Edwardsiella piscicida is one of the most important marine pathogens and causes serious edwardsiellosis in farmed fish during the summer-autumn seasonal changes, resulting in enormous losses to aquaculture industries worldwide. Survival and transmission of the pathogen in seawater are critical steps that increase the risk of outbreaks. To investigate the mechanism of survival in seawater for this marine pathogen, we used transposon insertion sequencing analysis to explore the fitness determinants in summer and autumn seawater. Approximately 127 genes linked to metabolism and virulence, as well as other processes, were revealed in E. piscicida to contribute to better adaptations to the seasonal alternations of seawater environments; these genes provide important insights into the infection outbreak mechanisms of E. piscicida and potential improved treatments or vaccines against marine pathogens.
KEYWORDS: Edwardsiella piscicida, T3SS, transposon insertion sequencing, TIS, oxidative phosphorylation, seawater, temperature
ABSTRACT
Marine pathogens are transmitted from one host to another through seawater. Therefore, it is important for marine pathogens to maintain survival or growth in seawater. However, little is known about how marine pathogens adapt to living in seawater environments. Here, transposon insertion sequencing was performed to explore the genetic determinants of Edwardsiella piscicida survival in seawater at 16 and 28°C. Seventy-one mutants with mutations mainly in metabolism-, transportation-, and type III secretion system (T3SS)-related genes showed significantly increased or impaired fitness in 16°C water. In 28°C seawater, 63 genes associated with transcription and translation, as well as energy production and conversion, were essential for optimal survival of the bacterium. In particular, 11 T3SS-linked mutants displayed enhanced fitness in 16°C seawater but not in 28°C seawater. In addition, 13 genes associated with oxidative phosphorylation and 4 genes related to ubiquinone synthesis were identified for survival in 28°C seawater but not in 16°C seawater, which suggests that electron transmission and energy-producing aerobic respiration chain factors are indispensable for E. piscicida to maintain survival in higher-temperature seawater. In conclusion, we defined genes and processes related to metabolism and virulence that operate in E. piscicida to facilitate survival in low- and high-temperature seawater, which may underlie the infection outbreak mechanisms of E. piscicida and facilitate the development of improved vaccines against marine pathogens.
IMPORTANCE Edwardsiella piscicida is one of the most important marine pathogens and causes serious edwardsiellosis in farmed fish during the summer-autumn seasonal changes, resulting in enormous losses to aquaculture industries worldwide. Survival and transmission of the pathogen in seawater are critical steps that increase the risk of outbreaks. To investigate the mechanism of survival in seawater for this marine pathogen, we used transposon insertion sequencing analysis to explore the fitness determinants in summer and autumn seawater. Approximately 127 genes linked to metabolism and virulence, as well as other processes, were revealed in E. piscicida to contribute to better adaptations to the seasonal alternations of seawater environments; these genes provide important insights into the infection outbreak mechanisms of E. piscicida and potential improved treatments or vaccines against marine pathogens.
INTRODUCTION
Marine pathogens cause outbreaks of infectious diseases in aquatic animals, particularly in farmed fish (1). Most pathogens utilize host nutrients to grow and then are shed back into seawater before transmission. Thus, seawater is an important vehicle for the survival and transmission of pathogenic microbes, particularly in aquaculture industries. In addition, the outbreaks of fish diseases are always associated with seawater temperature changes due to seasonal alternations and with other factors that influence pathogen growth and survival, including shifts in plankton concentrations, nutrient availability, salinity, and dissolved oxygen content (2). For example, outbreaks of Vibrio alginolyticus are associated with increasing seawater temperature (3) and lead to serious coral bleaching and fish diseases in summer seasons (4). Due to the limited availability of nutrients in seawater, the strategies pathogens use to adapt to and survive in seawater are critically important for host infection (5). Thus, it is important to investigate genetic determinants for pathogen survival and transmission in seawater.
Edwardsiella piscicida (formerly named E. tarda) (6, 7) is an important etiological agent of edwardsiellosis in marine fish, especially in farmed fish during the summer-autumn seasonal changes, resulting in enormous losses to aquaculture industries worldwide (8). E. piscicida is a member of the Enterobacteriaceae and has a broad host range, such as turbot, flounder, and ∼20 other piscine species (9). The major virulence determinants are the type III secretion system (T3SS) and the T6SS in E. piscicida, and their expression is subjected to a complex regulatory network with involvement of the key regulators EsrA, EsrB, and EsrC (10–12) upon bacterial entrance of appropriate niches in the host. Little is known about how these virulence factors and other factors contribute to the environmental adaptation and survival for E. piscicida in a broad range of fish species, especially in some farmed marine fish (13). Thus, E. piscicida could be used as a model organism to investigate the genetic determinants of survival and transmission in seawater.
Transposon insertion mutagenesis coupled with next-generation sequencing (TIS) has been developed as a powerful technique to explore gene function under a multitude of conditions (14, 15). In TIS analysis of high-density transposon insertion libraries, the insertion frequency at each locus or the relative abundance of corresponding mutants is generally inversely correlated with the locus’s contribution to fitness following the imposition of a selective pressure, such as that imposed by hosts, antibiotics, and so on (14). The principles of this methodology underlie a variety of related approaches, including TIS, transposon sequencing (TnSeq), insertion sequencing (INSeq), transposon-directed insertion site sequencing (TraDIS), high-throughput insertion tracking by deep sequencing (HITS), and transposon insertion site sequencing (TIS-Seq) (14, 16–18); these approaches are revolutionizing microbiological studies by facilitating unprecedented and deep genome-wide explorations of a wide range of bacterial species.
Here, TIS analysis was applied to an established transposon insertion mutant library of E. piscicida (19) and was utilized to investigate the genetic determinants for this organism’s survival in low (16°C)- and high (28°C)-temperature seawater. Approximately 127 genes linked to metabolism and virulence, as well as other processes, facilitate E. piscicida survival in seawater at different temperatures. In particular, the mutants of T3SS-related genes, including esrA, esrB, esrC, and esaM, significantly increased the fitness of E. piscicida in lower-temperature seawater, and the bacterium was essentially dependent on oxidative phosphorylation and ubiquinone synthesis to produce energy to maintain survival in higher-temperature seawater. These data revealed temperature cues and the corresponding genetic traits for marine pathogen survival in alternating natural environments before colonizing a host, thus providing new insights into the contribution of virulence genes to the physiological fitness of E. piscicida.
RESULTS
TIS analysis to determine the genome-wide fitness of E. piscicida in seawater at 16 and 28°C.
A high-density transposon insertion mutant library of E. piscicida was previously constructed based on the mariner Himar1 transposon that specifically recognizes the thiamine and adenine nucleoside (TA) loci in the genome (19). This library contained 80,616 distinct insertion mutants, covering 57.19% of the TA sites of the E. piscicida genome, and thus is highly complex and approaches saturation of insertion sites (19). With this transposon insertion mutant library, we performed conditional essential gene screening in seawater at 28 and 16°C to simulate the highest surface seawater temperatures in the farms in Yantai, Shandong province, China, in the summer and autumn seasons (20), respectively. After overnight incubation in Luria-Bertani (LB) broth, the transposon insertion mutant library (used as the input library) was inoculated into filtered natural seawater from a fish farm in Yantai, Shandong province (121.39°E, 37.52°N), where E. piscicida EIB202 was initially isolated (20) (Table 1) and incubated at 16 and 28°C without shaking. After 48 h of incubation in seawater, the bacteria were harvested and inoculated into LB medium until an optical density at 600 nm (OD600) of 1.0 was reached (this was taken as the output library) to eliminate DNA contamination from dead bacteria. The transposition loci and the abundance of the insertions were determined using the EL-ARTIST pipeline (21). The read abundance in 16 and 28°C seawater was normalized to that of the input libraries (see Tables S1 and S2 in the supplemental material). The three input libraries and the three independent replicates of the 16 and 28°C seawater output libraries showed high internal correlations (input, R2 = 0.993 ∼ 0.998; 16°C output, R2 = 0.888 ∼ 0.904; 28°C output, R2 = 0.714 ∼ 0.921) (Fig. S1).
