Abstract
We evaluated a fluorogenic probe–based assay for the detection of encephalomyocarditis virus (EMCV) by comparing a set of published primers and probe to a new set of primers and probe. The published reagents failed to amplify a range of Australian isolates and an Italian reference strain of EMCV. In contrast, an assay based on 2 new sets of primers and probes that were run in a duplex reverse-transcription real-time PCR (RT-rtPCR) worked well, with high amplification efficiency. The analytical sensitivity was ~100-fold higher than virus isolation in cell culture. The intra-assay variation was 0.21–4.90%. No cross-reactivity was observed with a range of other porcine viruses. One hundred and twenty-two clinical specimens were tested simultaneously by RT-rtPCR and virus isolation in cell culture; 72 specimens gave positive results by RT-rtPCR, and 63 of these were also positive by virus isolation. Of 245 archived cell culture isolates of EMCV that were tested in the RT-rtPCR, 242 samples were positive. The new duplex RT-rtPCR assay is a reliable tool for the detection of EMCV in clinical specimens and for use in epidemiologic investigations.
Keywords: Encephalomyocarditis virus, reverse-transcription polymerase chain reaction
Introduction
Encephalomyocarditis virus (EMCV; order Picornavirales, family Picornaviridae, genus Cardiovirus, species Cardiovirus A) is a small, non-enveloped, positive-sense single-stranded RNA virus.16 EMCV was first isolated in 1940 and has a worldwide distribution.4 Rodents are considered as reservoirs or natural hosts of EMCV,27 and they transmit the virus to a wide range of mammalian species including pigs,1,2,4,8,9,12 cattle,6,7 elephants,11,17 marsupials,23 other rodent species,9 non-human primates,3,13,19,23,33 and, rarely, humans.15,20,26,32
EMCV infection in different animals results in clinical signs ranging from asymptomatic persistence in natural reservoirs (rodents) to sudden death in most other animal species.1,3,4,13,23 Pigs are considered to be the most commonly and severely affected domestic animal.2,9 EMCV infection is known to be a cause of sudden death with high mortality rates as a result of myocarditis and encephalitis in young pigs, and reproductive failure in sows.2,4 This may lead to serious economic losses in pig farms. Significant losses are also experienced in a wide range of wildlife species, especially non-human primates, particularly in a captive environment,3,11,19,23,25,33 but also in the wild.11,17
Methods used to detect EMCV infection include virus isolation,10,18,22 serology,36 immunohistochemistry,30 conventional reverse-transcription PCR (RT-PCR),14,18,21,22,28,29 reverse-transcription loop-mediated isothermal amplification (RT-LAMP),34 and real-time RT-PCR (RT-rtPCR) based on SYBR Green detection.31 A fluorogenic probe–based RT-rtPCR assay has also been described.35 In contrast to traditional assays, RT-rtPCR is considered to be a highly sensitive, specific, and time-saving method, and is of higher sensitivity than RT-LAMP.34
We evaluated a duplex fluorogenic probe–based RT-rtPCR assay by comparing it with a published assay35 and virus isolation in cell culture. The capacity of the duplex RT-rtPCR to detect EMCV in clinical samples was also evaluated.
Materials and methods
Sample sources
At the Biosecurity Sciences Laboratory (BSL; Department of Agriculture and Fisheries, Coopers Plains, Queensland, Australia), 122 samples collected from a wide range of diseased mammalian species were tested concurrently by virus isolation and with the new RT-rtPCR. A large archival collection of tissue samples and cell culture fluids from which EMCV had been isolated was also available for testing. These samples were collected in 1970–2016 from a wide variety of mammalian species and were stored at −80°C at the Elizabeth Macarthur Agriculture Institute (EMAI; Menangle, New South Wales, Australia; Table 1). Also included was a European strain of EMCV (detected as a result of fatal myocarditis in Novara, Italy in 1986; Gualandi GL, Cordioli P, unpublished data12). Forty-two heart and one brain homogenate from various mammalian species were also tested concurrently at EMAI.
