an extreme environment (22). This suggests that stress response-related proteins may play an important role for bacterial survival in the harsh environment of crude glycerol. As shown in Fig. 4b, the numbers of most kinds of stress response proteins in the stress response subsystem are the highest in K. pneumoniae 2e among the compared strains according to further genomic analysis. In addition, the category of sigmaB stress response regulation only exists in K. pneumoniae 2e, with two RsbV anti-sigma factor antagonists (locus tags DA795_14645 and DA795_16570, GenBank AYO68155.1 and AYO68511.1).
FIG 4.
Comparisons of SEED subsystem protein abundances (a) and different kinds of protein abundances from stress response subsystem (b) between five Klebsiella strains.
As shown in Fig. 5, according to pan-genome analysis of the five strains, the compared genomes share a vast majority of their genes (3,096), which are regarded as core genes, suggesting the high preservation of the genome in Klebsiella strains, while differing by only 7% to 13% in specific gene content (for details, see Table S3). Of the 536 genes specific to K. pneumoniae 2e, there are three genes encoding putative proteins, including the aforementioned two RsbV anti-sigma factor antagonists (locus tags DA795_14645 and DA795_16570, GenBank AYO68155.1 and AYO68511.1) and a cold shock protein (locus tag DA795_14635, GenBank AYO68153.1), which belong to the stress response subsystem. Furthermore, we found one gene encoding a putative glycerol uptake facilitator protein (locus tag DA795_00510, GenBank AYO70531.1) directly involved in glycerol anaerobic fermentation in K. pneumoniae 2e located in one of its plasmids. As shown in Fig. 6, a phylogenetic analysis indicated that this protein has significant differences compared to the other three glycerol uptake facilitator proteins found in K. pneumoniae 2e. This protein is more similar to fungal and algal orthologs, suggesting that it might be a new glycerol uptake facilitator protein acquired by horizontal gene transfer.
FIG 5.
Venn diagram of the core and pan genomes of five Klebsiella strains. Overlapping regions represent the CDS shared between the compared genomes. Numbers in nonoverlapping regions indicate the unique CDS in each genome.
FIG 6.
Phylogenetic tree analysis of glycerol uptake facilitator proteins in K. pneumoniae 2e and related proteins based on amino acid sequences. The tree was constructed by the maximum likelihood algorithm (1,000 bootstrap trial) method. The scale bar indicates the number of amino acid substitutions per site. The numbers at each branch represent bootstrap values.
Gene expression analysis of K. pneumoniae 2e cultured in crude glycerol and pure glycerol substrates.
To obtain the expression profiles of genes associated with glycerol anaerobic metabolism and 1,3-PDO biosynthesis, quantitative real-time PCR (qRT-PCR) analysis was conducted in K. pneumoniae 2e cultured in crude glycerol and pure glycerol. As shown in Fig. 7, among the detected transcripts, the majority, including dhaD, dhaR, dhaG, dhaT, dhaB1, dhaB2, dhaB3, dhaF, glpF1, yqhD, pduG, pduH, gldA, glpF2, glpF3, glpF4, glpK, pdh1, pdh2, and pdh3, were significantly upregulated (P ≤ 0.05) in crude glycerol compared to that in pure glycerol, with more than 2-fold increases in expression, except for dhaD and dhaB1. According to the gene function and transcription analysis results, a putative glycerol anaerobic metabolism pathway in K. pneumoniae 2e was obtained. As shown in Fig. 8, the pathway is divided into an oxidative branch and a reductive branch. The oxidative branch provides energy and NADH for microbial growth, while the reductive branch leads to 1,3-PDO formation. The key genes in this pathway were significantly upregulated in crude glycerol relative to that in pure glycerol.
FIG 7.
Relative transcript expression of genes involved in glycerol anaerobic metabolism and 1,3-PDO biosynthesis in K. pneumoniae 2e in response to crude glycerol. dhaK1 (DA795_03250), dihydroxyacetone kinase; dhaM (DA795_03255), fused dihydroxyacetone-specific PTS enzymes; dhaL (DA795_03260), phosphoenolpyruvate-dihydroxyacetone phosphotransferase; dhaK2 (DA795_03265), PEP-dependent dihydroxyacetone kinase; dhaD (DA795_03280), glycerol dehydrogenase; dhaR (DA795_03285), phosphoenolpyruvate-dihydroxyacetone phosphotransferase operon regulatory protein; orfW (DA795_03290), putative B12-related propanediol dehydrogenase protein; dhaG (DA795_03295), glycerol dehydratase reactivation factor, small subunit; dhaT (DA795_03300), 1,3-propanediol oxidoreductase dehydrogenase; orfY (DA795_03305), hypothetical protein; dhaB1 (DA795_03310), glycerol dehydratase, large subunit; dhaB2 (DA795_03315), glycerol dehydratase, medium subunit; dhaB3 (DA795_03320), glycerol dehydratase, small subunit; dhaF (DA795_03325), glycerol dehydratase reactivation factor, large subunit; glpF1 (DA795_03330), glycerol uptake facilitator protein; yqhD (DA795_03630), NADPH-dependent broad range aldehyde dehydrogenase; pduG (DA795_04840), adenosylcobalamin-dependent diol dehydratase reactivation factor, small subunit; pduH (DA795_04845), propanediol utilization diol dehydratase reactivation protein; pduE (DA795_04850), propanediol dehydratase, small subunit; pduD (DA795_04855), propanediol dehydratase, small subunit; pduC (DA795_04860), propanediol dehydratase, large subunit; GldA (DA795_25500), glycerol dehydrogenase; glpF2 (DA795_26795), glycerol uptake facilitator protein; glpF3 (DA795_00510), glycerol uptake facilitator protein; glpF4 (DA795_04875), glycerol uptake facilitator protein; glpK (DA795_00505), glycerol kinase; glpR (DA795_01675), GlpR family transcriptional regulator; pdh1 (DA795_17085), pyruvate dehydrogenase; pdh2 (DA795_21375), pyruvate dehydrogenase; and pdh3 (DA795_21380), pyruvate dehydrogenase. Bars indicate the mean values from three replicates with the standard deviations (SDs). *, P < 0.05; **, P < 0.01; ***, P < 0.001 versus control.
