Abstract
A real-time PCR assay for the leukotoxin gene of Bibersteinia trehalosi was developed and validated to better identify this pathogen, which is a cause of respiratory disease in bighorn sheep. The specificity of the PCR primers was evaluated with DNA from 59 known isolates of the Pasteurellaceae family. For validation, 162 field samples were compared using both the new assay and an indirect method using 2 sets of published protocols. The real-time PCR assay was found to be specific for the leukotoxin gene of B. trehalosi and provides a rapid and direct approach for detecting leukotoxin-producing forms of this organism from samples containing mixed species of leukotoxin-positive Pasteurellaceae.
Keywords: Bibersteinia trehalosi, bighorn sheep, leukotoxin, Ovis canadensis, PCR
The decline of bighorn sheep (Ovis canadensis) populations in North America has prompted intensive study of the bacterial pathogens known to cause respiratory disease in this species. Difficulty in detecting and differentiating pathogenic from nonpathogenic bacteria remains a significant limitation to understanding this polymicrobial disease complex.1 Leukotoxin is the primary virulence factor of Mannheimia haemolytica and Bibersteinia trehalosi.2,3 Over 85% of B. trehalosi isolates obtained from bighorn sheep do not produce leukotoxin and are considered normal flora of the respiratory tract.12,13 However, leukotoxin-producing B. trehalosi has been documented as a significant cause of respiratory disease in bighorn sheep.6,14,15 Beta-hemolysis on blood agar is associated with the presence of the leukotoxin gene, but is not conclusive.5
There are several published primer sets to detect the leukotoxin gene in Pasteurella species,4,5,7,11 although none is specific for B. trehalosi leukotoxin. An indirect PCR approach for detection of leukotoxigenic B. trehalosi has been developed using 2 published primer sets: one to detect the leukotoxin gene of both Mannheimia spp. and Bibersteinia spp. (lktA9 and lktA7; Table 1),4 and a second primer set specific to the leukotoxin gene of the Mannheimia genus (lktA set-1; Table 1).11 Using these 2 PCR assays in conjunction can indirectly identify the leukotoxin of B. trehalosi (lktA9-7 positive/ lktA set-1 negative). However, if both primer sets amplify a product, it is not possible to rule out the presence of Bibersteinia leukotoxin in a sample of mixed bacterial species. A PCR assay specific for the leukotoxin gene of B. trehalosi is necessary for faster and more accurate identification of this pathogen.
Table 1.
Primer sequences used for the development and validation of a real-time PCR for the leukotoxin gene (lktA) of Bibersteinia trehalosi.
| Target organism/Target gene | Primer or probe | Sequence (5′–3′) | Size (bp) | Reference |
|---|---|---|---|---|
| B. trehalosi | ||||
| lktA | LKTBt1-F | AGAGGCGAGCGTACTTGTTC | 318 | Current study |
| LKTBt1-R | ATAGACTCCTCAAGTGGGCTGA | |||
| LKTBt1-probe (6FAM/BHQ1) | ACTTTAATCACTACCTCTTGTCCAGCGG | |||
| Bibersteinia and Mannheimia genera | ||||
| lktA | lktA9 | TCAAGAAGAGCTGGCAAC | 3,058 | 4 |
| lktA7 | AGTGAGGGCAACTAAACC | |||
| Mannheimia genus | ||||
| lktA | lktA set-1 F | CTTACATTTTAGCCCAACGTG | 497 | 11 |
| lktA set-1 R | TAAATTCGCAAGATAACGGG | |||
For primer selection, the leukotoxin gene sequences of B. trehalosi, M. haemolytica, and Mannheimia glucosida (GenBank accessions AF314523.2, AF314515.2, and AF314522.2, respectively) were aligned using MAFFT and Mview (ELMB-European Bioinformatics Institute, Hinxton, United Kingdom). Primers were chosen in variable regions of the Pasteurellaceae leukotoxin gene that maintained consensus for B. trehalosi strains. The resulting primers (LKTBt1; Table 1) were expected to amplify a 318-bp fragment of the lktA gene of B. trehalosi. A probe (LKTBt1-probe) was designed using PrimerQuest (Integrated DNA Technologies, Coralville, IA) with 6-carboxyfluorescein as a reporter dye and black hole quencher-1 as a quencher.
