Coordinated D-cyclin/Foxd1 activation drives mitogenic activity of the Sonic Hedgehog signaling pathway

Abstract

Sonic Hedgehog (Shh) signaling plays key regulatory roles in embryonic development and postnatal homeostasis and repair. Modulation of the Shh pathway is known to cause malformations and malignancies associated with dysregulated tissue growth. However, our understanding of the molecular mechanisms by which Shh regulates cellular proliferation is incomplete. Here, using mouse embryonic fibroblasts, we demonstrate that the Forkhead box gene Foxd1 is transcriptionally regulated by canonical Shh signaling and required for downstream proliferative activity. We show that Foxd1 deletion abrogates the proliferative response to SHH ligand while FOXD1 overexpression alone is sufficient to induce cellular proliferation. The proliferative response to both SHH ligand and FOXD1 overexpression was blocked by pharmacologic inhibition of cyclin-dependent kinase signaling. Time-course experiments revealed that Shh pathway activation of Foxd1 is followed by downregulation of Cdkn1c, which encodes a cyclin-dependent kinase inhibitor. Consistent with a direct transcriptional regulation mechanism, we found that FOXD1 reduces reporter activity of a Fox enhancer sequence in the second intron of Cdkn1c. Supporting the applicability of these findings to specific biological contexts, we show that Shh regulation of Foxd1 and Cdkn1c is recapitulated in cranial neural crest cells and provide evidence that this mechanism is operational during upper lip morphogenesis. These results reveal a novel Shh-Foxd1-Cdkn1c regulatory circuit that drives the mitogenic action of Shh signaling and may have broad implications in development and disease.

1. Introduction

Sonic Hedgehog (Shh) signaling is a conserved morphogenetic pathway that regulates cellular proliferation and differentiation. During embryonic and fetal development, Shh is required for the morphogenesis of diverse organs and structures including the central nervous system, midface, and limbs. Postnatally, the pathway regulates stem and progenitor cells involved in tissue healing and repair, and aberrant activation is linked to several types of cancer [1,2]. Control of cell proliferation appears to be a conserved cellular mechanism across these biological contexts. For example, genetic and chemical pathway perturbations during embryonic development cause birth defects of the forebrain (holoprosencephaly), face (cleft lip and palate), and limbs (ectrodactyly) that are associated with deficient tissue outgrowth [3,4]. Postnatally, pathway inhibition disrupts tissue healing and regrowth and is employed as a therapeutic treatment for neoplasia, indicating a conservation of promitogenic activity across these biological settings [5].

Shh signaling most often acts in a paracrine fashion, with epithelial secretion of SHH ligand generating a gradient of pathway activity in adjacent mesenchymal or stromal tissues. SHH ligand binding to the transmembrane receptor Patched1 (PTCH1) relieves repression of the heptahelical protein Smoothened (SMO). Subsequent translocation of SMO to the primary cilium triggers a complex downstream cascade that culminates in regulation of the GLI transcription factors. The three GLI proteins can act independently or in coordination to regulate the transcription of conserved and tissue-specific pathway target genes [6].

Basic research efforts to understand the molecular mechanisms of Shh pathway activity have largely focused on morphogenetic mechanisms. Having received less attention, our understanding of how the Shh pathway regulates cell proliferation is incomplete. D-type cyclin genes (Ccnd1 and Ccnd2) have been identified as Shh pathway targets in several biological contexts, but induction of these genes alone is unlikely sufficient for the precise regulation of cellular proliferation required for appropriate development and tissue repair. Shh signaling has also been shown to regulate expression of multiple members of the Forkhead (Fox) transcription factor member family in several developmental contexts [7–11]. Fox proteins, defined by characteristic winged helix/forkhead DNA binding domains, are also known to play important roles in cell cycle progression and cell proliferation [12]. Here, we utilized a tractable cell-based system to demonstrate that Shh and Fox signals, along with downstream targets, act to coordinately regulate cell proliferation. We then show that this mechanism identified through cell-based assays is operational in a specific biological context.

2. Materials and methods

2.1. Plasmids

Precision LentiORF FOXD1 transfer plasmid from GE Dharmacon (#OHS5897–202616573) and pLenti CMV Blast (w263–1) empty vector provided by Dr. Eric Campeau (Addgene plasmid #17486) [13] were used for lentiviral infection of wild-type immortalized mouse embryonic fibroblasts (iMEFs). A pX458-Dual-Cas9-GFP plasmid was used for CRISPR/Cas9 gene editing. Firefly luciferase constructs with Cdkn1c cis-regulatory elements (enh1 and enh2) were provided by Dr. Juhee Jeong [14].