Table 1.
Details of samples tested in both laboratories.
| Source (period)/Sample type | Species | Positive |
Negative | ||
|---|---|---|---|---|---|
| RT-rtPCR |
Virus isolation | RT-rtPCR | |||
| No. of positives | Ct value | ||||
| Queensland (1983–2016) | |||||
| Virus cultures | Porcine, bovine, primate, camelid, marsupial | 25 | 13.2–30.9 | 25 | |
| Heart | Porcine, bovine, primate, camelid, marsupial | 44 | 13.4–30.0 | 38 | 44 |
| Brain | Porcine | 1 | 21.5 | 4 | |
| Lymph node | Porcine | 1 | 36 | 1 | |
| Spleen | Porcine | 1 | 33.7 | 1 | |
| Total | 72 | 63 | 50 | ||
| NSW (1970–2016) | |||||
| Viral cultures | Porcine, bovine, primate, marsupial | 201 | 23.4 (11.4–38.1)* | 202 | 1 |
| Tissue | Porcine, bovine, primate, marsupial | 41 | 17.6 (10.2–37.5)† | 43 | 2 |
| Total | 242 | 245 | 3 | ||
NSW = New South Wales, Australia; RT-rtPCR = reverse-transcription real-time PCR. Cycle threshold (Ct) values are presented as ranges or means, with ranges in parentheses if applicable.
Includes 3 samples with Ct values >32.5.
Includes one sample with Ct value >32.5.
Primers and probes
The new RT-rtPCR assay was designed at BSL (AlleleID, Premier Biosoft, Palo Alto, CA). Twenty published EMCV sequences, including EMCV ATCC strain VR-129B from the National Center for Biotechnology Information (NCBI), were aligned, and the consensus sequence was used for the design of both RT-rtPCR assays (Table 2). The assay included sets of primers and TaqMan fluorogenic probes (Table 3), targeting sequences of the 5′–nontranslated region (5′-NTR) and 2B of the polyprotein region of the genome, and were used in a duplex assay. The sequence specificity of the primers and probes was confirmed by nucleotide–nucleotide search using the basic local alignment search tool (BLAST) of GenBank (http://www.ncbi.nlm.nih.gov/BLAST/). The assay used for comparison was as described previously35 (Table 3).
Table 2.
List of encephalomyocarditis virus (EMCV) sequences used for assay design.
| EMCV strain | GenBank accession | |
|---|---|---|
| 1 | D variant | M37588.1 |
| 2 | B variant | M22457.1 |
| 3 | D variant | M22458.1 |
| 4 | K3 | EU780148.1 |
| 5 | K11 | EU780149.1 |
| 6 | Ruckert | M81861.1 |
| 7 | 1086C | DQ835185 |
| 8 | BEL-2887A-91 | AF356822.1 |
| 9 | GXLC | FJ897755 |
| 10 | GX0602 | FJ604853.1 |
| 11 | HB1 | DQ464063 |
| 12 | BJC3 | DQ464062 |
| 13 | EMCV | X87335.1 |
| 14 | EMCV | X74312.1 |
| 15 | EMCV | NC_001479 |
| 16 | pEC9 | DQ288856 |
| 17 | PEMCV 30 | AY296731 |
| 18 | PEMCV CBN | DQ51424 |
| 19 | PEMCV NJ08 | HM641897.1 |
| 20 | ATCC VR-129B | KM269482.1 |
Table 3.