TABLE 1.
Strains and plasmids used in this study
| Strain or plasmid | Description | Source or reference |
|---|---|---|
| Strains | ||
| Edwardsiella piscicida | ||
| EIB202 | WT, CCTCC M208068; Colr Strr Cmr | 20 |
| WT(Δp) | WT, with pEIB202 cured; Colr Strs Cms | Lab collection |
| ΔesrA | EIB202, in-frame deletion of esrA; Colr | Lab collection |
| ΔesrB | EIB202, in-frame deletion of esrB; Colr | 12 |
| ΔesrC | EIB202, in-frame deletion of esrC; Colr | This study |
| ΔesaM | EIB202, in-frame deletion of esaM; Colr | This study |
| ΔnuoM | EIB202, in-frame deletion of nuoM; Colr | This study |
| ΔnuoJ | EIB202, complementation of nuoJ; Colr | This study |
| ΔnuoI | EIB202, in-frame deletion of nuoI; Colr | This study |
| ΔevpP | EIB202, in-frame deletion of evpP; Colr | 45 |
| ΔevpC | EIB202, in-frame deletion of evpC; Colr | 46 |
| ΔesrC+ | EIB202, complementation of esrC; Colr Ampr | This study |
| ΔesaM+ | EIB202, complementation of esaM; Colr Ampr | This study |
| ΔnuoM+ | EIB202, complementation of nuoM; Colr Ampr | This study |
| ΔnuoJ+ | EIB202, complementation of nuoJ; Colr Ampr | This study |
| Escherichia coli | ||
| DH5α λpir | Host for π requiring plasmids | Lab collection |
| SM10 λpir | Host for π requiring plasmids, conjugal donor | Lab collection |
| Plasmids | ||
| pDMK | Suicide plasmid, pir dependent, R6K, sacBR; Kmr | Lab collection |
| pDMK-esaM | Derivative of pDM4, for the construction of deletion; Cmr | This study |
| pDMK-nuoM | Derivative of pDM4, for the construction of deletion; Cmr | This study |
| pDMK-nuoJ | Derivative of pDM4, for the construction of deletion; Cmr | This study |
| pDMK-nuoI | Derivative of pDM4, for the construction of deletion; Cmr | This study |
| pUTt | Complementation vector; Ampr | 31 |
| pUTt-esaM | Derivative of pUTt, for complementation; Cmr | This study |
| pUTt-nuoM | Derivative of pUTt, for complementation; Cmr | This study |
| pUTt-nuoJ | Derivative of pUTt, for complementation; Cmr | This study |
We were particularly interested in the genes and cellular processes that might contribute to or impair the fitness of E. piscicida grown in 16 or 28°C seawater (Fig. 1). A total of 158 mutants, including 87 mutants with insertions in intergenic regions (55.0%) and 71 gene mutants (45.0%), displayed significant differences (SDs), i.e., Abs[log2(output/input or fold change)] ≥ 2.0, P < 0.05, and input reads of >20, in fitness in 16°C seawater (Fig. 1A and C; Table S1). Among the mutants with SDs in abundance in 16°C seawater, a total of 25 gene mutants (15.8%), including 13 T3SS gene mutants, showed significantly enhanced survival (Fig. 1A and 2A). Some T6SS-related mutants also showed slight survival enhancement in 16°C seawater, such as evpP (log2FC = 1.63), evpC (log2FC = 1.46), and evpJ (log2FC = 1.60) mutants (Table S1). In addition, 46 of 71 gene mutants displayed survival defects under 16°C seawater conditions (Fig. 2B; Table S3).
FIG 1.
Fitness of E. piscicida transposon mutants in 16 and 28°C seawater. (A and B) Scatter plots of the abundance of the transposon insertion mutants grown in LB (input) and in 16°C (A) and 28°C (B) seawater (output). Representation of the mutants (highlighted as blue triangles) with significant differences (SDs) based on a cutoff of Abs[log2(output/input)] ≥ 2.0 and P < 0.05; the fitness values for the mutants of the T3SS (red squares) and T6SS (green diamonds) genes are also highlighted. (C and D) Scatter plots of the fold change (FC) output/input ratios and P values of the transposon insertion mutants after survival in 16°C (C) and 28°C (D) seawater. Red squares represent P < 0.001, and blue triangles represent 0.01 < P < 0.001. The genes esrA, esrB, and esrC related to T3SS expression (A and C) and nuoI, nuoJ, and nuoM linked to oxidative phosphorylation (B and D) are highlighted. ND, nonsignificant difference.
FIG 2.
TIS analysis of the genes with significantly differential representation in 16 and 28°C seawater. (A and B) Venn diagram of the genes with relative read counts that significantly increased, i.e., indicating survival enhancement [log2(FC) ≥ 2.0, P < 0.05, and reads > 20] (A), or that significantly declined, i.e., indicating survival defects [log2(FC) ≤ −2.0, P < 0.05, and reads > 20] (B), in 16 and 28°C seawater. (C) The genes with significantly differential representation in the 16 and 28°C seawater were categorized and analyzed by COG categories.
Moreover, a total of 75 mutants, including 12 (16.0%) mutants with insertions in intergenic regions and 63 (84.0%) gene mutants, showed SDs in fitness in 28°C seawater (Fig. 1B and D; Table S2), among which eight gene mutants, namely, pspE, deoR, fruR, tadA, phoU, nagC, ETAE_2298, and ETAE_0374 mutants (Fig. 2A; Table S4), showed significant survival enhancement at 28°C. There were 55 gene mutants that showed significantly impaired survival in 28°C seawater, among which 7 genes, i.e., xerC, hflK, mraW, fadR, rluB, nlpD, and lpxH, overlapped with the genes essential for survival in 16°C seawater (Fig. 2B and Table 2), which suggested that these genes are essential for E. piscicida survival in seawater independent of temperature alternations. Interestingly, the tadA mutant for the gene encoding tRNA-specific adenosine deaminase showed a survival defect (log2FC = −2.67) in 16°C seawater but a survival enhancement (log2FC = 2.15) in 28°C seawater (Table 2). Mutants for ubiE, ubiF, ubiG, and ubiH, which are related to ubiquinone biosynthesis, displayed survival defects (log2FC = −5.04, −2.01, −5.04, and −5.04, respectively) in 28°C seawater but survival enhancement (log2FC = 2.22, 2.29, 1.54, and 2.17, respectively) in 16°C seawater (Table 2). None of the T3/T6SS-related mutants showed noticeable fitness differences in the 28°C seawater (Fig. 1B; Table S2).
TABLE 2.
