Identification and phylogenetic analysis of clade C Avipoxvirus in a fowlpox outbreak in exotic psittacines in southern Brazil

Abstract

Fowlpox is one of the oldest diseases reported in birds. The causative genus Avipoxvirus affects ~232 domestic and wild species. We present herein the history, clinical findings, and macroscopic and histologic lesions caused by a clade C poxvirus in an exotic psittacine breeding colony in southern Brazil. Clinical signs included yellow nodular lesions at the commissure of the beak and on the periocular skin, loss of appetite, and death. Fifty birds were autopsied, and fragments of periocular skin, tongue, and trachea were examined histologically, which revealed hyperkeratosis associated with eosinophilic intracytoplasmic inclusion bodies. Tracheal fragments and periocular skin were subjected to nested PCR and phylogenetic analyses. The sequenced strain showed 99.58% identity with the nucleotide sequences of Avipoxvirus strains AY53011, KC018069, AM050383, and AM05382 isolated from birds in Germany, United States, and United Kingdom. The strain was grouped under clade C, which represents isolates exclusively from the Psittacidae family. The infection caused by clade C Avipoxvirus in the exotic psittacines examined (Platycercus sp. and Psephotus haematonotus) demonstrates the circulation of this clade in this breeding colony.

Fowlpox may occur in cutaneous or diphtheritic (septicemic) forms, depending on viral virulence and host susceptibility. The cutaneous form is most frequently observed in psittacines; nodular proliferative skin lesions evolve from papules to become vesicles, pustules, and crusts, and are usually observed in regions of the body without feathers.⁴ Large nodules may obstruct eyesight or the opening of the beak, interfering with the bird’s ability to eat and drink. In the diphtheritic form, yellow lesions in the mucous membranes of the mouth, esophagus, or trachea may result in dyspnea, anorexia, and nasal and/or ocular discharge,⁴ and interfere with food and water intake as well as with breathing.^6,17

Species Fowlpox virus is a member of family Poxviridae, subfamily Chordopoxvirinae, and is the type species of genus Avipoxvirus.¹⁷ The exact number of existing species, strains, or variants is undefined.⁸ Some avipoxviruses (APVs) exhibit cross-reactive serogroups; the genome sequences of only 2 isolates—from chickens and canaries—are available, to date.^1,3 In addition, new isolates continue to be discovered in a wide variety of avian species, such as hummingbirds (Calypte anna) and dunnocks (Prunella modularis).^8,14

All poxviruses have similar morphology; mature structures are usually oval, large, and enveloped.^3,17 The viral nucleic acid is composed of a linear double-stranded DNA molecule of 260–365 kb, with a low content of guanine and cytosine residues.^1,20 APV is resistant in the environment, surviving in dry crusts of infected birds for long periods. Susceptible birds can be infected through skin trauma or by inhaling the virus present in feathers and crusts.¹⁷ Infections caused by APVs occur mainly during the hottest months of the year, coinciding with the greatest number of arthropod vectors, such as mosquitoes, which are considered the main transmitters of the virus.⁴

Order Psittaciformes is one of the main groups affected by APVs.³ Most wild birds infected with APVs are moderately affected, and rarely succumb to the infection.¹⁷ However, mortality rates may be high when oral and respiratory mucous membranes are affected.⁷ During outbreaks of the disease, 80–100% mortality rates were observed in an infected canary flock.¹⁷ Cases in wild birds are probably underestimated because of inherent difficulties in observing them.⁷

Regardless of host and strain diversity, lesions associated with the virus are the same in domestic and wild birds, although clinical signs vary according to host susceptibility, agent virulence, and type of lesions.^17,20 Birds of all ages and of both sexes can be infected by poxviruses.¹⁷ Most studies that have evaluated the pathogenicity of APVs in the past 20 y are based on single isolates from chickens, which makes it difficult to predict the behavior of different strains in other avian species.²⁰

A poxviral outbreak occurred in an ornamental bird breeding program located in the central region of Rio Grande do Sul, in southern Brazil, in 2016–2017. Psittacines were housed in double-breeder cages during the reproductive period. Commercial feed suitable for the period was provided once per day, as well as a seed mix containing millet (Panicum miliaceum) and birdseed (annual canarygrass, Phalaris canariensis). Water was available ad libitum.

