Abstract
Buffalobur (Solanum rostratum Dunal), which belongs to the Solanaceae family, is a worldwide noxious invasive weed and is listed as one of the top 10 alien invasive species in China. It is harmful to humans and livestock because the entire plant is covered with spines containing toxins. Many studies have analysed the gene expression in this weed species under different stress conditions using quantitative real-time PCR (qPCR). However, until now, there has been no report on suitable reference genes in buffalobur. Herein, 14 candidate reference genes were selected and evaluated for their expression stability in buffalobur in different tissues, at different developmental stages, and in response to several stress conditions using the geNorm, NormFinder, BestKeeper and RefFinder statistical algorithms. The results showed that EF1α, ACT and SAND are suitable reference genes across all samples tested. We recommend the normalization of target gene expression under different experimental conditions using these three genes together. Validation of selected reference genes was achieved by assessing the relative expression levels of P5CS and GI. This work identified the appropriate reference genes for transcript normalization in buffalobur, which will be helpful in future genetic studies of this invasive weed.
Subject terms: Plant stress responses, Molecular biology
Introduction
Buffalobur (Solanum rostratum Dunal) is native to North America and is ranked as a highly invasive weed species across the world1. Buffalobur poses a serious threat to local biodiversity and agro-ecosystems. The aggressive growth of this weed results in devastating damage to crop production2. Additionally, buffalobur is a crucial intermediate host for a wide range of pests and diseases, which threaten the health of crops3. Moreover, this weed species is harmful to humans and livestock because its leaves, stems and calyx are covered with spines containing toxins3. Eradication of this weed using conventional control measures including manual, mechanical, or chemical methods is difficult. Therefore, new and innovative approaches are being explored to control this weed. Measuring gene expression will help form weed-control approaches, and quantitative gene expression measurement requires appropriate reference genes.
Due to its advantages of high sensitivity and specificity, qPCR has been widely used to quantify gene expression to discover the genetic basis of physiological patterns during the plant life cycle4. Attaining precision in qPCR-based analysis depends on the selection of a suitable reference gene in experimental sets5. The expression level of the appropriate internal control gene should remain relatively constant and should not change significantly across experimental conditions, types of tissues, developmental stages or stress treatments6,7; however, in practice, no gene exhibits fully stable expression throughout all growth stages and experimental conditions. It has been suggested that multiple reference genes can achieve accurate normalization8. There is general agreement that the expression stability of candidate genes should be validated prior to initiating normalization studies using qPCR in a particular species.
There have been studies on the selection and validation of reference genes in many Solanaceae plants, such as pepper (Capsicum annuum L.)9, potato (Solanum tuberosum L.)10, eggplant (Solanum melongena L.)11, tomato (Lycopersicon esculentum Mill.)12, Lycium barbarum L. and L. ruthenicum Murray13. However, until now, no appropriate reference gene has been identified for qPCR analysis in buffalobur. In this study, 14 genes, namely, GAPDH, ACT, GR, UBQ, TIP41, RPL8, eIF, DNAJ, TUB, CYP, EF1α, PP2Acs, RUBP, and SAND, were selected as candidate reference genes for buffalobur. The expression stabilities of these genes were tested with respect to different developmental periods, tissues, abiotic stresses, and hormone stimuli and with glyphosate treatment using geNorm8, NormFinder14, BestKeeper15 and RefFinder16 to identify the most stable gene for qPCR normalization in buffalobur.
Results
Expression profiles of candidate reference genes
The quantification cycle values (Cq) of the 14 candidate genes across all samples ranged from 11.8 to 30.8, showing a wide range of variation (Fig. 1). The majority of values were between 18 and 23. The Cq values of TIP41 and RUBP ranged from 18.8 to 30.8 and from 11.8 to 28.3, respectively, showing great expression differences. Moreover, the Cq values of RUBP in roots were relatively high. According to the Cq values, we can make a preliminary judgement that TIP41 and RUBP might not be suitable candidate reference genes.
Figure 1.
Cq values of 14 reference genes across all samples. The box plots represent the interquartile range, the median, and the maximum and minimum values of each reference gene in all buffalobur samples.
geNorm analysis
The geNorm software identifies the optimal reference gene pair; smaller M values correlate with more stable gene expression. Some studies have established the threshold of M values ≤ 1.0 or 1.5 to identify appropriate reference genes17. M values below 0.5 are indicative of strong reference genes. Except for the group of total samples (M = 0.527), the M values of the best pairs in other groups were less than 0.5 in our study (Tables 2, 3 and 4; see Supplementary Fig. S1). For leaves of different developmental stages and different tissues in the fruiting period, the best two gene pairs were eIF and SAND. RPL8 and EF1α were the most stable gene pair in both the abiotic stress and glyphosate group. For the hormone stimuli group, the best gene pairs were ACT and RPL8. For the total samples group, the best gene pairs were ACT and PP2Acs. TIP41, RUBP and DNAJ were low-ranking candidates according to geNorm.
Table 2.
Gene expression stability ranked by four algorithms for the “Developmental stages” and “Tissues” groups.