FIG 8.
Predicted putative 1,3-PDO biosynthesis pathway in K. pneumoniae 2e based on the gene function analysis. Colored boxes indicate transcript level results from crude glycerol relative to pure glycerol.
DISCUSSION
Klebsiella strains have been studied extensively for biotechnological application in 1,3-PDO production due to their rapid growth, their ability to produce coenzyme B12, and the ease of genetic manipulation using methods developed for Escherichia coli (due to their evolutionary and biochemical proximity to E. coli) (23). However, the majority of studies have reported on Klebsiella strains capable of producing 1,3-PDO from pure glycerol as opposed to crude glycerol. In this study, we investigated the newly isolated strain K. pneumoniae 2e, with the capacity to produce 1,3-PDO from biodiesel-derived crude glycerol. Crude glycerol only had a slight impact on the fermentation process of K. pneumoniae 2e, which was confirmed by its 1,3-PDO production prowess from the impure substrate. To date, only a limited number of 1,3-PDO-producing Klebsiella strains with the ability to utilize crude glycerol have been reported (24). The 1,3-PDO yield of K. pneumoniae 2e was only slightly less than that of K. pneumoniae ATCC 8724 in comparison to these reported Klebsiella strains. Even compared to other genus strains, it was second to that of Clostridium butyricum VPI 1718 (0.68 mol 1,3-PDO/mol glycerol) (25). In addition, although the total amounts of by-products were far less than that of 1,3-PDO by K. pneumoniae 2e, it should not be negligible in industrial applications. Considering that the optimized fermentation conditions have yet to be established for K. pneumoniae 2e, further studies on fermentation optimization for improving 1,3-PDO yield and reduction of by-product amounts are crucial for its future industrial application.
The presence of impurities in crude glycerol is the primary barrier for microbial fermentation (14). The separate presence of different concentrations of NaCl, methanol, and oleic acid had no significant impact on 1,3-PDO production by K. pneumoniae 2e, suggesting a high tolerance to these impurities. Only the presence of linoleic acids imposed significant negative effects on K. pneumoniae 2e fermentation. The same phenomenon was also observed with fermentation of Clostridium pasteurianum ATCC 6013 and C. butyricum VPI 1718 (26, 27). Considering the low content of linoleic acid in the majority of crude glycerol sources, the negative effect on K. pneumoniae 2e is limited, which could be deduced from the results obtained from batch fermentation with crude glycerol. All accumulated evidence shows the adaptability of K. pneumoniae 2e to crude glycerol.
Due to the complex composition of crude glycerol, microorganisms are constantly under a variety of stresses, such as hyperosmosis stress, oxidative stress, and pH stress, during the fermentation process, which requires a robust stress response system for survival (14). The number of stress response-related proteins in K. pneumoniae 2e is higher than that of compared strains. In addition, three unique genes encoding putative proteins, including two RsbV anti-sigma factor antagonists and a cold shock protein, involved in stress response were found in K. pneumoniae 2e. RsbV was reported as the positive regulator of the alternative sigma factor σB, which plays a pivotal role in resistance to stresses (28, 29), while the cold shock protein is an induced response to a downshift in temperature (30). These results might highlight its advantages under crude glycerol conditions.
In the glycerol anaerobic pathway, glycerol uptake facilitator protein, glycerol dehydrogenase, glycerol dehydratases with corresponding reactivation factors, and 1,3-propanediol oxidoreductase are the key enzymes for 1,3-PDO formation (31). The significant upregulation of these genes might guarantee the activities of corresponding enzymes for the 1,3-PDO production in crude glycerol in response to stresses, for which the upregulation of some was in agreement with the similar levels of corresponding enzyme activities detected in the crude glycerol cultures.
Glycerol uptake facilitator protein (GlpF) is a transmembrane protein that forms aqueous pores allowing the passive transport of glycerol and other small molecules across the membrane (32). It can be deduced that the passive transport of glycerol might be more difficult for bacteria in the crude glycerol substrate due to the hyperosmosis stress caused by complex impurities. The existence of a new glycerol uptake facilitator protein encoded by glpF2 (DA795_26795) corresponds to the significant upregulation of all four glycerol uptake facilitator protein-encoding genes in crude glycerol relative to that in pure glycerol, suggesting a possible advantage for glycerol uptake from crude glycerol by K. pneumoniae 2e.