Primers and probes used in the reverse-transcription real-time PCR (RT-rtPCR) assays for encephalomyocarditis virus (EMCV).
| Assay name/Target | Primer/probe | Nucleotide sequence (5′–3′) | EMCV strain ATCC VR-129B |
Source |
|---|---|---|---|---|
| Position | ||||
| Duplex RT-rtPCR | ||||
| 5′-NTR | EMCV 5NTR-F | GTCTGTAGCGACCCTTTG | 519-536 | This study |
| EMCV 5NTR-R | CCTTGTTGAATACGCTTGAG | 694-675 | ||
| EMCV 5NTR-P | FAM-AGCCATTTGACTCTTTCCACAACTAT-BHQ1 | 671-646 | ||
| 2B | EMCV 2B-F | ATGGGAAAATGTAAAAGAAACA | 4173-4194 | |
| EMCV 2B-R | GCATCACTGCTATTGTCA | 4273–4256 | ||
| EMCV 2B-P | FAM-AGCTGCACACATCTGCTCAA-BHQ1 | 4244-4225 | ||
| Yuan et al. TaqMan assay | ||||
| 3D | EMCV-F | TCATTAGCCATTTCAACCCA | 7156-7175 | 35 |
| EMCV-R | GAGATACAAACCCGCCCTAA | 7290-7271 | ||
| EMCV-P | FAM-TCCCATCAGGTTGTGCAGCGA-TAMRA | 7214-7234 | ||
| CN PCR | ||||
| 5′-NTR | CN 5NTR-F | CTAACGTTACTGGCCGAAGC | 293-312 | This study |
| CN 5NTR-R | GGTACCTTCTGGGCATCCTT | 718-700 | ||
| 2B | CN 2B-F | CAGCTTTTACGGCTTTGCTC | 4088-4107 | |
| CN 2B-R | GTCCCAAACCAATCAACCAC | 4523–4504 | ||
5′-NTR = 5′–nontranslated region; 2B, 3D = polyprotein regions; CN = copy number; F = forward primer; P = TaqMan probe; R = reverse primer. FAM (6-carboxyfluorescein) was used as the reporter and BHQ-1 (black hole quencher) as the quencher.
Nucleic acid extraction
Total nucleic acid was extracted from 50 μL of a 1/10 dilution of tissue culture fluid or supernatant from tissue homogenates with a magnetic bead–based extraction kit (MagMax-96, Thermo Fisher Scientific, Austin, TX) according to the manufacturer’s instructions, using a magnetic particle handling system (KingFisher 96, Thermo Fisher). Extracts were eluted in 50 μL of nuclease-free water, and stored at –20°C if amplification by RT-rtPCR was not carried out immediately.
RT-rtPCR
The duplex RT-rtPCR was evaluated in 2 laboratories with slightly different methods.
EMAI protocol
The new duplex RT-rtPCR was performed using a commercial master mix (AgPath-ID one-step RT-PCR kit, Thermo Fisher) with 5 μL of purified nucleic acid in a total reaction volume of 25 μL. The reaction mixture included 0.15 μL of each forward and reverse primer (100 μM), 0.05 μL of each probe (100 μM), and the components of the RT-rtPCR kit as recommended by the manufacturer. The RT-rtPCR was run (ABI 7500 Fast thermocycler, normal mode, Thermo Fisher) under the standard reaction conditions for the master mix for a total of 45 cycles. Background fluorescence was adjusted automatically, and the threshold was set manually at 0.05. Results were expressed as cycle threshold (Ct) values, being the cycle at which the amplification curve crossed the 0.05 threshold.
In order to confirm that none of the samples contained factors that would either reduce the efficiency of RNA extraction or contain inhibitors of the RT-rtPCR, an extraneous RNA construct was used (XIPC).24 This was added to the sample lysis buffer, and the corresponding primers and probe were then added to the EMCV reaction mix to form a triplex RT-rtPCR. The impact of the XIPC on the efficiency of the RT-rtPCR was assessed by testing a titration series of the reference strain of EMCV used along with RNA extracted from some of the samples to compare performance of the EMCV duplex assay with and without the XIPC assay components.
BSL protocol
The duplex RT-rtPCR was performed (Rotor-Gene Q, Qiagen, Chadstone, Victoria, Australia; SuperScript Platinum III one-step quantitative RT-PCR system master mix, Thermo Fisher) as recommended by the manufacturer. The reaction mix contained 2 μL of each of the primers (40 μM) and 1 μL of each of the probes (5 μM). The probes were labeled with 2 different fluorophores, FAM (6-carboxyfluorescein) and VIC (Thermo Fisher). The cycling parameters were reverse transcription at 37°C for 15 min followed by initial denaturation at 95°C for 2 min and 45 cycles at 95°C for 5 s, 52°C for 5 s, and 72°C for 15 s, at which step the fluorescence was acquired. The background fluorescence was adjusted manually, and the threshold was set at 0.05. The results were expressed as described above.
