Skip to main content
3 Biotech logoLink to 3 Biotech
. 2019 May 7;9(6):205. doi: 10.1007/s13205-019-1737-1

Molecular cloning, expression pattern analysis, and in situ hybridization of a Transformer-2 gene in the oriental freshwater prawn, Macrobrachium nipponense (de Haan, 1849)

Yabing Wang 1, Shubo Jin 2, Hongtuo Fu 1,2,✉, Hui Qiao 2, Shengming Sun 2, Wenyi Zhang 2, Sufei Jiang 2, Yongsheng Gong 2, Yiwei Xiong 2, Yan Wu 2
PMCID: PMC6505021  PMID: 31139536

Abstract

In this study, we isolated a full-length cDNA sequence from Macrobrachium nipponense and investigated its gene function. We named the gene Mntra-2a because of high similarities and close evolutionary divergence with arthropod tra-2. The full-length cDNA of Mntra-2a was 1293 bp, consisting of a 212 bp 5′ UTR, a 268 bp 3′ UTR, and an ORF of 813 bp encoding 270 amino acids. It contained an RNA recognition motif and a linker region. Real-time PCR analysis showed that Mntra-2a was highly expressed in the gonads of both males and females. Further in situ hybridization analysis showed that Mntra-2a was mainly located in oocytes and spermatocytes. During embryogenesis, Mntra-2a expression was higher in the cleavage and nauplius stages. During the ovarian reproductive cycle, Mntra-2a expression reached a peak at OvaryV and decreased to the lowest level at OvaryIV. These results indicated that Mntra-2a probably played important roles in embryonic development and early gonad development in M. nipponense. Our results provide basic information for further functional studies of tra-2 in M. nipponense.

Keywords: Macrobrachium nipponense, Transformer-2, Temporal and spatial expression, In situ hybridization

Introduction

The oriental river prawn, Macrobrachium nipponense, is an economically important freshwater prawn and is widely farmed in China with an annual production of almost 272,592 tons in 2016 (Bureau of Fishery 2016). The male individuals of the oriental river prawn grow faster than female individuals of the species. The average weight of commodity male individuals is 2–2.5 times that of females. An all-male culture will help to increase the yield and economic value of M. nipponense and could be achieved through sexual control technology. Therefore, it is important to identify sex-determining genes and their regulatory mechanism.

Animals are under a variety of sex determination methods and this is currently the focus of research. Gender-determining methods in insects that are closely related to crustaceans are currently studied, especially with model species such as Drosophila (Burtis and Baker 1989; Martín et al. 2011). The sex determination mechanism of crustaceans is relatively complex and impacted by environmental factors. At present, studies in the sex determination mechanism of crustaceans are limited, and most species-related studies are still undefined. Insulin-like androgenic gland factor (IAG), a unique gene in crustaceans, plays an important role in sex differentiation, but its specific molecular mechanism is not yet clear (Ventura et al. 2008; Chung et al. 2011; Ma et al. 2013; Vega-Alpízar et al. 2017; Guo et al. 2018).

Insect sex determination involves a series of bottom-up regulatory genes (Wilkins 1995). Sex-lethal (sxl), which regulates female-specific splicing of the precursor mRNA of the transformer(tra) gene, is the major switch gene at the top of the cascade. (Chen et al. 2017). The functional tra protein interacts with the protein product of the transformer-2(tra-2) gene, which leads to female-specific splicing of the mRNA of doublesex (dsx) in the cascade. (Sievert et al. 1997; Chen et al. 2017). Transformer-2 (tra-2) is an important cofactor for sex determinations in most insect species (Hediger et al. 2010; Sarno et al. 2010; Schetelig et al. 2012; Geuverink et al. 2017). Studies of tra-2 knockdown in insects revealed participation of tra-2 in female-specific splicing of tra mRNAs (Burghardt et al. 2005; Concha and Scott 2009; Sarno et al. 2010; Martín et al. 2011; Nissen et al. 2012; Geuverink et al. 2017). In some species of insect, tra-2 has alternative isoforms which all encode for a basic RNA recognition motif (RRM) (Niu et al. 2005; Martín et al. 2011; Nissen et al. 2012; Shukla and Palli 2013). Only one tra-2 isoform was detected in other insect species (Burghardt et al. 2005; Concha and Scott 2009; Salvemini et al. 2003; Sarno et al. 2010; Schetelig et al. 2012; Liu et al. 2015). In crustacean species, Leelatanawit et al. (2009) cloned a homologous gene similar to Drosophila tra-2 in Penaeus monodon, but it has no gender differences in alternative splicing patterns and expression levels and may not participate in sex-related physiological processes. In Eriocheir sinensis and Fenneropenaeus chinensis, different isoforms of tra-2 were cloned. The expression of tra-2c in the ovary was significantly higher than that in the testis, and the expression level in the ovary before gonad differentiation increased sharply (Li et al. 2012; Luo et al. 2017).