Glycerol dehydrogenase encoded by the dhaD gene or gldA gene plays an essential role in the first step of the oxidative branch, which converts glycerol to dihydroxyacetone and generates NADH (33). However, it is thought that GldA serves in an auxiliary capacity to DhaD (34). In our study, the transcript levels of both dhaD and gldA were significantly upregulated in crude glycerol, with unexpectedly higher transcript levels of gldA than dhaD. This suggests that as opposed to DhaD, GldA is suspected to act as the main enzyme in the oxidative pathway of K. pneumoniae 2e during crude glycerol culturing. In addition, significantly upregulated transcripts of genes encoding three pyruvate dehydrogenases that catalyze oxidative decarboxylation in conjunction with NADH generation might also contribute to the maintenance of NADH levels needed for the reductive pathway (35).
Glycerol dehydratases encoded by three dhaB genes are regarded as key rate-limiting enzymes for catalyzing the dehydration of glycerol to 3-hydroxypropionaldehyde (3-HPA) in the reductive pathway (31). The transcript levels of the three dhaB genes in K. pneumoniae 2e were all significantly upregulated in crude glycerol relative to that in pure glycerol, whereas the genes encoding propanediol dehydratase, which is regarded as the functional substitution of glycerol dehydratase, were all downregulated. This implies that glycerol dehydratase plays a dominant role in the conversion of glycerol to 3-HPA in K. pneumoniae 2e. Due to the presence of complex impurities, it can be construed that glycerol dehydratase is more prone to undergo a mechanism-based suicidal inactivation by crude glycerol than by pure glycerol (8, 36). The significant upregulation of transcript levels of the four genes encoding the reactivation factors might keep sufficient amounts for glycerol dehydratase reactivation.
1,3-Propanediol oxidoreductase encoded by the dhaT gene is another key enzyme in the oxidative branch that catalyzes the hydrogenation of 3-HPA to 1,3-PDO with the consumption of NADH (31). In addition, an alcohol dehydrogenase encoded by yqhD functionally exhibits activity similar to that of 1,3-propanediol oxidoreductase (37). According to an expression analysis, the transcript levels of the dhaT and yqhD genes in K. pneumoniae 2e were significantly upregulated in crude glycerol relative to that in pure glycerol, increasing more than 10-fold for the yqhD gene. Considering that YqhD has also been reported as a detoxification enzyme for many aldehydes, the greatly increased transcript levels of the yqhD gene illustrate that an increased number of aldehydes might be generated in crude glycerol culture, requiring degradation (38).
In conclusion, comprehensive characterization and genomic profiling of K. pneumoniae 2e confirmed its adaptability to efficiently produce 1,3-PDO from crude glycerol. This work and further evaluation will facilitate the application of K. pneumoniae 2e in industrial 1,3-PDO production from crude glycerol.
MATERIALS AND METHODS
Biodiesel-derived crude glycerol.
Crude glycerol (69% purity) derived from cooking oil as the raw material was supplied by a biodiesel manufacturing plant (Weiming Biological Technology Co., Ltd., Changsha, China). The main impurities present in the crude glycerol included 11% (wt/wt) moisture, 1% (wt/wt) free fatty acids, 13% (wt/wt) methanol, and 6% (wt/wt) NaCl.
Microorganism isolation.
Soil samples were collected from biodiesel-derived waste-contaminated regions near the Weiming Biological Technology Co., Ltd., Changsha, China (N 28°07′21.01″, E 113°03′11.19″) using sterile plastic bags. One gram of sediment from each soil sample was suspended in 50 ml of sterile 0.8% (wt/vol) NaCl and stirred for 15 min. The supernatant was collected for strain enrichment. The strain enrichment medium contained (g/liter) glycerol (25.0), peptone (10.0), yeast extract (10.0), sodium acetate (5.0), K2HPO4 (2.0), MgSO4 (0.2), KH2PO4 (2.0), MnSO4 (0.02), CaCl2 (0.1), and agar (18.0), pH 7.0 to 7.2. After the cultivation of pure isolates for 2 to 3 generations, the cultures were inoculated in selective medium for 1,3-PDO production screening. The selective medium contained (g/liter) crude glycerol (36.0), yeast extract (10.0), (NH4)2SO4 (2.0), MgSO4 (0.2), K2HPO4 (2.0), CaCl2 (0.1), KH2PO4 (2.0), FeSO4 (0.05), and MnSO4 (0.02), pH 7.0 to 7.2. After three rounds of screening, the strains producing the highest 1,3-PDO yields were selected for further study.
Strain identification.
Identification of the isolated bacterium was conducted by physiological and biochemical characterization and 16S rRNA gene fingerprinting. The physiological and biochemical parameters were investigated according to the Bergey’s manual of determinative bacteriology (39). Total genomic DNA was extracted from an overnight nutrient broth (NB) culture using a bacterial DNA kit (Tiangen, Beijing, China). The 27 forward primer (5′-AGAGTTTGATCCTGGCTCAG-3′) and 1492 reverse primer (5′-TACGGCTACCTTGTTACGACTT-3′) were used for bacterial 16S rRNA gene amplification. The PCRs were conducted using 2× Taq PCR MasterMix (Tiangen, Beijing, China) according to the manufacturer’s instructions. Sequence data for the amplified 16S rRNA genes were aligned against available sequences in the GenBank database using the NCBI BLAST algorithm. Phylogenetic analysis was conducted using the neighbor-joining algorithm (Molecular Evolutionary Genetics Analysis, version 5.1).
Batch fermentation.