From September 2016 to January 2017, high mortality rates were observed in both male and female psittacines; young birds up to 90-d-old were primarily affected. The affected birds became lethargic, had bristly feathers, and were dyspneic. Moreover, one or both eyes were swollen, with nodular lesions on the periocular skin and on the commissure of the beak. They became anorexic, and succumbed at intervals of 1–3 d. The mortalities first occurred in the external area of the breeding complex, where there is grass, trees, and free-ranging birds. Later, birds from the inner area also began to show clinical signs. Australian species, such as Platycercus sp. and Psephotus haematonotus, were the most affected. All cases occurred during the warmest months, coinciding with a higher mosquito population.

Fifty deceased psittacines were sent to the Central Laboratory of Diagnosis of Avian Pathology (LCDPA/UFSM) and to the Laboratory of Veterinary Pathology (LPV/UFSM) of the Federal University of Santa Maria in partnership with the Center for Diagnosis and Research in Avian Pathology of the Federal University of Rio Grande do Sul (CDPA/UFRGS). External examination revealed that most of the birds had yellow, dry nodular masses in the periocular region, at the commissure of the beak, and on the tongue, consistent with the cutaneous form of fowlpox.

The diphtheritic form of fowlpox was also observed, characterized by caseous masses obstructing the trachea (Fig. 1). The crop, proventriculus, and ventriculus were empty in these cases. Autopsied birds were generally of poor nutritional status.

Figure 1.

Caseous mass (arrow) obstructing the trachea in the diphtheritic form of fowlpox.

The presence of macroscopic lesions is usually sufficient to confirm APV infection.¹⁷ However, similar skin lesions may occur in other conditions, such as papillomavirus infections, mite infestations, and mycotoxicoses.^17,20 Thus, histologic examinations, together with PCR, were performed to confirm the diagnosis.

Tissue fragments from periocular skin, tongue, and trachea were fixed in 10% formalin and processed routinely. Histologically, diffuse and marked hyperkeratosis was observed in the tongue, with vacuolar degeneration associated with large Bollinger bodies. Lymphoplasmacytic infiltrates were observed in the lamina propria around blood vessels, associated with intralesional intracytoplasmic eosinophilic inclusion bodies (Fig. 2). Similar lesions were observed in nodules of the commissure of the beak and periocular skin. The histologic diagnosis of fowlpox in the cutaneous and diphtheritic forms was based on the presence of typical large, intracytoplasmic, eosinophilic APV inclusion bodies.^4,6

Figure 2.

Hyperplastic epithelium in a psittacine tongue, with eosinophilic intracytoplasmic inclusion (Bollinger) bodies (arrows). H&E. Bar = 20 μm.

Tracheal tissue and skin from the periocular region were collected for PCR analysis. DNA extraction was carried out using 25 mg of the skin, trachea, and pulmonary lesions from 10 birds showing clinical signs; tissues were digested with proteinase K at 56°C for 1 h.¹⁵ After precipitation with sodium acetate and isopropanol, the pellet was suspended in 20 μL of ultrapure water. The extracted DNA was stored at −20°C until PCR analysis. To increase the sensitivity and specificity of detection, a nested PCR (nPCR) reaction was performed.