Representative genes with significant changes in fitness in 16 and 28°C seawater
| Gene_ID | Gene | Annotation | Log2(FC) |
|
|---|---|---|---|---|
| 16°C | 28°C | |||
| ETAE_0124 | xerC | Site-specific recombinase | –3.115 | –2.700 |
| ETAE_0354 | hflK | FtsH protease regulator | –2.146 | –3.334 |
| ETAE_0629 | mraW | S-Adenosyl-methyltransferase | –2.732 | –2.102 |
| ETAE_1472 | fadR | Fatty acid metabolism regulator | –2.030 | –3.740 |
| ETAE_1545 | rluB | Ribosomal large subunit pseudouridine synthase B | –2.555 | –2.031 |
| ETAE_2874 | nlpD | Outer membrane lipoprotein | –2.171 | –3.501 |
| ETAE_3554 | lpxH | UDP-2,3-diacyl glucosamine pyrophosphatase | –3.481 | –3.259 |
| ETAE_0772 | tadA | tRNA-specific adenosine deaminase | –2.672 | 2.313 |
| ETAE_2624 | ubiF | 2-Octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase | 2.296 | –2.011 |
| ETAE_0854 | esaL | Putative type III secretion apparatus | 2.262 | 0.128 |
| ETAE_0860 | esaG | Putative type III secretion system needle protein | 2.074 | 0.140 |
| ETAE_0861 | esrC | Putative transcriptional regulator | 3.482 | 0.191 |
| ETAE_0868 | eseE | Type III secretion system effector protein E | 2.669 | 0.361 |
| ETAE_0879 | esaM | Type III secretion apparatus protein | 2.403 | –0.541 |
| ETAE_0881 | esaS | Type III secretion apparatus | 2.230 | 0.026 |
| ETAE_0882 | esaT | Type III secretion system EscT homologue | 2.574 | 0.408 |
| ETAE_0883 | esaU | Type III secretion system EscU homologue | 2.874 | 0.167 |
| ETAE_0884 | Putative transglycosylase signal peptide protein | 3.968 | 0.477 | |
| ETAE_0885 | esrA | Two-component sensor/regulator | 4.273 | 0.129 |
| ETAE_0886 | esrB | Two-component sensor/regulator | 4.281 | 0.022 |
| ETAE_2373 | nuoN | NADH:ubiquinone oxidoreductase subunit 2 (chain N) | 0.137 | –4.468 |
| ETAE_2374 | nuoM | NADH:ubiquinone oxidoreductase subunit 4 (chain M) | 1.059 | –4.445 |
| ETAE_2375 | nuoL | NADH:ubiquinone oxidoreductase subunit 5 (chain L)/multisubunit Na+/H+ antiporter, MnhA subunit | 1.088 | –5.290 |
| ETAE_2376 | nuoK | NADH:ubiquinone oxidoreductase subunit 11 or 4L (chain K) | 1.005 | –5.219 |
| ETAE_2377 | nuoJ | NADH:ubiquinone oxidoreductase subunit 6 (chain J) | –0.287 | –2.224 |
| ETAE_2378 | nuoI | Formate hydrogenlyase subunit 6/NADH:ubiquinone oxidoreductase 23-kDa subunit (chain I) | 0.508 | –2.952 |
| ETAE_2379 | nuoH | NADH:ubiquinone oxidoreductase subunit 1 (chain H) | 0.959 | –2.366 |
| ETAE_2380 | nuoG | NADH dehydrogenase/NADH:ubiquinone oxidoreductase 75-kDa subunit (chain G) | 0.266 | –5.612 |
| ETAE_2381 | nuoF | NADH:ubiquinone oxidoreductase, NADH-binding (51-kDa) subunit | 0.783 | –4.407 |
| ETAE_2382 | nuoE | NADH:ubiquinone oxidoreductase 24-kDa subunit | 1.284 | –5.170 |
| ETAE_2383 | nuoD | NADH:ubiquinone oxidoreductase 49-kDa subunit 7 | 0.596 | –5.028 |
| ETAE_2384 | nuoB | NADH:ubiquinone oxidoreductase 20-kDa subunit and related Fe-S oxidoreductases | 1.180 | –4.402 |
| ETAE_2385 | nuoA | NADH:ubiquinone oxidoreductase subunit 3 (chain A) | 1.769 | –5.044 |
| ETAE_0147 | ubiE | Ubiquinone/menaquinone biosynthesis methyltransferase | 2.224 | –5.044 |
| ETAE_2337 | ubiG | 3-Demethyl ubiquinone-9 3-methyltransferase | 1.540 | –5.044 |
| ETAE_2944 | ubiH | 2-Octaprenyl-6-methoxyphenyl hydroxylase | 2.167 | –5.044 |
Cluster of Orthologous Group (COG) analysis further revealed that 19 (30.1%) genes were related to transcription, translation, and modification and were essential for growth at 28°C; this cluster had the highest ranking of all the categories (Fig. 2C). Totals of 17 and 1 (23.7 and 1.6%) genes were classified as associated with the metabolism and transport of amino acids, carbohydrates, lipids, and nucleotides, respectively; these gene clusters were identified in both the in 16 and 28°C seawater libraries (Fig. 2C). In addition, a total of 11 (15.4%) T3SS-related mutants, including ETAE_0884, esaL, esaG, easT, esaM, esaS, esaU, eseE, esrA, esrB, and esrC mutants, displayed survival enhancement (log2FC ≥ 2.0, P < 0.05) in 16°C seawater but not in 28°C seawater (Fig. 2C and Table 2). In particular, the growth of the mutants of esrA (log2FC = 4.27, P = 0.0040), esrB (log2FC = 4.28, P = 0.0063), and esrC (log2FC = 3.48, P = 0.0020) (Fig. 1C), the T3/T6SS master regulators, dramatically increased after selection in 16°C seawater. Interestingly, 2 and 17 (2.8 and 27.0%) genes categorized as being related to energy production and conversion, respectively, were enriched after treatment in 16 and 28°C seawater. In particular, 13 NADH metabolism-related genes, i.e., nuoA, nuoB, nuoD, nuoE, nuoF, nuoG, nuoH, nuoI, nuoJ, nuoK, nuoL, nuoM, and nuoN, responsible for oxidative phosphorylation were shown to be essential for survival in 28°C seawater at a high significance level. In addition, another four energy production- and conversion-related genes, ETAE_0728 (flavodoxin), ETAE_0770 (alcohol dehydrogenase), gltA, and fpr, were also essential for growth in 28°C seawater (Table 2), which suggests that E. piscicida is essentially dependent on oxidative phosphorylation to obtain energy for the maintenance of survival in 28°C seawater.
Validation of TIS analysis.
To validate the TIS data, 10 genes, namely, esrA, esrB, esrC, esaM, nuoM, nuoJ, nuoI, evpP, evpC, and evpI (Table 2), were selected to create their respective in-frame deletion mutants. Competitive index (CI) assays were performed with equally mixed wild type (WT; containing the endogenous streptomycin resistance plasmid pEIB202 [Strr]) or deletion mutant strain and WT(Δp); the WT strain cured for the plasmid pEIB202, i.e., WT(Δp) (streptomycin sensitive [Strs]), showed no growth defects (19) in 16 or 28°C LB and seawater. None of the mutants exhibited noticeable growth defects or enhancement in 16 or 28°C LB medium (Fig. 3). However, in 16°C seawater but not in 28°C seawater, the esrA, esrB, esrC, and esaM mutants significantly outcompeted the WT strain and showed enhanced fitness (Fig. 3). In 28°C seawater, nuoM, nuoJ, and nuoI mutants were significantly outcompeted by the WT strain (Fig. 3B), although no significant variations were observed for their respective CIs in 16°C seawater. The growth of the mutants of the T6SS genes, i.e., evpP, evpC, and evpI, did not display significant differences in either 16 or 28°C seawater (Fig. 3), suggesting that the enhanced survival resulting from the deletion of esrA, esrB, or esrC, encoding pivotal regulators for both T3SS and T6SS (10–12), might be associated with their regulatory roles in T3SS but not T6SS expression. Thus, these data validated the above TIS analysis.
FIG 3.
Competitive index (CI) assays to validate the TIS data from the 16 and 28°C seawater. (A and B) The indicated strain was mixed with the WT(Δp) strain at a ratio of 1:1 and inoculated into filtered seawater for CI assays and incubated at 16°C (A) and 28°C (B). At 48 h postincubation, the bacterial numbers were counted by plating on LB agar. The data are presented as means ± standard deviations. *, P < 0.05; ***, P < 0.001 [based on ANOVA, followed by Bonferroni’s multiple-comparison posttest, to compare the data to the values for the corresponding WT/WT(Δp) strain values, which are Str resistant or sensitive for discrimination of the bacterial cells in the LB agar plates in the presence or absence of Str].
Expression of T3SS increased the fitness burden of E. piscicida survival in 16°C seawater.