2.2. Reagents

Cells were treated with SHH-N peptide (R&D Systems #1845-SH) dissolved in PBS with 5 mg/mL BSA. The SMO inhibitor, vismodegib, was purchased from LC Laboratories (CAS No 879085–55–9) and dissolved in DMSO. The CCND:CDK4/6 inhibitor, palbociclib, was purchased from Selleckchem (CAS No 827022–32–2) and dissolved in DMSO.

2.3. Cell culture

Immortalized wild-type, Gli2^−/−3^−/−, and stably transfected iMEFs were maintained as described previously [15] in 10% fetal calf serum (FCS) DMEM (with L-glutamine, 4.5 g/L glucose, without sodium pyruvate) with 1% Penicillin-Streptomycin. Primary mouse embryonic fibroblasts (MEFs) were isolated and maintained as previously described [6]. Immortalized O9–1 mouse cranial neural crest and Ptch1^−/− cells were cultured as described [16].

2.4. Cell treatment

iMEFs (including those stably transfected and CRISPR/Cas9 edited), MEFs, or O9–1 cells were plated at 5 × 10⁵ cells/mL (0.4 mL per well in a 24-well plate) and allowed to attach in full 10% (or 15% for O9–1) FCS media for 24 h before media were replaced with DMEM containing 1% FCS. Cells were treated with SHH ligand at 0.4 μg/mL ± vismodegib at 100 nM or ± palbociclib at 100 nM. As a vehicle control, cells were also treated with equal volumes of PBS with 5 mg/mL BSA and DMSO. Cells were harvested at 48 h (unless otherwise indicated) following treatment for either RNA extraction or counting by hemocytometer.

2.5. RNA extraction and real time RT-PCR

RNA was extracted using GE Illustra RNAspin kits (GE Healthcare) and cDNA was synthesized from 500 ng of total RNA using Promega GoScript reverse transcription reaction kits. Singleplex RT-PCR was conducted as previously described [17] using SSoFast EvaGreen Supermix (BioRad Laboratories) and a BioRad CFX96 Touch thermocycler. Gene-specific RT-PCR primers (Table S1) were designed using IDT PrimerQuest (http://www.idtdna.com/primerquest). Primers were resuspended as stock solutions of 100 μM in TE buffer at pH = 7.0 (Ambion). Working stocks were made as 10 μM solutions containing both forward and reverse primers. Gapdh was used as the housekeeping gene, and analyses were conducted with the 2^−ddCt method.

2.6. CellTrace™ proliferation assay

Cells were plated at 5 × 10⁵ cells/mL (1.6 mL per well in a 6-well plate) and allowed to attach for 24 h. Media were removed and CellTrace™ Far Red (Invitrogen) diluted 1:1000 in DMEM without antibiotics and FCS was added to each well. Cells were incubated at 37 °C for 20 min and replaced with DMEM with 10% FCS for 5 min. Cells were then treated for 48 h with DMEM containing 1% FCS ± SHH ligand. Additional unstained cells and cells stained immediately prior to harvest were used for flow cytometry gating. Trypsinized cells were washed in FACS buffer and fixed in 2% paraformaldehyde. Cells were analyzed using a BD LSRFortessa flow cytometer (BD Biosciences). Data were analyzed by FlowJo® software (TreeStar, Ashland, OR).

2.7. Establishment of stable cell lines

GFP and SMO^M2-GFP overexpressing iMEFs were generated as described [6,15]. A pIRES shuttle vector carrying coding sequences for GFP and SMO^M2-GFP was used to retrovirally infect wild-type iMEF cells. Cells were plated at subconfluence in DMEM with 10% FCS. Cells were then incubated with viral-conditioned media at 37 °C for 6 h. Following a 72-hr propagation period, a BD FACSAriaIII fluorescence-activated cell sorter was used to isolate appropriate GFP+ populations. Wild-type iMEFs were also lentivirally transfected as previously described [18] with the LentiORF FOXD1 transfer plasmid and pLenti CMV Blast empty vector. Briefly, FOXD1 and pLenti transfer plasmids were packaged by 293T cells by FuGENE® 6 (Promega #E2691) transfection with envelope plasmid pCMV-VSV-G (Addgene plasmid #8454) and packaging plasmid(s) pCMV-dR8.2 dvpr (Addgene plasmid #8455) or pRSV-REV/pMDLg-RRE (Addgene #12253, 12251), respectively. After lentivirus production, target cells were infected with 8 μg/mL protamine sulfate (Sigma #P3369) twice for 4 h each. Infected cells were selected by Blasticidin S (Fisher Scientific, CAS No 3513–03–9) 24 hr post-infection. Cells were then aliquoted, frozen, and stored in liquid nitrogen.