In decapod crustaceans, as in vertebrates, the vitellogenesis oocytes is a huge growing oocyte, the cytoplasmic is filled with eosinophilic cells. The early vitellogenesis oocyte contains yolk granules with a nucleus located in the center of oocyte. In the late vitellogenesis stage, the oocytes are mature with increased volume and the nucleus moves to the edge of the oocyte. Eventually, the germinal vesicle breaks down and the nuclear membrane disappears, and the follicular cell layer of the egg becomes extremely thin (Li et al. 2018). The testes were made up of many seminiferous tubules containing germ cells that were distinguished by nuclear size and cell shape at different stages of development. The collected tissue was present in the epithelial cells surrounding the testicular tubules too. Spermatogenesis begins with the mitotic proliferation of spermatogonia in the germinative zone, and the germination is located on one side of the liners of the tubule (Kim et al. 2014). Then, spermatogonia become spermatocytes that pass through meiosis. Spermatocytes differentiate into spermatozoa through spermatids in the seminiferous tubules (Zhang and Qiu 2010).

In the present study, we cloned the tra-2 gene from multiple cDNA libraries of M. nipponense (Gu et al. 2017; Qiao et al. 2017). Our aim was to obtain a full cDNA clone encoding the tra-2 gene to characterize the nucleotide and to examine the expression pattern of the tra-2 gene in early embryonic developmental stages, ovary development, adult tissues, and histological positioning in the gonad of M. nipponense. This study can provide insight into sex determination by the tra-2 gene in M. nipponense and lay the foundation for functional studies of the Mntra-2 gene in the future.

Materials and methods

Experimental animals and sampling

Adult healthy prawns (M. nipponense) were collected from Tai Lake in Wuxi, China (120°13′44″E, 31°28′22″N) in June 2017. Male prawns weighed 2.8 ± 0.5 g and females weighed 1.8 ± 0.5 g. All prawns were transferred to the aquarium and cultured in an inflated freshwater pool in an indoor facility and fed with parudina twice per day. The different developmental stages of embryos were obtained from our laboratory. After prawn spawning, the developmental stages of embryos were continuously observed and collected under microscope.

Nucleotide sequence and bioinformatics analysis

Total RNA was extracted from testis was subjected to 5′ and 3′ RACE cDNA syntheses using a 5′-full RACE Kit and 3′-full RACE Core Set Ver. 2.0 Kit (TaKaRa, Japan). Two-step PCR cloning with gene-specific primers (listed in Table 1) was carried out as described (Li et al. 2018).The ORF Finder program (https://www.ncbi.nlm.nih.gov/orffinder/), BLASTX, and BLASTN (http://www.ncbi.nlm.nih.gov/BLAST/) were used to deduce amino acid sequences. The spatial structure was predicted by I-TASSER (https://zhanglab.ccmb.med.umich.edu/I-TASSER/). The phylogenetic tree was generated by Molecular Evolutionary Genetics Analysis (MEGA 5.1) by the neighbor-joining method and bootstrapping replications were 1000.

Table 1.

Primers of sequence used

Primer name Sequence (5′ → 3′) Description
5′-RACE outer CATGGCTACATGCTGACAGCCTA Primer for 5′-RACE
5′-RACE inner CGCGGATCCACAGCCTACTGATGATCAGTCGATG Primer for 5′-RACE
Tra-2-5′R GGACTGACTCATCTTTACCTC Primer for 5′-RACE
3′-RACE outer TACCGTCGTTCCACTAGTGATTT Primer for 3′-RACE
3′-RACE inner CGCGGATCCTCCACTAGTGATTTCACTATAGG Primer for 3′-RACE
Tra-2-3′F ACTCGCCACGCCGGGCATGA Primer for 3′-RACE
Tra-2-qF TTCATTTTCAAGGTCAAGGTCACG Primer for RT-PCR
Tra-2-qR GAATAAGATGGTGACCGGGAGTA Primer for RT-PCR
β-actinF TATGCACTTCCTCATGCCATC Primer for RT-PCR
β-actinR AGGAGGCGGCAGTGGTCAT Primer for RT-PCR
Tra-2-probe GTATTCTACATCATCACGACGACGTTACTCCCGGTCAC Probe foe ISH
Tra-2-control GTATTCTACATCATCACGACGACGTTACTCCCGGTCAC Control foe ISH

Tissue expression analysis by quantitative real-time PCR

After 1 week culture in the laboratory, eyestalk, brain, heart, hepatopancreas, gill, muscle, ovary and testis were dissected from mature prawns (n = 5). The developmental of embryos is divided into seven stages [from the unfertilized egg (UE) to the first-day larvae after hatching (L1)] based on the study of Bai et al. (2016). The samples were dissected separately, immediately frozen in liquid nitrogen and stored at − 80 °C until processed.