E. piscicida did not normally grow in 28°C seawater after 24 h of incubation, probably due to the nutrient limitation in filtered natural seawater (Fig. 4A). Afterward, the survival of the WT strain dramatically decreased in 28°C seawater, particularly after 36 h of incubation (Fig. 4A). The survival capabilities of the esrA, esrB, esrC, and esaM mutants were significantly enhanced compared to that of the WT strain and the ΔesaM+ and ΔesrC+ complement strains in 16°C seawater but displayed no differences in 28°C seawater (Fig. 4A). To further investigate the influence of T3SS on E. piscicida survival in 16°C seawater, we measured the transcription of esrA, esrB, esrC, and esaM in 16 and 28°C seawater by quantitative reverse transcription-PCR (qRT-PCR). Compared to that in 28°C seawater, the transcription of T3SS, including esrA, esrC, and esaM, in 16°C seawater was significantly increased (Fig. 4B). Due to the low transcript level of esrB, the transcriptional variations of esrB were difficult to detect by qRT-PCR in 16 and 28°C seawater (Fig. 4B). These results suggest that the enhanced T3SS expression in 16°C seawater may greatly reduce the fitness and survival of E. piscicida at this temperature compared to higher temperatures.
FIG 4.
T3SS is the burden for E. piscicida survival in 16°C seawater. (A) Growth curves of WT, ΔesrA, ΔesrB, ΔesrC, ΔesaM, ΔesrC+, and ΔesaM+ strains in 16 or 28°C seawater. The live bacteria were detected at the indicated time points by plating on LB agar. (B) Relative transcription levels of T3SS-related genes in 16 and 28°C seawater analyzed by qRT-PCR. gyrB was used as a control. n = 3; *, P < 0.05; ***, P < 0.001; NS, not significant (based on the Student t test).
Survival in higher-temperature seawater is dependent on active oxidative phosphorylation and energy production.
The number of living bacteria dramatically decreased after 36 h of growth in 28°C seawater but not in 16°C seawater (Fig. 4A). We speculated that physiological processes associated with enhanced metabolism might mediate the decrease in the number of living bacteria in the 28°C seawater. The rate of oxygen consumption is an indicator of active metabolism in bacteria (22). We first detected changes in dissolved oxygen content in seawater at 16 and 28°C during E. piscicida incubation. The initial relative dissolved oxygen percentage in 16°C seawater (77.0%) was significantly higher than that in 28°C seawater (67.7%) (Fig. 5A). The consumption rate of dissolved oxygen by the WT strain in 28°C seawater was significantly higher than that by the WT strain at 16°C (Fig. 5B), and the survival rate of the WT strain in 28°C seawater was significantly lower than that observed at 16°C (Fig. 4A). These results suggest that the metabolic rate of the WT strain is higher in 28°C seawater than in 16°C seawater. Indeed, the growth rate of the WT strain at 28°C in LB medium was significantly higher than that of the WT strain at 16°C in LB medium without the restraint of dissolved oxygen under shaking conditions (Fig. 5C). Similarly, the growth rate of the WT strain at 28°C in LB medium with shaking was significantly higher than that of the WT strain without shaking (Fig. 5C). Compared to the WT strain, the nuoM, nuoJ, and nuoI mutants associated with electron transmission, oxidative phosphorylation, and energy production showed decreased consumption rates of dissolved oxygen in both 16 and 28°C seawater, particularly in the latter condition (Fig. 5B), and showed dramatically impaired survival at 28°C (Fig. 5D). Moreover, all of the strains showed higher growth at 28°C than at 16°C in LB medium (Fig. 5C). Taken together, these results suggest that dissolved oxygen and energy production are necessarily important for E. piscicida survival in 28°C seawater to meet the enhanced bacterial requirements for metabolism in high-temperature seawater.
FIG 5.
Survival in higher-temperature seawater is dependent on active oxidative phosphorylation. (A) Relative dissolved oxygen levels in 16 and 28°C seawater (n = 3; *, P < 0.05, based on the Student t test). (B) Relative oxygen consumption in WT, ΔnuoM, ΔnuoJ, ΔnuoI, ΔnuoM+, and ΔnuoJ+ strains. The dissolved oxygen content in 16 and 28°C seawater was measured at the indicated time points. Seawater without bacterial inoculation was used as a blank control. Three independent replicates were performed. (C) Growth of the indicated strains in 16 and 28°C LB medium with or without shaking. (D) Survival curves of WT, ΔnuoM, ΔnuoJ, ΔnuoI, ΔnuoM+, and ΔnuoJ+ strains incubated statically in 16 and 28°C seawater. The live bacteria were detected at the indicated time points by plating on LB agar. ***, P < 0.001, based on the Student t test.
DISCUSSION
Outbreaks of edwardsiellosis in farmed fish usually occur during the summer-autumn seasonal changes when the seawater surface temperatures drastically change (23–26). Identification of the genetic determinants for survival and transmission in both warmer (summer)- and cooler (autumn)-temperature seawater is key to understanding the dynamics of E. piscicida outbreaks (6, 27, 28). Here, we harnessed the power of TIS technology to investigate the genetic determinants of E. piscicida survival in seawater at 16 and 28°C to simulate the conditions in the summer and autumn seasons. We discovered that the genes and processes required for survival under high- and low-temperature seawater conditions are highly variable in E. piscicida (Tables S1 and S2). Principally, our investigation revealed that energy production and conversion is the key process that supports E. piscicida survival in high-temperature seawater (Fig. 2C). However, E. piscicida mainly relies on carbohydrate metabolism, amino acid metabolism, and nucleotide metabolism for survival in lower-temperature seawater (Fig. 2C). The twin-arginine translocation (Tat) system related to the osmotic stress response (29, 30) is also involved in the optimal fitness of the survival of the bacterium in 16°C seawater (Table 2). Unexpectedly, mutation of T3SS-related genes significantly increased the fitness and survival of the bacterium in low-temperature seawater (Fig. 1and Table 2). This study highlighted the scenarios where E. piscicida adapts to the environmental conditions and alters the patterns of the expression of essential genes for survival before successful infections.
TIS analysis has been proven to be a powerful technology for forward genetic screens, with the massive parallel sequencing of transposon insertions of a gene and statistical analysis of the abundance of the insertions, as well as genetically linked genes in cistronic gene clusters and metabolic related pathways (14–19). Previous time-resolved TIS analysis indicates that ∼540 and ∼417 genes, respectively, are essential for E. piscicida grown in LB medium and in turbot (19). T3SS and T6SS genes are essential for in vivo colonization in the bacterium (11, 31–33). Here, T3SS genes linked in a genomic island and the nuoA-nuoN genes in the same cistron (6) were shown to be involved in the growth fitness in lower and higher temperatures of seawater (Fig. 1 and 3). The limitations of the mariner transposon-based TIS analysis or false-positive hits from highly correlated libraries seem to appear in the genes with fewer TA sites. For example, the mutant of ETAE_1714–ETAE1715 (bioD-yhjA) showed underrepresentation (log2FC = 1.05) with extremely low P values (6.45 × 10−6) in 16°C seawater; minE and ETAE_1778 (nifJ) displayed drastically decreased representation (log2FC = −4.98 and −3.81, respectively) with high P values (0.031 and 0.058, respectively) (Fig. 1C and D). Due to the paucity in TA sites, correspondingly few input reads in TIS data for these genes were observed: bioD-yhjA, 3 TAs with 19 reads; minE, 11 TAs with 31 reads; and ETAE_1778, 1 TA with 13 reads. Thus, checking both the FC derived from the output versus input libraries (Fig. 1A and B) and the P values (Fig. 1C and D) prior to comparisons of the TA site number is a good way to avoid false-positive results in TIS analysis.