PCR competency (successful extraction and absence of PCR inhibitors) of the RNA extracts was monitored by multiplexing the duplex RT-rtPCR with an internal control RT-PCR that targets mitochondrial DNA.5 The internal control RT-PCR probe was labeled with a different fluorophore, Cy5 (cyanine 5).
Analytical sensitivity, intra-assay variation, and amplification efficiency of the RT-rtPCR
An Australian reference strain of EMCV (F728) with a titer of 107.8 TCID50/mL was diluted in serial 10-fold dilutions from 10−1 to 10−8 in phosphate-buffered gelatin saline (PBGS). These dilutions were extracted and tested in the RT-rtPCR assays in duplicate to determine detection limits and construct standard curves. Intra-assay variation was assessed by calculating the coefficient of variation (CV) from the duplicates on each test plate. The amplification efficiency of each RT-rtPCR was calculated from the slope of the standard curve constructed from the serial dilutions of template.
Determination of copy number and limit of detection
The copy number (CN) and limit of detection (LOD) were determined as described previously.6 Briefly, for the determination of CN and LOD of each of the RT-rtPCR assays, CN PCR assays were designed. The 5′-NTR CN PCR was designed to amplify a 425-bp region of the EMCV 5′-NTR, and the 2B CN PCR was designed to amplify a 436-bp region of the 2B region of the EMCV genome. The primers were designed to flank the amplicons of their respective RT-rtPCR assays (Table 3).
The resulting amplicon was purified and quantified (NanoPhotometer, Implen, München, Germany), and serial 10-fold (10−1–10−15) dilutions were prepared and assayed. The CN was calculated using the formula described by the University of Rhode Island Genomic and Sequencing Center (http://cels.uri.edu/gsc/cndna.html).
Analytical specificity of the RT-rtPCR
As well as comparison with the virus isolation results, the specificity of the new duplex RT-rtPCR was confirmed by testing high-titer samples of other relevant animal viruses including Bungowannah virus, Menangle rubulavirus, porcine parvovirus (PPV; species Ungulate protoparvovirus 1), porcine circovirus 2 (PCV-2), porcine epidemic diarrhea virus (PEDV), classical swine fever virus (CSFV; species Pestivirus C), and influenza A virus.
Virus isolation
Virus isolation in cell culture was undertaken on 10–20% homogenates of 122 tissues using standard techniques.2,23 Virus isolates were identified as EMCV by virus neutralization test using a polyclonal antiserum against EMCV.
Results
The performance of the published and the new duplex assay was initially assessed under the same reaction conditions by testing serial dilutions of the Australian F728 strain of EMCV. The published EMCV RT-rtPCR failed to show amplification of any virus dilution. When testing a collection of isolates with Ct values of 15–19 in the new assay, it also failed to detect 7 strains (including the Italian Novara strain) or had a difference of >10 cycles (6 isolates) compared to the new assay. Acceptable results were only obtained for 2 isolates. Consequently, evaluation of this assay was discontinued. In contrast, there was good amplification with the new duplex RT-rtPCR over an 8 log10 range without reaching the LOD, with the 10−8 dilution of the virus stock, giving a mean Ct value of 34.4. The intra-assay CV was 0.21–4.90%. The amplification efficiency was 97.24%. The determination of the LOD at BSL suggested that the cutoff for the RT-rtPCR was a Ct value of 36, which corresponded to 0.9 TCID50. The CN using amplified DNA was ~1.2 × 102 and 1.5 × 102 target copies, which corresponded to Ct values of 37.5 and 35.5 for 5′-NTR RT-rtPCR and 2B RT-rtPCR, respectively.