Group | Rank | geNorm | NormFinder | BestKeeper | RefFinder | |||||
---|---|---|---|---|---|---|---|---|---|---|
Gene | Stability | Gene | Stability | Gene | SD [±Cq] | CV (%Cq) | Gene | Stability | ||
Developmental stagesa |
1 | eIF | 0.343 | ACT | 0.084 | GR | 0.30 | 1.24 | ACT | 2.11 |
2 | SAND | 0.343 | EF1α | 0.124 | ACT | 0.33 | 1.80 | EF1α | 2.51 | |
3 | UBQ | 0.411 | GR | 0.185 | PP2Acs | 0.38 | 1.73 | GR | 2.82 | |
4 | EF1α | 0.530 | PP2Acs | 0.287 | CYP | 0.44 | 2.51 | SAND | 3.66 | |
5 | ACT | 0.576 | CYP | 0.295 | EF1α | 0.48 | 2.70 | PP2Acs | 4.56 | |
6 | PP2Acs | 0.610 | SAND | 0.359 | SAND | 0.58 | 2.45 | CYP | 5.03 | |
7 | GR | 0.654 | UBQ | 0.425 | UBQ | 0.61 | 3.10 | eIF | 5.20 | |
8 | CYP | 0.686 | GAPDH | 0.455 | GAPDH | 0.69 | 3.74 | UBQ | 5.86 | |
9 | GAPDH | 0.715 | eIF | 0.522 | eIF | 0.76 | 3.52 | GAPDH | 7.97 | |
10 | RPL8 | 0.747 | RPL8 | 0.564 | RPL8 | 0.83 | 4.03 | RPL8 | 10.00 | |
11 | TUB | 0.794 | TUB | 0.714 | RUBP | 0.88 | 6.73 | TUB | 11.24 | |
12 | TIP41 | 0.929 | TIP41 | 1.040 | TUB | 1.11 | 5.49 | TIP41 | 12.24 | |
13 | RUBP | 1.039 | RUBP | 1.048 | TIP41 | 1.14 | 5.20 | RUBP | 12.47 | |
14 | DNAJ | 1.260 | DNAJ | 1.724 | DNAJ | 1.99 | 9.98 | DNAJ | 14.00 | |
Tissuesb | 1 | eIF | 0.413 | SAND | 0.166 | PP2Acs | 0.40 | 1.89 | SAND | 1.57 |
2 | SAND | 0.413 | PP2Acs | 0.181 | SAND | 0.45 | 1.94 | PP2Acs | 1.93 | |
3 | CYP | 0.459 | CYP | 0.289 | CYP | 0.54 | 3.07 | eIF | 2.51 | |
4 | EF1α | 0.532 | eIF | 0.364 | GR | 0.56 | 2.26 | CYP | 3.22 | |
5 | RPL8 | 0.574 | ACT | 0.579 | eIF | 0.67 | 3.21 | EF1α | 6.45 | |
6 | GAPDH | 0.601 | GAPDH | 0.619 | UBQ | 0.68 | 3.88 | GAPDH | 6.51 | |
7 | PP2Acs | 0.636 | UBQ | 0.640 | ACT | 0.72 | 4.14 | ACT | 6.85 | |
8 | UBQ | 0.732 | GR | 0.643 | EF1α | 0.87 | 5.00 | UBQ | 7.20 | |
9 | ACT | 0.792 | EF1α | 0.657 | TUB | 1.01 | 5.17 | GR | 7.52 | |
10 | GR | 0.843 | RPL8 | 0.726 | GAPDH | 1.04 | 5.74 | RPL8 | 8.39 | |
11 | TUB | 0.943 | TUB | 0.943 | RPL8 | 1.06 | 5.11 | TUB | 10.46 | |
12 | TIP41 | 1.084 | TIP41 | 1.206 | DNAJ | 1.52 | 8.05 | TIP41 | 12.24 | |
13 | DNAJ | 1.330 | DNAJ | 1.483 | TIP41 | 1.66 | 7.70 | DNAJ | 12.74 | |
14 | RUBP | 1.936 | RUBP | 3.812 | RUBP | 3.85 | 20.82 | RUBP | 14.00 |
aThe fully expanded leaves were harvested at different developmental stages. bDifferent tissues were harvested in the fruiting period.
Table 3.
Gene expression stability ranked by four algorithms for the “Abiotic stresses”, “Hormone stimuli” and “Glyphosate” groups.
Group | Rank | geNorm | NormFinder | BestKeeper | RefFinder | |||||
---|---|---|---|---|---|---|---|---|---|---|
Gene | Stability | Gene | Stability | Gene | SD [±Cq] | CV (%Cq) | Gene | Stability | ||
Abiotic stresses |
1 | RPL8 | 0.355 | EF1α | 0.123 | EF1α | 0.42 | 2.43 | EF1α | 1.00 |
2 | EF1α | 0.355 | TUB | 0.175 | TUB | 0.49 | 2.57 | RPL8 | 2.63 | |
3 | ACT | 0.413 | ACT | 0.201 | PP2Acs | 0.51 | 2.25 | TUB | 2.83 | |
4 | TUB | 0.454 | RPL8 | 0.207 | RPL8 | 0.56 | 2.82 | ACT | 3.22 | |
5 | PP2Acs | 0.489 | PP2Acs | 0.245 | SAND | 0.56 | 2.35 | PP2Acs | 4.40 | |
6 | SAND | 0.568 | GR | 0.442 | ACT | 0.57 | 3.06 | SAND | 5.96 | |
7 | GR | 0.647 | SAND | 0.444 | RUBP | 0.69 | 5.13 | GR | 6.96 | |
8 | RUBP | 0.721 | RUBP | 0.585 | GR | 0.78 | 3.21 | RUBP | 7.97 | |
9 | CYP | 0.780 | CYP | 0.605 | eIF | 0.85 | 4.07 | CYP | 8.97 | |
10 | GAPDH | 0.865 | eIF | 0.780 | CYP | 0.86 | 4.89 | eIF | 9.97 | |
11 | eIF | 0.958 | GAPDH | 0.880 | GAPDH | 1.20 | 6.47 | GAPDH | 10.74 | |
12 | UBQ | 1.069 | UBQ | 1.056 | DNAJ | 1.24 | 6.45 | UBQ | 12.24 | |
13 | TIP41 | 1.180 | DNAJ | 1.211 | UBQ | 1.26 | 6.73 | DNAJ | 13.22 | |
14 | DNAJ | 1.283 | TIP41 | 1.225 | TIP41 | 1.47 | 6.38 | TIP41 | 13.49 | |
Hormone stimuli |
1 | ACT | 0.250 | SAND | 0.061 | SAND | 0.18 | 0.78 | SAND | 1.78 |
2 | RPL8 | 0.250 | EF1α | 0.077 | EF1α | 0.20 | 1.22 | EF1α | 1.86 | |
3 | EF1α | 0.264 | ACT | 0.139 | UBQ | 0.28 | 1.42 | ACT | 2.82 | |
4 | GAPDH | 0.281 | UBQ | 0.143 | eIF | 0.29 | 1.41 | RPL8 | 3.50 | |
5 | SAND | 0.300 | RPL8 | 0.189 | TUB | 0.31 | 1.62 | UBQ | 4.12 | |
6 | UBQ | 0.314 | TUB | 0.216 | RPL8 | 0.34 | 1.78 | TUB | 6.19 | |
7 | TUB | 0.348 | GAPDH | 0.224 | ACT | 0.35 | 1.92 | GAPDH | 6.56 | |
8 | eIF | 0.374 | eIF | 0.254 | GR | 0.36 | 1.46 | eIF | 6.73 | |
9 | PP2Acs | 0.393 | PP2Acs | 0.262 | PP2Acs | 0.37 | 1.66 | PP2Acs | 9.00 | |
10 | CYP | 0.418 | CYP | 0.274 | CYP | 0.40 | 2.37 | CYP | 10.00 | |
11 | GR | 0.443 | GR | 0.341 | GAPDH | 0.40 | 2.25 | GR | 10.16 | |
12 | RUBP | 0.484 | RUBP | 0.413 | RUBP | 0.49 | 3.57 | RUBP | 12.00 | |
13 | DNAJ | 0.586 | DNAJ | 0.804 | DNAJ | 0.77 | 4.01 | DNAJ | 13.00 | |