The procedures for RNA isolation and cDNA synthesis were as described (Li et al. 2018). The expression profiles of Mntra-2 in different tissues were determined using qPCR assays (CWBIO, China) (Zhang et al. 2013; Li et al. 2018). The relative copy numbers of Mntra-2 mRNA were calculated according to the 2−ΔΔCT comparative CT method (Livak and Schmittgen 2001). Differences in expression levels were considered significant at P < 0.05.

Expression profiles of tra-2 in the ovarian cycle

The ovarian stage was determined based on the color of the oocytes, according to the criteria as stated (Qiao et al. 2015): stage I, transparent; stage II, yellow; stage III, light green; stage IV, dark green; and stage V, gray. Ovarian samples were treated in the same way as the previous tissue. Then we used qPCR to detect the expression level.

In situ hybridization (ISH)

Tissue samples were embedded in paraffin as described (Li et al. 2018). ISH was performed on 4-µm-thick formalin-fixed paraffin-embedded ovary and testis sections using a Zytofast PLUS CISH implementation kit. The slides were examined under a light microscope. The antisense and sense probes of chromogenic ISH studies were designed by Primer5 software based on the cDNA sequence of Mntra-2a. Both antisense and sense probes were hybridized with the slide. The antisense probe (Tra-2-probe) was prepared for the experimental group, whereas a sense probe (Tra-2-control) was prepared for the control group (Table 1).

Data analysis

All data are expressed as mean ± standard deviation. Data-processing software and method are as described in Li et al. (2018). The significance level was set to P < 0.05.

Results

Molecular cloning and structural analysis of tra-2 gene

The full-length cDNA of Mntra-2a was 1293 bp (GenBank accession number, MH540105) encoding 270 amino acids. The 5′-untranslated region (UTR) was 212 bp long, and the 3′-UTR was 268 bp long. The termination codon and polyadenylation signal locating on the 3′-RACE PCR product revealed the integrity of the sequences we cloned. We found a conserved RRM and linker region in the amino acid sequence of Mntra-2a (Fig. 1).

Fig. 1.

Fig. 1

Nucleotide and deduced amino acid sequence of Macrobrachium nipponense transformer-2a gene (Mntra-2a) cDNA. 5′ UTR and 3′ UTR are listed with lowercase letters. ORF are showed by capital letters. The translation starts codon (ATG), termination codon (TGA), polyadenylation signal (AATAAA) are underlined. Serine/arginine-rich domains (dotted line) and an RNA recognition motif are marked with red

The deduced peptides of Mntra-2a contains 270 amino acids, the conserved RRM (Cys 109-Val 181), two arginine/serine-rich regions (RS1: Met 1-Arg 102; RS2: Gly 230-Ala 270) and a linker region (Asp 182-Arg 202) (Fig. 1). The predicted 3D structure of Mntra-2a is similar to F. chinensis, both had two α-helix; four main β-sheets and one poly-glycine region (Fig. 2) (Li et al. 2012).

Fig. 2.

Fig. 2

3D structures of Mntra-2a by I-TASSER

Multiple alignments of Mntra-2a and tra-2 homologs from several invertebrates were performed using MEGA5.1 and DNAMAN 6.0 software. The RRM domain and the linker region had a high similarity between different tra-2 genes, while the two RS regions had a very low similarity in the sequence (Fig. 3). Phylogenetic analysis indicated that Mntra-2a and tra-2 (Zhang et al. 2013) were clustered into a clade and classified into one clade of tra-2 in other arthropods (Fig. 4).

Fig. 3.

Fig. 3

Alignment of amino acid sequences of Macrobrachium nipponense transformer-2 gene (Mntra-2a) and its homologs. RNA recognition motif (RRM) including RNP1 and RNP2 motif, which indicate the positions of two ribonucleoprotein identifier sequences, are highly conserved between RRM proteins. GenBank accession numbers are in Fig. 4

Fig. 4.

Fig. 4

Phylogenetic analysis of tra-2 family members. The diagram was generated by the neighbor-joining method using the MEGA 5.1 program. Bootstrapping replications were 1000. GenBank accession numbers are in brackets

Tissue-specific expression patterns of Mntra-2a

The expression levels were analyzed in adult prawn tissues by qPCR, and the results showed that Mntra-2a mRNA was distributed in all the tissues of the prawns (Fig. 5). The expression of Mntra-2a was highest in the testis (P < 0.05), followed by the ovary (P < 0.05). In the eyestalk, heart, gill, and muscle, Mntra-2a was expressed more highly in the male than in the female. The amount of expression in the brain and hepatopancreas, however, was the opposite.

Fig. 5.