The isolated colonies were inoculated in NB and incubated at 37°C and 170 rpm until the logarithmic phase. Then, the cultures (10% [vol/vol]) were inoculated into triplicate 1-liter bioreactors with 800 ml fermentation medium. The medium used for batch fermentation contained (g/liter) crude glycerol (36.0) or pure glycerol (25.0), yeast extract (10.0), (NH4)2SO4 (2.0), MgSO4 (0.2), K2HPO4 (2.0), CaCl2 (0.1), KH2PO4 (2.0), FeSO4 (0.05), and MnSO4 (0.02), pH 7.0 to 7.2. The fermentation medium was purged with nitrogen to remove oxygen prior to autoclaving. Batch fermentation experiments were performed at 37°C under anaerobic conditions.
Impact of impurities on glycerol fermentation.
To assess the influence of the various impurities, fermentation was conducted in pure glycerol (25.0 g/liter) substituted with various impurities (weight of impurity/weight of substrate) at concentrations similar to those in crude glycerol to mimic natural conditions. These were individually prepared as follows for investigation of the effect of impurities on microbial glycerol fermentation: NaCl was added at 2%, 4%, 6%, and 8%; methanol was added at 7.5%, 10%, 12.5%, and 15%; and oleic acid and linoleic acid were added at 0.6%, 0.8%, 1.0%, and 1.2%.
Enzymatic assays.
Intracellular crude proteins were extracted from harvested bacterial cells by sonication and centrifuged at 10,000 × g for 10 min at 4°C, and the supernatants were collected. Glycerol dehydratase (GDHt) activity was detected based on the method of Raj et al. using 1,2-propanediol as the substrate (40). 1,3-Propanediol oxidoreductase (PDOR) activity was assayed according to the method of Seo et al. by monitoring the production of substrate-dependent NADH at 340 nm (37). Glycerol dehydrogenase (GDH) activity was assessed according to the method of Zhang et al. by monitoring the change in absorbance of NADH at 340 nm (41). Under the assay conditions, the amount of enzyme needed to produce 1 μM product per minute was defined as one unit of enzyme activity. The protein concentration was determined by the bicinchoninic acid (BCA) assay using a BCA protein assay kit (Tiangen, Beijing, China). All assays were conducted using three replicates.
Bacterial growth assay.
The growth of bacteria was determined by measuring the optical density of the sample at 600 nm (OD600) using a spectrophotometer (Eppendorf, Germany).
Metabolic product analysis.
The samples for gas chromatography-mass spectrometry (GC-MS) and/or high-performance liquid chromatographic (HPLC) analysis were centrifuged at 10,000 × g for 10 min at 4°C, and the supernatant was filtered through a nitrocellulose membrane with 0.22-μm pores. The 1,3-PDO produced during the screening process was identified by GC-MS analysis according to the procedure of Guo et al. (10). The concentrations of glycerol, 1,3-PDO, 2,3-butanediol, acetic acid, and lactic acid were quantified by HPLC analysis (Agilent 1200) coupled with an Aminex HPX-87H cation exchange column (300 mm by 7.8 mm) (Bio-Rad, USA) using a refractive index detector or a diode array detector. A solution of 5 mM H2SO4 was employed as the mobile phase with a flow rate of 0.5 ml/min. The sample injection volume was 10 μl, and the column temperature was controlled at 60°C. Glycerol, 1,3-PDO, and 2,3-butanediol were detected by the refractive index detector, while acetic acid and lactic acid were analyzed by the diode array detector at 210 nm.
Complete genome sequence analysis and comparative genomics.
The genome of K. pneumoniae 2e was sequenced by single-molecule real-time (SMRT) technology at Novogene Bioinformatics Technology Co., Ltd. (Beijing, China). The low-quality reads were filtered by SMRT Link v5.0.1, and the filtered reads were assembled to generate one contig (5,439,580 bp) without gaps. The prediction and annotation of genes were performed using the Gene-Mark program. Functional annotation of open reading frames was performed by the BLAST algorithm using the NR, KEGG, COG, GO TCDB, and Swiss-Prot public databases. The compared genomes of K. pneumoniae MGH 78578 (GenBank CP000647), K. pneumoniae ATCC 8724 (GenBank CP003218) (previously reported as K. oxytoca KCTC 1686) (42), K. pneumoniae ATCC 25955 (GenBank AQQH00000000), and K. oxytoca M5al (GenBank AMPJ00000000) were obtained from the NCBI database. Pan-genome and Venn diagram analyses of the pan-genomic data sets were performed using the Pan-genome Analysis Pipeline (PGAP) (43). For protein subsystem classification, the genomes of the compared strains were reannotated using Rapid Annotations using Subsystems Technology (RAST), followed by SEED subsystem classification (44).
Total RNA extraction and cDNA synthesis.
Bacterial cells were harvested from crude glycerol and pure glycerol cultures at 8 h by centrifugation at 4,000 × g for 10 min at 4°C. Total RNA was extracted using TRIzol reagent (Invitrogen, Carlsbad, USA) as described previously by Ma et al. (45). Total RNA (1 μg) was used to synthesize first-strand cDNA by the Prime Script RT reagent kit (Perfect Real Time; TaKaRa, Dalian, China) according to the manufacturer’s suggested protocol.
Quantitative real-time PCR.
The primers used for quantitative real-time PCR (qRT-PCR) analysis are listed in Table 4 and were designed by Beacon Designer 7 software. Melting curve analysis of the products was conducted to verify primer specificity. The 16S rRNA gene was used as the reference gene. The qRT-PCR was performed on a QuantStudio 6 Flex real-time PCR system (Applied Biosystems) using SYBR Premix Ex Taq II (Tli RnaseH Plus; TaKaRa, Dalian, China). The applied cycling conditions were as follows: 95°C 30 s for initial denaturation, followed by 40 cycles of 95°C for 5 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s. All reactions were performed in triplicate. The relative fold change in the detected genes was analyzed using the 2−ΔΔCT method as previously described, normalizing the gene expression levels in the crude glycerol substrate to that in the pure glycerol substrate, where the expression level of the gene in the pure glycerol substrate was set to one (45).