The LKTBt1 primers and probe (Eurofins WMG Operon, Huntsville, AL) were optimized for annealing temperature and concentration using DNA from leukotoxin-positive B. trehalosi strain ATCC 29703 (American Type Culture Collection, Manassas, VA). This isolate also served as an internal positive control for subsequent reactions. DNA from a leukotoxin-negative Bibersteinia isolate (GenBank accession KC542341.1) provided a negative control. The final reaction volume of 25 µL contained 12.5 µL of iTaq universal probes supermix (Bio-Rad, Hercules, CA), 75 nM of each primer, 75 nM of probe, and 10 ng of genomic DNA. Genomic DNA was quantified (NanoDrop 2000 spectrophotometer, NanoDrop products, Wilmington, DE). A CFX96 Touch real-time PCR detection system and CFX Manager software (Bio-Rad) were used to perform each assay. Cycling conditions consisted of initial denaturation at 95°C for 2 min, and 40 cycles of 95°C for 10 s, 58.7°C for 30 s. The assay has a run time of 1 h and 1 min and, as used in our study, has the capacity for 96 samples to be tested on a plate at an average cost of US$3.50 per sample. Quantification cycles (Cqs) for each sample were determined using a single threshold line automatically as defined by the software. Placement of the threshold line was above baseline fluorescence and in the log-linear portion of the amplification curve.
A reference standard curve was constructed using purified leukotoxin-positive B. trehalosi (ATCC 29703) DNA to determine the efficiency and detection limit of the assay. The amount of genomic DNA in a stock solution was calculated based on the size of the B. trehalosi genome being 2.34 × 106 bp8 and the average molar mass per base pair being 650 (g/mol)/bp. A 10-fold dilution series of DNA from 2 × 106 to 2 × 10−1 genome copies per reaction was prepared, and 6 replicates of each concentration were tested to plot a standard curve. The efficiency was calculated to be 92.5%, and the limit of detection, in which all 6 replicates had a positive amplification curve, was 20 copies of the genome with a Cq mean of 38.96 (SD 0.395) at that level. This is a late Cq, and false-positives could potentially occur when testing mixed bacterial samples. A Cq >35 should be considered as suspect or indeterminate and retested as needed to determine clinical relevance. A Cq of 35 was used as a cutoff for all specificity and validation testing.
The specificity of the PCR primers was evaluated using DNA from 59 known isolates that consisted of M. haemolytica (n = 8), M. glucosida (n = 18), Mannheimia ruminalis (n = 8), and B. trehalosi (n = 25) previously characterized by BOX-PCR10 and 16S rRNA sequencing (n = 33)9 or by 16S rRNA PCR and subsequent amplicon sequencing (n = 26). Each species included one or more strains from the NCBI nucleotide database PopSet 459931240. To confirm amplification of B. trehalosi leukotoxin by the LKTBt1 primers, PCR amplicons were sequenced (Genewiz, South Plainfield, NJ) from 3 positive isolates. NCBI BLAST was used to compare product and target gene sequences, and each product shared ≥98% homology. Fourteen of 25 known B. trehalosi isolates (based on 16S rRNA sequences) were positive for leukotoxin by PCR using both the direct BtLKT1 primer assay and the indirect method lktA9-7/lktA set-1 (Table 2). The 34 known M. haemolytica, M. glucosida, and M. ruminalis isolates tested negative using BtLKT1 primers and positive using lktA9-7 and lktA set-1 primers (Table 2).
Table 2.
Summary of PCR results for Pasteurellaceae isolates used for specificity testing of the assay for the leukotoxin gene of Bibersteinia trehalosi.
| 16S rRNA sequenced isolate | n | LKTBt1+ | lktA9-7+/lktA set-1– | lktA9-7+/lktA set-1+ |
|---|---|---|---|---|
| Bibersteinia trehalosi | 25 | 14 | 14 | 0 |
| Mannheimia haemolytica | 8 | 0 | 0 | 8 |
| Mannheimia glucosida | 18 | 0 | 0 | 18 |
| Mannheimia ruminalis | 8 | 0 | 0 | 8 |
LKTBt1 = the new assay specific for the leukotoxin gene of B. trehalosi; lktA9-7 = assay that detects leukotoxin gene in all Mannheimia and Bibersteinia isolates; lktA set-1 = assay that specifically detects the leukotoxin gene of Mannheimia spp.