Fig. 5

The expressions of Mntra-2a revealed by qPCR in different tissues. The amount of two genes mRNA was normalized to the β-actin transcript level. Data are shown as mean ± SD (n = 5 prawns). E eyestalk, Br brain, H heart, HE hepatopancreas, G gill, M muscle, O ovary, T testis; statistical analyses were performed with one-way ANOVA analysis. Bars with different letters were considered significant at P < 0.05

Expression of the Mntra-2a gene during embryo stages

In different developmental stages, the Mntra-2a expression pattern was analyzed by qPCR (from cleavage stage to the first-day larvae after hatching) (Fig. 6). A relatively high level of Mntra-2a expression was observed in the cleavage and nauplius stages of embryos (P < 0.05).

Fig. 6.

Fig. 6

The expressions of Mntra-2a revealed by qPCR in different embryo stages. The amount of two genes mRNA was normalized to the β-actin transcript level. UE unfertilized egg, CS cleavage stage, BS blastula stage, GS gastrula stage, NS nauplius stage, ZS zoea stage, L1 the first-day larvae after hatching. Data are shown as mean ± SD (n = 5 prawns). Statistical analyses were performed with one-way ANOVA analysis. Bars with different letters were considered significant at P < 0.05

Expression of the Mntra-2a gene in different developmental stages of the ovaries

Figure 7 shows that the patterns of Mntra-2a expression in the ovary obtained using qPCR. The results confirmed a regular expression throughout ovary maturation. The Mntra-2a transcript level was high at the spent stage (stage V) and reduced to a minimum at the ripe stage (stage IV). As ovary maturation proceeded, the expression of Mntra-2a gradually decreased.

Fig. 7.

Fig. 7

Quantitative analysis of Mntra-2a transcripts using real-time PCR in different development stages of ovaries. OI undeveloped stage, OII developing stage, OIII nearly-ripe stage, OIV ripe stage, OV spent stage. Data are shown as mean ± SD (n = 5 prawns). Statistical analyses were performed with one-way ANOVA analysis. Bars with different letters were considered significant at P < 0.05

Localization of the Mntra-2a gene in the gonad

The cellular localization of the Mntra-2a was examined in different development stages of ovaries by ISH. The Mntra-2a mRNA was visualized in all the oocyte including the yolk granule, nucleus, and cytoplasmic membrane (Fig. 8b). In mature testis, the Mntra-2a mRNA was visualized in spermatogonia during spermatogenesis (Fig. 8c).

Fig. 8.

Fig. 8

Location of Mntra-2a gene was detected in the gonads by in situ hybridization. a Photograph of M. nipponense ovary in ovarian cycle. OC oocyte, N nucleus, Y yolk granule, FC follicle cell. b Histological section of ovary at different ovary stages of M. nipponense. OG oogonium, OC oocyte, N nucleus, CM cytoplasmic membrane, Y yolk granule, FC follicle cell, FM follicle membrane. c Histological section of testis of M. nipponense. CT collecting tissue, SG spermatogonium, SC spermatocyte, SC1 primary spermatocyte, SC2 second spermatocyte, ST spermatid, S sperm. Scale bars: a × 100, b × 400; c × 400

Discussion

A tra-2 gene in Macrobrachium nipponense has been studied in previous research (Zhang et al. 2013). Tra-2 is also found in other arthropod species such as D. melanogaster (Mattox et al. 1990), Bombyx mori (Niu et al. 2005), Sciara ocellaris (Martín et al. 2011), E. sinensis (Luo et al. 2017), and F. chinensis (Li et al. 2012). In this study, we identified another tra-2 gene in M. nipponense that we named Mntra-2a and performed a series of analyses such as amino acid translation, motif identification and comparison, and phylogenetic analysis to characterize the gene. Further analysis of the predicted amino acid sequence alignments showed it contained an RRM, an RRM-linker region, a poly-glycine region, and two arginine/serine-rich domains (RS/SR) (Li et al. 2012; Zhang et al. 2013; Luo et al. 2017). The RRM domain of tra-2 protein mainly used RNA junctions. The tra protein RRM is highly conserved among different species. RRM is not a characteristic domain of tra-2 protein, however, most RNA-binding proteins have this domain. Downstream of the RRM, we also discovered an RVDY domain. RVDY is mainly involved in the dephosphorylation of the tra-2 protein after binding to protein phosphatase 1. RVDF is followed by three consecutive conserved amino acids: serine/isoleucine/threonine (Dauwalder et al. 1996). The linker domain is a characteristic domain of the tra-2 protein, and the linker region shows very high amino acid sequence conservation. Through the analysis of protein sequence deletions and mutations, the integrity of the linker region is known to be critical for the tra-2 protein. Once the linker region protein sequence changes, the sex differentiation and sperm growth of the individual can be affected. This indicates that the linker domain maintains tra-2. The function of the protein is crucial and can influence the sex differentiation and function of germ cells (Martín et al. 2011). The RS domain is widely involved in protein binding and can directly combine exon splicing enhancement factors to regulate the process of downstream gene selective cleavage (Shen et al. 2004).

