Skip to main content
EMBO Reports logoLink to EMBO Reports
. 2019 Mar 15;20(5):e46888. doi: 10.15252/embr.201846888

A microRNA switch controls dietary restriction‐induced longevity through Wnt signaling

Yunpeng Xu 1, Zhidong He 1, Mengjiao Song 1, Yifei Zhou 1, Yidong Shen 1,✉
PMCID: PMC6500965  PMID: 30872315

Abstract

Dietary restriction (DR) is known to have a potent and conserved longevity effect, yet its underlying molecular mechanisms remain elusive. DR modulates signaling pathways in response to nutrient status, a process that also regulates animal development. Here, we show that the suppression of Wnt signaling, a key pathway controlling development, is required for DR‐induced longevity in Caenorhabditis elegans. We find that DR induces the expression of mir‐235, which inhibits cwn‐1/WNT4 expression by binding to the 3′‐UTR. The “switch‐on” of mir‐235 by DR occurs at the onset of adulthood, thereby minimizing potential disruptions in development. Our results therefore implicate that DR controls the adult lifespan by using a temporal microRNA switch to modulate Wnt signaling.

Keywords: dietary restriction, longevity, microRNA, Wnt signaling

Subject Categories: Ageing, Metabolism, Signal Transduction

Introduction

Dietary restriction (DR), the reduction in food intake without causing malnutrition, is an effective way to promote longevity in a wide range of species. Similar to many other mediators of longevity, DR not only extends an organism's lifespan but also decreases the incidence of age‐related diseases and promotes health span as well 1, 2. Multiple genetic pathways such as AMPK, mTOR, pha‐4/FOXA, skn‐1/NRF, and nhr‐62/PPAR have been identified in DR to reprogram metabolism and promote the homeostasis of proteins, reactive oxygen species, and lipids 3, 4, 5. Yet, the molecular mechanisms underlying DR‐induced longevity, particularly in the temporal dimension, remain elusive.

Similar to DR, animal development also responds to nutrient conditions through signaling pathways. Wnt signaling and other key developmental signaling pathways carefully control cell fates as well as metabolism in response to diet 6, 7. In addition to animal development, Wnt signaling is also essential for adult tissue renewal and maintenance. More intriguingly, high activity of Wnt signaling is required for specific developmental stages, whereas it drives various age‐related disorders in aged animals, including cancer and neurodegenerative diseases 6, 8, 9, 10. It is therefore plausible to assume that Wnt signaling also controls adult longevity upon DR. How DR may regulate Wnt signaling in adulthood to rectify its antagonistic pleiotropic effect on aging remains another interesting issue to explore.

Besides, if DR does indeed control Wnt signaling for longevity, then how does it protect animals from serious developmental defects? Despite that the dysregulation of Wnt signaling leads to serious defects in development, animals undergoing proper DR treatment show no damaging effects on growth 11, 12. The mechanisms protecting animals under DR from developmental disorders while promoting longevity are still poorly understood.

Herein, we show that DR upregulates mir‐235/miR‐92 at the onset of adulthood in Caenorhabditis elegans. The upregulated mir‐235 suppresses Wnt signaling specifically in adulthood, thus avoiding interference with larval development through this temporal regulation. The downregulated Wnt signaling in adulthood subsequently upregulates multiple autophagy genes, enhances autophagy, and promotes longevity. These results reveal a microRNA switch in response to DR that specifically inhibits Wnt signaling in adulthood, promoting adult longevity while minimizing developmental defects.

Results

Dietary restriction induces mir‐235/miR‐92 at the onset of adulthood

The function of microRNAs in DR‐induced longevity is an emerging field to be explored. To identify microRNAs involved in the DR‐induced longevity of C. elegans, we performed RNA‐Seq on newly molted adults (i.e., day 0, D0) of wild‐type (WT) worms and eat‐2 mutants, the latter being a genetic model of DR 13. Consistent with a previous report 14, our microRNA transcriptome data showed that a conserved microRNA, mir‐235/miR‐92, was increased in the eat‐2 mutants. Subsequent qRT–PCR analysis confirmed the upregulation of mir‐235 in this mutant (Figs 1A and EV1A). In another solid agar plate‐based DR (sDR) protocol by diluting bacteria on solid agar plates, the level of mir‐235 in D0 WT adults was also increased 13 (Figs 1B and EV2A). A transcriptional reporter of mir‐235 showed this upregulation in multiple tissues (e.g., muscle, neuron, intestine, and hypodermis) of live worms (Fig EV1B and C). Interestingly, when tracing the expression of mir‐235 during larval development, we observed no differences between the WT worms and eat‐2 mutants in the first three larval stages (L1–L3), instead of an immediate response (Figs 1A and EV1A). At the last larval stage (L4), mir‐235 was slightly upregulated in the eat‐2 mutants compared with its expression in the WT worms and was remarkably increased at D0 (Figs 1A and EV1A). As observed in the eat‐2 mutants, D0 young adults undergoing sDR from L4 (for 12 h) exhibited a significant increase in mir‐235 compared with the worms fed ad libitum (Figs 1B and EV2A), whereas a 12 h‐sDR treatment from L2 to L3 did not change the transcription of these two genes (Fig EV2B and C). Therefore, DR upregulates mir‐235 at the onset of adulthood.

Figure 1. Dietary restriction switches on mir‐235 at the end of larval development through pha‐4 .

Figure 1

  1. qRT–PCR of mir‐235 at the indicated developmental stages in wild‐type (WT) and eat‐2 worms, normalized against WT L1. L1–L4: 1st–4th larval stages. D0: day 0, freshly molted adults carrying no eggs.
  2. Transcription levels of mir‐235 in worms fed ad libitum (AL) or subjected to 12 h of solid plate‐based dietary restriction (sDR) from L4 to D0.
  3. The promoters of sod‐1 and sod‐2 immunoprecipitated with PHA‐4::GFP. The amount of immunoprecipitated DNA is represented as the signal relative to the total amount of input chromatin.
  4. The three predicted PHA‐4‐binding sites (sites 2–4, see Fig EV1E for details) in the mir‐235 promoter immunoprecipitated with PHA‐4::GFP. 3′NC: negative control sequence in the 3′ of mir‐235.
  5. The upregulation of mir‐235 in the eat‐2 mutants is suppressed by pha‐4 RNAi.
Data information: Two‐way ANOVA: vs. WT in (A, C, and D). Unpaired t‐test: vs. AL in (B) and vs. luci in (E). ns, non‐significant. *P < 0.05, **P < 0.01, ***P < 0.001. Error bars: SD.

Figure EV1. A molecular switch of pha‐4 and mir‐235 is turned on at the end of larval development in eat‐2 mutants, related to Fig 1 .

Figure EV1

  1. Amount of mir‐235 in WT and eat‐2 worms at the indicated developmental stages. L1–L4: 1st–4th larval stages. D0: day 0, freshly molted adults carrying no eggs. Error bars: SEM.
  2. mir‐235 is upregulated in the eat‐2 mutants at day 1 of adulthood. The transcription of mir‐235 was examined via GFP expression driven by the mir‐235 promoter (mir‐235p::GFP), as well as qRT–PCR. The pharynx‐specific mCherry (myo‐2p::mCherry) in the same transgene as mir‐235p::GFP served as a control. m, muscle; n, neuron; s, seam cell; i, intestine. Scale bar = 100 μm. Error bars: SD.
  3. At day 1 of adulthood, the transcription of mir‐235 is increased in the hypodermis and intestine of the eat‐2 mutants. hyp, hypodermal cell; s, seam cell; int, intestinal cell. Scale bar = 10 μm.
  4. A diagram depicting the predicted PHA‐4‐ or FOXA‐binding sites in the cel‐mir‐235 or miR‐92b promoter.
  5. The transfection of GFP‐PHA‐4 upregulates the luciferase reporter with a wild‐type mir‐235 promoter (mir‐235p WT). With all four predicted pha‐4‐binding sites mutated (mir‐235p M), the luciferase reporter no longer responds to GFP‐PHA‐4. Error bars: SD.
  6. Time course of the indicated gene levels in WT and eat‐2 worms, normalized against to those of WT L1. Error bars: SD.
  7. RNAi against pha‐4 suppresses the upregulation of bec‐1 in the eat‐2 animals.
Data information: two‐way ANOVA: vs. WT in (A and F). Unpaired t‐test: vs. WT in (B) and vs. GFP in (E). One‐way ANOVA in (G). ns, non‐significant. *P < 0.05, **P < 0.05, ***P < 0.001.

Figure EV2. Solid plate‐based dietary restriction upregulates mir‐235 at the onset of adulthood via daf‐16, related to Fig 1 .

Figure EV2

  1. The quantity of mir‐235 is increased upon a 12 h‐sDR treatment from L4 to D0. AL, ad libitum; sDR, solid plate‐based dietary restriction. Error bars: SD.
  2. A 12 h‐sDR from L2 does not change the transcription levels of pha‐4 or mir‐235 in L3 larvae. Left: relative quantification against reference genes. Right: absolute quantification of mir‐235. Error bars: SD.
  3. The WT worms undergoing a 12 h‐sDR from L2 are much smaller and lighter than those with AL diet. Scale bar = 100 μm.
  4. sod‐1 is not induced by pha‐4 upon sDR. Error bars: SEM.
  5. The transcription of pha‐4 is increased upon sDR. WT worms were fed with either HT115 cells of luc RNAi or OP50 and subjected to sDR for 12 h from L4 to D0. Error bars: SEM.
  6. RNAi against daf‐16 but not pha‐4 suppresses the upregulation of mir‐235 upon a 12 h‐sDR treatment from L4 to D0. Error bars: SEM.
Data information: unpaired t‐test: vs. AL. ns, non‐significant. **P < 0.05, ***P < 0.001.