2.8. CRISPR/Cas9 gene editing

Chopchop 2.0 and Deskgen were used to design two guide RNAs (gRNAs): gRNA-10 TTGGTGCAGAGTCCCCAGCGCGG and gRNA-4 GCTCAGGGTCATAGCTGGGGCGG that recognize and excise a 1,306-bp genomic region that includes the lone exon in Foxd1. DNAs encoding gRNA-10 and gRNA-4 were respectively cloned into the BbsI and BsaI sites of the pX458-Dual-Cas9-GFP plasmid. Plasmids (10 μg) with and without inserts were separately electroporated into WT iMEFs (1 × 10⁷ cells) at 200 V and 950 μF in 2 mm cuvettes. Following a 48-hr recovery period, a BD FACSAriaIII fluorescence-activated cell sorter was used to isolate appropriate GFP+ populations. Single cells were individually sorted into wells of a 96-well plate and remaining cells were pooled into the wells of a 6-well plate. Deletion in Foxd1 was confirmed by a decrease in amplicon size by PCR using primers (forward: CGTTTCTAG ATTCTCACTCCTC, reverse: TCCACTGTGGTCCCTTTA) targeting the lone exon in Foxd1. Cell lines with confirmed deletions were used for downstream assays. An equal number of Cas9-GFP+ cell lines electroporated with plasmids without inserts were used as controls.

2.9. Luciferase reporter experiments

FOXD1-overexpressing and pLenti negative control iMEFs were plated at 1.25 × 10⁵ cells/mL (0.4 ml per well in a 24-well plate) in duplicate. After 24 h, media were changed to DMEM with 1% FCS and transiently transfected with 0.75 μL Lipofectamine® 3000, 1 μL P3000™ reagent, and 125 ng of Cdkn1c-enh1 or Cdkn1c-enh2 in Opti-MEM® following manufacturer’s instructions. To normalize transfection efficiency, all plated cells were cotransfected with 62.5 ng SV40-driven renilla plasmid. After 48 h, cell lysates were collected and analyzed by the Dual-Luciferase® Reporter Assay System (Promega).

2.10. Statistics

Paired, two-tailed t-tests were used for analysis of gene expression changes, proliferation, and luciferase reporter assays. Based upon predicted directional changes from these experiments, one-tailed t-tested were used for SMO^M2-GFP overexpressing iMEFs and Gli2^−/−3^−/− iMEFs gene expression results. Graphpad Prism 6 was used for all statistical analyses. An alpha value of 0.05 was maintained for determination of significance for all experiments.

2.11. Animals

This study was conducted in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The protocol was approved by the University of Wisconsin School of Veterinary Medicine Institutional Animal Care and Use Committee (protocol number G005396). C57BL/6J mice were purchased from The Jackson Laboratory and housed under specific pathogen-free conditions in disposable, ventilated cages (Innovive, San Diego, CA). Rooms were maintained at 22 ± 2 °C and 30–70% humidity on a 12 hour light, 12 hour dark cycle. Mice were fed 2920× Irradiated Harlan Teklad Global Soy Protein-Free Extruded Rodent Diet until day of plug, when dams received 2919 Irradiated Teklad Global 19% Protein Extruded Rodent Diet. Mice were set up for timed pregnancies as previously described [19].

2.12. In situ hybridization (ISH)

Embryos at gestational day (GD) 11 were dissected in PBS and fixed in 4% paraformaldehyde in PBS overnight. Embryos then underwent graded dehydration (1:3, 1:1, 3:1 v/v) into 100% methanol and stored at −20 °C indefinitely for subsequent ISH analysis. In situ hybridization was performed as previously described [11,17]. Embryo sections were imaged using a Nikon Eclipse E600 microscope. Gene-specific ISH riboprobe primers were designed using IDT PrimerQuest (http://www.idtdna.com/primerquest) and affixed with the T7 polymerase consensus sequence plus a 5-bp leader sequence (CGATGTTAATACGACTCACTATAGGG) to the reverse primer (Table S2).

2.13. Immunohistochemistry

GD10.25 embryos were fixed in 4% paraformaldehyde in PBS overnight prior to graded dehydration into methanol and storage at −20 °C. Embryos were subsequently rehydrated into PBS and 100 μm frontal sections were obtained using a vibrating microtome. Sections were blocked in 5% normalized goat serum (NGS) and 1% DMSO in PBSTx for 1 h, incubated in monoclonal rabbit anti-Ki67 (1:250, Cell Signaling cat#9027, [20]), washed, and transferred to monoclonal goat anti-rabbit-Alexafluor594 secondary antibody (1:1000, Thermo Scientific cat#R37117) in PBSTx + 5% NGS for 1 h at room temperature. Finally, sections were incubated with DAPI (1:1000 Thermo Scientific) in PBS for 6 mins and imaged using a Leica SP8 confocal microscope.