14 | TIP41 | 0.697 | TIP41 | 0.906 | TIP41 | 0.81 | 3.56 | TIP41 | 14.00 | |
Glyphosate | 1 | RPL8 | 0.363 | TUB | 0.088 | PP2Acs | 0.26 | 1.17 | ACT | 2.06 |
2 | EF1α | 0.363 | ACT | 0.129 | SAND | 0.30 | 1.31 | EF1α | 2.51 | |
3 | ACT | 0.436 | RPL8 | 0.134 | ACT | 0.31 | 1.67 | RPL8 | 3.00 | |
4 | GAPDH | 0.489 | CYP | 0.184 | EF1α | 0.46 | 2.67 | TUB | 4.12 | |
5 | CYP | 0.518 | EF1α | 0.194 | CYP | 0.49 | 2.73 | PP2Acs | 4.30 | |
6 | TUB | 0.544 | GAPDH | 0.306 | GR | 0.52 | 2.11 | CYP | 4.47 | |
7 | PP2Acs | 0.611 | PP2Acs | 0.369 | eIF | 0.56 | 2.75 | SAND | 5.03 | |
8 | SAND | 0.648 | SAND | 0.425 | TUB | 0.60 | 2.99 | GAPDH | 6.78 | |
9 | GR | 0.687 | GR | 0.591 | RPL8 | 0.61 | 3.05 | GR | 8.13 | |
10 | eIF | 0.756 | UBQ | 0.668 | UBQ | 0.64 | 3.41 | eIF | 9.59 | |
11 | UBQ | 0.792 | eIF | 0.701 | GAPDH | 0.67 | 3.58 | UBQ | 10.24 | |
12 | DNAJ | 0.971 | RUBP | 1.299 | DNAJ | 1.39 | 7.28 | RUBP | 12.49 | |
13 | RUBP | 1.156 | DNAJ | 1.437 | RUBP | 1.78 | 11.51 | DNAJ | 12.49 | |
14 | TIP41 | 1.484 | TIP41 | 2.338 | TIP41 | 2.71 | 10.45 | TIP41 | 14.00 |
Table 4.
Gene expression stability ranked by four algorithms for the total samples group.
Rank | geNorm | NormFinder | BestKeeper | RefFinder | |||||
---|---|---|---|---|---|---|---|---|---|
Gene | Stability | Gene | Stability | Gene | SD [±Cq] | CV (%Cq) | Gene | Stability | |
1 | ACT | 0.527 | EF1α | 0.275 | SAND | 0.49 | 2.07 | EF1α | 1.68 |
2 | PP2Acs | 0.527 | ACT | 0.393 | EF1α | 0.51 | 2.95 | ACT | 1.86 |
3 | SAND | 0.712 | SAND | 0.412 | ACT | 0.58 | 3.16 | SAND | 2.28 |
4 | EF1α | 0.742 | RPL8 | 0.454 | PP2Acs | 0.60 | 2.67 | PP2Acs | 3.36 |
5 | RPL8 | 0.810 | TUB | 0.462 | GR | 0.60 | 2.43 | RPL8 | 5.14 |
6 | GR | 0.853 | CYP | 0.466 | TUB | 0.69 | 3.57 | GR | 5.96 |
7 | CYP | 0.879 | GR | 0.470 | RPL8 | 0.70 | 3.51 | TUB | 6.62 |
8 | TUB | 0.907 | PP2Acs | 0.482 | eIF | 0.72 | 3.43 | CYP | 7.17 |
9 | GAPDH | 0.937 | eIF | 0.643 | CYP | 0.73 | 4.17 | eIF | 8.97 |
10 | eIF | 0.977 | GAPDH | 0.654 | GAPDH | 0.93 | 5.08 | GAPDH | 9.74 |
11 | UBQ | 1.051 | UBQ | 0.907 | UBQ | 1.05 | 5.60 | UBQ | 11.00 |
12 | DNAJ | 1.179 | TIP41 | 1.564 | DNAJ | 1.24 | 6.46 | DNAJ | 12.00 |
13 | TIP41 | 1.370 | DNAJ | 1.173 | TIP41 | 1.75 | 7.57 | TIP41 | 13.00 |
14 | RUBP | 1.644 | RUBP | 2.162 | RUBP | 1.83 | 12.51 | RUBP | 14.00 |
Additionally, geNorm provides the pairwise variation (Vn/Vn+1), which determines the minimal number of reference genes to obtain an accurate and reliable normalization. A value of 0.2 is usually considered acceptable. For the total samples group, the V3/4 value of 0.186 indicated that the top three reference genes (ACT, PP2Acs and SAND) would be appropriate to use for normalization; for the other groups, the top two genes were sufficient for normalization because their V2/3 values were all less than 0.15 (see Supplementary Fig. S2).
NormFinder analysis
The lower the stability value obtained via NormFinder, the more stable the candidate reference gene is. A grouped analysis can be used to evaluate these candidate reference genes with this statistical algorithm. The output includes the best reference gene and the best combination of two reference genes (Tables 2, 3 and 4; see Supplementary Table S3). Notably, the ranking alone cannot identify whether a candidate gene is good, the stability values need to be considered for the assessment. Only when the stability value is low enough, the gene can be considered good. In our study, for leaves of different developmental stages (grouped by stage), the best gene was ACT (0.111), and the best combination of genes was GR and eIF with a stability value of 0.082. For different tissues in the fruiting period (grouped by tissue), SAND (0.121) was the best reference gene, and the best pair was GR and PP2Acs (0.084). ACT (0.114) was ranked the top gene for glyphosate-treated samples (grouped by time), and eIF and CYP were the best combination with a stability value of 0.079. For abiotic stress-treated samples (grouped by stress type), the best gene was EF1α (0.051), and the best combination of two genes was TUB and EF1α (0.036). For samples of hormone stimuli (grouped by ABA and GA), EF1α (0.019) was also the best reference gene, and EF1α and SAND (0.015) formed the best gene pair. For the total samples (grouped by subgroup), the top three genes were EF1α (0.065), ACT (0.065) and TUB (0.072); the best combination of two genes was GAPDH and SAND with a stability value of 0.046. The ranking of candidate reference genes and best combination of two genes from NormFinder were not identical to those from the geNorm analysis (Tables 2, 3 and 4).