Limited availabilities of iron, nutrients, and cofactors in seawater (34) likely represent significant stress cues for bacterial growth. Consistent with this, RpoS, an alternative sigma factor enabling transcription of genes associated with the general stress response and stationary-phase metabolism in Gram-negative bacteria, including E. piscicida (31), and other waterborne pathogens, including Legionella pneumophila (35), was highly essential (log2FC = −7.86, P = 0.0006119) during growth in 28°C seawater (Table S4). In L. pneumophila, the disruption of rpoS resulted in a strong survival defect in defined water medium compared to the wild type due to an aberrant regulation of the stringent response to exclude successful adaptation into starvation (35). In addition, coenzyme metabolism (thiL, ETAE_0728), inorganic ion transport and metabolism (corA), and nucleotide metabolism and transport (purR), as well as stress adaptation-related genes (uspA and hflCK), are also significantly underrepresented in 28°C seawater, and most of these genes are regulated by RpoS (31). However, none of these genes were included in the candidate essential gene list for E. piscicida treated with 16°C seawater (Table S3). Remarkably, insertions in rpoS showed increased (log2FC = 1.7198, P = 0.0302) representation in this case (Table S1), suggesting a bacterial physiological state in 16°C seawater largely different from that in 28°C seawater. In comparison to a total of ∼127 genes involved in fitness in seawater environments in E. piscicida, 147 genes in Salmonella enterica serovar Typhi are significantly essential for optimal survival in and revival from water (36). However, few genes overlapped from these screens in the two phylogenetically related bacteria. These analyses indicate that different essential gene profiles for survival in seawater at various temperatures likely dictate both gene expression and functional modes in bacteria.
The mutagenesis of the Tat system, which consists of TatABC and mediates Sec-independent transport of folded precursor proteins across the bacterial plasma membrane bearing twin-arginine signal peptides (37), resulted in dramatic fitness defects in 16°C (tatA, log2FC = −2.27, P = 0.004; tatC, log2FC = −2.65, P = 0.0005) but not in 28°C seawater (Tables S3 and S4). Our previous investigations indicated that the Tat system is essential for the tolerance of osmotic stress, as well as other processes (29, 30). We suspect that lower temperatures may exacerbate osmotic stress or other processes. In addition, fadR, encoding a master regulator of fatty acid accumulation by repressing fatty acid degradation and activating fatty acid synthesis (38), showed critical underrepresentation in both lower- and higher-temperature seawater (Tables S3 and S4), which is similar to the TIS result of Vibrio cholerae in pond water (39). E. piscicida is incapable of fatty acid degradation because of the lack of genes associated with oxidative processes of fatty acids (6). These data imply that fatty acid metabolism or composition is important for E. piscicida survival in seawater.
T3SS gene expression is affected by various factors, such as iron, Mg2+, pH, temperature, and host cell attachment in E. piscicida (10–12, 28, 31). The mutagenesis of T3SS displayed significant fitness enhancement in 16°C seawater (Fig. 1A and 3A), and the lower temperature appeared to facilitate the expression of T3SS genes (Fig. 4B), suggesting that the expression of T3SS may significantly influence E. piscicida fitness in lower-temperature seawater, where the bacterium could not significantly grow or replicate (Fig. 4A). Thus, the bacterium has to infect and colonize a host during transmission in seawater or eventually enters into a viable but nonculturable (VBNC) state during the late autumn season (40). On the other hand, E. piscicida maintains the appropriate expression of T3SS and the cognate effectors to facilitate its internalization into and colonization of host cells in lower-temperature seawater (41, 42). Thus, a lower temperature might modulate the E. piscicida trade-off between prolonged survival and host infection capability before causing outbreaks during the autumn season.
Survival in and revival from seawater represent a critical step of E. piscicida transmission. An improved understanding of the molecular basis of this phase of the infectious cycle will provide important insights into the infection outbreak mechanisms and has potential applications for the development of biological containment for live attenuated vaccines (LAVs) against marine pathogens. We previously used the Tat mutant as a novel salt-sensitive biological containment system for LAVs in marine fish vaccinology (30). Further investigations with time series TIS and transcriptomic analysis will be required to illuminate the essential genes and their functions under various environmental conditions, such as a larger range of temperatures and polluted fresh and brackish water, in addition to entering into and being resuscitated from the VBNC state. TIS analysis could also facilitate the study of the transmission mechanisms of E. piscicida shed from the feces of infected fish back to water. In conclusion, functional analysis of E. piscicida adaptation to survival in seawater at low and high temperatures will enrich our understanding of bacterial infection outbreak mechanisms and provide the knowledge base for the rational design of improved LAVs in addition to biological containment strategies affecting the vaccine survival.
MATERIALS AND METHODS
Bacterial strains and culture conditions.
E. piscicida EIB202 was used as the parental strain for the construction of indicated mutant strains (Table 1). Other bacterial strains and plasmids used in this study are shown in Table 1, and the primers used in this study are shown in Table 3. E. piscicida strains were grown in LB broth or LB agar (Oxoid, England) and naturally filtered seawater obtained from an aquaculture farm in Yantai, Shandong Province, at 16 or 28°C. When required, antibiotics were supplemented at the following concentrations: polymyxin B (Col; 20 μg/ml), ampicillin (Amp; 100 μg/ml), kanamycin (Km; 25 μg/ml), streptomycin (Str; 100 μg/ml), and gentamicin (Gm; 15 μg/ml).
TABLE 3.
Primers used for this study
| Primer | Sequence (5′–3′)a |
|---|---|
| qPCR-esrA-F | TAGCGCCGTAGAGAAAACCC |
| qPCR-esrA-R | TCGCGGCAGATGGAGAATAC |
| qPCR-esrC-F | CCATGCCGAACTTGTCGTTG |
| qPCR-esrC-R | GAGTGTCAACGGACCTCCAC |
| qPCR-esrB-F | CGACCAGCTTGAGAATTTGCC |
| qPCR-esrB-R | GTAGCCTCGTCCGATATGGC |
| qPCR-esaM-F | CTGAAATCCACAGCGCATCG |
| qPCR-gyrB-F | GGATAACGCGATTGACGAAGC |
| qPCR-gyrB-R | CTGTACGGAGACGGAGTTGT |
| pDM4-esaM-P1 | gtggaattcccgggagagctAGCTCTTTGTCGCCACCTG |
| pDM4-esaM-P2 | TAGCCAGCTACATGAATATCCTCCGCGATC |
| pDM4-esaM-P3 | GATATTCATGTAGCTGGCTACACAAACTC |
| pDM4-esaM-P4 | aagcttatcgataccgtcgaCTGCACGACGGTAATGATGG |
| pDM4-esaM-in-F | GCAAACCGAACTTTGGCTAC |
| pDM4-esaM-in-R | CATGGGGATTCTCCATCACG |
| pDM4-esaM-out-F | CGACACCATCATCATCCCC |
| pDM4-esaM-out-R | AGAGCTGGCTCTCTTTTTGC |
| pDM4-esaM-P1 | gtggaattcccgggagagctAGCTCTTTGTCGCCACCTG |
| pDM4-esaM-P2 | TAGCCAGCTACATGAATATCCTCCGCGATC |
| pDM4-esaM-P3 | GATATTCATGTAGCTGGCTACACAAACTC |
| pDM4-nuoM-P2 | TGGCGATTTACATGGCGTTTGGTTTCCCTT |
| pDM4-nuoM-P3 | AAACGCCATGTAAATCGCCATGACAATAAC |
| pDM4-nuoM-P4 | aagcttatcgataccgtcgaCTCTATCCCCAGGAACAGCG |
| pDM4-nuoM-in-F | GCTGAAAGCGCCGCGCTGG |
| pDM4-nuoM-in-R | CGATCAGGAAGTACATCGGC |
| pDM4-nuoM-out-F | GCAGAACATCTTCAAGATG |
| pDM4-nuoM-out-R | CGGCGAAGGAGAGATCGC |
| pDM4-nuoJ-P1 | gtggaattcccgggagagctGCTGGCGTATTTGCCTGCC |
| pDM4-nuoJ-P2 | AACGGGATCACATGCTCGGCTCCTTAGGG |
| pDM4-nuoJ-P3 | GCCGAGCATGTGATCCCGTTACAACATGGG |
| pDM4-nuoJ-P4 | aagcttatcgataccgtcgaCGGGAAAAGGCCAGGATCAG |
| pDM4-nuoJ-in-F | CCGTGTTGGCGACGATCCG |
| pDM4-nuoJ-in-R | CAGCATCGAGACCAGCTCC |
| pDM4-nuoJ-out-F | CACCCTGTTCTTCGGCGGC |
| pDM4-nuoJ-out-R | CGGTAAAGTTACCGACCGC |
| pDM4-nuoI-P1 | gtggaattcccgggagagctCTGTTCTTCCTGATGATGGC |
| pDM4-nuoI-P2 | CGGCTCCTTATGTCATGGTTACACTCACC |
| pDM4-nuoI-P3 | AACCATGACATAAGGAGCCGAGCATGGAAT |
| pDM4-nuoI-P4 | aagcttatcgataccgtcgaCAATGTGGAAGGCCACGAC |
| pDM4-nuoI-in-F | GGTTGGTTTCGGCACCCAAG |
| pDM4-nuoI-in-R | CCATACGGTAAAAGTTGTAG |
| pDM4-nuoI-out-F | GATCAAGATGTTCTTCAAGG |
| pUTt-esaM-F | ctcatccgccaaaacagccaATGGACCTACAGTGGCAACG |
| pUTt-esaM-R | ttggttaaaaattaaggaggaattCTATTGACCGTTTTCATGGGG |
| pUTt-nuoM-F | ctcatccgccaaaacagccaATGTTATTACCTTGGCTAATT |
| pUTt-nuoM-R | ttggttaaaaattaaggaggaattTTACGGCCTTGTGGTTAAAG |
| pUTt-nuoJ-F | ctcatccgccaaaacagccaATGGAATTTGCCTTTTACGC |
| pUTt-nuoJ-R | ttggttaaaaattaaggaggaattTCATGCGCGCTCCTCCGCT |
| P5 | AATGATACGGCGACCACCGA |
| P7 | CAAGCAGAAGACGGCATACGAGAT |
Annealing sequences compatible with Gibson assembly ligation to the plasmid backbone are in lowercase.