The promoter of mir‐235 harbors four predicted binding sites for pha‐4/FOXA, a key transcription factor for DR‐induced longevity 15, 16. Its mammalian homolog, miR‐92b, also contains five FOXA target sites in its promoter (Fig EV1D). In HEK293T cells, overexpressing GFP‐PHA‐4 (but not GFP) significantly upregulated the luciferase reporter controlled by the mir‐235 promoter (Fig EV1E). When all four potential PHA‐4‐binding sites were mutated, the mir‐235 promoter‐controlled luciferase reporter no longer responded to GFP‐PHA‐4 (Fig EV1E). Worms with a genomic insertion of gfp at the C‐terminus of pha‐4 (pha‐4::gfp) were then subjected to ChIP–qPCR to assay the in vivo interaction of PHA‐4 with the mir‐235 promoter. As expected, the promoters of mir‐235 and two known pha‐4 target genes (sod‐1 and sod‐2), but not their 3′ sequences, were highly enriched in the immunoprecipitated DNA from the pha‐4::gfp animals (Fig 1C and D) 15. Therefore, PHA‐4 directly interacts with the mir‐235 promoter. RNAi treatment against pha‐4 suppressed the upregulation of mir‐235 in D0 eat‐2 adults (Fig 1E), further indicating pha‐4 as a regulator of mir‐235 upon DR with eat‐2 mutants. Moreover, pha‐4/FOXA and its four targets under DR (viz., sod‐1, sod‐2, sod‐4, and bec‐1) 15, 17 exhibited a similar expression pattern to that of mir‐235 in response to DR. The eat‐2 mutation did not upregulate the transcription of these genes until either the end of the larval stages or the beginning of adulthood (Fig EV1F and G). Therefore, pha‐4 drives the upregulation of mir‐235 in eat‐2 mutants.

We next examined the regulator of mir‐235 in worms undergoing sDR. pha‐4 is not required for sDR‐induced longevity 13. Its target gene sod‐1 is not induced upon sDR, either (Fig EV2D). Consistently, RNAi against pha‐4 did not inhibit the upregulation of mir‐235 upon sDR, even though its own transcription was induced (Fig EV2E and F). daf‐16 controls mir‐235 during L1 starvation and is required for the extended lifespan by sDR 13, 18. Indeed, suppressing daf‐16 by RNAi blocked the upregulation of mir‐235 in sDR‐treated worms (Fig EV2F), indicating that sDR induces mir‐235 through daf‐16.

mir‐235 is required for dietary restriction‐induced longevity

Is the upregulation of mir‐235 important for DR‐induced longevity? Consistent with previous reports on transcriptomes of aging worms 19, 20, our qRT–PCR assays showed a decrease in mir‐235 expression in the aged worms (Figs 2A and EV3A). Its upregulation in eat‐2 mutants declines with aging, potentially due to the diminishing difference in pumping rates between the WT worms and eat‐2 mutants (Figs 2A, and EV3A and B). The expression pattern of mir‐235 with aging suggests that the upregulation of mir‐235 upon DR has a potential role in longevity. Indeed, the mutation of mir‐235 abolished the extended lifespan by both sDR treatment and eat‐2 mutation (Fig 2B and C, and Table EV1), showing that mir‐235 is required for DR‐induced longevity. The pumping rates were unchanged in the mir‐235;eat‐2 mutants (Fig EV3B), implying that the control of mir‐235 over DR‐induced longevity is not through dietary changes but by intrinsic signaling. The mutation of mir‐235 deletes a part of the T09B4.7 promoter. To clarify whether the aging phenotype of mir‐235(−) mutants could be from T09B4.7 instead, we examined the lifespan of T09B4.7(−) mutants. Mutating T09B4.7 did not change the lifespan of either the WT or eat‐2 worms (Fig EV3C and Table EV1), confirming the role of mir‐235 in DR‐induced longevity.

Figure 2. mir‐235 is required for dietary restriction‐induced longevity.

Figure 2

  • A
    Expression of mir‐235 in the WT worms and eat‐2 mutants at indicated ages of adulthood. Note that the reproductive period of the WT worms ends at around day 7 of adulthood and their mean lifespan is approximately 20 days. Two‐way ANOVA, vs. WT. ns, non‐significant. **P < 0.01, ***P < 0.001. Error bars: SD.
  • B
    Median lifespans of WT worms and mir‐235 mutants fed with the indicated concentrations of bacteria. cfu, colony‐forming units. See Table EV1 for the statistics. Error bars: SEM.
  • C, D
    Aging assays of the indicated strains. In (D), six survival curves from the same experiment are presented in two panels. OE, overexpression. At least three independent experiments were performed. See Table EV1 for more details.

Figure EV3. mir‐235 specifically regulates the dietary restriction‐induced longevity, related to Fig 2 .

Figure EV3

  1. The amount of mir‐235 in the WT worms and eat‐2 mutants at indicated ages. Error bars: SD.
  2. Pumping rates of the indicated strains at days 1, 7, and 14 of adulthood. Error bars: SD.
  3. Aging assays of the indicated strains. Three independent experiments were performed. See Table EV1 for more details.
  4. qRT–PCR of mir‐235 in the indicated strains. Left: normalized against WT L1. Right: absolute quantification of mir‐235. L1–L4: 1st–4th larval stages. D0: freshly molted adults without eggs. OE, overexpression. Error bars: SEM.
Data information: unpaired t‐test in (A), two‐way ANOVA: vs. WT in (B and D). ns, non‐significant. *P < 0.05, ***P < 0.001.

To further test whether the upregulation of mir‐235 is sufficient to induce longevity, we increased the mir‐235 expression in the adult worms to a level comparable to that of the DR condition, using a transgene of mir‐235 driven by its native promoter (Figs 1 and EV3D). Similar to the situation under DR, this transgene did not overexpress mir‐235 in somatic tissues until the fourth larval stage, further implying a temporal modulation of mir‐235 expression (Fig EV3D). The mir‐235;eat‐2 double mutants and the eat‐2 mutants exhibited similar lifespans upon the exogenous overexpression of mir‐235 (Fig 2D and Table EV1), indicating that this temporal microRNA switch is sufficient to regulate DR‐induced longevity in somatic tissues. Moreover, overexpressing mir‐235 in the WT and eat‐2 worms resulted in a mild but significant extension of the lifespan without affecting the pumping rates (Figs 2D and EV3B, and Table EV1), suggesting that mir‐235 overexpression is sufficient to promote longevity.

Autophagy, a key mechanism for maintaining protein homeostasis, is enhanced upon DR and required for DR‐induced longevity 21. To examine whether mir‐235 modulates DR‐enhanced autophagy, we examined a series of autophagy indices. The number of GFP::LGG‐1‐labeled autophagosomes and the transcription of lgg‐1/LC3 are two well‐accepted autophagy markers 22. Both were increased in the eat‐2 worms as previously reported 21, but suppressed in the mir‐235;eat‐2 mutants to a similar level as that in the WT worms and mir‐235(−) mutants (Fig 3A–C). The decrease in GFP::LGG‐1 puncta could be due to either a block or an induction of autophagy 22. To clarify this issue, we further checked SQST‐1::GFP, a substrate for autophagy. With a decrease in the puncta, an increase in autophagy is evident 22, 23. Mutating mir‐235 increased the number of SQST‐1::GFP puncta in multiple tissues of the eat‐2 animals to that of the WT level (Fig 3D). Taken together, mir‐235 is required for the DR‐enhanced autophagy. Autophagy is crucial for the protection of cells against protein aggregates 24. Consistently, the DR‐induced resistance to protein aggregates of α‐synuclein in dopaminergic neurons was abolished by mir‐235 mutation and rescued by its overexpression (Fig 3E).

Figure 3. mir‐235 is required for the enhanced autophagy upon dietary restriction.

Figure 3

  • A, B
    Number of GFP::LGG‐1 puncta in the seam cell, body wall muscle, and intestine of the indicated strains. Arrowheads denote representative GFP::LGG‐1 puncta. Scale bar = 10 μm.
  • C
    qRT–PCR of lgg‐1 in the indicated strains.
  • D
    Number of SQST‐1::GFP puncta in the seam cell and body wall muscle of the indicated strains. Arrowheads denote representative SQST‐1::GFP puncta. Scale bar = 10 μm.
  • E
    Overexpression of mir‐235 in the mir‐235;eat‐2 mutants restores their resistance against α‐synuclein aggregates in dopaminergic (DA) neurons.
Data information: One‐way ANOVA. ns, non‐significant. ***P < 0.001. Error bars: SD.