The amino acid sequence analysis showed the Mntra-2a has 72–97% identity to previously reported arthropods tra-2 genes. The highest similarity was compared with the tra-2 (97%) characterized by Zhang et al. (2013). We found a high degree of similarity in the RRM and RRM-linker region of M. nipponense (98.94%) (Zhang et al. 2013); F. chinensis tra-2 (89.36%) (Li et al. 2012); and E. sinensis tra-2 (79.79%) (Luo et al. 2017). In comparing the RS1 domain of the reported insect and crustacean tra-2, diversity was mainly observed (Fig. 3). The number of RS/SR repeats in the RS1 domain of other reported species is 11–18 and the number in Mntra-2a was also 11. However, in others homologs, the number of repeats in RS1 was 1, 13, and 7 in RS1 of M. nipponense (Zhang et al. 2013), P. monodon (Leelatanawit et al. 2009), and D. pulex (Colbourne et al. 2011), respectively. Furthermore, the Mntra-2a protein included a poly-glycine region (Fig. 3), which was similar in M. nipponense (Zhang et al. 2013), F. chinensis (Li et al. 2012), and E. sinensis (Luo et al. 2017).

Among the reported species, we have found that tra-2 pre-mRNA can generate multiple alternatively spliced mRNAs encoding multiple isoforms of tra-2 protein by alternative splicing pathway (Mattox et al. 1990; Niu et al. 2005; Li et al. 2012; Luo et al. 2017). Zhang et al. (2013) proposed that M. nipponense has a single tra-2 mRNA. Comparing Mntra-2a and the other tra-2 from M. nipponense (Zhang et al. 2013), we found that Mntra-2a had 90 aa more than the other tra-2 in N-terminus, and Mntra-2a has 12 aa less than the other tra-2 in C-terminus. This was the same as the results reported for various crustaceans. We expect there are more subtypes waiting to be discovered. In the phylogenetic tree, tra-2 from different subtypes of the same species shared the same branch, which indicated that the difference in the same species was small but the difference between different species was larger (Fig. 4). The result of the phylogenetic trees also confirmed this.

To characterize the expression pattern of Mntra-2a in different tissues from M. nipponense, the spatial distribution of Mntra-2a transcripts was analyzed with qPCR. We found that Mntra-2a was highly expressed in the testis and ovary which is consistent with reports on other crustaceans, such as F. chinensis (Li et al. 2012). In E. sinensis, different subtypes of Estra-2 show different expression patterns. Only Estra-2c is expressed highly in gonads. Estra-2c was expressed more highly in the ovary than in testis (Luo et al. 2017). In our research, Mntra-2 was expressed higher in the muscle than in other tissue (Zhang et al. 2013). There is a ubiquitous but differential distribution of Mntra-2a transcripts in gonad and among most of the tissues. The expression pattern of Mntra-2a suggested that it may act in a concentration-dependent manner, rather than being either present or absent. Further study was needed to examine the expression pattern of Mntra-2a in different embryo stages of M. nipponense. The Mntra-2a expression level increased rapidly at the cleavage and nauplius stages. In other words, Mntra-2a may be related to cell division of early fertilized eggs and differentiation of tissues in M. nipponense.

Although abundant Mntra-2a transcripts existed in ovaries, further studies showed that Mntra-2a might not play a role in ovary development as in other species such as E. sinensis (Luo et al. 2017), D. melanogaster (Mattox et al. 1990), and Apis mellifera (Gempe et al. 2009). Mntra-2a had the highest expression level in the final stage (stage V) but levels decreased along with ovary maturation and reached the lowest level in the ovary after oviposition (stage IV). Although the expression level of Mntra-2a in the ovary was higher, it seemed that its expression decreased with the ovary maturation processes in prawns. After completing the task in the early developmental stage in the ovary, the expression level of Mntra-2a began to decline.

Subsequently, we analyzed the histological location of the Mntra-2a in the gonad by ISH technology. The results revealed that Mntra-2a mRNA was visualized in all the oocyte include yolk granule, nucleus, and cytoplasmic membrane. We found that the Mntra-2a signal appeared only in oocyte cells but not in other cells. The signal was in the nucleus in stage I. With the development of the ovary, the signal began to distribute in various regions of the oocyte cell. The change in signal strength, however, was not the same as the real-time PCR result. We speculate that this may be related to the operation of ISH. In mature testis, the Mntra-2a mRNA signal was only visualized in spermatogonia during spermatogenesis, but no signals were observed in spermatocyte and sperm. This indicated that the Mntra-2a mainly promoted spermatogonia development, rather than other cells. This result further confirmed that Mntra-2a advanced early gonad development in M. nipponense. To the best of our knowledge, this study was the first to analyze the expression of Mntra-2a in the gonads by ISH.