For validation of the direct PCR assay (LKTBt1 primers) as an improved method for detection of leukotoxigenic B. trehalosi, results from this assay were compared side by side with the indirect PCR assay (lktA9-7/lktA set-1 primers). Samples used for method comparison included bighorn sheep tonsillar swabs (n = 144) from wild and captive populations in Wyoming and tissue (lung, liver, or spleen; n = 21) from captive research sheep that had died of respiratory disease.15 Tonsil swabs were inoculated on one quarter of a Columbia blood agar (CBA) plate with 5% sheep blood (Hardy Diagnostic, Santa Maria, CA). Tissues were aseptically removed from sterile Whirl-Pak bags (Nasco, Fort Atkinson, WI), cut to expose an interior area of tissue, and plated over half of a CBA plate. All plates were streaked for isolation and incubated at 37°C in 10% CO2. After 48 h, all bacterial growth on the plate was collected as a plate wash with a sterile polyester swab (Thermo Fisher Scientific, Waltham, MA), placed into 15-mL Falcon tubes (Corning, Corning, NY) filled with sterile phosphate-buffered saline (Becton Dickinson, Franklin Lakes, NJ), and vortexed to suspend bacteria. A 250-µL aliquot of this plate wash was pipetted into a PCR tube (Eppendorf, Hamburg, Germany) for DNA extraction. DNA was extracted (E.Z.N.A. tissue DNA kit, Omega Bio-Tek, Norcross, GA) using the manufacturer’s cultured cells extraction protocol. Extracted DNA was tested using both direct and indirect protocols, and results were compared.
During the comparison study, 3 plate wash samples (2 autopsy tissues and 1 tonsillar swab) were negative with LKTBt1 and lktA set-1, but showed nonspecific banding and a faint band of ~3,000-bp DNA using lktA9-7 primers. For these samples, the ~3,000-bp band of the lktA9-7 PCR product was concentrated and purified (Purelink PCR purification kit, Life Technologies, Carlsbad, CA) for sequencing. However, no priming was achieved with either forward (lktA9) or reverse (lktA7) primers using multiple sequencing protocols. The traces obtained were between 590 bp and 765 bp and did not match any Pasteurellaceae leukotoxin or any known sequence of bacteria in GenBank. The faint and nonspecific banding in these samples may have been artifact of environmental contamination or DNA degradation that altered the specificity of the lktA9-7 primers. These samples were excluded.
Eighty-six of 162 plate wash samples were classified as positive (n = 39) or negative (n = 47) for the B. trehalosi leukotoxin gene by direct PCR and the indirect PCR assay (Table 3). Sequencing was done for PCR products from 5 paired samples. All of the sequenced products matched the leukotoxin gene of B. trehalosi (≥97% homology) using NCBI BLAST.
Table 3.
Results of the direct Bibersteinia trehalosi leukotoxin gene PCR (using LKTBt1 primers) compared to the indirect PCR assay (using primer set lktA9-7, which detects the leukotoxin gene in Mannheimia and Bibersteinia, and lktA set-1, which detects the leukotoxin gene of Mannheimia spp.). Samples used for the work were plate washes of mixed bacterial growth from tonsillar swabs or tissues.
| Result of LKBt1 PCR | Indirect PCR results |
||
|---|---|---|---|
| Positive | Negative | Inconclusive | |
| Positive | 39 | 0 | 33 |
| Negative | 0 | 47 | 43 |
Positive = lktA9-7 positive/lktA set-1 negative, an indirect way to determine the presence of Bibersteinia leukotoxin; negative = lktA9-7 negative/lktA set-1 negative; inconclusive = lktA9-7 positive/lktA set-1 positive, not possible to rule out the presence of Bibersteinia.
Seventy-six of 162 plate wash samples had inconclusive results for B. trehalosi leukotoxin using the indirect PCR method, with amplification by both primer sets indicating the presence of leukotoxigenic Mannheimia species. Using the direct PCR method, leukotoxin-positive B. trehalosi was detected in 33 of these 76 samples (Table 3), demonstrating the utility of this assay as a direct approach to detect leukotoxigenic B. trehalosi from a sample containing mixed species of leukotoxin-positive Pasteurellaceae. This real-time PCR assay is specific for the leukotoxin gene of B. trehalosi and provides a streamlined molecular approach to detect pathogenic strains of the organism.