The high specificity of this duplex RT-rtPCR assay was demonstrated by the lack of amplification of high-titer nucleic acid extracts from all other porcine viruses tested (Bungowannah virus, Menangle virus, PPV, PCV-2, PEDV, CSFV, and influenza A virus).
Further evaluation of the duplex RT-rtPCR was conducted in Queensland in parallel with virus isolation on 122 clinical samples; 72 of the 122 samples were positive by RT-rtPCR, and EMCVs were isolated from 63 of these samples. Fifty of the 122 samples were negative by both methods (Table 1). When comparing the Ct values obtained from various tissues, heart tissue gave the lowest Ct values (13.4–30.0); lymph node and spleen gave the highest Ct values. The Ct values of heart tissues were comparable to those of viral culture (13.2–31.0). The single brain sample tested also gave a low Ct value (13.2). On the other hand, lymph node and spleen gave the highest Ct values (36.0 and 33.7, respectively), which are close to the LOD of the RT-rtPCR. There was no evidence of inhibition of the internal control including for the 50 negative samples.
Finally, when the RT-rtPCR was used to test the 43 archived tissue homogenates from which EMCV had been isolated at EMAI, and 202 EMCV isolates (including the Italian Novara strain), 242 of the 245 samples were positive, with mean Ct values of 17. 6 (range: 10.2–37.5) for the isolates, and 23.4 (range: 11.4–38.1) for the tissue homogenates. Three of the 245 samples were negative. There was no evidence of inhibition of the XIPC that was included in the RT-rtPCR (data not shown). The evaluation of the efficiency of the duplex EMCV RT-rtPCR was not affected by the inclusion of an XIPC construct or the internal control RT-rtPCR.
Discussion
Initial evaluation of the published set of primers and probe35 gave extremely poor results. Conversely, the paired set of new primers and probe showed good amplification with a high efficiency (97.24%). One possible interpretation is that the published primers and probe that failed to amplify most of the Australian isolates of EMCV were designed and validated using samples collected in China, but the published assay also failed to detect the Italian Novara strain. However, there is not a single consensus sequence to detect all Australian strains of EMCV, hence the need to use a paired set of primers and probe, run in a duplex assay (triplex with XIPC and internal RT-rtPCR). Two variant strains of EMCV have been described in Singapore.33 These 2 variants were shown to be divergent from other EMCV strains based on sequencing of the 3D region of the polyprotein, the region targeted by the published assay, and the VP1 capsid region.32 Based on sequence comparisons, we did not expect the published assay to detect these 2 variants. In silico evaluation of the published sequences of these variants suggests that these would also be detected by one set of primers and probe in the new duplex assay. Unfortunately, there was no Chinese positive control sample of EMCV available in either of the 2 participating laboratories to evaluate the performance of the new duplex RT-rtPCR against a Chinese strain of EMCV. Conversely, there was also no published genomic sequence of an Australian EMCV available to the Chinese scientists during the development of their assay.35 Our study demonstrates the critical need to evaluate published assays using local strains of an agent.
The reliability of the new duplex assay from nucleic acid extraction through the RT-rtPCR was confirmed by titration of a high-titer virus preparation. This evaluation demonstrated good assay performance over a range of 8 log10 with a LOD equivalent to 0.3 TCID50/mL (mean Ct value of 34.4) with good repeatability (CV = 0.21–4.90%).
The RT-rtPCR results for clinical samples suggest that the best sample for the detection of EMCV RNA is heart tissue. The Ct values for heart RNA extracts gave consistently lower Ct values when compared to other tissues such as spleen and lymph node. Brain was the alternative sample of choice but may depend on whether there are characteristic EMCV lesions in the brain (i.e., nonsuppurative encephalitis).
Because pigs are the species most frequently infected with EMCV, the high specificity of this assay was confirmed by a lack of reactivity with a number of porcine viruses, including Bungowannah virus, Menangle virus, PPV, PCV-2, PEDV, CSFV, and influenza A virus.