mir‐235 inhibits cwn‐1 by targeting its 3′ untranslated region

MicroRNAs function through binding to the 3′ untranslated region (UTR) of target genes. Bioinformatic prediction by microRNA.org showed that a Wnt ligand, cwn‐1/WNT4, harbors a conserved binding site for mir‐235 in its 3′‐UTR 25, 26 (Fig EV4A). The transfection of a mir‐235 mimic into HEK293T cells reduced the signal from a luciferase reporter of the cwn‐1 3′‐UTR, whereas transfection of a control oligo did not. Mutating the mir‐235 target site in the cwn‐1 3′‐UTR abolished this regulation (Figs 4A and EV4A). Therefore, mir‐235 interacts with cwn‐1 3′‐UTR. Overexpressing a mammalian homolog of mir‐235 (miR‐92b) in HEK293T cells also suppressed a luciferase reporter of the WNT4 3′‐UTR but not the reporter with a mutated miR‐92b‐binding site (Fig EV4A and B), suggesting that this interaction could be conserved in evolution. We further tested the interaction of mir‐235 with cwn‐1 in live worms, using a transgene expressing mCherry controlled by the promoter and 3′‐UTR of cwn‐1, and green fluorescent protein (GFP) as a control. The reduced signal of mCherry vs. GFP (mCherry/GFP) represents suppression of the cwn‐1 3′‐UTR (Fig 4B). As noted above, mir‐235 is switched on by DR at the onset of adulthood (Fig 1). Consistently, there was no difference in the mCherry/GFP signal between the WT and eat‐2 worms until the last larval stage, but it was decreased by 44% at day 1 (D1) of adulthood in the eat‐2 mutants when mir‐235 was upregulated by 2.6‐fold (Figs 4C, EV1B and EV4C). The mutation of mir‐235 increased the mCherry/GFP signal by 2.0‐fold in the WT and 5.2‐fold in the eat‐2 animals (Figs 4C and EV4D). Moreover, mutating the mir‐235 target site in the cwn‐1 3′‐UTR also blocked the changes in mCherry/GFP in the eat‐2 and mir‐235(−) mutants (Fig 4D), confirming the interaction of mir‐235 with the cwn‐1 3′‐UTR in vivo. We next examined the protein level of CWN‐1 using a transgene expressing CWN‐1::mNeonGreen by the native promoter and 3′‐UTR of cwn‐1. Consistent with our observations with the cwn‐1 3′‐UTR reporters, the CWN‐1::mNeonGreen level was decreased in the eat‐2 mutants by 48% and, upon mir‐235 mutation, was increased by 1.6‐fold in the WT and 2.3‐fold in the eat‐2 mutants at day 1 of adulthood (Fig 4E). Taken together, these data indicate that DR suppresses CWN‐1 expression through mir‐235.

Figure EV4. cwn‐1/WNT4 is a target of mir‐235/miR‐92, related to Figs 4 and 5 .

Figure EV4

  1. Predicted mir‐235/miR‐92‐binding sites on the 3′‐UTRs of cwn‐1/WNT4. The mutations in these sites are marked in red. Note that the seeding sequences of mir‐235 and miR‐92b (AUUGCA, in upper case) are well conserved.
  2. The miR‐92b mimic suppresses the luciferase reporter with the WNT4 3′‐UTR but not the reporter with a mutated miR‐92b target site. Error bars: SD.
  3. The reporter of cwn‐1 3′‐UTR is downregulated in the eat‐2 mutants at the L4 larval stage. mCherry was fused with cwn‐1 3′‐UTR, whereas GFP served as a control. Error bars: SD.
  4. Western blots of the reporter of the cwn‐1 3′‐UTR in the indicated strains at day 1 of adulthood.
  5. The migration of Q neuroblasts (arrowheads) is unaffected in the mir‐235(−) and eat‐2 mutants. Q neuroblasts were labeled with INA‐1::GFP. Scale bar = 10 μm.
  6. Vulva development is normal in the mir‐235(−) and eat‐2 mutants. Scale bar = 10 μm.
Data information: unpaired t‐test: vs. Ctrl. in (B), two‐way ANOVA: vs. WT in (C). ns, non‐significant. *P < 0.05, ***P < 0.001.

Figure 4. mir‐235 inhibits CWN‐1 by binding to the 3′‐UTR of cwn‐1 .

Figure 4

  1. A luciferase reporter with the cwn‐1 3′‐UTR is inhibited by an mir‐235 mimic in HEK293T cells. Mutating the mir‐235 target site in the cwn‐1 3′‐UTR (cwn‐1 3′‐UTR m) blocks this interaction. Error bars: SD.
  2. A diagram of the transgenic reporter of the cwn‐1 3′‐UTR. If mir‐235 binds to the 3′‐UTR of cwn‐1, the mCherry expression controlled by the native promoter and 3′‐UTR of cwn‐1 is suppressed. This suppression will be abolished when the mir‐235 target site in the cwn‐1 3′‐UTR is mutated. The promoter of sur‐5 drives the expression of GFP in all tissues, serving as an internal control.
  3. The reporter of the cwn‐1 3′‐UTR is downregulated in the eat‐2 worms and targeted by mir‐235 in vivo. Scale bar = 200 μm. Error bars: SEM.
  4. The cwn‐1 3′‐UTR reporter with a mutated mir‐235‐binding site no longer responds to eat‐2 or mir‐235 mutations. Scale bar = 300 μm. Error bars: SD.
  5. Fluorescence of CWN‐1::mNeonGreen (mNG) in the indicated strains at day 1 of adulthood. Scale bar = 200 μm. Error bars: SEM.
Data information: Unpaired t‐test. ns, non‐significant. *P < 0.05, **P < 0.01, ***P < 0.001.

Dietary restriction suppresses Wnt signaling in adulthood

Since CWN‐1 is a ligand in Wnt signaling and the upregulation of mir‐235 in adulthood is required for DR‐induced longevity 26 (Figs 2, 3, 4), we questioned whether DR modulates Wnt signaling through mir‐235 for longevity. To answer this, we first checked Q neuroblast migration and vulva development, two larval developmental processes controlled by cwn‐1 and Wnt signaling 26, 27. Consistent with our observations that DR triggers mir‐235 expression at the onset of adulthood (Figs 1A and EV1A), neither the eat‐2 nor mir‐235(−) mutants exhibited obvious defects in these two developmental processes (Fig EV4E and F), suggesting that Wnt signaling is undisturbed by DR or mir‐235 during larval development. We next examined the activities of Wnt signaling in adult worms subjected to DR. Activated Wnt signaling increases β‐catenin to control gene expression 28. Indeed, at day 1 of adulthood, compared with that in the WT worms, the protein level of GFP‐tagged BAR‐1/β‐catenin decreased by 46% in the eat‐2 worms whereas it increased to ~2‐fold in the mir‐235(−) mutants (Fig 5A and B), indicating that DR suppresses Wnt signaling through mir‐235 upregulation. Consistent with the reduced upregulation of mir‐235 in aged eat‐2 mutants (Figs 2A and EV3A), the mir‐235‐dependent decrease in BAR‐1::GFP in eat‐2 mutants declines with aging (Fig 5C), implying that DR suppresses Wnt signaling mainly during early adulthood.

Figure 5. Dietary restriction suppresses Wnt signaling through the interaction between mir‐235 and cwn‐1 .

Figure 5

  1. BAR‐1::GFP expression in the indicated strains. mCherry expressed in the same transgene with BAR‐1::GFP served as a control. Error bars: SEM.
  2. Representative images of BAR‐1::GFP in the indicated strains at day 1 of adulthood. Scale bar = 125 μm.
  3. The level of BAR‐1::GFP in the indicated strains at days 1, 7, and 14 of adulthood. mCherry expressed in the same transgene of BAR‐1::GFP served as a control. Error bars: SD.
  4. mRNA levels of three Wnt signaling targets in the indicated strains of different ages. Error bars: SD.
  5. qRT–PCR of the Wnt signaling targets in the indicated strains at four larval stages (L1–L4) and day 1 of adulthood (D1). Error bars: SD.
Data information: Unpaired t‐test (A), two‐way ANOVA (C–E). ns, non‐significant. *P < 0.05, **P < 0.01, ***P < 0.001.

Wnt signaling suppresses autophagy‐related genes such as atg‐18/WIPI2, lgg‐2/MAP1LC3, and dct‐1/BNIP3 during larval development 29. qRT–PCR showed that all three genes were not affected by DR throughout the four larval stages, but were increased upon DR at D1 of adulthood in a mir‐235‐ and cwn‐1‐dependent manner (Fig 5D and E). In accordance with the reduced upregulation of mir‐235 and diminished control on Wnt signaling in aged eat‐2 mutants, aging also suppressed the upregulation of these three genes in eat‐2 worms (Fig 5D). These results therefore confirm the suppression of Wnt signaling by mir‐235 in early adulthood under DR.

The suppression of Wnt signaling by mir‐235 is important for dietary restriction‐induced longevity

To further dissect the role of Wnt signaling in DR‐induced longevity, adult worms were respectively treated with RNAi against the mir‐235 target (cwn‐1) or two β‐catenin genes (bar‐1 and hmp‐2) to suppress the elevated Wnt signaling in adult mir‐235(−) mutants and to avoid developmental defects from reduced Wnt signaling in the larvae. If the increased CWN‐1 and thereby Wnt signaling in adulthood are responsible for the longevity phenotypes of the mir‐235(−) mutants upon DR, the adult‐specific suppression of them should rescue the longevity phenotypes of the mir‐235;eat‐2 mutants to the levels of the eat‐2 worms. We first checked the lifespan under these RNAi treatments. As expected, all three RNAi treatments extended the lifespan of the mir‐235;eat‐2 mutants to the level of the eat‐2 worms (Figs 6A and B, EV5A, and Table EV1). As Wnt signaling functions by regulating gene transcription, we next examined the mRNA levels of Wnt signaling targets. Consistent with the increased autophagy under DR, we identified atg‐18/WIPI2, lgg‐2/MAP1LC3, and dct‐1/BNIP3 as Wnt signaling targets in DR (Fig 5D and E). Treating mir‐235;eat‐2 mutants with cwn‐1 RNAi from D1 rescued the transcription of these genes to their levels in the eat‐2 worms at day 3 of adulthood (Fig 6C). Besides, RNAi against cwn‐1, bar‐1, or hmp‐2 also restored the mRNA level of lgg‐1/LC3 in the mir‐235;eat‐2 mutants to that in the eat‐2 mutants (Figs 6D and EV5B). Moreover, the resistance to protein aggregates in the mir‐235;eat‐2 mutants was accordingly rescued by RNAi against cwn‐1, bar‐1, or hmp‐2 (Figs 6E and EV5C). Therefore, the suppression of Wnt signaling in adulthood by mir‐235 upregulation is required for DR‐induced longevity.

Figure 6. mir‐235 controls dietary restriction‐induced longevity through Wnt signaling.