TABLE 4.
Primers used for quantitative real-time-PCR
| Gene (locus tag) | Sequence |
Production length (bp) | |
|---|---|---|---|
| 5′ | 3′ | ||
| dhaK1 (DA795_03250) | GTGATGCTCAATAACCTC | GCCTATTAACCAGTCAATG | 105 |
| dhaM (DA795_03255) | CGGCAGATGTTAATCAAC | CATGACTTTAAGCGGATC | 96 |
| dhaL (DA795_03260) | CTGAACAGAACGCAAATC | GTCGCCAATCTCTTTATC | 99 |
| dhaK2 (DA795_03265) | CTGTATGGCGTGTATAAC | CTGTATGGCGTGTATAAC | 122 |
| dhaD (DA795_03280) | ATCGGTTACTACCAGAAG | TCGGATAGATCAGATACTC | 127 |
| dhaR (DA795_03285) | GCGTCATTGAGAATATCG | GCGTGAATAATAGCTTCC | 163 |
| orfW (DA795_03290) | CCGTCGATGAACTGATATC | CGTCTGCTGAATATGGTG | 92 |
| dhaG (DA795_03295) | CCATAACCTATGACGGAG | ATGAGTGAGGGCTATCTC | 116 |
| dhaT (DA795_03300) | GTCTCTATCAACGATCCA | GCGTCTTTGGAGATATAG | 110 |
| orfY (DA795_03305) | GCGTCTTTGGAGATATAG | GTCAACTACGGAAAACAC | 102 |
| dhaB1 (DA795_03310) | GACCAGTTTGACATGATC | GAATATCCACCAGCATAC | 115 |
| dhaB2 (DA795_03315) | CCCTCTTTTACCCTGAAA | GTGATGCTGGTGTTTATC | 108 |
| dhaB3 (DA795_03320) | TGCAGGATTATCCGTTAG | GAGGGTAATATCGGTCAA | 80 |
| dhaF (DA795_03325) | CTCTCGCATCTATCTTAAC | GATTCGGTGATAATGGTC | 84 |
| glpF1 (DA795_03330) | CCAGACTTCTACCTTAAC | GATAATACTGATCTCCCAC | 136 |
| yqhD (DA795_03630) | GGTTCTGAATCCAACAAAG | TGGCAGGGTATAGGTATA | 126 |
| pduG (DA795_04840) | ATGGAGAGTAGCGTAGTC | ATGCCTTCCTCTTCAATG | 101 |
| pduH (DA795_04845) | TATATTCTGGTGGTCTCC | GATATGCTGAACTTCGTC | 101 |
| pduE (DA795_04850) | CCAAAAGTTAGCGACTAC | GCTTAATACGTTCTCCAG | 102 |
| pduD (DA795_04855) | GAAGTCATTATTGCCGTC | GATGCCTTCTTCCTCAAT | 117 |
| pduC (DA795_04860) | CCTATTACGGATGAAGAAG | CTTGTTGATGATCTCCTG | 111 |
| gldA (DA795_25500) | GCCCACTTTATGAATGTG | CTTCGTCGGTGTATATCA | 94 |
| glpF2 (DA795_26795) | CTTGTGATGATTGGTGTAG | GGCTGAAAACAGATGTATG | 120 |
| glpF3 (DA795_00510) | GTTTACGGGCTTTACTAC | GTTTACGGGCTTTACTAC | 107 |
| glpF4 (DA795_04875) | CCAGTATATTCAGCACCTA | CAGAATGCCAATCAACAG | 164 |
| glpK (DA795_00505) | GGTAAACCCATCTACAAC | CTTGCGGATATACTCTTC | 99 |
| glpR (DA795_01675) | CACAACGATCTGCGAATT | CGAGAATAATGCGGAAGTC | 82 |
| pdh1 (DA795_17085) | CGAGAATAATGCGGAAGTC | GTTGATGTCGATCTGGATA | 125 |
| pdh2 (DA795_21375) | TGAATTGACCACCATCTC | ACTCTTTACCATTCCATACC | 194 |
| pdh3 (DA795_21380) | GGTATGGAAGGTCTGTTC | TTGTTGGTGCTGTAAGAG | 188 |
| 16s RNA (DA795_01305) | AATACGATATGGACCTGG | GACATGAACGGTGTTAATC | 95 |
Data availability.
The complete genome sequence of K. pneumoniae 2e was deposited at DDBJ/EMBL/GenBank under accession numbers CP028478 to CP028480.
Supplementary Material
ACKNOWLEDGMENTS
This work was funded by the National Postdoctoral Program for Innovative Talents (BX201700074), the China Postdoctoral Science Foundation (2018M632965), and the National Natural Science Foundation of China (31470594 and 31772374).
Footnotes
Supplemental material for this article may be found at https://doi.org/10.1128/AEM.00254-19.