BestKeeper analysis
Pfaffl proposed that genes with high SD or CV values can be considered inconsistent15. In general, a gene with an SD value greater than 1 is not acceptable(Tables 2, 3 and 4). For leaves of different developmental stages, GR was the optimal reference gene with an SD value of 0.30. For different tissues in the fruiting period and the group with glyphosate treatment, PP2Acs (SD values of 0.40 and 0.26, respectively) was the most stable gene. For the abiotic stress group, EF1α (an SD value of 0.42) was the most stable of the candidate reference genes. For the hormone treatment and total samples group, BestKeeper ranked SAND as the best reference gene with SD values of 0.18 and 0.49, respectively.
RefFinder analysis
The stability rankings generated by geNorm, NormFinder and BestKeeper, which are based on different algorithms, differed; but in most cases the 3 or 4 same genes were ranked highly, just in different orders. We used RefFinder to obtain a final ranking based on the outputs of the previous three methods (plus Delta-Ct) (Tables 2, 3 and 4). For leaves of different developmental stages and the glyphosate treatment group, the best gene was ACT followed by EF1α. For different tissues in the fruiting period, the suitable reference genes were SAND and PP2Acs. For the abiotic stress groups, the top two genes were EF1α and RPL8. SAND and EF1α were the most stable genes in the leaves of hormone treatment groups. For the total samples group, the most stable three reference genes were EF1α, ACT and SAND. RUBP, DNAJ and TIP41 had unstable expression in all of the groups.
Reference gene validation
Delta 1-pyrroline-5-carboxylate synthetase (P5CS) is the rate-limiting enzyme in the proline synthesis pathway under stress conditions18. GIGANTEA (GI) participates in multiple molecular regulatory responses including flowering, circadian rhythm and stress tolerance19. The elevated expression of P5CS and GI improves resistance against salinity and drought stresses. Therefore, P5CS and GI expression should increase or hold stable rather than decrease. Previous studies found that the Arabidopsis thaliana gi mutant is resistant to herbicide20, indicating that lower expression of GI indicates stronger herbicide tolerance.
As shown in Figs 2 and 3, the expression patterns of P5CS and GI were significantly different when using the best reference gene combination for normalization under different stress conditions than when normalized with the least stable reference gene. With the best gene combination, the P5CS level at 72 h was 2.2-fold higher than in the untreated sample; with the least stable reference gene, the expression at 72 h was 475-fold higher than in the untreated sample (Fig. 2). Using the stable gene combination, the expression level of GI decreased significantly within 48 h of glyphosate treatment, which is consistent with the expected pattern; while using the worst reference gene, its expression dramatically increased (Fig. 3).
Figure 2.
The relative expression patterns of P5CS under different treatments and with normalization to different reference genes. (a) Glyphosate treatment, (b) drought treatment, (c) salinity treatment, (d) heat treatment, (e) cold treatment, (f) ABA treatment, and (g) GA treatment. The error bars represent the standard error.
Figure 3.
Relative expression of GI under different treatments and with normalization to different reference genes. (a) Glyphosate treatment, (b) drought treatment, (c) salinity treatment, (d) heat treatment, (e) cold treatment, (f) ABA treatment, and (g) GA treatment. The error bars represent the standard error.
In the drought, salinity or abscisic acid (ABA) treatment groups, the expression of P5CS and GI increased or decreased slightly when using the best reference gene combinations for normalization, and the values ranged from 0.4 to 1.5; when using the least stable reference genes, these expressions decreased by 4 to 30-fold (Figs 2 and 3). The expression patterns of P5CS and GI normalized by stable reference gene combinations were more in line with the expectations than when they were normalized with the least stable reference genes. For the heat, cold and gibberellin (GA) stress groups, the expression of P5CS and GI ranged from 0.3 to 1.5 when normalized with the best reference gene combination; the expression normalized by the worst reference genes increased 3 to 40-fold (Figs 2 and 3).
For the relative expression of P5CS or GI, the coefficients of variation (CV (%)) using the poor reference genes were much higher than those produced by using the best gene combinations (see Supplementary Table S4). This indicates that the normalization with stable reference genes lowers the variability of the raw data, so the selected stable reference genes are acceptable. In our study, the expression normalized with the least stable reference genes DNAJ and TIP41 deviated dramatically from those normalized with the best gene combination. DNAJ, a molecular chaperone, responds to stress and maintains protein homeostasis in plant cells21. DNAJ rises sharply in response to stress, as observed in Figs 2 and 3. Similarly, TIP41 responds to abiotic stresses via the TOR signalling pathway22. Under stress conditions, the acute decrease in TIP41 levels results in unreasonably higher normalized expression values (Figs 2 and 3).
Discussion
Buffalobur (Solanum rostratum Dunal) is a worldwide noxious invasive weed, and it ranked as one of the top 10 alien invasive species in China1. Many studies have focused on understanding the physiological characteristics of this weed, including seed germination and seedling emergence23. For genetic research, it is necessary to select stable reference genes to ensure the accuracy of research results. In this study, three software packages and one web tool were used to test the statistical reliability of candidate reference genes.
Notably, the different algorithms evaluating the expression stability of reference genes generated different stable genes due to their different mathematical calculations. One disadvantage of geNorm is that it is likely to select coregulated genes with similar expression profiles, such as genes in the same functional class. When groups are specified, NormFinder considers the inter- and intragroup variations for normalization factor calculation and eliminates artificial selection of coregulated gene values; however, it cannot exclude systematic errors generated from sample preparation14. For BestKeeper, input data derived from more than three candidate genes are required for accurate assessment of the stability of each gene15. Based on different calculation principles, the stability rankings of three statistical packages were different. RefFinder considers four statistical approaches (geNorm, NormFinder, BestKeeper and Delta-Ct); therefore, we used RefFinder to obtain a comprehensive ranking of gene expression stability.