The first reaction amplified a 578-bp fragment of the 4b gene, and the second reaction allowed specific type differentiation using the products of the first PCR as template. The expected product of the second reaction was 419 bp. Gene 4b, which is 1,971 nucleotides long, encodes a protein of 75,200 Da.² Sequences upstream of the fowlpox virus 4b gene correspond to the consensus sequence determined for vaccinia late promoters, suggesting that late promoter signals may be shared by different genera of poxviruses.² The highly conserved 4b core protein gene was used as the sole pan-genus marker both in testing and phylogeography.^13,14

Reactions were composed of 2.5 μL of 10× PCR Rxn buffer (Invitrogen, Carlsbad, CA), 2.5 mM of each dNTP (Ludwig Biotec, Alvorada, RS, Brazil), 0.2 μM of each primer (Invitrogen), 2 U GoTaq hot start polymerase (Promega, Madison, WI), 2.5 mM MgCl₂ (Promega), and 2 μL (50 ng/µL) of DNA. Primer sequences and thermocycling conditions are noted in Table 1.

Table 1.

Sequence of selected primers, size of amplicons, and thermocycling conditions for a nested PCR assay (reactions 1 and 2).

Reaction	Primer sequence (5’–3’)	Primer reference	Amplicon (bp)	No. of cycles	Thermocycling conditions
1	CAGCAGGTGCTAAACAACAA CGGTAGCTTAACGCCGAATA	2	578	35	94°C, 30 s
					52°C, 60 s
					72°C, 60 s
2	ACGACCTATGCGTCTTC ACGCTTGATATCTGGATG	5	419	35	94°C, 30 s
					60°C, 60 s
					72°C, 60 s

Amplification reactions were performed (Swift MaxPro thermal cycler, ESCO Technologies, Hatboro, PA), and electrophoresis of the amplified products was performed on 1.2% agarose gel stained with ethidium bromide. Amplified products were visualized with an ultraviolet light transilluminator (MacroVue, Pharmacia-LKB, Uppsala, Sweden). Two strains of commercial chickenpox virus vaccines and trachea fragments of specific pathogen–free (SPF) chickens were used, respectively, as positive and negative controls for the reactions. A mixture of all constituents of the PCR reaction mix, without the addition of extracted DNA, was used as the PCR control. All trachea and skin fragment samples from the periocular region selected for nPCR were positive (Fig. 3). Detection of nucleic acids increased the sensitivity and specificity of detection of viral pathogens, including the poxvirus, when compared with conventional laboratory techniques.²⁰ The use of nPCR resulted in the detection of <1 infectious unit, and it increased the specificity of the technique through the use of internal primers.⁵

Figure 3.

Agarose gel (1.2%) stained with ethidium bromide, with amplification products compatible with the 4b gene: the upper band of 578 bp corresponds to amplicon obtained with reaction 1, and the lower band of ~419 bp corresponds to amplicon obtained with reaction 2. MW = molecular weight marker (100-bp DNA ladder); lanes 01–03: psittacine tracheal samples; lanes 04–06: psittacine skin fragment samples; lanes 07–10: fowlpox vaccines; lane 11: negative control. The arrow indicates a 500-bp marker.

Samples that were positive in nPCR were selected for sequencing by the Sanger method for determination of the forward and reverse sequences of the amplicon. Each sample was sequenced in triplicate. Initially, the amplicons were purified (QIAquick PCR purification kit, QiAGEN, Hilden, Germany). The DNA was then subjected to electrophoresis on 2% agarose gel, stained with ethidium bromide, and quantified (Low DNA mass ladder, Invitrogen). Subsequently, 50 ng of template DNA, 4.5 pmol of the specific oligonucleotide, and ultrapure water was added to a 0.5-mL microcentrifuge tube to achieve a final volume of 6 μL. The samples were sequenced (PRISM 3100 genetic analyzer, Applied Biosystems, Norwalk, CT) and assembled with 50-cm capillaries and POP6 polymer (Applied Biosystems). DNA templates (50 ng) were labeled using 2.5 pmol of the forward primer or 2.5 pmol of the reverse primer, and 3 μL of BigDye Terminator v3.1 cycle sequencing RR-100 (Applied Biosystems), to achieve a final volume of 10 μL.