Figure 6

  • A, B
    Aging assays of the indicated strains. RNAi treatments were started from the first day of adulthood. At least three independent experiments were performed. See Table EV1 for more details.
  • C
    RNAi of cwn‐1 rescues the expression of atg‐18, lgg‐2, and dct‐1 in the mir‐235;eat‐2 mutants. Error bars: SD.
  • D
    cwn‐1 or bar‐1 RNAi treatment restores lgg‐1 expression in the mir‐235;eat‐2 mutants. Error bars: SD.
  • E
    cwn‐1 or bar‐1 RNAi treatment in the mir‐235;eat‐2 mutants restores their resistance against α‐synuclein aggregates in dopaminergic (DA) neurons. Error bars: SEM.
  • F
    A schematic summary of mir‐235 and Wnt signaling in dietary restriction‐induced longevity. Dietary restriction induces mir‐235/miR‐92 expression. Upregulation of mir‐235/miR‐92 upon DR subsequently inhibits CWN‐1/WNT4, suppressing Wnt signaling for longevity. Dashed lines represent genetic interactions.
Data information: Two‐way ANOVA (C, D), unpaired t‐test (E). ns, non‐significant, **P < 0.01, ***P < 0.001.

Figure EV5. hmp‐2 functions downstream of mir‐235 for dietary restriction‐induced longevity, related to Fig 6 .

Figure EV5

  1. Aging assays of eat‐2 and mir‐235;eat‐2 mutants under the indicated RNAi treatments, which were started from the first day of adulthood. At least three independent experiments were performed. See Table EV1 for more details.
  2. hmp‐2 RNAi treatment rescues lgg‐1 expression in the mir‐235;eat‐2 mutants. These data are from the same set of experiments in Fig 6D. Error bars: SEM.
  3. hmp‐2 RNAi treatment in the mir‐235;eat‐2 mutants restores their resistance against α‐synuclein aggregates in dopaminergic (DA) neurons.
Data information: two‐way ANOVA in (B), unpaired t‐test in (C). ns, non‐significant. **P < 0.01, ***P < 0.001.

Discussion

Both development and DR‐induced longevity are controlled by molecular signaling pathways in response to nutrient status. It is therefore intriguing to explore the roles of important developmental signaling pathways, such as that of Wnt signaling, in the longevity induced by DR. In this study, we identified a temporal microRNA switch regulating Wnt signaling in adulthood for DR‐induced longevity in C. elegans. Our data showed that DR induces mir‐235 at the end of larval development. This microRNA subsequently suppresses Wnt signaling by inhibiting cwn‐1/WNT4 and thereby promotes longevity (Fig 6F).

mir‐235 has been proposed as a nutrient sensor of the starvation at the first larval stage (L1) under the regulation of daf‐16/FOXO 18. We hereby show that this microRNA sensor also responds to DR, a milder reduction in food. Two DR regimens, eat‐2 mutation and sDR, increase the mir‐235 level in young adult worms (Fig 1). The eat‐2 mutation does not cause starvation and therefore does not induce mir‐235 at L1. Because daf‐16/FOXO is not involved in the DR‐induced longevity by eat‐2 mutation, it is unlikely to drive mir‐235 expression in this context 13. pha‐4/FOXA is well recognized as a key transcription factor that responds to glucose and controls DR‐induced longevity 15, 30. Upon DR, the transcription of pha‐4/FOXA is increased, in a pattern that correlates to the upregulation of mir‐235 (Figs 1 and EV1) 15. Our results with luciferase reporters and ChIP–qPCR further indicate that pha‐4/FOXA may directly control the transcription of mir‐235 (Figs 1 and EV1), which is consistent with the results from previous ChIP‐Seq studies 31, 32. Moreover, suppression of pha‐4/FOXA blocks the upregulation of mir‐235 in the eat‐2 animals, confirming that pha‐4/FOXA is the upstream regulator of mir‐235 upon DR (Fig 1). As the tissues expressing pha‐4/FOXA and mir‐235 overlap but are not identical, the regulation of mir‐235 by pha‐4/FOXA could be autonomous (e.g., in neurons and intestine) and nonautonomous (e.g., in hypodermis) 15, 33, 34, 35.

Although pha‐4/FOXA is a potent regulator of mir‐235 in eat‐2 mutants and also upregulated under sDR, it does not control the upregulation of mir‐235 in this DR regimen (Fig EV2). This is consistent with the fact that pha‐4/FOXA is not required for sDR‐induced longevity 13. sod‐1, a well‐defined pha‐4/FOXA target, is not induced upon sDR, either (Fig EV2) 15. It will be interesting to investigate why sDR upregulates pha‐4/FOXA without inducing its targets in the future, as this could provide insights on the differences in the molecular signaling underlying different DR regimens. sDR extends lifespan via daf‐16/FOXO 13. Accordingly, we found sDR upregulates mir‐235 by daf‐16/FOXO (Fig EV2), potentially in a similar manner as L1 starvation 18. The upstream regulator of mir‐235, pha‐4/FOXA and daf‐16/FOXO, responds to various non‐overlapping DR methods 13. mir‐235 is also regulated by intermittent fasting, another DR method 36. Therefore, mir‐235 could be a central sensor of different DR regimens. Interestingly, the expression of mir‐235 in the WT animals is unchanged upon pha‐4 or daf‐16 RNAi (Fig 1), indicating that mir‐235 is not constitutively under the control of these two transcription factors and suggesting that their transcription regulation on mir‐235 is a response to a low nutrient status such as DR. Whether these two transcription factors could control mir‐235 under other circumstances is interesting to explore in the future.

The upregulation of mir‐235 is not only a molecular marker for dietary changes, but also actively functions in DR‐induced longevity. Our results show that mir‐235 is required for the enhanced autophagy, protein homeostasis, and prolonged lifespan upon DR (Figs 2 and 3). mir‐235 is widely upregulated in various tissues under this condition. The DR‐enhanced autophagy in these tissues depends on mir‐235 (Fig 3), implying that mir‐235 controls DR‐induced longevity autonomously in multiple tissues. As the expression of pha‐4 is more restricted than mir‐235, pha‐4 may transduce the longevity signal of DR to a broader range of tissues via the nonautonomous upregulation of mir‐235. Our results, together with previous studies reporting other microRNAs in DR‐induced longevity, indicate microRNAs as effective regulators underlying this longevity program 37, 38.

Interestingly, although our results and previous reports indicate that a pha‐4‐mediated increase in autophagy in young adults is important for longevity 17, 21, it was recently reported that the upregulated transcription of multiple autophagy genes by pha‐4 in aged worms promotes aging 39. With aging, the formation of autophagosomes (APs) increases whereas that of autolysosomes (ALs) does not exhibit a similar change 40. We therefore speculate that instead of upregulating a wide range of autophagy genes in young animals, the effect of pha‐4 in aged worms could be mainly in the APs, causing the incoordination between APs and ALs. Consistently, RNAi treatment against genes for APs (but not for ALs) in aged worms extends lifespan in a similar manner to pha‐4 RNAi 39. The mechanisms underlying the age‐associated change in pha‐4 downstream targets are interesting for future studies.

In addition to its functions in worms under DR, mir‐235 could also be important to aging in the WT animals. In the WT worms, the expression of mir‐235 drops with age, and overexpressing mir‐235 mildly extends their lifespan (Fig 2). It is always intriguing to explore whether longevity signaling rectifies or bypasses the machinery underlying natural aging. Our data on mir‐235 suggest that rectification of natural aging contributes to DR‐induced longevity.

Although DR is known to modulate the expression of numerous genes for longevity 4, 37, the temporal control of DR‐regulated gene expression is poorly studied. Our results indicate that the upregulation of mir‐235 and suppression of Wnt signaling by DR in worms are stage‐specific, in that they are not induced in the early larval development, but triggered at the onset of adulthood and peaked in young adulthood (Figs 1, 2, EV1, EV2, and EV3). Although the underlying machinery remains to be explored, this stage‐specific regulation is an important temporal control of gene expression for DR‐induced longevity. The activation of Wnt signaling is required for developmental programs, whereas its hyper‐activation is related to disorders and aging in adult animals 6, 28, 41, 42. DR resolves the dilemma of the antagonistic pleiotropic Wnt signaling by this temporal regulation on mir‐235‐Wnt signaling. A DR‐induced upregulation of mir‐235 from the last larval stage will not alter its target, Wnt signaling, or induce L1 arrest during larval development, thus protecting the worms from developmental defects (Figs 1, EV1 and EV4) 18. Accordingly, the eat‐2 and mir‐235(−) mutants do not exhibit obvious defects during larval development. When worms under DR enter adulthood, mir‐235 is upregulated and suppresses Wnt signaling for longevity (Figs 1, 5 and EV4). Such a temporal regulation of gene expression may be important to other longevity pathways, especially to those involving developmental signalings, because it elaborately reduces potential interferences on development and focuses the transcriptome changes on adult survival. Consistent with this speculation, germline ablation also turns on a developmental timing switch at L4 for longevity 43.

We have shown herein that DR upregulates mir‐235 to inhibit cwn‐1 and thereby Wnt signaling in adulthood for longevity (Fig 6). Wnt signaling controls autophagy gene expression during larval development 44. Our data have indicated that the reduction in Wnt signaling upon DR increases the same set of autophagy genes in adulthood and promotes longevity (Figs 4 and 5). Wnt signaling also interacts with the AMPK and mTOR pathways to ensure metabolic homeostasis 45. Their interactions could be important to DR‐induced longevity as well. Our results suggest that the mir‐235/miR‐92‐cwn‐1/WNT4 axis could be evolutionarily conserved (Figs EV1 and EV4). Consistent with our findings, the homologs of mir‐235 are also regulated in mammals undergoing DR 46, 47, 48. As hyper‐activation of Wnt signaling can lead to aging‐related diseases, such as cancer and diabetes, and inhibits self‐renewal of satellite cells in aged mice 28, 49, it will be interesting to explore the regulation and function of this switch in the longevity of vertebrates. Moreover, consistent with the fact that both animal development and DR modulate molecule signaling in response to nutrient conditions, our results indicate that Wnt signaling controls DR‐induced longevity as well as development. As many other developmental signaling pathways respond to nutrient status 50, 51, 52, 53, it will be interesting to pursue whether they are also involved in DR‐induced longevity.