Seawater screening and transposon insertion sequencing analysis.
The E. piscicida EIB202 derived transposon insertion mutant library (19) was inoculated into LB medium at 30°C and shaken for 12 h until the OD600 reached 2.0 (input library). Bacteria were centrifuged at 8,000 × g for 2 min, washed twice with filtered natural seawater, diluted 1:100 into 50 ml of filtered natural seawater, and incubated at 16 or 28°C for 48 h without shaking. Afterward, all of the bacteria were pelleted and resuspended in 30 ml of LB medium and shaken at 28°C to allow growth of a limited number of generations until the OD600 reached 1.0 (output library) for sequencing with MiSeq (Illumina). The extended incubation in LB medium was performed to eliminate the contamination of DNA from dead bacteria.
The TIS experiments and data analysis followed the protocols from Chao et al. (21), adapted for E. piscicida EIB202 (19, 31). Briefly, the genomic DNA was extracted and fragmented by sonication. The DNA fragments were then subjected to end repairing, A-tailing, and the addition of adapters and P5/P7 sequencing primers (Table 3). The triplicate sequencing libraries were subjected to high-throughput sequencing on an Illumina MiSeq platform, and ∼2 million reads were generated for each library. The sequencing results were processed with adapter trimming, genome mapping, and locus tallying for each locus of E. piscicida EIB202. The read counts for each locus were normalized by the number of sequencing reads in the input libraries. The fold change (FC) of each locus was generated by the output divided by the input read counts. Conditionally essential loci are typically identified as regions (e.g., genes and intergenic regions) in a high-density transposon library that lack or have a significantly lower than average frequency of insertions after the library is grown in seawater following analysis with the EL-ARTIST algorithm, which defines essential genes or loci based on a hidden Markov model (21). Functional classification was based on the 2014-updated COG database (43), following the COG software’s protocol (44).
Construction of deletion and complementation strains.
In-frame deletion mutants of the indicated genes were generated by sacB-based allelic exchange as previously described (19). Overlap PCR was used to generate fragments with in-frame deletions of each gene. The DNA fragments were cloned into the suicide vector pDM4, followed by transformation into E. coli SM10 λpir (Table 1). Conjugation was performed with E. piscicida WT and E. coli SM10 λpir carrying pDMK (19) (Table 1). The transconjugants with plasmids integrated into the chromosome by homologous recombination were selected on LB medium containing Km and Col. Then, double-crossover mutants were selected on LB plates that contained 12% sucrose. To construct the complemented strain, the intact gene and the corresponding putative promoter region were amplified and introduced into the pUTt vector (Table 1). The resulting plasmid was transformed via electroporation into the corresponding deletion mutants. Amp- and Col-resistant colonies were selected, and transformation was verified by PCR analysis and sequencing. All of the primers used for the construction of the mutants are listed in Table 3.
Competitive index assays in seawater and LB medium.
Competitive assays were performed between WT or the indicated strains and WT(Δp) (Table 1), the WT strain cured of its endogenous R plasmid pEIB202 showing no impaired growth in LB medium and seawater. The overnight-incubated strains, including WT, WT(Δp), ΔesrA, ΔesrB, ΔesrC, ΔesaM, ΔnuoM, ΔnuoJ, ΔnuoI, ΔevpP, ΔevpC, and ΔevpI strains, were washed twice with sterile phosphate-buffered saline. The strains were mixed with WT(Δp) at a ratio of 1:1 and inoculated into seawater and LB medium for incubation at 16 and 28°C without shaking. After 48 h of incubation, the strains were plated on LB agar with or without 100 μg/ml Str to distinguish WT(Δp) (Strs) or other strains (Strr) as previously described (19).
Determination of the growth curve in seawater.
The overnight-cultured strains, including WT, ΔesrA, ΔesrB, ΔesrC, ΔesaM, ΔesrC+, ΔesaM+, ΔnuoM, ΔnuoJ, ΔnuoI, ΔnuoM+, and ΔnuoJ+ strains, were centrifuged and washed twice with filtered natural seawater and then diluted 1:100 into 50 ml of filtered natural seawater for incubation at 16 and 28°C without shaking. The bacteria were plated and enumerated on LB agar.
Total RNA extraction and qRT-PCR.
Overnight cultures of the WT strain were statically subcultured in seawater at 16 and 28°C for 12 h. RNA samples were extracted with an RNA isolation kit (Tiangen, China), and mRNA was reverse transcribed into cDNA using a FastKing RT kit (Tiangen, China). qRT-PCR was conducted on an Applied Biosystems 7500 real-time system (Applied Biosystems, CA) in triplicate. The comparative CT (2–ΔΔCT) method was used to quantify the relative qualities of each transcript, and the housekeeping gyrB gene was used as an internal control (31).
Detection of dissolved oxygen.
An overnight culture of the WT strain was statically subcultured in seawater at 16 and 28°C, followed by dissolved oxygen detection every 6 h with an oxygen sensor (Mettler Toledo, Switzerland). Dissolved oxygen was set to zero in a saturated Na2SO3 solution to calibrate the oxygen sensor.
Statistical analysis.
GraphPad Prism (version 6.0) was used to perform the statistical analyses. The results are representative of at least three independent experiments. Significance, indicated by asterisks (*, P < 0.05; ***, P < 0.001) in the figures, was determined using a Student t test or analysis of variance (ANOVA).
Accession number(s).
The Illumina sequencing data for E. piscicida EIB202 TIS analysis are accessible under SRA accession number PRJNA480066.