3. Results

3.1. Canonical Shh signaling drives proliferation in iMEFs

We have shown previously that SHH ligand elicits a robust transcriptional response in wild-type (WT) immortalized mouse embryonic fibroblasts (iMEFs) that is consistent with the classic paracrine pathway signaling model [15]. We first examined whether WT iMEFs also model the proliferative response to SHH stimulation. After 48 h, treatment with SHH ligand resulted in a 63% increase in cell number compared to vehicle treatment (Fig. 1A). This response was completely blocked by addition of vismodegib, a potent pharmacologic inhibitor of the SMO protein. Addition of vismodegib alone had no effect on cell count, suggesting an absence of basal Shh signaling activity in WT iMEFs (Fig. S1). We next tested whether the proliferative response to SHH ligand is dependent upon the GLI transcription factors. As opposed to WT iMEFs, no change in cell number was observed following SHH stimulation in Gli2^−/−3^−/− iMEFs. The mitogenic activity of SHH ligand was further examined using CellTrace™ proliferation dye [21]. Relative to vehicle treatment, SHH stimulation of WT iMEFs caused a leftward shift in fluorescent intensity, indicative of increased cell division (Fig. 1B).

Fig. 1.

Canonical Shh signaling drives proliferation in iMEFs. (A) Wild-type (WT) and Gli2^−/−3^−/− iMEFs were cultured ± SHH ligand and ± the SMO antagonist vismodegib (Vis). Cell number is shown relative to vehicle-treated cells. SHH increased proliferation in WT iMEFs, but not in Gli2^−/−3^−/− iMEFs. This increase in proliferation was blocked by the addition of vismodegib (n = 5). (B) Histogram of fluorescence intensity of cells treated with the cell tracing reagent CellTrace™ Far Red and analyzed by flow cytometry. SHH treatment resulted in a leftward shift in fluorescence compared to vehicle-treated cells, indicating an increase in cellular divisions (n = 1). Significance: * = p < 0.05. Error bars show SEM.

3.2. Foxd1 is a target of canonical Sonic Hedgehog signaling

We next examined the effect of SHH stimulation on the expression of Forkhead box family genes, which have been implicated as pathway target genes in multiple developmental contexts including gut, central nervous system and orofacial development [8–11]. Treatment with SHH ligand resulted in a significant induction of the conserved pathway target Gli1, as well as Foxd1 in WT iMEFs (Fig. 2A). Responsiveness of Foxd1 appeared specific, as the expression of three other Fox family members expressed in these cells and associated with cell proliferation (Foxm1, Foxo1, and Foxp1) was unchanged by SHH stimulation (Fig. S2). Consistent with the proliferative response of WT iMEFs to SHH stimulation, Foxd1 induction was blocked by addition of the SMO inhibitor vismodegib. We further examined the specificity of Foxd1 regulation by Shh signaling utilizing Ptch1^−/− iMEFs, which demonstrate ligand-independent constitutive pathway activation [16]. Expression levels of both Gli1 and Foxd1 were significantly higher in Ptch1^−/− cells relative to WT iMEFs, and expression of both genes was reduced by the addition of vismodegib (Fig. 2B). Because blocking SMO activity with vismodegib inhibited Foxd1 expression, we next tested whether SMO overexpression could induce Foxd1 expression. Overexpression of a mutant form of SMO (SMO^M2) that generates constitutive downstream pathway activity [22] was sufficient to induce both Gli1 and Foxd1 expression to levels approximating SHH ligand stimulation (Fig. 2C). In Gli2^−/−3^−/− iMEFs, treatment with SHH ligand did not change Foxd1 expression, suggesting that its induction by SHH ligand requires the GLI transcription factors (Fig. 2D).

Fig. 2.

Foxd1 is a target of canonical Sonic Hedgehog signaling. (A) Gene expression was determined for WT iMEFs cultured ± SHH ligand and ± the SMO antagonist vismodegib (Vis). Expression changes are shown as a fold change from vehicle-treated cells. SHH treatment resulted in an increase in Gli1 and Foxd1 expression, which was blocked by the addition of vismodegib (n = 6). (B) Expression of Gli1 and Foxd1 is increased in Ptch1^−/− iMEFs relative to wild-type (inset) and significantly reduced by vismodegib treatment. (C) Expression of Gli1 and Foxd1 is increased in iMEFs overexpressing a constitutively active form of human Smoothened (SMO^M2). Expression changes are shown as a fold change from cell overexpressing GFP (n = 5). Insert shows SMO expression. (D) Expression of Gli1 and Foxd1 is not significantly changed in Gli2^−/−3^−/− iMEFs treated with SHH ligand (n = 4). Significance: * = p < 0.05, ** = p < 0.01, *** = p < 0.001. Error bars show SEM.