Materials and Methods

Caenorhabditis elegans strains and culture

Caenorhabditis elegans were grown with standard techniques at 20°C, unless otherwise noted 54. Strains used in this study are listed in Table EV2. Some strains were provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440). For synchronization, eggs laid in a desired time window (4 h to O/N) were collected unless otherwise noted.

Cell culture

HEK293T (ATCC) cells were maintained in DMEM medium supplemented with 10% fetal bovine serum (Thermo Fisher, Cat# 10099141) at 37°C, 5% CO2. Cells were authenticated by morphology and tested for mycoplasma contamination before experiments.

Solid plate‐based dietary restriction in C. elegans

Solid plate‐based dietary restriction (sDR) in C. elegans was performed as described 55. In brief, worms were synchronized and grown on NGM plate with regular OP50 seeding. At the fourth larval stage (L4), worms were transferred onto NGM plates supplemented with ampicillin (100 μg/ml) and seeded with OP50 at various concentrations, unless otherwise noted. C. elegans was tested at five bacteria concentrations: 1011, 1010, 109, 108, and 107 cfu/ml. The bacteria concentrations of 1011 and 108 cfu/ml were considered as the ad libitum and sDR feeding conditions, respectively.

For RNA interference, HT115 cells with RNAi constructs were incubated in LB with ampicillin (100 μg/ml) overnight. After measured for concentrations, bacteria were spinned down and resuspended in LB with kanamycin (100 μg/ml) at desired concentrations and seeded onto fresh NGM plates with 100 μg/ml ampicillin and 0.8 mM IPTG. Worms at L4 were transferred onto RNAi plates with various bacteria concentrations. The bacteria concentrations of 1011 and 108 cfu/ml were considered as the ad libitum and sDR feeding conditions, respectively.

Lifespan assays

Adult lifespan analysis was performed as previously reported 56. For lifespan assays under sDR, worms were transferred onto fresh plates every 8 h during reproductive period and every other day afterward. Worms undergoing internal hatching, bursting vulva, or crawling off the plates were censored. Statistical analysis was performed with the Mantel–Cox log rank method.

Plasmid construction

To generate mir‐235p::gfp, mir‐235 promoter of 2.3 kb was PCR‐amplified from N2 genomic DNA with primers F (5′‐GCCTGCAGGTCGACTCGTCAGTCAACTTGGTATTC‐3′) and R (5′‐GCCGCGAATCGATAGCAGCAAACGAATAGATAGCA‐3′) and cloned into XbaI‐ and BamHI‐digested L3781 (Fire vector kit 1997). The Fire Lab C. elegans Vector Kit was a gift from Andrew Fire.

To generate mir‐235p::gfp::mir‐235, the stem loop of mir‐235, 149 bp of its 5′ flanking sequence, and 198 bp of its 3′ flanking sequence were PCR‐amplified from N2 genomic DNA with primers F (5′‐CACAAGCTTTGGTAAGGACCTTCATGGCCAA‐3′) and R (5′‐TACTTGTATGGCCGGAGAGAGCAAAAAGCAATGTC‐3′). mir‐235p::gfp was linearized by PCR with the primers F (5′‐GACATTGCTTTTTCTCTCCGGCCATACAAGTA‐3′) and R (5′‐TTGGTACCAATTGAAGGTCCTACAAGCTTT‐3′) and ligated with the amplified mir‐235 fragment.

For L3781‐mCherry, mCherry was amplified from myo‐2::mCherry with the primers F (5′‐GGCCGCTGTACACCCATGGTCTCAAAGGGTGAAGA‐3′) and R (5′‐TATGGCCGGCTAGCGCTACTTATACAATTCATCCA‐3′). L3781 was linearized by PCR with primers F (5′‐TGGATGAATTGTATAAGTAGCGCTAGCGGCCATA‐3′) and R (5′‐TCTTCACCCTTTGAGACCATGGGTGTACAGCGGCC‐3′) and ligated with the amplified mCherry fragment.

To generate cwn‐1p::mCherry::cwn‐1u, 1.89 kb of cwn‐1 promoter was PCR‐amplified from N2 genomic DNA using the primers F (5′‐CGGTTTTGGCGCGATCAAATTAGAATCAGGC‐3′) and R (5′‐CCATGGGTGTACAGCTTCATATAATTTTTTAG‐3′). 182 bp of cwn‐1 3′‐UTR was similarly cloned using the primers F (5′‐ATTGTATAAGTAGCGTTTGAACTTCTATCGTCTTT‐3′) and R (5′‐TTACTTGTATGGCCGATCTTGAACATTTTTATTGC‐3′). The promoter and 3′‐UTR of cwn‐1 were then cloned into L3781‐mCherry (digested with BamHI and NotI for the promoter and NheI for the 3′‐UTR).

To generate cwn‐1p::mCherry::cwn‐1uM, the mutation of the mir‐235 target site was introduced by PCR with cwn‐1p::mCherry::cwn‐1u as the template, using the primers F (5′‐CATTAATCTCTATTTgagctcAAAAATGTTCAAGAT‐3′) and R (5′‐ATCTTGAACATTTTTgagctcAAATAGAGATTAATG‐3′).

To generate cwn‐1p::cwn‐1::mNeonGreen, L3781 was first linearized by PCR using the primers F (5′‐GAGCTGTACAAGTAAGCGGCCGCGAATTCG‐3′) and R (5′‐GCCCTTGCTCACCATCTCGAGCGGATCCGC‐3′). mNeonGreen was amplified from pNCS‐mNeonGreen with the primers F (5′‐GCGGATCCGCTCGAGATGGTAAAGGGC‐3′) and R (5′‐CGAATTCGCGGCCGCTTACTTGTACAGCTC‐3′) and ligated into the linearized L3781. The 3′‐UTR of cwn‐1 was amplified from N2 genomic DNA using the primers F (5′‐GCGAATTCTTTGAACTTCTATCGTCTTT‐3′) and R (5′‐CGGCTAGCATCTTGAACATTTTTATTGC‐3′) and cloned into L3781‐mNeonGreen (digested with EcoRI and NheI). cwn‐1 promoter and its coding sequence were subsequently amplified from N2 genomic DNA with the primers F (5′‐CGGTTTTGGCGCGATCATTTAAGATTCAGGC‐3′) and R (5′‐CCCTTGCTCACCATCTCTAAGCTAAAATTCTC‐3′) and cloned into L3781‐mNeonGreen::cwn‐1u (digested with BamHI and XhoI).

To generate bar‐1p::bar‐1::gfp, bar‐1 promoter and its coding sequence were PCR‐amplified from N2 genomic DNA with the primers F (5′‐GCCTGCAGGTCGACTCTGACAACTGTATATTTACG‐3′) and R (5′‐ACTCATTTTTTCTACAAATCGACTATTCCTAGAAG‐3′) and cloned into L3781 (digested with BamHI and NotI).

To generate L4440::luci, L4440::bar‐1i, L4440::hmp‐2i, and L4440::cwn‐1i, 1.65 kb of luc2 cDNA, 2.44 kb of bar‐1 cDNA, 2.12 kb of hmp‐2 cDNA, and 1.12 kb of cwn‐1 cDNA were amplified from pGL4 or N2 cDNA by PCR and respectively cloned into L4440 (digested with NheI and HindIII). luc2 cDNA was PCR‐amplified with the primers F (5′‐CCACCGGTTCCATGGATGGAAGATGCCAAAAACAT‐3′) and R (5′‐TCGACGGTATCGATATTACACGGCGATCTTGCCGC‐3′), bar‐1 cDNA with the primers F (5′‐CCACCGGTTCCATGGATGGACCTGGATCCGAACCTAGTT‐3′) and R (5′‐TCGACGGTATCGATATTAAAATCGACTATTCCTAGAAGG‐3′), hmp‐2 cDNA with the primers F (5′‐CCACCGGTTCCATGGATGCGATTATTCTCATATTT‐3′) and R (5′‐TCGACGGTATCGATATTACAAATCGGTATCGTACC‐3′), and cwn‐1 cDNA with the primers F (5′‐CCACCGGTTCCATGGATGCTGAAATCTACACAAGTGATC‐3′) and R (5′‐TCGACGGTATCGATATTATAAGCATAAATACTTCTCAATTCG‐3′).

For luciferase reporters with 3′‐UTR, 3′‐UTRs of interest were amplified from genomic DNA by PCR and cloned after the luciferase gene in pGL3‐M luciferase (digested by EcoRI and XbaI, gifts from Zhu Lab). cwn‐1 3′‐UTR was amplified with the primers F (5′‐GGCTGCAGGATATCGTTTGAACTTCTATCGTCTTTTTCA‐3′) and R (5′‐CCGGCCGCCCCGACTATCTTGAACATTTTTATTGCAAAA‐3′), and WNT4 3′‐UTR with the primers F (5′‐GGCTGCAGGATATCGCCGCCTGCCTAGCCCTGCGC‐3′) and R (5′‐CCGGCCGCCCCGACTGTGCATCAGACTATGTCATGGGAC‐3′). The mutation of mir‐235‐ or miR‐92b‐binding site was thereafter introduced using PCR with the following primer pairs: F (5′‐CATTAATCTCTATTTgagctcAAAAATGTTCAAGAT‐3′) and R (5′‐ATCTTGAACATTTTTgagctcAAAT‐AGAGATTAATG‐3′) for mutating mir‐235‐binding site and F (5′‐GGGAGGAAAGGGCTGgagctcAAAGTCCTCTCCCAT‐3′) and R (5′‐ATGGGAGAGGACTTTgagctcCAGCCCTTTCCTCCC‐3′) for mutating miR‐92b‐binding site.