In summary, we reported the cloning, sequence analysis, temporal and spatial expression, and histological location of Mntra-2a in M. nipponense. The conservation of key amino acids and motifs in the gene supported a common evolutionary origin and function. Histological localization was also studied by ISH. To understand thoroughly the function of Mntra-2a, further research on potential subtypes of Mntra-2 in M. nipponense is required.

Acknowledgements

This research was supported by grants from the Jiangsu Agricultural Industry Technology System (JFRS-02); the National Key R&D Progrom of China (2018YFD0901303); National Natural Science Foundation of China (31572617); New varieties creation Major Project in Jiangsu province (PZCZ201745); China Agriculture Research System-48 (CARS-48); Central Public-interest Scientific Institution Basal Research Fund CAFS (2017JBFZ05); and Science and Technology Development Fund of Wuxi (CLE02N1514).

Compliance with ethical standards

Conflict of interest

We declare that we do not have any commercial or associative interest that represents a conflict of interest in connection with the work submitted.

References

  1. Bai H, Qiao H, Li F, Fu H, Jiang S, Zhang W, Yan Y, Xiong Y, Sun S, Jin S, Gong Y, Wu Y. Molecular and functional characterization of the vitellogenin receptor in oriental river prawn, Macrobrachium nipponense. Comp Biochem Phys A. 2016;194:45–55. doi: 10.1016/j.cbpa.2015.12.008. [DOI] [PubMed] [Google Scholar]
  2. Bureau of Fishery (2016) Ministry of Agriculture, P.R.C. Fisheries Economic Statistics. In: China Fishery Yearbook. Beijing, China Agricultural Press, pp 236
  3. Burghardt G, Hediger M, Siegenthaler C, Moser M, Dübendorfer A, Bopp D. The transformer2 gene in Musca domestica is required for selecting and maintaining the female pathway of development. Dev Genes Evol. 2005;215(4):165–176. doi: 10.1007/s00427-004-0464-7. [DOI] [PubMed] [Google Scholar]
  4. Burtis KC, Baker BS. Drosophila doublesex gene controls somatic sexual differentiation by producing alternatively spliced mRNAs encoding related sex-specific polypeptides. Cell. 1989;56(6):997–1010. doi: 10.1016/0092-8674(89)90633-8. [DOI] [PubMed] [Google Scholar]
  5. Chen S, Fu H, Qiao H, Sun S, Zhang W, Jin S, Gong Y, Jiang S, Xiong Y, Wu Y. RNA interference studies on the sex-linked genes transformer-2and sex-lethal in the Oriental River Prawn Macrobrachium nipponense. Isr J Aquacult-Bamid. 2017;69:1374. [Google Scholar]
  6. Chung JS, Manor R, Sagi A. Cloning of an insulin-like androgenic gland factor (IAG) from the blue crab, Callinectes sapidus: implications for eyestalk regulation of IAG expression. Gen Comp Endocr. 2011;173(1):4–10. doi: 10.1016/j.ygcen.2011.04.017. [DOI] [PubMed] [Google Scholar]
  7. Colbourne JK, Pfrender ME, Gilbert D, Thomas WK, Tucker A, Oakley TH, Tokishita S, Aerts A, Arnold GJ, Basu MK, Bauer DJ. The ecoresponsive genome of Daphnia pulex. Science. 2011;331(6017):555–561. doi: 10.1126/science.1197761. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Concha C, Scott MJ. Sexual development in Lucilia cuprina (Diptera, Calliphoridae) is controlled by the transformer gene. Genetics. 2009;182(3):785–798. doi: 10.1534/genetics.109.100982. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Dauwalder B, Amaya-Manzanares F, Mattox W. A human homologue of the Drosophila sex determination factor transformer-2 has conserved splicing regulatory functions. P Natl Acad Sci. 1996;93(17):9004–9009. doi: 10.1073/pnas.93.17.9004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. De Haan W (1849) Crustacea. Fauna Japonica, sive Descriptio animalium, quae in itinere per Japoniam, jussu et auspiciis superiorum, qui summum in India Batava imperium tenent, suscepto, annis 1823-1830 collegit, notis, observationibuset adumbrationibus illustravit P.F. de Siebold. Conjunctis studiis C.J. Temminck et H. Schlegel pro Vertebratis atque W. de Haan pro Invertebratis elaborata Regis aupicus edita. I. P. F. v. Siebold. I. P. F. v. Siebold. Leiden, Lugduni-Batavorum. Decas VI: 165-196 (For dates see Sherborn and Jentink, 1895, Holthuis 1953, Holthuis and Sakai 1970)