3.3. Foxd1 drives proliferative activity that is sensitive to CDK-cyclin inhibition

We next deleted Foxd1 using CRISPR/Cas gene editing to test its requirement for the proliferative response of iMEFs to SHH ligand stimulation. WT iMEFs were transfected with gRNAs targeting the single Foxd1 exon or with control plasmid alone, then sorted and plated as single cells to produce two Foxd1 deletion and two control monoclonal lines. Deletion of Foxd1 was confirmed both by genotyping and RT-PCR (Fig. 3A, Fig. S3). As opposed to the control lines, SHH ligand stimulation did not increase cell count in either Foxd1 deletion line (Fig. 3B). These results suggest that FOXD1 is necessary for the proliferative response of iMEFs to SHH ligand stimulation.

Fig. 3.

Shh-Foxd1 drives proliferative activity that is sensitive to CDK-cyclin inhibition. (A) Schematic of the Foxd1 locus in mouse genome with target sites of CRISPR/Cas9 gRNAs and genotyping primers (arrowheads). A shortened PCR amplicon (~758 bp) in CRISPR Foxd1 Deletion (Del) lines compared to full-length amplicons (2064 bp) in WT iMEF and CRISPR Control lines indicate successful CRISPR/Cas9 gene editing. (B) CRISPR Control and Foxd1 Deletion lines were cultured ± SHH ligand. SHH treatment increased cell number in control lines relative to vehicle treatment but not in Foxd1-deleted cell lines (n = 6–7). (C) WT iMEFs were cultured ± CCND:CDK4/6 inhibitor palbociclib (Palbo) and ± SHH ligand. Cell numbers are shown relative to vehicle-treated negative control cells (pLenti). In low serum, SHH increased proliferation while palbociclib blocked this increase. Palbociclib alone did not change proliferation in low serum (n = 5). (D) iMEFs stably overexpressing empty pLenti construct and FOXD1 were cultured ± the CDK4/6 inhibitor palbociclib in low serum (1% FCS). Cell numbers are shown relative to vehicle-treated pLenti expressing cells. iMEFs expressing FOXD1 resulted in increased cell number, which was blocked by the addition of palbociclib (n = 3). Significance: * = p < 0.05. Error bars show SEM.

Several Fox family members have been shown to regulate cyclin-dependent kinase inhibitor (CDKI) proteins [14,23–25]. We therefore tested whether Shh-induced proliferation in iMEFs is CDK-dependent and sensitive to the potent pharmacologic CDKI, palbociclib. Initial control experiments showed that treatment with 10 nM palbociclib reduced but did not eliminate proliferation in cells grown in 10% FCS and had no effect on cells grown in 1% FCS media (Fig. S4). Palbociclib treatment efficiently blocked the SHH-induced increase in cell number but had no effect in the absence of SHH (Fig. 3C). We next generated WT iMEFs with stable overexpression of human FOXD1. Cell number was increased by 40% in FOXD1 overexpressing cells relative to the negative control (pLenti), suggesting that FOXD1 is sufficient to drive cell proliferation. This increase was completely blocked by the addition of palbociclib (Fig. 3D), demonstrating that both SHH- and FOXD1-induced proliferation is highly sensitive to Cyclin-CDK inhibition.

3.4. SHH suppresses Cdkn1c expression

D-type cyclins (CCNDs) complex with cyclin-dependent kinases 4 and 6 (CDK4/6) to progress the cell forward through the cell cycle. Palbociclib acts comparably to CDKI proteins by inhibiting CCND:CDK4/6 complexes. We therefore examined the expression profiles of D-type cyclins and CDKIs in iMEFs treated with SHH ligand. Pathway activation increased Ccnd1 mRNA levels, while expression of Cdkn1c (p57) was reduced following SHH ligand stimulation. Transcriptional targeting of Ccnd1 and Cdkn1c appeared relatively specific in this system, as the expression of other D-type cyclins (Ccnd2 and Ccnd3) and CDKIs (Cdkn1a and Cdkn1b) was not changed by the addition of SHH ligand. As observed for pathway regulation of Foxd1 transcription and cell proliferation, SHH-stimulated changes in Ccnd1 and Cdkn1c expression were completely blocked by the SMO inhibitor vismodegib (Fig. 4A). Similarly, vismodegib treatment of Ptch1^−/− iMEFs reduced expression of Ccnd1 while increasing Cdkn1c expression (Fig. 4B). Overexpression of SMO^M2 resulted in a significant increase in Ccnd1 expression while almost completely ablating expression of Cdkn1c (Fig. 4C). SHH-regulation of Ccnd1 and Cdkn1c also appeared dependent upon the GLI transcription factors, as SHH ligand addition in Gli2^−/−3^−/− iMEFs did not change their expression (Fig. 4D). We next investigated the temporal sequence of transcriptional changes following SHH stimulation. Expression of Gli1 was significantly increased as early as 6 h following ligand addition, whereas Foxd1 expression was not increased until 24 h. While unchanged 24 h following SHH ligand addition, expression of Cdkn1c was significantly downregulated at 48 and 72 h (Fig. 4E).