To generate mir‐235p::luc, 2.3 kb of mir‐235 promoter was PCR‐amplified from N2 genomic DNA with the primers F (5′‐CTGAGCTCGCTAGCCCGTCAGTCAACTTGGTATTC‐3′) and R (5′‐AGTACCGGATTGCCACAGCAAACGAATAGATAG‐CA‐3′) and cloned before the luciferase gene in pGL4.17 (digested with XhoI and HindIII).

To generate mir‐235pM::luc, 2.3 kb of mir‐235 promoter with four potential PHA‐4‐binding sites mutated was synthesized by Qinglan Biotech, PCR‐amplified from the synthetic DNA with the primers F (5′‐GCCTCGAGGATATCACGTCAGTCAACTTGGTATTC‐3′) and R (5′‐TTGGCCGCCGAGGCCCAGCAAACGAATAGATAGCA‐3′), and cloned before the luciferase gene in pGL4.17 (digested with XhoI and HindIII).

To generate gfp‐pha‐4, 1.52 kb of pha‐4 coding sequence was PCR‐amplified from N2 genomic DNA with the primers F (5′‐TCCGGACTCAGATCaATGACATCGCCATCCAGTGA‐3′) and R (5′‐TACCGTCGACTGCAGTTATAGGTTGGCGGCCGAGT‐3′) and cloned after the gfp gene in pEGFP‐C1 (digested with XhoI and EcoRI).

The CRISPR–Cas9‐mediated genome editing plasmids were constructed as described 57. Briefly, to generate pDD162‐pha‐4, the sgRNA sequence (5′‐GGCGGCCGAGTTCGGGTTGG‐3′) targeting pha‐4 C‐terminal was cloned into pDD162 (a gift from Bob Goldstein, Addgene plasmid # 47549) by site‐directed mutagenesis (primer F: 5′‐CAAGACATCTCGCAATAGGAGG‐3′ and R: 5′‐GGCGGCCGAGTTCGGGTTGGGTTTTAGAGCTAGAAATAGCAAGT‐3′). To generate pDD282‐pha‐4‐avi, the 570 bp of 5′ and 550 bp of 3′ homologous repair templates were cloned from N2 genomic DNA by PCR (for 5′ homologous repair template, F: 5′‐ACGTTGTAAAACGACGGCCAGTCGCCGGCATTCTAAATAGGCCCCTGCAA‐3′ and R: 5′‐CATCGATGCTCCTGAGGCTCCCGATGCTCCTAGGTTGGCGGCCGAGTTCG‐3′; for 3′ homologous repair template, F: 5′‐TTCGAAGCTCAGAAGATTGAATGGCATGAATAAATCTCCAATTCACACGT‐3′ and R: 5′‐TCACACAGGAAACAGCTATGACCATGTTATACCATGAGAAAATGAGAGA‐3′) and inserted into pDD282‐Avi (digested by SpeI and AvrII) by HiFi DNA Assembly (New England Biolabs, Cat# M0530L). Target site in the template was modified with synonymous mutation by PCR (primers F: 5′‐AAATAATTTCAGCTCTACCAACCCGAACTCG‐3′ and R: 5′‐CGAGTTCGGGTTGGTAGAGCTGAAATTATTT‐3′). pDD282‐Avi is modified from pDD282 (a gift from Bob Goldstein, Addgene plasmid # 66823) by inserting an Avi tag at the 3′ of FLAG tag (primers F: 5′‐GGACTTAATGATATTTTCGAAGCTCAgAAgATTGAATGGCATGAActagtTCGACCTGCAGACTG‐3′, 5′‐CGTGATTACAAGGATGACGATGACAAGAGATCTGGAGGAGGATCTGGACTTAATGATATTTTCGA‐3′, and R: 5′‐CAGGAAACAGCTATGACCATG‐3′).

Transgenes

Plasmids cwn‐1p::mCherry::cwn‐1u (25 ng/μl) and cwn‐1p::mCherry::cwn‐1uM (25 ng/μl) were injected into N2 to respectively generate sydEx027 and sydEx103, with an injection marker of sur‐5p::gfp (50 ng/μl). 50 ng/μl of plasmids mir‐235p::gfp, bar‐1p::bar‐1::gfp, mir‐235p::gfp::mir‐235, and cwn‐1p::cwn‐1::mNeonGreen were injected into N2 to respectively generate sydEx059, sydEx061, sydEx093, and sydEx101 with an injection marker of myo‐2p::mCherry (2.5 ng/μl).

To generate sydIs097, plasmids pDD162‐pha‐4 (50 ng/μl) and pDD282‐pha‐4‐Avi (10 ng/μl) were injected into N2 with an injection marker of myo‐2p::mCherry (2.5 ng/μl). The following screening processes were conducted as described 57.

RNA interference

RNAi experiments were performed as described 58. For RNAi of cwn‐1, hmp‐2, and bar‐1, synchronized larvae were grown on OP50 plates until the first day of adulthood and transferred to corresponding RNAi plates. For RNAi of pha‐4, synchronized eggs were seeded on HT115 plates expressing corresponding dsRNA. The RNAi constructs against luc2, bar‐1, hmp‐2, or cwn‐1 were prepared in this study. The RNAi clones against pha‐4 and daf‐16 are from Ahringer RNAi library. Their GenePairs names are F38A6.1 and R13H8.1, respectively.

Cell transfection

HEK293T cells were seeded into a 24‐well plate and transfected using Lipofectamine 3000 Transfection Reagent (Thermo Fisher, Cat# L3000015) following the manufacturer's instruction 1 day post‐seeding. When testing the interaction between cel‐mir‐235 and cwn‐1 3′‐UTR, 10.4 pmol of microRNA mimic and 260 ng of the 3′‐UTR reporter plasmid were added into each well. For the binding of hsa‐miR‐92b to WNT4 3′‐UTR, 12.6 pmol of microRNA mimic and 160 ng of the 3′‐UTR reporter plasmid were transfected for each well. When testing the interaction between PHA‐4 and cel‐mir‐235 promoter, GFP‐PHA‐4, the luciferase reporter of mir‐235 promoter, and the internal reference of Renilla luciferase were transfected as a ration of 4:1:0.1. MicroRNA mimics were ordered from GenePharma. Sequences of these mimics are listed in Table EV3.

Luciferase assay

Luciferase activities were measured using Dual‐Luciferase Reporter Assay System (Promega, Cat# E1910) 48 h post‐transfection as the manufacturer instructed. At least three independent experiments were performed.

Quantitative RT–PCR

Synchronized worms were grown until day 0 of adulthood (D0, young adults without bearing eggs) to minimize the interference from growing embryos, unless otherwise noted. D0 adults grow into D1 adults within hours, making their somatic tissues and related phenotypes almost the same as D1 worms. Afterward, worms were frozen in TRIzol (Invitrogen, Cat# 15596018) and subjected to qRT–PCR as previously reported 43. For mRNA, total RNA was prepared by RNeasy Mini Kit (Qiagen, Cat# 74104). cDNA was subsequently generated by iScript™ Reverse Transcription Supermix for qRT–PCR (Bio‐Rad, Cat# 1708841). For microRNA, miRNeasy Mini Kit (Qiagen, Cat# 217004) and TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems, Cat# 4366596) were used for total RNA and cDNA preparation, respectively.

qRT–PCR was performed with Bestar® Sybr Green qPCR Master Mix (DBI Bioscience, Cat# DBI‐2043) on a QuantStudio™ 6 Flex Real‐time PCR System (Applied Biosystems) or a CFX384 Touch™ Real‐Time PCR Detection System (Bio‐Rad). Four technical replicates were performed in each reaction. When performing relative quantification, a combination of ama‐1 and cdc‐42 was used as reference for mRNA quantification, whereas Sno‐RNA U18 was used as a reference for microRNA qRT–PCR. When performing absolute quantification (AQ) of mir‐235, a serial dilution of cDNA from mir‐235 mimic (1.00E‐1, 1.00E‐2, 1.00E‐3, 1.00E‐4, 1.00E‐5, 1.00E‐6, 1.00E‐7 pmol/well) and water was included in each AQ–qRT–PCR plate to make a standard curve. The results were from at least three biological replicates. qRT–PCR primers for mir‐235 and lgg‐2 are listed in Table EV3. Other primer sequences are as reported 4, 43, 44, 59, 60, 61, 62.

Chromatin immunoprecipitation

Synchronized worms at day 1 of adulthood were subjected to the chromatin immunoprecipitation (ChIP) assay as previously described 63. In brief, worms were synchronized by bleaching and subjected ChIP at day 1 of adulthood. Crosslinked worms were sonicated five times by a SCIENTZ‐IID (Scientz) at 80 W for 8 s. Sonicated worm lysate with 2 mg protein was incubated with 3 μl of anti‐GFP antibody—ChIP Grade (Abcam, Cat# ab290) and 20 μl of ChIP‐Grade Protein G Agarose Beads (CST, Cat# 9007S). Immunoprecipitated DNA was digested by proteinase K (NEB, Cat# P8107S) and purified using StarPrep PCR & DNA Fragment Purification Kit (Genstar, Cat# D206‐04). Purified DNA was analyzed by qRT–PCR. Primers were designed according to the prediction of PHA‐4‐binding sites and reported ChIP‐Seq data 31, 32. Primers used are listed in Table EV3.