Acknowledgments
We thank Mike Miller and Lisa Wolfe with the Colorado Division of Parks and Wildlife for isolates used for testing the specificity of the assay, technical advice, and editing assistance.
Footnotes
Declaration of conflicting interests: The authors declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.
Funding: The work has been supported by the Wyoming Game and Fish Department, the Wyoming State Veterinary Laboratory at the University of Wyoming, and the Colorado Division of Parks and Wildlife.
References
- 1. Besser TE, et al. Causes of pneumonia epizootics among bighorn sheep, Western United States, 2008–2010. Emerg Infect Dis 2012;18:406–414. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Dassanayake RP, et al. Mannheimia haemolytica serotype A1 exhibits differential pathogenicity in two related species, Ovis canadensis and Ovis aries. Vet Microbiol 2009;133:366–371. [DOI] [PubMed] [Google Scholar]
- 3. Dassanayake RP, et al. Role of Bibersteinia trehalosi, respiratory syncytial virus, and parainfluenza-3 virus in bighorn sheep pneumonia. Vet Microbiol 2013;162:166–172. [DOI] [PubMed] [Google Scholar]
- 4. Davies RL, et al. Sequence diversity and molecular evolution of the leukotoxin (lktA) gene in bovine and ovine strains of Mannheimia (Pasteurella) haemolytica. J Bacteriol 2001;183:1394–1404. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Fisher MA, et al. Use of a polymerase chain reaction method to detect the leukotoxin gene lktA in biogroup and biovariant isolates of Pasteurella haemolytica and P. trehalosi. Am J Vet Res 1999;60:1402–1406. [PubMed] [Google Scholar]
- 6. George JL, et al. Epidemic pasteurellosis in a bighorn sheep population coinciding with the appearance of a domestic sheep. J Wildl Dis 2008;44:388–403. [DOI] [PubMed] [Google Scholar]
- 7. Green AL, et al. Polymerase chain reaction techniques for differentiating cytotoxic and noncytotoxic Pasteurella trehalosi from Rocky Mountain bighorn sheep. Am J Vet Res 1999;60:583–588. [PubMed] [Google Scholar]
- 8. Harhay GP, et al. Complete closed genome sequences of three Bibersteinia trehalosi nasopharyngeal isolates from cattle with shipping fever. Genome Announc 2014;2:e00084-14. doi: 10.1128/genomeA.00084-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Miller MW, et al. Phylogenetic and epidemiologic relationships among Pasteurellaceae from Colorado bighorn sheep herds. J Wildl Dis 2013;49:653–660. [DOI] [PubMed] [Google Scholar]
- 10. Miller MW, Wolfe LL. Pasteurellaceae from Colorado bighorn sheep herds. J Wildl Dis 2011;47:800–804. [DOI] [PubMed] [Google Scholar]
- 11. Shanthalingam S, et al. PCR assay detects Mannheimia haemolytica in culture-negative pneumonic lung tissues of bighorn sheep (Ovis canadensis) from outbreaks in the western USA, 2009–2010. J Wildl Dis 2014;50:1–10. [DOI] [PubMed] [Google Scholar]
- 12. Sweeney SJ, et al. Comparative leukotoxicities of Pasteurella haemolytica isolates from domestic sheep and free-ranging bighorn sheep (Ovis canadensis). J Wildl Dis 1994;30:523–528. [DOI] [PubMed] [Google Scholar]
- 13. Weiser GC, et al. Variation in Pasteurella (Bibersteinia) and Mannheimia spp. following transport and antibiotic treatment in free-ranging and captive Rocky Mountain bighorn sheep (Ovis canadensis canadensis). J Zoo Wildl Med 2009;40:117–125. [DOI] [PubMed] [Google Scholar]
- 14. Wolfe LL, et al. A bighorn sheep die-off in southern Colorado involving a Pasteurellaceae strain that may have originated from syntopic cattle. J Wildl Dis 2010;46:1262–1268. [DOI] [PubMed] [Google Scholar]
- 15. Wood ME, et al. How respiratory pathogens contribute to lamb mortality in a poorly performing bighorn herd. J Wildl Dis 2017;53:126–130. [DOI] [PubMed] [Google Scholar]