The duplex RT-rtPCR also has very high analytical sensitivity, and while correctly identifying all 63 positive clinical specimens from which EMCV was isolated, it also detected EMCV RNA in another 9 specimens that gave negative results by virus isolation. During retrospective testing of the collection of archived samples, negative results were obtained for 3 of 245 stored virus isolates or tissue that had originally given positive results; another 4 samples gave Ct values >32.5. Given that all 7 samples or isolates had been held for >20 y, it is likely that samples deteriorated during storage.
The ability of the duplex RT-rtPCR to detect EMCV RNA in clinical samples from which virus has been isolated underlines the detection sensitivity of the assay. Furthermore, the specificity of the RT-rtPCR was also demonstrated by the negative results obtained from 50 clinical samples from which EMCV was not isolated.
We validated a fluorogenic probe–based duplex RT-rtPCR method for detection of EMCV on a large number of samples collected from a variety of mammalian species and over a lengthy period of time; the oldest samples had been stored for 46 y. Our results indicate that this fluorogenic probe–based duplex RT-rtPCR method is reliable and can be used for the detection of EMCV. Although one Italian virus was successfully detected, there is, however, a need to evaluate this assay in other geographical regions to confirm its capacity to detect a wider range of strains of EMCV.
Acknowledgments
We thank Guangxi Veterinary Research Institute and the family of Shaomin Qin for supporting his travel to Australia. We are grateful for the contributions of the staff of the Virology Laboratory at EMAI for assistance with virus isolation and sample storage over many decades. Mrs. M Frost provided valuable assistance during the initial evaluation of the assay. The helpful comments from Dr. R Hawkes during the preparation of this manuscript are appreciated.
Footnotes
Declaration of conflicting interests: The authors declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.
Funding: This project was supported by NSW Department of Primary Industries and the Queensland Department of Agriculture and Fisheries. Qin Shaomin received a travel grant from the Project of Guangxi Talents Center of Development of Animal Disease Prevention and Control Technology for his visit to Australia.
References
- 1. Acland HM, Littlejohns IR. Encephalomyocarditis virus infection of pigs. 1. An outbreak in New South Wales. Aust Vet J 1975;51:409–415. [DOI] [PubMed] [Google Scholar]
- 2. Alexandersen S, et al. Encephalomyocarditis virus. In: Zimmerman JJ, et al. eds. Diseases of Swine. 10th ed. Ames, IA: Wiley, 2012:606–610. [Google Scholar]
- 3. Canelli E, et al. Encephalomyocarditis virus infection in an Italian zoo. Virol J 2010;7:64. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Carocci M, Bakkali-Kassimi L. The encephalomyocarditis virus. Virulence 2012;3:351–367. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Cawthraw S, et al. Real-time PCR detection and identification of prohibited mammalian and avian material in animal feeds. J Food Prot 2009;72:1055–1062. [DOI] [PubMed] [Google Scholar]
- 6. Diallo IS, et al. Detection and differentiation of bovine herpesvirus 1 and 5 using a multiplex real-time polymerase chain reaction. J Virol Methods 2011;175:46–52. [DOI] [PubMed] [Google Scholar]
- 7. Diallo IS, et al. Encephalomyocarditis virus infection in a splenectomised calf. Aust Vet J 2013;91:391–394. [DOI] [PubMed] [Google Scholar]
- 8. Feng R, et al. National serosurvey of encephalomyocarditis virus in healthy people and pigs in China. Arch Virol 2015;160:2957–2964. [DOI] [PubMed] [Google Scholar]