Fig. 4.

SHH suppresses Cdkn1c expression. (A) Gene expression was determined for wild-type (WT) iMEFs cultured ± SHH ligand and ± the SMO antagonist vismodegib (Vis). Expression changes are shown as a fold change from vehicle-treated cells. SHH treatment resulted in an increase in Ccnd1 and a decrease in Cdkn1c expression, both of which were blocked by the addition of vismodegib. Expression changes are shown as a fold change from vehicle-treated cells. (n = 9). (B) Expression of Ccnd1 is increased in Ptch1^−/− iMEFs relative to WT (inset). Vismodegib treatment Ptch1^−/− iMEFs results in decreased Ccnd1 expression and increased Cdkn1c expression (C) Expression of Gli1 and Foxd1 is not significantly changed in Gli2^−/− 3^−/− iMEFs treated with SHH ligand (n = 4). (C) In iMEFs overexpressing a constitutively active form of human Smoothened (SMO^M2), expression of Ccnd1 was increased while Cdkn1c expression was decreased. Expression changes are shown as a fold change from cells overexpressing GFP (n = 5). (D) To determine the temporal sequence of gene expression changes, WT cells were harvested at 6, 12, 24, 48, and 72 h after treatment ± SHH ligand. Gli1 expression (white arrow) is significantly increased by 6 h followed by increased Foxd1 expression (black arrow) by 24 h, and Cdkn1c expression (gray arrow) is not significantly decreased until 48 h post-treatment. Expression changes are shown as a fold change from vehicle-treated cells at respective time points (n = 5). Significance: * = p < 0.05, ** = p < 0.01, *** = p < 0.001, **** = p < 0.0001. Error bars show SEM.

3.5. FOXD1 regulates activity of a Fox enhancer element in Cdkn1c

The temporal sequence of transcriptional changes following SHH ligand stimulation implicates Foxd1 as a direct pathway target, which may then regulate Cdkn1c expression. This hypothesis is supported by the recent identification of two FOX enhancer sequences in the Cdkn1c locus [14]. We tested whether FOXD1 directly binds these enhancer sequences using established luciferase reporter constructs. As shown in Fig. 5A, enh1 is in the second intron of Cdkn1c while enh2 is located in the 3′ UTR. Luciferase reporter constructs were transfected into iMEFs stably overexpressing FOXD1 or a negative control vector. FOXD1-expressing cells exhibited higher activity of enh1-driven luciferase than negative controls while no difference was observed in luciferase activity driven by enh2 (Fig. 5B).

Fig. 5.

FOXD1 regulates activity of a Fox enhancer element in Cdkn1c. (A) Schematic of the Cdkn1c locus in mouse genome adapted from Cesario et al. [14]. enh1 is located between exons 2 and 3. enh2 is located in the 3′ UTR of the Cdkn1c gene. (B) Firefly luciferase reporter assay driven by Cdkn1c enhancer elements, enh1 and enh2, in iMEFs overexpressing empty pLenti construct or FOXD1. Firefly luciferase activity relative to renilla luciferase activity is shown as a fold change from pLenti negative control (n = 6). Significance: * = p < 0.05. Error bars show SEM.

3.6. Conservation of the Shh-Foxd1-Cdkn1c circuit

We next examined whether the regulatory circuit defined in iMEFs is conserved in other SHH-responsive cells. To test this paradigm without potential influences of cell immortalization, we first examined primary mouse embryonic fibroblasts (MEFs). In WT MEFs, SHH stimulation increased expression of Gli1, Foxd1, and Ccnd1 while modestly but significantly decreasing Cdkn1c expression, suggesting that findings observed in iMEFs are not influenced by the cell immortalization process (Fig. 6A). We next examined a mouse cranial neural crest cell line (O9–1) that was recently shown to be transcriptionally and proliferatively responsive to SHH ligand [26]. In this developmentally-defined cell line, SHH-induced changes in Gli1, Foxd1, Ccnd1, and Cdkn1c closely paralleled those observed in both MEFs and iMEFs (Fig. 6A).