In our study, the combination of EF1α, ACT (β-actin) and SAND was sufficient to normalize expression levels of target genes in the total samples group. Therefore, it is recommended that EF1α, ACT and SAND should be used together for normalization in various buffalobur experimental samples. ACT, which is a cytoskeleton component and cell division regulator24, is the most stable gene in leaves of different developmental stages and glyphosate-treated leaves (Tables 2 and 3). ACT is also stably expressed in Hordeum vulgare L.25. In Descurainia sophia, actin 7 (ACT7) is suitable in most samples under different conditions, and actin 8 (ACT8) is the least stable reference gene26. SAND is the most stable reference gene for different tissues in the fruiting period and in hormone-stimulated leaves (Tables 2 and 3). Similarly, SAND is stable in different tomato tissues12. In Stellera chamaejasme and Robinia pseudoacacia L., SAND levels are stable under ABA and drought treatments, respectively27,28. In Peucedanum praeruptorum Dunn, SAND and actin 2 (ACT2) are the top two most stable reference genes under abiotic stress and hormone treatments and in different tissues29. EF1α, which participates in the elongation cycle of protein biosynthesis, is the most stable gene for leaves under abiotic stress or hormone stimulation (Tables 2 and 3). In potato, the expression of EF1α has been used to normalize expression levels across cold, salt and late blight stresses10; in drought and simulated drought environments, EF1α performs best out of candidate reference genes30. In tomato, EF1α is the top-ranked reference gene during N and cold stress31. However, for hormone stimuli, EF1α ranks behind other candidates in Diospyros kaki Thunb and Hibiscus cannabinus L.32,33. These results suggest that evaluation of reference gene expression stability is indispensable prior to the analysis of target gene expression under specific experimental conditions.
Buffalobur is closely related to tomato, whose qPCR reference genes have been reported in numerous studies12,34. TIP41 has exhibits highly stable expression in different tissues (root, leaves, and inflorescence) at different developmental stages in tomato12; however, in buffalobur, it ranks behind other reference genes in different tissues of the fruiting period and leaves of different developmental stages (Table 2). It showed that reference genes used in tomato might not be suitable in genetically related species. Our results here further emphasize the importance of species-specific screening of proper reference genes because genetic difference, even in closely related species, may contribute to distinct and variable expression of these genes under the same experimental conditions.
P5CS is stress-responsive as it is involved in the synthesis of key enzymes in the proline synthesis pathway18. GI participates in developmental processes such as plant flowering, but it is also involved in mediating cold stress and salt stress responses19. Under stress conditions such as salinity, drought and ABA, the expression of P5CS and GI are expected to increase or hold stable rather than decrease to help plants adapt to the negative conditions. In our research, the P5CS or GI expression levels normalized using the best reference gene combination were significantly different from those normalized with the least stable reference gene (Figs 2 and 3). With the best gene combination for normalization, the expression of P5CS and GI were only slightly different before and after stresses; with the least stable reference gene, P5CS and GI expression rose or fell sharply (Figs 2 and 3). Therefore, the reference genes selected in this study are reliable.
In summary, 14 candidate reference genes were first selected under different treatments in buffalobur. For leaves of different developmental stages and leaves of glyphosate-treated plants, the best reference genes are ACT and EF1α. For different tissues in the fruiting period, the most stable gene pair is SAND and PP2Acs. EF1α and RPL8 are the most stable reference genes for the abiotic stress group. EF1α and SAND are suitable reference genes for the hormone stimuli group. For the total samples group, the EF1α, ACT and SAND triplet should be used as reference genes for normalization. This study will facilitate the study of gene expression analysis in buffalobur, which might lay a fundamental path for exploring the molecular mechanism underlying its developmental regulation and for effectively controlling this invasive weed species.
Materials and Methods
Plant materials and stress treatments
Buffalobur seeds were collected from the Miyun District (N40.24.082, E116.50.364), Beijing, China, in 2017. Seeds were sown in pots (11 cm diameter) filled with Pindstrup substrate (SIA Pindstrup, Balozi, Latvia) and grown in chambers under a 14 h light/10 h dark photoperiod with 300 μmol·m−2·s−1 of light intensity at 30 ± 2 °C. When the seedlings were at the 5-leaf stage, they were subjected to three types of stress treatments including abiotic stress (drought, salinity, cold, and heat), hormone stimuli (ABA and GA) and herbicide treatment (glyphosate) (Table 5). For salt or drought treatments, approximately 150 mL of NaCl (300 mM) or 20% PEG-6000 was applied to irrigate the plants; for cold or heat treatments, the plants were transferred to chambers at a temperature of 4 °C or 40 °C under the same photoperiod and light intensity as previously specified; for hormone treatment, the leaves were sprayed with 0.35 mM ABA (Sinopharm Chemical Reagent Co., Ltd., Shanghai, China) or 0.35 mM GA (Sinopharm Chemical Reagent Co., Ltd., Shanghai, China); and for glyphosate treatment, 1680 g ae ha−1 of glyphosate (Roundup, isopropylamine salt of glyphosate, 410 g ae L−1, Monsanto Company, St. Louis, USA) was sprayed on the leaves. The fifth leaves were collected at 0 (untreated), 24, 48 and 72 h after treatment. Three independent biological replicates per treatment were collected, immediately frozen in liquid nitrogen and stored at −80 °C until RNA extraction.
Table 5.
The summary of samples collected under different conditions in this study.
Stress treatmentsa | Times after treatment | |||||||||
---|---|---|---|---|---|---|---|---|---|---|
0 hb (N = 3) | 24 h (N = 3) | 48 h (N = 3) | 72 h (N = 3) | |||||||
Abiotic Stresses | Drought | √ | √ | √ | √ | |||||
Salt | √ | √ | √ | √ | ||||||
Cold | √ | √ | √ | √ | ||||||
Heat | √ | √ | √ | √ | ||||||
Hormone stimuli | ABA | √ | √ | √ | √ | |||||
GA | √ | √ | √ | √ | ||||||
Glyphosate | √ | √ | √ | √ | ||||||
Tissues c | ||||||||||
Roots | Stems | The 7th leaves | Petals | Pericarps | ||||||
Periods d | ||||||||||
Cotyledon stage | Seedling stage | Vegetative stage | Fruiting period |
aThe 5th leaves were harvested at different time under different kinds of stresses. Three samples were taken at each time point for biological replicates. For the “Drought”, “Salt”, “Cold”, “Heat”, “ABA”, “GA” and “Glyphosate” groups, and each group contains 12 samples (four timepoints, and 3 samples for each timepoint); The “Abiotic Stresses” and “Hormone stimuli” groups contain 48 and 24 samples, respectively. bLeaves without stress treatment were harvested. cDifferent tissues were harvested in the fruiting period. Three samples were taken from each tissue for biological replicates. dThe fully expanded leaves were harvested at different developmental stages. Three samples were taken at each period for biological replicates.