Supplementary Material
ACKNOWLEDGMENTS
This study was supported by grants from the National Natural Science Foundation of China (31602200 to X.L. and 31430090 to Y.Z.), the Ministry of Agriculture of China (CARS-47), and the Science and Technology Commission of Shandong and Shanghai Municipality (2017CXGC0103 and 17391902000).
Footnotes
Supplemental material for this article may be found at https://doi.org/10.1128/AEM.00233-19.
REFERENCES
- 1.Austin B, Allen-Austin D. 1985. Bacterial pathogens of fish. J Appl Bacteriol 58:483–506. doi: 10.1111/j.1365-2672.1985.tb01490.x. [DOI] [PubMed] [Google Scholar]
- 2.Austin B. 2010. Vibrios as causal agents of zoonoses. Vet Microbiol 140:310–317. doi: 10.1016/j.vetmic.2009.03.015. [DOI] [PubMed] [Google Scholar]
- 3.Gu D, Guo M, Yang MJ, Zhang YX, Zhou XH, Wang QY. 2016. A σE-mediated temperature gauge controls a switch from LuxR-mediated virulence gene expression to thermal stress adaptation in Vibrio alginolyticus. PLoS Pathog 12:e1005645. doi: 10.1371/journal.ppat.1005645. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Xie ZY, Ke SW, Hu CQ, Zhu ZX, Wang SF, Zhou YC. 2013. First characterization of bacterial pathogen, Vibrio alginolyticus, for Porites andrewsi white syndrome in the South China Sea. PLoS One 8:e75425. doi: 10.1371/journal.pone.0075425. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Cornax R, Moriñigo MA, Romero P, Borrego JJ. 1990. Survival of pathogenic microorganisms in seawater. Curr Microbiol 20:293–298. doi: 10.1007/BF02091908. [DOI] [Google Scholar]
- 6.Wang Q, Yang M, Xiao J, Wu H, Wang X, Lv Y, Xu L, Zheng H, Wang S, Zhao G, Liu Q, Zhang Y. 2009. Genome sequence of the versatile fish pathogen Edwardsiella tarda provides insights into its adaptation to broad host ranges and intracellular niches. PLoS One 4:e7646. doi: 10.1371/journal.pone.0007646. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Shao S, Lai Q, Liu Q, Wu H, Xiao J, Shao Z, Wang Q, Zhang Y. 2015. Phylogenomics characterization of a highly virulent Edwardsiella strain ET080813T encoding two distinct T3SS and three T6SS gene clusters: propose a novel species as Edwardsiella anguillarum sp. nov. Syst Appl Microbiol 38:36–47. doi: 10.1016/j.syapm.2014.10.008. [DOI] [PubMed] [Google Scholar]
- 8.Esteve C, Alcaide E. 2018. Seasonal recovery of Edwardsiella piscicida from wild European eels and natural waters: isolation methods, virulence, and reservoirs. J Fish Dis 41:1613–1623. doi: 10.1111/jfd.12867. [DOI] [PubMed] [Google Scholar]
- 9.Buján N, Toranzo AE, Magariños B. 2018. Edwardsiella piscicida: a significant bacterial pathogen of cultured fish. Dis Aquat Organ 131:59–71. doi: 10.3354/dao03281. [DOI] [PubMed] [Google Scholar]
- 10.Leung KY, Siame BA, Tenkink BJ, Noort RJ, Mok YK. 2012. Edwardsiella tarda: virulence mechanisms of an emerging gastroenteritis pathogen. Microbes Infect 14:26–34. doi: 10.1016/j.micinf.2011.08.005. [DOI] [PubMed] [Google Scholar]
- 11.Liu Y, Zhao LY, Yang MJ, Yin KY, Zhou XH, Leung KY, Liu Q, Zhang YX, Wang QY. 2017. Transcriptomic dissection of the horizontally acquired response regulator EsrB reveals its global regulatory roles in the physiological adaptation and activation of T3SS and the cognate effector repertoire in Edwardsiella piscicida during infection toward turbot. Virulence 8:1355–1377. doi: 10.1080/21505594.2017.1323157. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Lv YZ, Xiao JF, Liu Q, Wu HZ, Zhang YX, Wang QY. 2012. Systematic mutation analysis of two-component signal transduction systems reveals EsrA-EsrB and PhoP-PhoQ as the major virulence regulators in Edwardsiella tarda. Vet Microbiol 157:190–199. doi: 10.1016/j.vetmic.2011.12.018. [DOI] [PubMed] [Google Scholar]
- 13.Reichley SR, Ware C, Steadman J, Gaunt PS, García JC, LaFrentz BR, Thachil A, Waldbieser GC, Stine CB, Buján N, Arias CR, Loch T, Welch TJ, Cipriano RC, Greenway TE, Khoo LH, Wise DJ, Lawrence ML, Griffin MJ. 2017. Comparative phenotypic and genotypic analysis of Edwardsiella isolates from different hosts and geographic origins, with emphasis on isolates formerly classified as E. tarda, and evaluation of diagnostic methods. J Clin Microbiol 55:3466–3491. doi: 10.1128/JCM.00970-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Chao MC, Abel S, Davis BM, Waldor MK. 2016. The design and analysis of transposon insertion sequencing experiments. Nat Rev Microbiol 14:119–128. doi: 10.1038/nrmicro.2015.7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Price MN, Wetmore KM, Waters RJ, Callaghan M, Ray J, Liu H, Kuehl JV, Melnyk RA, Lamson JS, Suh Y, Carlson HK, Esquivel Z, Sadeeshkumar H, Chakraborty R, Zane GM, Rubin BE, Wall JD, Visel A, Bristow J, Blow MJ, Arkin AP, Deutschbauer AM. 2018. Mutant phenotypes for thousands of bacterial genes of unknown function. Nature 557:503–509. doi: 10.1038/s41586-018-0124-0. [DOI] [PubMed] [Google Scholar]
- 16.Veeranagouda Y, Didier M. 2017. Transposon insertion site sequencing (TIS-Seq): an efficient and high-throughput method for determining transposon insertion site(s) and their relative abundances in a PiggyBac transposon mutant pool by next-generation sequencing. Curr Protoc Mol Biol 120:21–35. doi: 10.1002/cpmb.47. [DOI] [PubMed] [Google Scholar]
- 17.Gawronski JD, Wong SM, Giannoukos G, Ward DV, Akerley BJ. 2009. Tracking insertion mutants within libraries by deep sequencing and a genome-wide screen for Haemophilus genes required in the lung. Proc Natl Acad Sci U S A 106:16422–16427. doi: 10.1073/pnas.0906627106. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Langridge GC, Phan MD, Turner DJ, Perkins TT, Parts L, Haase J, Charles I, Maskell DJ, Peters SE, Dougan G, Wain J, Parkhill J, Turner AK. 2009. Simultaneous assay of every Salmonella Typhi gene using one million transposon mutants. Genome Res 19:2308–2316. doi: 10.1101/gr.097097.109. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Yang GH, Billings G, Hubbard TP, Park JS, Leung KY, Liu Q, Davis BM, Zhang YX, Wang QY, Waldor MK. 2017. Time-resolved transposon insertion sequencing reveals genome-wide fitness dynamics during infection. mBio 8:e01581-17. doi: 10.1128/mBio.01581-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Xiao J, Wang Q, Liu Q, Wang X, Liu H, Zhang Y. 2008. Isolation and identification of fish pathogen Edwardsiella tarda from mariculture in China. Aquac Res 40:13–17. doi: 10.1111/j.1365-2109.2008.02101.x. [DOI] [Google Scholar]