REFERENCES
- 1.Lee CS, Aroua MK, Daud W, Cognet P, Pérès-Lucchese Y, Fabre P-L, Reynes O, Latapie L. 2015. A review: conversion of bioglycerol into 1,3-propanediol via biological and chemical method. Renew Sustain Energy Rev 42:963–972. doi: 10.1016/j.rser.2014.10.033. [DOI] [Google Scholar]
- 2.Tan HW, Abdul Aziz AR, Aroua MK. 2013. Glycerol production and its applications as a raw material: a review. Renew Sustain Energy Rev 27:118–127. doi: 10.1016/j.rser.2013.06.035. [DOI] [Google Scholar]
- 3.Quispe CAG, Coronado CJR, Carvalho JA Jr. 2013. Glycerol: production, consumption, prices, characterization and new trends in combustion. Renew Sustain Energy Rev 27:475–493. doi: 10.1016/j.rser.2013.06.017. [DOI] [Google Scholar]
- 4.Luo X, Ge X, Cui S, Li Y. 2016. Value-added processing of crude glycerol into chemicals and polymers. Bioresour Technol 215:144–154. doi: 10.1016/j.biortech.2016.03.042. [DOI] [PubMed] [Google Scholar]
- 5.Mitrea L, Trif M, Cătoi A-F, Vodnar D-C. 2017. Utilization of biodiesel derived-glycerol for 1,3-PD and citric acid production. Microb Cell Fact 16:190. doi: 10.1186/s12934-017-0807-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Liu H, Xu Y, Zheng Z, Liu D. 2010. 1,3-Propanediol and its copolymers: research, development and industrialization. Biotechnol J 5:1137–1148. doi: 10.1002/biot.201000140. [DOI] [PubMed] [Google Scholar]
- 7.Clomburg JM, Gonzalez R. 2013. Anaerobic fermentation of glycerol: a platform for renewable fuels and chemicals. Trends Biotechnol 31:20–28. doi: 10.1016/j.tibtech.2012.10.006. [DOI] [PubMed] [Google Scholar]
- 8.Chatzifragkou A, Papanikolaou S. 2012. Effect of impurities in biodiesel-derived waste glycerol on the performance and feasibility of biotechnological processes. Appl Microbiol Biotechnol 95:13–27. doi: 10.1007/s00253-012-4111-3. [DOI] [PubMed] [Google Scholar]
- 9.Yang X, Kim DS, Choi HS, Kim CK, Thapa LP, Park C, Kim SW. 2017. Repeated batch production of 1,3-propanediol from biodiesel derived waste glycerol by Klebsiella pneumoniae. Chem Eng J 314:660–669. doi: 10.1016/j.cej.2016.12.029. [DOI] [Google Scholar]
- 10.Guo Y, Dai L, Xin B, Tao F, Tang H, Shen Y, Xu P. 2017. 1,3-Propanediol production by a newly isolated strain, Clostridium perfringens GYL. Bioresour Technol 233:406–412. doi: 10.1016/j.biortech.2017.02.116. [DOI] [PubMed] [Google Scholar]
- 11.Vivek N, Pandey A, Binod P. 2016. Biological valorization of pure and crude glycerol into 1,3-propanediol using a novel isolate Lactobacillus brevis N1E9.3.3. Bioresour Technol 213:222–230. doi: 10.1016/j.biortech.2016.02.020. [DOI] [PubMed] [Google Scholar]
- 12.Singh N, Roy R, Srivastava SK, Choudhury B. 2018. Potential role of halophile in crude glycerol based biorefinery, p 167–186. In Kumar S, Sani R (ed), Biorefining of biomass to biofuels. Biofuel and biorefinery technologies, vol 4 Springer, Cham, Switzerland. [Google Scholar]
- 13.Dodd A, Swanevelder D, Zhou N, Brady D, Hallsworth JE, Rumbold K. 2018. Streptomyces albulus yields ε-poly-l-lysine and other products from salt-contaminated glycerol waste. J Ind Microbiol Biotechnol 45:1083–1090. doi: 10.1007/s10295-018-2082-9. [DOI] [PubMed] [Google Scholar]
- 14.Samul D, Leja K, Grajek W. 2014. Impurities of crude glycerol and their effect on metabolite production. Ann Microbiol 64:891–898. doi: 10.1007/s13213-013-0767-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Maervoet VE, De Maeseneire SL, Soetaert WK, De Mey M. 2014. Unraveling the dha cluster in Citrobacter werkmanii: comparative genomic analysis of bacterial 1,3-propanediol biosynthesis clusters. Bioprocess Biosyst Eng 37:711–718. doi: 10.1007/s00449-013-1041-0. [DOI] [PubMed] [Google Scholar]
- 16.Knietsch A, Bowien S, Whited G, Gottschalk G, Daniel R. 2003. Identification and characterization of coenzyme B12-dependent glycerol dehydratase- and diol dehydratase-encoding genes from metagenomic DNA libraries derived from enrichment cultures. Appl Environ Microbiol 69:3048–3060. doi: 10.1128/AEM.69.6.3048-3060.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Zhuge B, Zhang C, Fang H, Zhuge J, Permaul K. 2010. Expression of 1,3-propanediol oxidoreductase and its isoenzyme in Klebsiella pneumoniae for bioconversion of glycerol into 1,3-propanediol. Appl Microbiol Biotechnol 87:2177–2184. doi: 10.1007/s00253-010-2678-0. [DOI] [PubMed] [Google Scholar]