Fig. 6.

Conservation of the Shh-Foxd1-Cdkn1c circuit. (A) Gene expression was determined ± SHH ligand in primary mouse embryonic fibroblasts (MEFs) or O9–1 cranial neural crest cells. Expression changes are shown as a fold change from vehicle-treated cells. SHH treatment resulted in an increase in expression of Gli1, Foxd1, and Ccnd1, while expression of Cdkn1c was decreased in both cell types. Significance: * = p < 0.05, ** = p < 0.01. Error bars show SEM. (B) Frontal sections of gestational day 11 embryos were generated to show expression patterns of Gli1, Foxd1, and Cdkn1c in tissues of the developing face. Note that the region with Gli1 and Foxd1 expression corresponds with higher Ki67 positive staining (white dashed outline) than the adjacent region with Cdkn1c expression (dashed yellow outline).

Among the derivatives of cranial neural crest cells is the mesenchyme of the growth centers that form the midface, including the upper lip. We have shown previously that Shh signaling is required for upper lip closure and that pathway inhibition results in cleft lip stemming from deficient outgrowth of the medial nasal processes (MNPs) [26,27]. We therefore tested whether the observed regulatory circuit mediating SHH-induced cell proliferation is operational in upper lip morphogenesis. The expression domains of Gli1, Foxd1, and Cdkn1c were defined in GD11.0 mouse embryos with focus placed on the distal portion of the MNP, which must grow outward to meet and fuse with the maxillary process to close the upper lip. Gli1 and Foxd1 exhibited parallel expression domains that opposed that of Cdkn1c (Fig. 6B). Staining for Ki67 in parallel sections revealed proliferating cells in more abundance in the medial Foxd1-expressing domain than in the lateral Cdkn1c expressing domain of the MNP.

4. Discussion

Our study is the first to demonstrate that canonical Shh signaling regulates Foxd1 transcription and that FOXD1 expression is sufficient to recapitulate the proliferative response to SHH ligand addition. We also provide the first evidence linking the mitogenic activity of Shh-Foxd1 signaling to regulation of cyclin-dependent kinase activity. Based upon the collective results reported herein, we propose a novel Shh-initiated circuit that regulates proliferation through coordinated activation of Ccnd1 and FOXD1-mediated suppression of Cdkn1c (Fig. 7). Finally, we show evidence that this regulatory circuit is operational during embryonic development. Our findings suggest that Shh acts through independent, parallel mechanisms to drive cell cycle progression through the CyclinD:CDK4/6 complex. While Shh signaling has long been considered pro-mitogenic, our understanding of the underlying molecular mechanisms is incomplete. Gene expression profiling identified Ccnd2 as one of the first bona fide Shh target genes while studies of Shh signaling in development and malignancy showed that both Ccnd1 and Ccnd2 are relatively conserved pathway targets that promote G1 to S cell cycle progression [28–33]. However, a mechanism limited to Shh upregulation of D-type cyclins appears overly simplistic. For example, CyclinD:CDK4/6 complexes are negatively regulated by several CDKIs, such that Shh-mediated upregulation of D-type Cyclins alone would likely be insufficient to advance the cell cycle from G1 to S in the presence of CDKI proteins. The circuit identified herein resolves this by showing that induction of Ccnd1 is coupled with Fox-mediated suppression of Cdkn1c. However, our data also suggests that suppression of Cdkn1c augments but is not necessary for the Shh proliferative response. Specifically, we observed loss of Cdkn1c expression in both monoclonal control and Foxd1 deletion lines (Fig. S5). This may result from selection of cells in which the anti-mitogenic Cdkn1c is downregulated. While SHH stimulation of control monoclonal lines cause a significant increase in cell count, the proliferative response was muted relative to the original polyclonal population in which Cdkn1c is expressed at much higher levels.

Fig. 7.

Proposed Shh-Foxd1-Cdkn1c signaling model. Binding of SHH ligand to the transmembrane protein PTCH1 triggers activation of SMO and GLI2-mediated transcription of pathway target genes, including Ccnd1 and Foxd1. FOXD1 binds to a FOX-binding site in the Cdkn1c gene. Downregulation of CDKN1C relieves repression of the CyclinD:CDK4/6 complex.