- 21.Chao MC, Pritchard JR, Zhang YJ, Rubin EJ, Livny J, Davis BM, Waldor MK. 2013. High-resolution definition of the Vibrio cholerae essential gene set with hidden Markov model-based analyses of transposon-insertion sequencing data. Nucleic Acids Res 41:9033–9048. doi: 10.1093/nar/gkt654. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Simoni RD, Shallenberger MK. 1972. Coupling of energy to active transport of amino acids in Escherichia coli. Proc Natl Acad Sci U S A 69:2663–2667. doi: 10.1073/pnas.69.9.2663. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Baya A, Romalde JL, Green DE, Navarro RB, Evans J, May EB, Toranzo AE. 1997. Edwardsiellosis in wild striped bass from the Chesapeake Bay. J Wildl Dis 33:517–525. doi: 10.7589/0090-3558-33.3.517. [DOI] [PubMed] [Google Scholar]
- 24.Tang X, Zhan W, Sheng X, Chi H. 2010. Immune response of Japanese flounder Paralichthys olivaceus to outer membrane protein of Edwardsiella tarda. Fish Shellfish Immunol 28:333–343. doi: 10.1016/j.fsi.2009.11.015. [DOI] [PubMed] [Google Scholar]
- 25.Castro N, Toranzo AE, Devesa S, González A, Nuñez S, Magariños B. 2012. First description of Edwardsiella tarda in Senegalese sole, Solea senegalensis (Kaup). J Fish Dis 35:79–82. doi: 10.1111/j.1365-2761.2011.01325.x. [DOI] [PubMed] [Google Scholar]
- 26.Mawardi M, Jaelani J, Zainun Z, Mundayana Y, Chilora BS, Hardi EH. 2018. Identification and characterization of Edwardsiella ictaluri from diseased Pangasius pangasius, cultured in Cirata Lake, Indonesia. Biodiversitas 19:816–822. doi: 10.13057/biodiv/d190309. [DOI] [Google Scholar]
- 27.Green DM. 2010. A strategic model for epidemic control in aquaculture. Prev Vet Med 94:119–127. doi: 10.1016/j.prevetmed.2009.12.004. [DOI] [PubMed] [Google Scholar]
- 28.Chakraborty S, Li M, Chatterjee C, Sivaraman J, Leung KY, Mok YK. 2010. Temperature and Mg2+ sensing by a novel PhoP-PhoQ two-component system for regulation of virulence in Edwardsiella tarda. J Biol Chem 285:38876–38888. doi: 10.1074/jbc.M110.179150. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Wang Y, Wang Q, Yang M, Zhang Y. 2013. Proteomic analysis of a twin-arginine translocation-deficient mutant unravel its functions involved in stress adaptation and virulence in fish pathogen Edwardsiella tarda. FEMS Microbiol Lett 343:145–155. doi: 10.1111/1574-6968.12140. [DOI] [PubMed] [Google Scholar]
- 30.Wang Y, Wang Q, Yang W, Liu B, Zhang Y. 2013. Functional characterization of Edwardsiella tarda twin-arginine translocation system and its potential use as biological containment in live attenuated vaccine of marine fish. Appl Microbiol Biotechnol 97:3545–3557. doi: 10.1007/s00253-012-4462-9. [DOI] [PubMed] [Google Scholar]
- 31.Yin K, Guan Y, Ma R, Wei L, Liu B, Liu X, Zhou X, Ma Y, Zhang Y, Waldor MK, Wang Q. 2018. Critical role for a promoter discriminator in RpoS control of virulence in Edwardsiella piscicida. PLoS Pathog 14:e1007272. doi: 10.1371/journal.ppat.1007272. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Yang M, Lv Y, Xiao J, Wu H, Zheng H, Liu Q, Zhang Y, Wang Q. 2012. Edwardsiella comparative phylogenomics reveal the new intra/inter-species taxonomic relationships, virulence evolution and niche adaptation mechanisms. PLoS One 7:e36987. doi: 10.1371/journal.pone.0036987. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Zheng J, Leung KY. 2007. Dissection of a type VI secretion system in Edwardsiella tarda. Mol Microbiol 66:1192–1206. doi: 10.1111/j.1365-2958.2007.05993.x. [DOI] [PubMed] [Google Scholar]
- 34.Morel FM, Hudson RJ, Price NM. 1991. Limitation of productivity by trace metals in the sea. Limnol Oceanogr 36:1742–1755. doi: 10.4319/lo.1991.36.8.1742. [DOI] [Google Scholar]
- 35.Trigui H, Dudyk P, Oh J, Hong JI, Faucher SP. 2015. A regulatory feedback loop between RpoS and SpoT supports the survival of Legionella pneumophila in water. Appl Environ Microbiol 81:918–928. doi: 10.1128/AEM.03132-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Kingsley RA, Langridge G, Smith SE, Makendi C, Fookes M, Wileman TM, El Ghany MA, Keith Turner A, Dyson ZA, Sridhar S, Pickard D, Kay S, Feasey N, Wong V, Barquist L, Dougan G. 2018. Functional analysis of Salmonella Typhi adaptation to survival in water. Environ Microbiol 20:4079–4090. doi: 10.1111/1462-2920.14458. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Yahr TL, Wickner WT. 2001. Functional reconstitution of bacterial Tat translocation in vitro. EMBO J 20:2472–2479. doi: 10.1093/emboj/20.10.2472. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Van Aalten DM, DiRusso CC, Knudsen J, Wierenga RK. 2000. Crystal structure of FadR, a fatty acid-responsive transcription factor with a novel acyl coenzyme A-binding fold. EMBO J 19:5167–5177. doi: 10.1093/emboj/19.19.5167. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Kamp HD, Patimalla-Dipali B, Lazinski DW, Wallace-Gadsden F, Camilli A. 2013. Gene fitness landscapes of Vibrio cholerae at important stages of its life cycle. PLoS Pathog 9:e1003800. doi: 10.1371/journal.ppat.1003800. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Du M, Chen J, Zhang X, Li A, Li Y, Wang Y. 2007. Retention of virulence in a viable but nonculturable Edwardsiella tarda isolate. Appl Environ Microbiol 73:1349–1354. doi: 10.1128/AEM.02243-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Wang X, Wang Q, Xiao J, Liu Q, Wu H, Zhang Y. 2010. Hemolysin EthA in Edwardsiella tarda is essential for fish invasion in vivo and in vitro and regulated by two-component system EsrA–EsrB and nucleoid protein HhaEt. Fish Shellfish Immun 29:1082–1091. doi: 10.1016/j.fsi.2010.08.025. [DOI] [PubMed] [Google Scholar]
- 42.Okuda J, Takeuchi Y, Nakai T. 2014. Type III secretion system genes of Edwardsiella tarda associated with intracellular replication and virulence in zebrafish. Dis Aquat Organ 111:31–39. doi: 10.3354/dao02763. [DOI] [PubMed] [Google Scholar]
- 43.Galperin MY, Makarova KS, Wolf YI, Koonin EV. 2015. Expanded microbial genome coverage and improved protein family annotation in the COG database. Nucleic Acids Res 43:D261–D269. doi: 10.1093/nar/gku1223. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Kristensen DM, Kannan L, Coleman MK, Wolf YI, Sorokin A, Koonin EV, Mushegian A. 2010. A low-polynomial algorithm for assembling clusters of orthologous groups from inter-genomic symmetric best matches. Bioinformatics 26:1481–1487. doi: 10.1093/bioinformatics/btq229. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Wang X, Wang Q, Xiao J, Liu Q, Wu H, Xu L, Zhang Y. 2009. Edwardsiella tarda T6SS component evpP is regulated by esrB and iron, and plays essential roles in the invasion of fish. Fish Shellfish Immunol 27:469–477. doi: 10.1016/j.fsi.2009.06.013. [DOI] [PubMed] [Google Scholar]
- 46.Chen H, Yang D, Han F, Tan J, Zhang L, Xiao J, Zhang Y, Liu Q. 2017. The bacterial T6SS effector EvpP prevents NLRP3 inflammasome activation by inhibiting the Ca2+-dependent MAPK-Jnk pathway. Cell Host Microbe 21:47–58. doi: 10.1016/j.chom.2016.12.004. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.