- 18.Biebl H, Menzel K, Zeng A-P, Deckwer W-D. 1999. Microbial production of 1,3-propanediol. Appl Microbiol Biotechnol 52:289–297. doi: 10.1007/s002530051523. [DOI] [PubMed] [Google Scholar]
- 19.Hong E, Yoon S, Kim J, Kim E, Kim D, Rhie S, Ryu YW. 2013. Isolation of microorganisms able to produce 1,3-propanediol and optimization of medium constituents for Klebsiella pneumoniae AJ4. Bioprocess Biosyst Eng 36:835–843. doi: 10.1007/s00449-013-0921-7. [DOI] [PubMed] [Google Scholar]
- 20.Wang Y, Tao F, Li C, Li L, Xu P. 2013. Genome sequence of Klebsiella pneumoniae strain ATCC 25955, an oxygen-insensitive producer of 1,3-propanediol. Genome Announc 1:e00587-13. doi: 10.1128/genomeA.00587-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Cheng K-K, Zhang J-A, Liu D-H, Sun Y, Liu H-J, Yang M-D, Xu J-M. 2007. Pilot-scale production of 1,3-propanediol using Klebsiella pneumoniae. Process Biochem 42:740–744. doi: 10.1016/j.procbio.2007.01.001. [DOI] [Google Scholar]
- 22.Chao Y, Ma L, Yang Y, Ju F, Zhang XX, Wu WM, Zhang T. 2013. Metagenomic analysis reveals significant changes of microbial compositions and protective functions during drinking water treatment. Sci Rep 3:3550. doi: 10.1038/srep03550. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Kumar V, Park S. 2018. Potential and limitations of Klebsiella pneumoniae as a microbial cell factory utilizing glycerol as the carbon source. Biotechnol Adv 36:150–167. doi: 10.1016/j.biotechadv.2017.10.004. [DOI] [PubMed] [Google Scholar]
- 24.Dobson R, Gray V, Rumbold K. 2012. Microbial utilization of crude glycerol for the production of value-added products. J Ind Microbiol Biotechnol 39:217–226. doi: 10.1007/s10295-011-1038-0. [DOI] [PubMed] [Google Scholar]
- 25.Chatzifragkou A, Papanikolaou S, Dietz D, Doulgeraki AI, Nychas GJ, Zeng AP. 2011. Production of 1,3-propanediol by Clostridium butyricum growing on biodiesel-derived crude glycerol through a non-sterilized fermentation process. Appl Microbiol Biotechnol 91:101–112. doi: 10.1007/s00253-011-3247-x. [DOI] [PubMed] [Google Scholar]
- 26.Chatzifragkou A, Dietz D, Komaitis M, Zeng AP, Papanikolaou S. 2010. Effect of biodiesel-derived waste glycerol impurities on biomass and 1,3-propanediol production of Clostridium butyricum VPI 1718. Biotechnol Bioeng 107:76–84. doi: 10.1002/bit.22767. [DOI] [PubMed] [Google Scholar]
- 27.Venkataramanan KP, Boatman JJ, Kurniawan Y, Taconi KA, Bothun GD, Scholz C. 2012. Impact of impurities in biodiesel-derived crude glycerol on the fermentation by Clostridium pasteurianum ATCC 6013. Appl Microbiol Biotechnol 93:1325–1335. doi: 10.1007/s00253-011-3766-5. [DOI] [PubMed] [Google Scholar]
- 28.Vijay K, Brody MS, Fredlund E, Price CW. 2000. A PP2C phosphatase containing a PAS domain is required to convey signals of energy stress to the σB transcription factor of Bacillus subtilis. Mol Microbiol 35:180–188. doi: 10.1046/j.1365-2958.2000.01697.x. [DOI] [PubMed] [Google Scholar]
- 29.Ferreira A, O'Byrne CP, Boor KJ. 2001. Role of σB in heat, ethanol, acid, and oxidative stress resistance and during carbon starvation in Listeria monocytogenes. Appl Environ Microbiol 67:4454–4457. doi: 10.1128/AEM.67.10.4454-4457.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Phadtare S, Alsina J, Inouye M. 1999. Cold-shock response and cold-shock proteins. Curr Opin Microbiol 2:175–180. doi: 10.1016/S1369-5274(99)80031-9. [DOI] [PubMed] [Google Scholar]
- 31.Jiang W, Wang S, Wang Y, Fang B. 2016. Key enzymes catalyzing glycerol to 1,3-propanediol. Biotechnol Biofuels 9:57. doi: 10.1186/s13068-016-0473-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Maurel C, Reizer J, Schroeder JI, Chrispeels MJ. 1994. Functional characterization of the Escherichia coli glycerol facilitator, GlpF, in Xenopus oocytes. J Biol Chem 269:11869–11872. [PubMed] [Google Scholar]
- 33.Ruzheinikov SN, Burke J, Sedelnikova S, Baker PJ, Taylor R, Bullough PA, Muir NM, Gore MG, Rice DW. 2001. Glycerol dehydrogenase: structure, specificity, and mechanism of a family III polyol dehydrogenase. Structure 9:789–802. doi: 10.1016/S0969-2126(01)00645-1. [DOI] [PubMed] [Google Scholar]
- 34.Wang Y, Tao F, Xu P. 2014. Glycerol dehydrogenase plays a dual role in glycerol metabolism and 2,3-butanediol formation in Klebsiella pneumoniae. J Biol Chem 289:6080–6090. doi: 10.1074/jbc.M113.525535. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Zhang Q, Teng H, Sun Y, Xiu Z, Zeng A. 2008. Metabolic flux and robustness analysis of glycerol metabolism in Klebsiella pneumoniae. Bioprocess Biosyst Eng 31:127–135. doi: 10.1007/s00449-007-0155-7. [DOI] [PubMed] [Google Scholar]