  11. Gempe T, Hasselmann M, Schiøtt M, Hause G, Otte M, Beye M. Sex determination in honeybees: two separate mechanisms induce and maintain the female pathway. PLoS Biol. 2009;7(10):e1000222. doi: 10.1371/journal.pbio.1000222. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Geuverink E, Rensink AH, Rondeel I, Beukeboom LW, van de Zande L, Verhulst EC. Maternal provision of transformer-2 is required for female development and embryo viability in the wasp Nasonia vitripennis. Insect Biochem Molec. 2017;90:23–33. doi: 10.1016/j.ibmb.2017.09.007. [DOI] [PubMed] [Google Scholar]
  13. Gu X, Fu H, Sun S, Qiao H, Zhang W, Jiang S, Xiong Y, Jin S, Sun S, Gong Y, Wu Y. Dietary cholesterol-induced transcriptome differences in the intestine, hepatopancreas, and muscle of Oriental River prawn Macrobrachium nipponense. Comp Biochem Phys D. 2017;23:39–48. doi: 10.1016/j.cbd.2017.06.001. [DOI] [PubMed] [Google Scholar]
  14. Guo Q, Li S, Lv X, Xiang J, Sagi A, Manor R, Li F. A putative insulin-like androgenic gland hormone receptor gene specifically expressed in male Chinese shrimp. Endocrinology. 2018;159(5):2173–2185. doi: 10.1210/en.2017-03253. [DOI] [PubMed] [Google Scholar]
  15. Hediger M, Henggeler C, Meier N, Perez R, Saccone G, Bopp D. Molecular characterization of the key switch f provides a basis for understanding the rapid divergence of the sex-determining pathway in the housefly. Genetics. 2010;184(1):155–170. doi: 10.1534/genetics.109.109249. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Kim BM, Jeong CB, Kim IC, Yim JH, Lee YS, Rhee JS, Lee JS. Identification of three doublesex genes in the monogonont rotifer Brachionus koreanus and their transcriptional responses to environmental stressor-triggered population growth retardation. Comp Biochem Phys B. 2014;174:36–44. doi: 10.1016/j.cbpb.2014.05.003. [DOI] [PubMed] [Google Scholar]
  17. Leelatanawit R, Sittikankeaw K, Yocawibun P, Klinbunga S, Roytrakul S, Aoki T, Hirono I, Menasveta P. Identification, characterization and expression of sex-related genes in testes of the giant tiger shrimp Penaeus monodon. Comp Biochem Phys A. 2009;152(1):66–76. doi: 10.1016/j.cbpa.2008.09.004. [DOI] [PubMed] [Google Scholar]
  18. Li S, Li F, Wen R, Xiang J. Identification and characterization of the sex-determiner transformer-2 homologue in Chinese shrimp. Fenneropenaeus chinensis. Sex Dev. 2012;6(5):267–278. doi: 10.1159/000341377. [DOI] [PubMed] [Google Scholar]
  19. Li F, Qiao H, Fu H, Sun S, Zhang W, Jin S, Jiang S, Xiong Y, Gong Y, Wu Y, Hu Y, Shan D. Identification and characterization of opsin gene and its role in ovarian maturation in the oriental river prawn Macrobrachium nipponense. Comp Biochem Phys B. 2018;218:1–12. doi: 10.1016/j.cbpb.2017.12.016. [DOI] [PubMed] [Google Scholar]
  20. Liu G, Wu Q, Li J, Zhang G, Wan F. RNAi-mediated knock-down of transformer and transformer 2 to generate male-only progeny in the oriental fruit fly, Bactrocera dorsalis (Hendel) PLoS One. 2015;10(6):e0128892. doi: 10.1371/journal.pone.0128892. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods. 2001;25(4):402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  22. Luo D, Liu Y, Hui M, Song C, Liu H, Cui Z. Molecular characterization and expression profiles of four transformer-2 isoforms in the Chinese mitten crab Eriocheir sinensis. Chin J Oceanol Limnol. 2017;35(4):782–791. doi: 10.1007/s00343-017-6071-z. [DOI] [Google Scholar]
  23. Ma K, Lin J, Guo S, Chen Y, Li J, Qiu F. Molecular characterization and expression analysis of an insulin-like gene from the androgenic gland of the oriental river prawn, Macrobrachium nipponense. Gen Comp Endocr. 2013;185:90–96. doi: 10.1016/j.ygcen.2013.01.018. [DOI] [PubMed] [Google Scholar]
  24. Martín I, Ruiz MF, Sánchez L. The gene transformer-2 of Sciara (Diptera, Nematocera) and its effect on Drosophila Sex Dev. BMC Dev Biol. 2011;11(1):19. doi: 10.1186/1471-213X-11-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Mattox W, Palmer MJ, Baker BS. Alternative splicing of the sex determination gene transformer-2 is sex-specific in the germ line but not in the soma. Gene Dev. 1990;4(5):789–805. doi: 10.1101/gad.4.5.789. [DOI] [PubMed] [Google Scholar]