Developmental tissue samples
Buffalobur seeds were sown in pots and grown in chambers under the conditions mentioned above. The leaves were collected at different developmental stages; the collected leaves included the cotyledons (cotyledon stage) and the fully expanded 3rd (seedling stage), 5th (vegetative stage) and 7th (fruiting period) leaves (Table 5).
For different tissues in the fruiting period, the roots, stems (6 cm above the root), 7th leaves, petals (without stamens and pistils), and pericarps (with thorns) were collected (Table 5). Three independent biological replicates per treatment were collected, and the storage procedure was same as that for the stress-treatment samples.
RNA extraction and cDNA synthesis
Total RNA isolation was conducted using the common method described by Chen et al.35. The concentration and purity of total RNA were quantified using the NanoDrop™ One/OneC ultra trace UV spectrophotometer (ThermoFisher, Waltham, MA, USA). The A260/A280 values of the RNA samples ranged from 1.90 to 2.10. The RNA integrity was assessed using 1% agarose electrophoresis gels stained with Solargel Red nucleic-acid dyes (Solarbio, Beijing, China), and gels of all RNA samples exhibited sharp and intense bands for 28S and 18S (see Supplementary Fig. S5). cDNA synthesis was performed with 800 ng of total RNA in a final volume of 20 μL using the same kit described by Chen et al., and the synthetic cDNA was stored at −80 °C until use35.
Primer design and qPCR assay
Fourteen candidate reference genes (GAPDH, ACT, GR, UBQ, TIP41, RPL8, eIF, TUB, DNAJ, CYP, EF1α, PP2Acs, RUBP, and SAND) were selected for the stable expression assay, and the GenBank accession numbers of these genes are MG930815, MG930814, MG930816, MG930817, KT807935, KT807936, KT596731, KT807934, KT596730, MK181638, MK181640, MK181639, MK181641 and MK181642, respectively. The primers for qPCR were designed using the Oligo 7 software; information on the primers is presented in Table 1. Polymerase chain reaction (PCR) was performed to confirm the 14 candidate reference gene sequences, and the primers amplified a single correct target product without visible primer dimers (see Supplementary Fig. S6). The qPCR reactions were performed using the 7500 RealTime PCR System (Applied Biosystems, Waltham, MA, USA) for thermal cycling and SYBR Green detection chemistry (Applied Biosystems, CA, USA). The reaction mixtures and cycling conditions were based on the method described by Chen et al.35. A single peak was detected on the melting curve for each primer pair after qPCR, which further demonstrated the specificity of these primers (see Supplementary Fig. S7). To confirm the specificity of the primer pairs, the amplification efficiency (E) and correlation coefficient (R2) parameters were obtained from the standard curves using the common method33. The amplification efficiencies of 14 candidate reference genes ranged from 90.0% to 104.7%, and the correlation coefficients (R2) were between 0.990 and 0.998 (Table 1; see Supplementary Fig. S8).
Table 1.
Information on the selected primer pairs and amplification characteristics of the 14 candidate reference genes and 2 target genes for buffalobur.
Gene symbol | Gene description | Primer sequence F/R | Product length (bp) | Efficiency (%) | Correlation coefficient |
---|---|---|---|---|---|
GAPDH | Glyceraldehyde-3-phosphate dehydrogenase | GCAGTCAACGATCCATTTATCTCCAC TCAACAACGAACTCAGCACCAG |
203 | 101.1 | 0.995 |
ACT | β-actin | GTGTTCCCTAGCATTGTTGGTCG GCCATATCTTCTCCATATCATCCCAGTTG |
172 | 95.0 | 0.998 |
GR | Glutaredoxin protein | GCTACTGAGGCTTCCAACAATAACG ACCATAAATTAGCAAGAAAATCACAGAGGC |
96 | 90.0 | 0.995 |
UBQ | Ubiquitin | GCACTTCTTTTTCCTCTCATTCTCTCG ATGCCTTCCTTGTCTTGAATCTTAGC |
168 | 91.3 | 0.996 |
TIP41 | Tonoplast intrinsic protein/aquaporin | ATCACCCCAGTTCACACCTTAGC GCCCCAACAACAAGCCCAGTTAG |
170 | 91.4 | 0.994 |
RPL8 | Ribosomal protein L8 | CAAATCCCACACCCACCACC GCAACACATTACCAACCATAAGACTAGC |
260 | 90.4 | 0.994 |
eIF | Eukaryotic initiation factor | TGGTCACATCGTCATTAAAAATCGTCCT GGTATCATCAGTTGGGAGCCTCAAG |
277 | 93.1 | 0.994 |
TUB | β-tubulin | GGTGTTACTTGCTGTTTGAGATTCCCT ATCATCTGTTCATCTACCTCCTTTGTGC |
290 | 104.7 | 0.990 |
DNAJ | DnaJ-like protein (hsp40) | GTTTCCGCCTCTTGCTCCACA CCGCCGACGAATTTTGCTG |
193 | 96.2 | 0.991 |
CYP | Cyclophilin | TCAAGAAGGTGGAGGCTGTTGG GACAAGACCCGACCCAAGCA |
211 | 98.6 | 0.998 |
EF1α | Elongation factor 1-alpha | CTGTGCTGTCCTGATTATTGACTCG GGGTGAAAGCAAGCAACGCA |
98 | 90.6 | 0.995 |
PP2Acs | A catalytic subunit of protein phosphatase 2A | GCCAGTAAAAAGCCCTGTGACTA CGCAAGCATTCATCATAGAACCCAT |
267 | 97.7 | 0.997 |
RUBP | Ribulose 1,5 bisphosphate | GCAAAACACTGACATCACCTCCA ATACAAATCCGTGCTCAGTCTCG |
206 | 94.2 | 0.998 |
SAND | SAND protein family | ACTAGAGAATCGTCAGAGAGGTTTGC CGGAGTAACCCAGCACAGTAGA |
267 | 91.6 | 0.997 |
P5CS | Delta 1-pyrroline-5-carboxylate synthetase | AGTTCTGTTGAGTGATGTAGAGGGTC CCGATGAAAGAGGGTGCCGAT |
271 | 100.9 | 0.995 |
GI | GIGANTEA | ACACTACAACCGCCCGATTTT CCATAACACCGCCACACCAACG |
233 | 104.7 | 0.998 |
Data analysis for expression stability
We chose three statistical software programs (geNorm8, NormFinder14, and BestKeeper15) and a web tool (RefFinder16) (http://150.216.56.64/referencegene.php?type=reference#) to evaluate the stability of 14 candidate reference genes. The analysis methods of these four programs were the same as those reported in other published articles35. geNorm identifies the best reference gene pair by calculating the value M8. The smaller the M value, the more stable the gene expression. Furthermore, geNorm also determines the optimal number of reference genes needed by calculating the pairwise variation (Vn/Vn+1)35. NormFinder evaluates gene expression stability via grouped analysis. The output is not simply the best gene but also the best combination of two genes. The value of expression stabilities derived from NormFinder is smaller, and the single reference gene is more stable. BestKeeper employs pair-wise correlation analysis of all pairs of candidate reference genes to estimate gene expression stability. Pfaffl considers genes with elevated SD or CV values inconsistent15. RefFinder generates a comprehensive ranking synthesized using the results of four algorithms (geNorm, NormFinder, BestKeeper and Delta- Ct).