- 36.Toraya T, Tanokuchi A, Yamasaki A, Nakamura T, Ogura K, Tobimatsu T. 2016. Diol dehydratase-reactivase is essential for recycling of coenzyme B12 in diol dehydratase. Biochemistry 55:69–78. doi: 10.1021/acs.biochem.5b01023. [DOI] [PubMed] [Google Scholar]
- 37.Seo JW, Seo MY, Oh BR, Heo SY, Baek JO, Rairakhwada D, Luo LH, Hong W-K, Kim CH. 2010. Identification and utilization of a 1,3-propanediol oxidoreductase isoenzyme for production of 1,3-propanediol from glycerol in Klebsiella pneumoniae. Appl Microbiol Biotechnol 85:659–666. doi: 10.1007/s00253-009-2123-4. [DOI] [PubMed] [Google Scholar]
- 38.Jarboe LR. 2011. YqhD: a broad-substrate range aldehyde reductase with various applications in production of biorenewable fuels and chemicals. Appl Microbiol Biotechnol 89:249–257. doi: 10.1007/s00253-010-2912-9. [DOI] [PubMed] [Google Scholar]
- 39.Holt JG, Krieg NR, Sneath PHA, Staley JT, Williams ST. 1994. Bergey's manual of determinative bacteriology, 9th ed Williams & Wilkins, Baltimore, MD. [Google Scholar]
- 40.Raj SM, Rathnasingh C, Jung W-C, Selvakumar E, Park S. 2010. A novel NAD+-dependent aldehyde dehydrogenase encoded by the puuC gene of Klebsiella pneumoniae DSM 2026 that utilizes 3-hydroxypropionaldehyde as a substrate. Biotechnol Bioprocess Eng 15:131–138. doi: 10.1007/s12257-010-0030-2. [DOI] [Google Scholar]
- 41.Zhang L, Xu Q, Peng X, Xu B, Wu Y, Yang Y, Sun S, Hu K, Shen Y. 2014. Cloning, expression and characterization of glycerol dehydrogenase involved in 2,3-butanediol formation in Serratia marcescens H30. J Ind Microbiol Biotechnol 41:1319–1327. doi: 10.1007/s10295-014-1472-x. [DOI] [PubMed] [Google Scholar]
- 42.Shin SH, Kim S, Kim JY, Lee S, Um Y, Oh MK, Kim YR, Lee J, Yang KS. 2012. Complete genome sequence of Klebsiella oxytoca KCTC 1686, used in production of 2,3-butanediol. J Bacteriol 194:2371–2372. doi: 10.1128/JB.00026-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Zhao Y, Wu J, Yang J, Sun S, Xiao J, Yu J. 2012. PGAP: pan-genomes analysis pipeline. Bioinformatics 28:416–418. doi: 10.1093/bioinformatics/btr655. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Overbeek R, Olson R, Pusch GD, Olsen GJ, Davis JJ, Disz T, Edwards RA, Gerdes S, Parrello B, Shukla M, Vonstein V, Wattam AR, Xia F, Stevens R. 2014. The SEED and the rapid annotation of microbial genomes using subsystems technology (RAST). Nucleic Acids Res 42:D206–D214. doi: 10.1093/nar/gkt1226. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Ma J, Zhang K, Liao H, Hector SB, Shi X, Li J, Liu B, Xu T, Tong C, Liu X, Zhu Y. 2016. Genomic and secretomic insight into lignocellulolytic system of an endophytic bacterium Pantoea ananatis Sd-1. Biotechnol Biofuels 9:25. doi: 10.1186/s13068-016-0439-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Mu Y, Teng H, Zhang DJ, Wang W, Xiu ZL. 2006. Microbial production of 1,3-propanediol by Klebsiella pneumoniae using crude glycerol from biodiesel preparations. Biotechnol Lett 28:1755–1759. doi: 10.1007/s10529-006-9154-z. [DOI] [PubMed] [Google Scholar]
- 47.Moon C, Ahn JH, Kim SW, Sang BI, Um Y. 2010. Effect of biodiesel-derived raw glycerol on 1,3-propanediol production by different microorganisms. Appl Biochem Biotechnol 161:502–510. doi: 10.1007/s12010-009-8859-6. [DOI] [PubMed] [Google Scholar]
- 48.Metsoviti M, Paraskevaidi K, Koutinas A, Zeng A-P, Papanikolaou S. 2012. Production of 1,3-propanediol, 2,3-butanediol and ethanol by a newly isolated Klebsiella oxytoca strain growing on biodiesel-derived glycerol based media. Process Biochem 47:1872–1882. doi: 10.1016/j.procbio.2012.06.011. [DOI] [Google Scholar]
- 49.Rossi DM, de Souza EA, Flôres SH, Ayub M. 2013. Conversion of residual glycerol from biodiesel synthesis into 1,3-propanediol by a new strain of Klebsiella pneumoniae. Renew Energy 55:404–409. doi: 10.1016/j.renene.2012.12.048. [DOI] [Google Scholar]
- 50.Wu J, Wang F, Wang Z, Ye H, Liu P. 2016. 1,3-Propanediol production from crude glycerol by Klebsiella pneumoniae. Chiang Mai J Sci 43:718–725. [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The complete genome sequence of K. pneumoniae 2e was deposited at DDBJ/EMBL/GenBank under accession numbers CP028478 to CP028480.