Microscopy

For imaging, synchronized worms were collected at day 1 of adulthood unless otherwise noted. Worms were subsequently anesthetized using 1 mM levamisole (Sigma‐Aldrich, Cat# 31742) for imaging GFP::LGG‐1 and SQST‐1::GFP or 0.1% sodium azide for the rest experiments and mounted on agar pads. Images were captured using an Olympus BX51, an Olympus BX53, or a Leica TCS SP8 X microscope.

For pumping rates, worms were examined on OP50 plates on an Olympus SZX16 stereo microscope. For each genotype, 51–126 animals from at least three independent experiments were scored.

For thrashing rates, 150 μl of M9 was added into each well of a 96‐well plate. Worms at day 10 of adulthood were transferred into this 96‐well plate, with one worm in each well. An Olympus SZX16 stereo microscope mounted with a Nikon D4 camera was used for video recording. Thrashing rate was subsequently scored from videos. For each genotype or treatment, 66–75 animals from three independent experiments were examined.

Fluorescence intensity was measured by Adobe Photoshop or Image J. Background signal was subtracted as reported 64. For each genotype or treatment, 35–83 animals from at least three independent experiments were scored.

Autophagy

GFP::LGG‐1 and SQST‐1::GFP puncta were counted as previously described 22, 40, 65. In brief, for quantification of GFP::LGG‐1 puncta in intestine cells, the images were acquired from about five slices with 0.8 μm step size, where intestinal nucleus was clearly observed. For quantification of GFP::LGG‐1 and SQST‐1::GFP puncta in the body wall muscle and the seam cells, the images were acquired from one slice where the muscular striation and the seam cell body were clearly seen, respectively. The puncta were counted using ComDet v.0.3.7 in ImageJ. For autophagy in the intestine, the pair of intestinal cells closest to the tail was examined. For autophagy in the seam cells and the body wall muscle, cells in the middle of the body were checked. For each genotype, 31–70 animals at the late fourth larval stage or the first day of adulthood from at least three independent experiments were scored.

Western blotting

Synchronized worms were grown to day 1 of adulthood and harvested in lysis buffer as reported 66. After three rounds of freezing and thawing with liquid nitrogen, worms were homogenized using a Precellys 24 homogenizer (Bertin). Proteins were separated by reducing SDS–PAGE and transferred to PVDF membranes. Membranes were then blotted with antibodies against GFP (1:2,000, Santa Cruz Biotechnology, Cat# sc‐9996) or mCherry (1:2,000, Novus Biologicals, Cat# NBP1‐96752). Anti‐mouse secondary antibody conjugated with horseradish peroxidase (1:5,000, Thermo Fisher Scientific, Cat# G‐21040) was used for detecting anti‐GFP or anti‐mCherry primary antibodies.

Statistical analysis

Results are presented as mean ± SD unless otherwise noted. Statistical tests were performed as indicated using GraphPad Prism (GraphPad software). The statistics of lifespan assays are listed in Table EV1. Other statistics are in Dataset EV1.

Author contributions

YS conceived the project. YX and YS designed and performed the experiments and analyzed the data. ZH prepared the transgenic strains of pha‐4::gfp. MS carried out the quantification of the microscopy images and contributed to transgenic strain preparation and worm culture. YZ contributed to autophagy monitoring. YS wrote the manuscript. YX, ZH, MS, and YZ contributed to manuscript editing.

Conflict of interest

The authors declare that they have no conflict of interest.

Supporting information

Expanded View Figures PDF

Table EV1

Table EV2

Table EV3

Dataset EV1

Review Process File

Acknowledgements

We thank Yumin Dai and Qingyuan Hu (SIBCB, CAS) for their technical support; Dr. Xueliang Zhu (SIBCB, CAS) and Dr. Jingdong Han (PKU) for providing plasmids; the CGC, Dr. Hong Zhang (IBP, CAS), and Dr. Adam Antebi (MPI‐AGE) for providing strains; and Mr. Chenghui Wan for the illustration in synopsis. This research was supported by the Thousand Talents Plan (Youth), the Strategic Priority Research Program of the Chinese Academy of Sciences (Grant No. XDB19000000) and NSFC (Grant No. 31771518).