Validation of reference genes
To validate the reliability of the obtained reference genes, the expression of two target genes—delta 1-pyrroline-5-carboxylate synthetase (P5CS) and GIGANTEA (GI)—under different experimental conditions was normalized using the combination of the two best reference genes and the most variable gene obtained via RefFinder (see Supplementary Tables S9, S10 and S11). The GenBank accession numbers of P5CS and GI are MK181643 and MK181644, respectively. Information on the primers for these two target genes is listed in Table 1. The expression levels of these two target genes normalized to the reference genes were analysed using the 2−ΔΔCt method36. We set up three biological and technical replicates in qPCR assays.
Supplementary information
Acknowledgements
The authors would like to thank the editor and the anonymous reviewers for their precious time and helpful comments. This work was supported by the National Key Research and Development Program of China [grant number 2018YFD0200602], the National Natural Science Foundation of China [grant number 31572022, 31171867] and the Beijing Natural Science Foundation [grant number 6182033].
Author Contributions
S.H.W., H.J.H. and D.D.Z. conceived and designed research. D.D.Z., J.C.C. and X.W. conducted experiments. Z.F.H. and C.L.J. contributed reagents and analytical tools. D.D.Z. and X.W. analyzed data. D.D.Z., J.C.C., C.X.Z. and H.Q.H. wrote the manuscript.
Data Availability
The datasets generated and analyzed during the current study are available from the corresponding author on reasonable request.
Competing Interests
The authors declare no competing interests.
Footnotes
Publisher’s note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Dandan Zhao, Xu Wang and Jingchao Chen contributed equally.
Contributor Information
Hongjuan Huang, Email: hjhuang@ippcaas.cn.
Shouhui Wei, Email: shwei@ippcaas.cn.
Supplementary information
Supplementary information accompanies this paper at 10.1038/s41598-019-43438-6.
References
- 1.Wei S, et al. Rapid and effective methods for breaking seed dormancy in buffalobur (Solanum rostratum) Weed Sci. 2010;58:141–146. doi: 10.1614/WS-D-09-00005.1. [DOI] [Google Scholar]
- 2.Rushing DW, Murray DS, Verhalen LM. Weed interference with cotton (Gossypium hirsutum). I. Buffalobur (Solanum rostratum) Weed Sci. 1985;33:810–814. doi: 10.1017/S0043174500083405. [DOI] [Google Scholar]
- 3.Bassett I, Munro D. The biology of Canadian weeds.: 78. Solanum carolinense L. and Solanum rostratum Dunal. Can. J. Plant Sci. 1986;66:977–991. doi: 10.4141/cjps86-120. [DOI] [Google Scholar]
- 4.Bustin S, Benes V, Nolan T, Pfaffl M. Quantitative real-time RT-PCR–a perspective. J. Mol. Endocrinol. 2005;34:597–601. doi: 10.1677/jme.1.01755. [DOI] [PubMed] [Google Scholar]
- 5.Huggett J, Dheda K, Bustin S, Zumla A. Real-time RT-PCR normalisation; strategies and considerations. Genes Immun. 2005;6:279. doi: 10.1038/sj.gene.6364190. [DOI] [PubMed] [Google Scholar]
- 6.Bustin, S. A. et al. MIQE precis: Practical implementation of minimum standard guidelines for fluorescence-based quantitative real-time PCR experiments. BMC Mol. Biol. 11, doi:10.1186 (2010). [DOI] [PMC free article] [PubMed]
- 7.Huggett, J., Nolan, T. & Bustin, S. A. MIQE: Guidelines for the Design and Publication of a Reliable Real-time PCR Assay. Real-Time PCR: Advanced Technologies and Applications; Caister Acad. Press: Norfolk, UK, 247–258 (2013).