  26. Nissen I, Müller M, Beye M. The Am-tra2 gene is an essential regulator of female splice regulation at two levels of the sex determination hierarchy of the honeybee. Genetics. 2012;192(3):1015–1026. doi: 10.1534/genetics.112.143925. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Niu B, Meng Z, Tao Y, Lu S, Weng H, He L, Shen W. Cloning and alternative splicing analysis of Bombyx mori transformer-2 gene using silkworm EST database. Acta Bioch Bioph Sin. 2005;37(11):728–736. doi: 10.1111/j.1745-7270.2005.00106.x. [DOI] [PubMed] [Google Scholar]
  28. Qiao H, Xiong Y, Zhang W, Fu H, Jiang S, Sun S, Bai H, Jin S, Gong Y. Characterization, expression, and function analysis of gonad-inhibiting hormone in Oriental River prawn, Macrobrachium nipponense and its induced expression by temperature. Comp Biochem Phys A. 2015;185:1–8. doi: 10.1016/j.cbpa.2015.03.005. [DOI] [PubMed] [Google Scholar]
  29. Qiao H, Fu H, Xiong Y, Jiang S, Sun S, Jin S, Gong Y, Wang Y, Shan D, Li F, Wu Y. Molecular insights into reproduction regulation of female Oriental River prawns Macrobrachium nipponense through comparative transcriptomic analysis. Sci Rep. 2017;7(1):12161. doi: 10.1038/s41598-017-10439-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Salvemini M, Robertson M, Aronson B, Atkinson P, Polito LC, Saccone G. Ceratitis capitata transformer-2 gene is required to establish and maintain the autoregulation of Cctra, the master gene for female sex determination. Int J Dev Biol. 2003;53(1):109–120. doi: 10.1387/ijdb.082681ms. [DOI] [PubMed] [Google Scholar]
  31. Sarno F, Ruiz MF, Eirín-López JM, Perondini AL, Selivon D, Sánchez L. The gene transformer-2 of Anastrepha fruit flies (Diptera, Tephritidae) and its evolution in insects. BMC Evol Biol. 2010;10(1):140. doi: 10.1186/1471-2148-10-140. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Schetelig MF, Milano A, Saccone G, Handler AM. Male only progeny in Anastrepha suspensa by RNAi-induced sex reversion of chromosomal females. Insect Biochem Molec. 2012;42(1):51–57. doi: 10.1016/j.ibmb.2011.10.007. [DOI] [PubMed] [Google Scholar]
  33. Shen H, Kan JL, Green MR. Arginine-serine-rich domains bound at splicing enhancers contact the branchpoint to promote prespliceosome assembly. Mol Cell. 2004;13(3):367–376. doi: 10.1016/S1097-2765(04)00025-5. [DOI] [PubMed] [Google Scholar]
  34. Shukla JN, Palli SR. Tribolium castaneum transformer-2 regulates sex determination and development in both males and females. Insect Biochem Molec. 2013;43(12):1125–1132. doi: 10.1016/j.ibmb.2013.08.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Sievert V, Kuhn S, Traut W. Expression of the sex determining cascade genes Sex-lethal and doublesex in the phorid fly Megaselia scalaris. Genome. 1997;40(2):211–214. doi: 10.1139/g97-030. [DOI] [PubMed] [Google Scholar]
  36. Vega-Alpízar JL, Alfaro-Montoya J, Hernández-Noguera L, Umaña-Castro R, Aflalo ED, Sagi A. Implant recognition and gender expression following ampoule-androgenic gland implantation in Litopenaeus vannamei females (Penaeidae) Aquaculture. 2017;468:471–480. doi: 10.1016/j.aquaculture.2016.11.007. [DOI] [Google Scholar]
  37. Ventura T, Manor R, Aflalo ED, Weil S, Raviv S, Glazer L, Sagi A. Temporal silencing of an androgenic gland-specific insulin-like gene affecting phenotypical gender differences and spermatogenesis. Endocrinology. 2008;150(3):1278–1286. doi: 10.1210/en.2008-0906. [DOI] [PubMed] [Google Scholar]
  38. Wilkins AS. Moving up the hierarchy: a hypothesis on the evolution of a genetic sex determination pathway. BioEssays. 1995;17(1):71–77. doi: 10.1002/bies.950170113. [DOI] [PubMed] [Google Scholar]
  39. Zhang EF, Qiu GF. A novel Dmrt gene is specifically expressed in the testis of Chinese mitten crab, Eriocheir sinensis. Dev Genes Evol. 2010;220(5–6):151–159. doi: 10.1007/s00427-010-0336-2. [DOI] [PubMed] [Google Scholar]
  40. Zhang Y, Fu H, Qiao H, Jin S, Jiang S, Xiong Y, Gong Y, Zhang X. Molecular cloning and expression analysis of transformer-2 gene during development in Macrobrachium nipponense (de Haan 1849) J World Aquacult Soc. 2013;44(3):338–349. doi: 10.1111/jwas.12039. [DOI] [Google Scholar]

Articles from 3 Biotech are provided here courtesy of Springer

RESOURCES