Here, we show that FOXD1 expression is sufficient to drive proliferation in a manner that is sensitive to pharmacologic CDK inhibition. While FOXD1 is a known mesenchymal factor in several developmental contexts, most evidence of its mitogenic role comes from cancer studies. In this context, Foxd1 has yet to be directly linked to Shh signaling. However, Foxd1 has been implicated in several cancer types driven by aberrant Shh pathway signaling, including lung, breast, and prostate [34–37]. FOXD1 is overexpressed in lung, breast, and prostate cancer biopsies, and its depletion suppresses cell proliferation in lung and breast cancer cell lines [34,38,39]. Our finding that Shh drives Foxd1 expression in fibroblasts warrants further investigation into whether parallel regulation is operational in Shh pathway-driven cancer.

We utilized iMEFs to uncover the Shh-Foxd1-Cdkn1c regulatory circuit and showed that it is conserved in a cranial neural crest cell line that is relevant to craniofacial development. Two independent studies demonstrated multiple Fox genes downstream of Shh signaling in the cranial neural crest-derived mesenchyme in vivo [7,11]. While Foxd1 was identified in both these studies, neither tested whether it is a direct target of Shh signaling. Our cell-based evidence suggests that Foxd1 is directly targeted by canonical Shh signaling, as its response to SHH ligand requires both SMO and GLI protein function. To test whether this circuit is operational in a specific developmental context, we chose to examine upper lip morphogenesis because we recently showed that formation of the upper lip is regulated by Shh-Fox signaling [11]. Specifically, SHH in the surface ectoderm activates pathway activity and expression of multiple Fox genes, including Foxd1, in the adjacent cranial neural crest-derived mesenchyme. Here we show that Foxd1 expression parallels that of canonical Shh target gene Gli1 in the mesenchyme of the medial portion of the medial nasal process. Cdkn1c is also present in the mesenchymal compartment of the medial nasal process and its expression is restricted to the lateral aspect directly opposing the domain of Foxd1 expression. In accordance with our in vitro findings, more proliferating cells were observed in the medial, Foxd1-expressing domain than in the lateral, Cdkn1c-expressing domain of the medial nasal process. These findings support the premise that FOXD1 suppresses expression of Cdkn1c to promote cell proliferation in vitro and in vivo.

Whether Shh signaling regulates Foxd1 in other developmental contexts is unclear. The most well-described role of Foxd1 is in kidney development. Global inactivation of both Foxd1 and Shh results in hypoplastic and fused kidneys, though likely through distinct mechanisms [40,41]. Shh expression is restricted to the distal collecting ducts that arise from the first branches of the uteric bud and activates pathway activity in subjacent mesenchyme while Foxd1 is strongly expressed in the cortical stroma [40,41]. Both Shh signaling and Foxd1 are also independently required for formation of the optic chiasm [42]. While in this biological context SHH is thought to function primarily as a chemoattractant that directs retinal ganglionic growth, it may also act by regulating Foxd1 expression. Shh is expressed in the ventral-most region of the diencephalon where it appears to activate pathway activity in retinal ganglionic cells as they are traveling the optic tract [43]. Foxd1 is also expressed in the ventral diencephalon, and in mice lacking Foxd1 or the SHH co-receptor Boc, an overlapping phenotype of decreased ipsilateral retinal ganglion cell projection is observed. While there is positional proximity and overlapping functional outcomes, understanding specific regulatory directionality between Shh and FOXD1 in these developmental contexts will require additional investigation [44].

The incomplete phenotypic overlap between Shh and Foxd1 null mice argues that the specific Shh-Foxd1-Cdkn1c regulatory circuit described here may not be universal. It is more likely that Shh functions through context-dependent cassettes of Fox and CDKI family members. In fact, several other Fox family members, including Foxa2, Foxe1, Foxf1, Foxf2, and Foxl1 have been identified as targets of Shh signaling in diverse developmental contexts including the gut, central nervous system, and secondary palate [8–11]. Several Fox genes, including Foxd1, Foxm1, and Foxo1, have been shown to regulate CDKN1A (p21) and CDKN1B (p27) [39,45,46]. These observations support the wider applicability of Shh-Fox-Cdkn signaling and suggest that specific contexts may involve unique combinations of individual family members.

Abbreviations

Ccnd1

Cyclin D1

CDK

Cyclin-dependent kinase

CDKI

Cyclin-dependent kinase inhibitor

Cdkn1c

Cyclin-Dependent Kinase Inhibitor 1C (aka p57, Kip2)

Foxd1

Forkhead Box d1

iMEF

Immortalized mouse embryonic fibroblast

MEF

Primary mouse embryonic fibroblast

MNP

Medial nasal process

SHH

Sonic Hedgehog

SMO

Smoothened