EMBO Reports (2019) 20: e46888

References

  • 1. Mattison JA, Colman RJ, Beasley TM, Allison DB, Kemnitz JW, Roth GS, Ingram DK, Weindruch R, de Cabo R, Anderson RM (2017) Caloric restriction improves health and survival of rhesus monkeys. Nat Commun 8: 14063 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Fontana L, Partridge L (2015) Promoting health and longevity through diet: from model organisms to humans. Cell 161: 106–118 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Riera CE, Merkwirth C, De Magalhaes Filho CD, Dillin A (2016) Signaling networks determining life span. Annu Rev Biochem 85: 35–64 [DOI] [PubMed] [Google Scholar]
  • 4. Heestand BN, Shen Y, Liu W, Magner DB, Storm N, Meharg C, Habermann B, Antebi A (2013) Dietary restriction induced longevity is mediated by nuclear receptor NHR‐62 in Caenorhabditis elegans . PLoS Genet 9: e1003651 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Bishop NA, Guarente L (2007) Two neurons mediate diet‐restriction‐induced longevity in C. elegans . Nature 447: 545–549 [DOI] [PubMed] [Google Scholar]
  • 6. Clevers H (2006) Wnt/beta‐catenin signaling in development and disease. Cell 127: 469–480 [DOI] [PubMed] [Google Scholar]
  • 7. Sethi JK, Vidal‐Puig A (2010) Wnt signalling and the control of cellular metabolism. Biochem J 427: 1–17 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Sato C, Zhao G, Ilagan MX (2012) An overview of notch signaling in adult tissue renewal and maintenance. Curr Alzheimer Res 9: 227–240 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Petrova R, Joyner AL (2014) Roles for Hedgehog signaling in adult organ homeostasis and repair. Development 141: 3445–3457 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Ables JL, Breunig JJ, Eisch AJ, Rakic P (2011) Not(ch) just development: Notch signalling in the adult brain. Nat Rev Neurosci 12: 269–283 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Lakowski B, Hekimi S (1998) The genetics of caloric restriction in Caenorhabditis elegans . Proc Natl Acad Sci USA 95: 13091–13096 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Wu A, Wan F, Sun X, Liu Y (2002) Effects of dietary restriction on growth, neurobehavior, and reproduction in developing Kunmin mice. Toxicol Sci 70: 238–244 [DOI] [PubMed] [Google Scholar]
  • 13. Greer EL, Brunet A (2009) Different dietary restriction regimens extend lifespan by both independent and overlapping genetic pathways in C. elegans . Aging Cell 8: 113–127 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Pandit A, Jain V, Kumar N, Mukhopadhyay A (2014) PHA‐4/FOXA‐regulated microRNA feed forward loops during Caenorhabditis elegans dietary restriction. Aging 6: 835–855 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Panowski SH, Wolff S, Aguilaniu H, Durieux J, Dillin A (2007) PHA‐4/Foxa mediates diet‐restriction‐induced longevity of C. elegans . Nature 447: 550–555 [DOI] [PubMed] [Google Scholar]
  • 16. Raharjo WH, Logan BC, Wen S, Kalb JM, Gaudet J (2010) In vitro and in vivo characterization of Caenorhabditis elegans PHA‐4/FoxA response elements. Dev Dyn 239: 2219–2232 [DOI] [PubMed] [Google Scholar]
  • 17. Lapierre LR, Gelino S, Melendez A, Hansen M (2011) Autophagy and lipid metabolism coordinately modulate life span in germline‐less C. elegans . Curr Biol 21: 1507–1514 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Kasuga H, Fukuyama M, Kitazawa A, Kontani K, Katada T (2013) The microRNA miR‐235 couples blast‐cell quiescence to the nutritional state. Nature 497: 503–506 [DOI] [PubMed] [Google Scholar]
  • 19. Lucanic M, Graham J, Scott G, Bhaumik D, Benz CC, Hubbard A, Lithgow GJ, Melov S (2013) Age‐related micro‐RNA abundance in individual C. elegans . Aging 5: 394–411 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Kato M, Chen X, Inukai S, Zhao H, Slack FJ (2011) Age‐associated changes in expression of small, noncoding RNAs, including microRNAs, in C. elegans . RNA 17: 1804–1820 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Hansen M, Chandra A, Mitic LL, Onken B, Driscoll M, Kenyon C (2008) A role for autophagy in the extension of lifespan by dietary restriction in C. elegans . PLoS Genet 4: e24 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Zhang H, Chang JT, Guo B, Hansen M, Jia K, Kovacs AL, Kumsta C, Lapierre LR, Legouis R, Lin L et al (2015) Guidelines for monitoring autophagy in Caenorhabditis elegans . Autophagy 11: 9–27 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Li J, Zhu R, Chen K, Zheng H, Zhao H, Yuan C, Zhang H, Wang C, Zhang M (2018) Potent and specific Atg8‐targeting autophagy inhibitory peptides from giant ankyrins. Nat Chem Biol 14: 778–787 [DOI] [PubMed] [Google Scholar]
  • 24. Lamark T, Johansen T (2012) Aggrephagy: selective disposal of protein aggregates by macroautophagy. Int J Cell Biol 2012: 736905 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Betel D, Wilson M, Gabow A, Marks DS, Sander C (2008) The microRNA.org resource: targets and expression. Nucleic Acids Res 36: D149–D153 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Zinovyeva AY, Yamamoto Y, Sawa H, Forrester WC (2008) Complex network of Wnt signaling regulates neuronal migrations during Caenorhabditis elegans development. Genetics 179: 1357–1371 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Gleason JE, Szyleyko EA, Eisenmann DM (2006) Multiple redundant Wnt signaling components function in two processes during C. elegans vulval development. Dev Biol 298: 442–457 [DOI] [PubMed] [Google Scholar]
  • 28. Clevers H, Nusse R (2012) Wnt/beta‐catenin signaling and disease. Cell 149: 1192–1205 [DOI] [PubMed] [Google Scholar]
  • 29. van der Bent ML, Sterken MG, Volkers RJ, Riksen JA, Schmid T, Hajnal A, Kammenga JE, Snoek LB (2014) Loss‐of‐function of beta‐catenin bar‐1 slows development and activates the Wnt pathway in Caenorhabditis elegans . Sci Rep 4: 4926 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Friedman JR, Kaestner KH (2006) The Foxa family of transcription factors in development and metabolism. Cell Mol Life Sci 63: 2317–2328 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Zhong M, Niu W, Lu ZJ, Sarov M, Murray JI, Janette J, Raha D, Sheaffer KL, Lam HY, Preston E et al (2010) Genome‐wide identification of binding sites defines distinct functions for Caenorhabditis elegans PHA‐4/FOXA in development and environmental response. PLoS Genet 6: e1000848 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Niu W, Lu ZJ, Zhong M, Sarov M, Murray JI, Brdlik CM, Janette J, Chen C, Alves P, Preston E et al (2011) Diverse transcription factor binding features revealed by genome‐wide ChIP‐seq in C. elegans . Genome Res 21: 245–254 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Martinez NJ, Ow MC, Reece‐Hoyes JS, Barrasa MI, Ambros VR, Walhout AJ (2008) Genome‐scale spatiotemporal analysis of Caenorhabditis elegans microRNA promoter activity. Genome Res 18: 2005–2015 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Azzaria M, Goszczynski B, Chung MA, Kalb JM, McGhee JD (1996) A fork head/HNF‐3 homolog expressed in the pharynx and intestine of the Caenorhabditis elegans embryo. Dev Biol 178: 289–303 [DOI] [PubMed] [Google Scholar]
  • 35. Murray JI, Bao Z, Boyle TJ, Boeck ME, Mericle BL, Nicholas TJ, Zhao Z, Sandel MJ, Waterston RH (2008) Automated analysis of embryonic gene expression with cellular resolution in C. elegans . Nat Methods 5: 703–709 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Kogure A, Uno M, Ikeda T, Nishida E (2017) The microRNA machinery regulates fasting‐induced changes in gene expression and longevity in Caenorhabditis elegans . J Biol Chem 292: 11300–11309 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Smith‐Vikos T, de Lencastre A, Inukai S, Shlomchik M, Holtrup B, Slack FJ (2014) MicroRNAs mediate dietary‐restriction‐induced longevity through PHA‐4/FOXA and SKN‐1/Nrf transcription factors. Curr Biol 24: 2238–2246 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Vora M, Shah M, Ostafi S, Onken B, Xue J, Ni JZ, Gu S, Driscoll M (2013) Deletion of microRNA‐80 activates dietary restriction to extend C. elegans healthspan and lifespan. PLoS Genet 9: e1003737 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Wilhelm T, Byrne J, Medina R, Kolundzic E, Geisinger J, Hajduskova M, Tursun B, Richly H (2017) Neuronal inhibition of the autophagy nucleation complex extends life span in post‐reproductive C. elegans . Genes Dev 31: 1561–1572 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Chang JT, Kumsta C, Hellman AB, Adams LM, Hansen M (2017) Spatiotemporal regulation of autophagy during Caenorhabditis elegans aging. ELife 6: e18459 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Naito AT, Shiojima I, Komuro I (2010) Wnt signaling and aging‐related heart disorders. Circ Res 107: 1295–1303 [DOI] [PubMed] [Google Scholar]
  • 42. Lezzerini M, Budovskaya Y (2014) A dual role of the Wnt signaling pathway during aging in Caenorhabditis elegans . Aging Cell 13: 8–18 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43. Shen Y, Wollam J, Magner D, Karalay O, Antebi A (2012) A steroid receptor‐microRNA switch regulates life span in response to signals from the gonad. Science 338: 1472–1476 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44. Jackson BM, Abete‐Luzi P, Krause MW, Eisenmann DM (2014) Use of an activated beta‐catenin to identify Wnt pathway target genes in Caenorhabditis elegans, including a subset of collagen genes expressed in late larval development. G3 4: 733–747 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45. Sherwood V (2015) WNT signaling: an emerging mediator of cancer cell metabolism? Mol Cell Biol 35: 2–10 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46. Hsieh CH, Rau CS, Wu SC, Yang JC, Wu YC, Lu TH, Tzeng SL, Wu CJ, Lin CW (2015) Weight‐reduction through a low‐fat diet causes differential expression of circulating microRNAs in obese C57BL/6 mice. BMC Genom 16: 699 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47. Csiszar A, Gautam T, Sosnowska D, Tarantini S, Banki E, Tucsek Z, Toth P, Losonczy G, Koller A, Reglodi D et al (2014) Caloric restriction confers persistent anti‐oxidative, pro‐angiogenic, and anti‐inflammatory effects and promotes anti‐aging miRNA expression profile in cerebromicrovascular endothelial cells of aged rats. Am J Physiol Heart Circ Physiol 307: H292–H306 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48. Schneider A, Dhahbi JM, Atamna H, Clark JP, Colman RJ, Anderson RM (2017) Caloric restriction impacts plasma microRNAs in rhesus monkeys. Aging Cell 16: 1200–1203 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49. Brack AS, Conboy MJ, Roy S, Lee M, Kuo CJ, Keller C, Rando TA (2007) Increased Wnt signaling during aging alters muscle stem cell fate and increases fibrosis. Science 317: 807–810 [DOI] [PubMed] [Google Scholar]
  • 50. Meng Z, Moroishi T, Guan KL (2016) Mechanisms of Hippo pathway regulation. Genes Dev 30: 1–17 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51. Bhatia B, Potts CR, Guldal C, Choi S, Korshunov A, Pfister S, Kenney AM, Nahle ZA (2012) Hedgehog‐mediated regulation of PPARgamma controls metabolic patterns in neural precursors and shh‐driven medulloblastoma. Acta Neuropathol 123: 587–600 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52. Hong SH, Kang M, Lee KS, Yu K (2016) High fat diet‐induced TGF‐beta/Gbb signaling provokes insulin resistance through the tribbles expression. Sci Rep 6: 30265 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53. Bonfini A, Wilkin MB, Baron M (2015) Reversible regulation of stem cell niche size associated with dietary control of Notch signalling. BMC Dev Biol 15: 8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54. Brenner S (1974) The genetics of Caenorhabditis elegans . Genetics 77: 24 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55. Ching TT, Hsu AL (2011) Solid plate‐based dietary restriction in Caenorhabditis elegans . J Vis Exp 51: 2701 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56. Gerisch B, Weitzel C, Kober‐Eisermann C, Rottiers V, Antebi A (2001) A hormonal signaling pathway influencing C. elegans metabolism, reproductive development, and life span. Dev Cell 1: 841–851 [DOI] [PubMed] [Google Scholar]
  • 57. Dickinson DJ, Ward JD, Reiner DJ, Goldstein B (2013) Engineering the Caenorhabditis elegans genome using Cas9‐triggered homologous recombination. Nat Methods 10: 1028–1034 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58. Kamath RS, Martinez‐Campos M, Zipperlen P, Fraser AG, Ahringer J (2000) Effectiveness of specific RNA‐mediated interference through ingested double‐stranded RNA in Caenorhabditis elegans . Genome Biol 2: 10 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59. Denzel MS, Storm NJ, Gutschmidt A, Baddi R, Hinze Y, Jarosch E, Sommer T, Hoppe T, Antebi A (2014) Hexosamine pathway metabolites enhance protein quality control and prolong life. Cell 156: 1167–1178 [DOI] [PubMed] [Google Scholar]
  • 60. Yanase S, Onodera A, Tedesco P, Johnson TE, Ishii N (2009) SOD‐1 deletions in Caenorhabditis elegans alter the localization of intracellular reactive oxygen species and show molecular compensation. J Gerontol A Biol Sci Med Sci 64: 530–539 [DOI] [PubMed] [Google Scholar]
  • 61. Li J, Huang KX, Le WD (2013) Establishing a novel C. elegans model to investigate the role of autophagy in amyotrophic lateral sclerosis. Acta Pharmacol Sin 34: 644–650 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62. Palikaras K, Lionaki E, Tavernarakis N (2015) Coordination of mitophagy and mitochondrial biogenesis during ageing in C. elegans . Nature 521: 525–528 [DOI] [PubMed] [Google Scholar]
  • 63. Mukhopadhyay A, Deplancke B, Walhout AJ, Tissenbaum HA (2008) Chromatin immunoprecipitation (ChIP) coupled to detection by quantitative real‐time PCR to study transcription factor binding to DNA in Caenorhabditis elegans . Nat Protoc 3: 698–709 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64. King JM, Hays TS, Nicklas RB (2000) Dynein is a transient kinetochore component whose binding is regulated by microtubule attachment, not tension. J Cell Biol 151: 739–748 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65. Hansen M, Chandra A, Mitic LL, Onken B, Driscoll M, Kenyon C (2005) A role for autophagy genes in the extension of lifespan by dietary restriction in C. elegans . PLoS Genet 4: e24 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66. Tian Y, Garcia G, Bian Q, Steffen KK, Joe L, Wolff S, Meyer BJ, Dillin A (2016) Mitochondrial stress induces chromatin reorganization to promote longevity and UPR(mt). Cell 165: 1197–1208 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Expanded View Figures PDF

Table EV1

Table EV2

Table EV3

Dataset EV1

Review Process File


Articles from EMBO Reports are provided here courtesy of Nature Publishing Group

RESOURCES