- 8.Vandesompele, J. et al. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome. Biology. 3, research0034. 0031 (2002). [DOI] [PMC free article] [PubMed]
- 9.Wan H, et al. Identification of reference genes for reverse transcription quantitative real-time PCR normalization in pepper (Capsicum annuum L.) Biochem. Biophys. Res. Commun. 2011;416:24–30. doi: 10.1016/j.bbrc.2011.10.105. [DOI] [PubMed] [Google Scholar]
- 10.Nicot N, Hausman J-F, Hoffmann L, Evers D. Housekeeping gene selection for real-time RT-PCR normalization in potato during biotic and abiotic stress. J. Exp. Bot. 2005;56:2907–2914. doi: 10.1093/jxb/eri285. [DOI] [PubMed] [Google Scholar]
- 11.Gantasala NP, et al. Selection and validation of reference genes for quantitative gene expression studies by real-time PCR in eggplant (Solanum melongena L) BMC Research Notes. 2013;6:312. doi: 10.1186/1756-0500-6-312. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Expósito-Rodríguez M, Borges AA, Borges-Pérez A, Pérez JA. Selection of internal control genes for quantitative real-time RT-PCR studies during tomato development process. BMC Plant Biol. 2008;8:131. doi: 10.1186/1471-2229-8-131. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Zeng S, et al. Identification and validation of reference genes for quantitative real-time PCR normalization and its applications in lycium. PloS One. 2014;9:e97039. doi: 10.1371/journal.pone.0097039. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Andersen CL, Jensen JL, Ørntoft TF. Normalization of real-time quantitative reverse transcription-PCR data: a model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res. 2004;64:5245–5250. doi: 10.1158/0008-5472.CAN-04-0496. [DOI] [PubMed] [Google Scholar]
- 15.Pfaffl MW, Tichopad A, Prgomet C, Neuvians TP. Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper–Excel-based tool using pair-wise correlations. Biotechnol. Lett. 2004;26:509–515. doi: 10.1023/B:BILE.0000019559.84305.47. [DOI] [PubMed] [Google Scholar]
- 16.Xie F, Xiao P, Chen D, Xu L, Zhang B. miRDeepFinder: a miRNA analysis tool for deep sequencing of plant small RNAs. Plant Mol. Biol. 2012;80:75–84. doi: 10.1007/s11103-012-9885-2. [DOI] [PubMed] [Google Scholar]
- 17.Gomes AÉI, et al. Selection and validation of reference genes for gene expression studies in Klebsiella pneumoniae using Reverse Transcription Quantitative real-time PCR. Sci. Rep. 2018;8:9001. doi: 10.1038/s41598-018-27420-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.LaRosa PC, Rhodes D, Rhodes JC, Bressan RA, Csonka LN. Elevated accumulation of proline in NaCl-adapted tobacco cells is not due to altered Δ1-pyrroline-5-carboxylate reductase. Plant Physiol. 1991;96:245–250. doi: 10.1104/pp.96.1.245. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Park HJ, Kim W-Y, Yun D-J. A role for GIGANTEA: keeping the balance between flowering and salinity stress tolerance. Plant Signal. Behav. 2013;8:e24820. doi: 10.4161/psb.24820. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Kurepa J, Smalle J, Va M, Montagu N, Inzé D. Oxidative stress tolerance and longevity in Arabidopsis: the late-flowering mutant gigantea is tolerant to paraquat. Plant J. 1998;14:759–764. doi: 10.1046/j.1365-313x.1998.00168.x. [DOI] [PubMed] [Google Scholar]
- 21.Rajan VBV, D’Silva P. Arabidopsis thaliana J-class heat shock proteins: cellular stress sensors. Funct. Integr. Genomi. 2009;9:433. doi: 10.1007/s10142-009-0132-0. [DOI] [PubMed] [Google Scholar]
- 22.Jacinto E, Guo B, Arndt KT, Schmelzle T, Hall MN. TIP41 interacts with TAP42 and negatively regulates the TOR signaling pathway. Mol. Cell. 2001;8:1017–1026. doi: 10.1016/S1097-2765(01)00386-0. [DOI] [PubMed] [Google Scholar]
- 23.Wei S, et al. Factors affecting buffalobur (Solanum rostratum) seed germination and seedling emergence. Weed Sci. 2009;57:521–525. doi: 10.1614/WE-09-054.1. [DOI] [Google Scholar]
- 24.Pollard TD, Cooper JA. Actin, a central player in cell shape and movement. Science. 2009;326:1208–1212. doi: 10.1126/science.1175862. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Cai J, et al. Selection of appropriate reference genes for the detection of rhythmic gene expression via quantitative real-time PCR in Tibetan hulless barley. PloS One. 2018;13:e0190559. doi: 10.1371/journal.pone.0190559. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Xu X, et al. Selection of relatively exact reference genes for gene expression studies in flixweed (Descurainia sophia) by quantitative real-time polymerase chain reaction. Pestic. Biochem. Physiol. 2016;127:59–66. doi: 10.1016/j.pestbp.2015.09.007. [DOI] [PubMed] [Google Scholar]
- 27.Liu X, et al. Reference gene selection for qRT-PCR assays in Stellera chamaejasme subjected to abiotic stresses and hormone treatments based on transcriptome datasets. PeerJ. 2018;6:e4535. doi: 10.7717/peerj.4535. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Wang J, et al. Selection and validation of reference genes for quantitative gene expression analyses in black locust (Robinia pseudoacacia L.) using real-time quantitative PCR. PloS One. 2018;13:e0193076. doi: 10.1371/journal.pone.0193076. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Zhao Y, et al. Selection of reference genes for gene expression normalization in Peucedanum praeruptorum dunn under abiotic stresses, hormone treatments and different tissues. PloS One. 2016;11:e0152356. doi: 10.1371/journal.pone.0152356. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Tang X, Zhang N, Si H, Calderón-Urrea A. Selection and validation of reference genes for RT-qPCR analysis in potato under abiotic stress. Plant Methods. 2017;13:85. doi: 10.1186/s13007-017-0238-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Løvdal T, Lillo C. Reference gene selection for quantitative real-time PCR normalization in tomato subjected to nitrogen, cold, and light stress. Anal. Biochem. 2009;387:238–242. doi: 10.1016/j.ab.2009.01.024. [DOI] [PubMed] [Google Scholar]
- 32.Wang P, et al. Selection of suitable reference genes for RT-qPCR normalization under abiotic stresses and hormone stimulation in persimmon (Diospyros kaki Thunb) PloS one. 2016;11:e0160885. doi: 10.1371/journal.pone.0160885. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Niu X, et al. Reference gene selection for qRT-PCR normalization analysis in kenaf (Hibiscus cannabinus L.) under abiotic stress and hormonal stimuli. Front. Plant Sci. 2017;8:771. doi: 10.3389/fpls.2017.00771. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Dekkers BJ, et al. Identification of reference genes for RT–qPCR expression analysis in Arabidopsis and tomato seeds. Plant Cell Physiol. 2012;53:28–37. doi: 10.1093/pcp/pcr113. [DOI] [PubMed] [Google Scholar]
- 35.Chen J, et al. Selection of relatively exact reference genes for gene expression studies in goosegrass (Eleusine indica) under herbicide stress. Sci. Rep. 2017;7:46494. doi: 10.1038/srep46494. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The datasets generated and analyzed during the current study are available from the corresponding author on reasonable request.