Sequence quality was analyzed based on the electropherograms generated, and the contigs were built (DNASTAR Lasergene SeqMan Pro, http://www.dnastar.com/t-seqmanpro.aspx). Multiple alignments of the data were performed using the ClustalW method, with sequences from different strains available from GenBank (http://www.ncbi.nlm.nih.gov/genbank). The evolutionary history was inferred by using the maximum likelihood method. The model Tamura 3-parameter¹⁶ was selected for testing the different models for the dataset. The initial tree(s) for the heuristic search was obtained automatically by applying neighbor-join and BioNJ algorithms to a matrix of pairwise distances that were estimated using the maximum composite likelihood approach, and then selecting the topology with upper log-likelihood value. A discrete gamma distribution was used to model differences in evolutionary rates among sites (5 categories [+ G, parameter = 0.4504]). The analysis involved 231 nucleotide sequences. Codon positions included were 1st + 2nd + 3rd + noncoding. All positions containing gaps and missing data were eliminated. There were 460 positions in the final dataset. Evolutionary analyses were conducted (Molecular Evolutionary Genetics Analysis v.7).¹¹ The nucleotide sequences of sequences 1–4 were submitted to GenBank (accessions MG601779–MG601782).

The avian isolates from the clinical case skin fragments (sequence 1) and tracheal fragments (sequence 2) were clustered in clade C, as previously described (Fig. 4). Vaccine samples (sequences 3 and 4) were clustered in clade A, as expected.⁸

Figure 4.

Maximum likelihood phylogeny generated from the 4b core protein sequences from GenBank. Avipoxvirus clades A–C, subclades, and clusters, are labeled according to the nomenclature described previously.^9,10 The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. Confidence was measured using the bootstrap method inferred from 1,000 replicates. Similar sequences were condensed in cluster A and cluster B.

The PCR amplicon sequencing process allows for a rapid search for homologous sequences to identify the virus and to evaluate the phylogenetic relationships between host specificity and virulence of the isolate.²⁰ However, the phylogenetic study of APVs is still limited.^8,20 This lack of information is likely the result of the difficulty in identifying genus markers or species-specific primers that can be used to amplify different genes.²⁰ Only 2 complete genomes of chicken (AF198100) and canary (AY318871) strains have been sequenced,^1,18 representing only 70% of sequence identity.⁸

The locus commonly selected for detection through PCR¹³ and for analysis of the genetic relationship of APV¹⁴ is the region of the genome that encodes the 4b virion core protein. Other core genes may also be combined to provide a more robust phylogenetic analysis for APV classification.⁸

Phylogenetic studies based on this locus indicate that most of the isolates analyzed to date are clustered closely with previously sequenced strains of chicken in clade A or canary in clade B.¹⁹ However, some isolates may be located in a third group of psittacids in clade C.^8,9 Phylogenetic characterization of APV from turkeys in Brazil was achieved in 2016.¹² The isolates were classified in subclass 1 of clade A, which comprises strains from galliform birds, with a wide geographic distribution. Clade C consists exclusively of isolates from psittacids. It is still unclear whether this clade is considered a separate group or if it is remotely related to clade B.⁸

Sequenced samples showed 99.58% identity with nucleotide sequences of strains AY53011, KC018069, AM050383, and AM05382, available in GenBank. These strains were isolated from Agapornis spp. in Germany, Amazona ochrocephala in the United States, and Amazona spp. and parrots in the United Kingdom, respectively.^8,9 Small differences among the sequences recovered in our clinical cases, and those isolated in Europe and in the United States, may be related to the high conservation of APV DNA.¹² In addition, extensive adaptation to different species in distinct geographic regions highlights the potential results of anthropogenic action that allows unnatural contact between species, both in zoos and in the wild.⁸

Circulation of APVs among closely related hosts and breeders with different bird species, as described in our cases, provide a natural interface for viral exchange and coinfection.⁸ Thus, birds can be carriers of the virus among local populations and among migratory routes used by different species.⁷ The increased number of serious cases observed, in addition to the involvement of a new bird species, suggests that fowlpox is an emerging viral disease in southern Brazil.