- 9. Gainer JH. Encephalomyocarditis virus infections in Florida, 1960–1966. J Am Vet Med Assoc 1967;151:421–425. [PubMed] [Google Scholar]
- 10. Ge XN, et al. Isolation and characterization of porcine encephalomyocarditis virus. Acta Vet Zootech 2007;38:59–65. [Google Scholar]
- 11. Grobler DG, et al. Encephalomyocarditis virus infection in free-ranging African elephants in the Kruger National Park. Onderstepoort J Vet Res 1975;62:97–108. [PubMed] [Google Scholar]
- 12. Gualandi GL, et al. A serologic survey of encephalomyocarditis virus infection in pigs in Italy. Microbiologica 1989;12:129–132. [PubMed] [Google Scholar]
- 13. Jones P, et al. Encephalomyocarditis virus mortality in semi-wild bonobos (Panpanicus). J Med Primatol 2011;40:157–163. [DOI] [PubMed] [Google Scholar]
- 14. Kassimi LB, et al. Detection of encephalomyocarditis virus in clinical samples by immunomagnetic separation and one-step RT-PCR. J Virol Methods 2002;101:197–206. [DOI] [PubMed] [Google Scholar]
- 15. Kirkland PD, et al. Human infection with encephalomyocarditis virus in New South Wales. Med J Aust 1989;151:176–177. [DOI] [PubMed] [Google Scholar]
- 16. Knowles NJ, et al. Picornaviridae. In: King AMQ, et al. eds. Virus Taxonomy: Classification and Nomenclature of Viruses. Ninth Report of the International on Taxonomy of Viruses. San Diego, CA: Elsevier, 2011:855–880. [Google Scholar]
- 17. Lamglait B, et al. Fatal encephalomyocarditis virus infection in an African savanna elephant (Loxodonta africana). J Zoo Wildl Med 2015;46:393–396. [DOI] [PubMed] [Google Scholar]
- 18. Liu H, et al. Isolation and molecular and phylogenetic analyses of encephalomyocarditis virus from wild boar in central China. Infect Genet Evol 2016;40:67–72. [DOI] [PubMed] [Google Scholar]
- 19. Masek-Hammerman K, et al. Epizootic myocarditis associated encephalomyocarditis virus in a group of rhesus macaques (Macaca mulatta). Vet Pathol 2012;49:386–392. [DOI] [PubMed] [Google Scholar]
- 20. Oberste MS, et al. Human febrile illness caused by encephalomyocarditis virus infection, Peru. Emerg Infect Dis 2009;15:640–646. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Pérez LJ, Díaz De, Arce H. A PCR assay for the detection of encephalomyocarditis virus infections in pigs. Braz J Microbiol 2009;40:988–993. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Philipps A, et al. Isolation and molecular characterization of a second serotype of the encephalomyocarditis virus. Vet Microbiol 2012;161:49–57. [DOI] [PubMed] [Google Scholar]
- 23. Reddacliff LA, et al. Encephalomyocarditis virus infection in an Australian zoo. J Zoo Wildl Med 1997;28:153–157. [PubMed] [Google Scholar]
- 24. Schroeder M, et al. Development and performance evaluation of calf diarrhea pathogen nucleic acid purification and detection workflow. J Vet Diagn Invest 2012;24:945–953. [DOI] [PubMed] [Google Scholar]
- 25. Simpson CF, et al. Encephalomyocarditis virus infection of captive elephants. J Am Vet Med Assoc 1977;171:902–905. [PubMed] [Google Scholar]
- 26. Tesh RB. The prevalence of encephalomyocarditis virus neutralizing antibodies among various human populations. Am J Trop Med Hyg 1978;27:144–149. [DOI] [PubMed] [Google Scholar]
- 27. Tesh RB, Wallace GD. Observations of the natural history of encephalomyocarditis virus. Am J Trop Med Hyg 1978;27:133–143. [DOI] [PubMed] [Google Scholar]
- 28. Vanderhallen H, Koenen F. Rapid diagnosis of encephalomyocarditis virus infection in pigs using a reverse transcription-polymerase chain reaction. J Virol Methods 1997;66:83–89. [DOI] [PubMed] [Google Scholar]
- 29. Vanderhallen H, Koenen F. Identification of encephalomyocarditis virus in clinical samples by reverse transcription-PCR followed by genetic typing using sequence analysis. J Clin Microbiol 1998;36:3463–3467. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30. Vlemmas J, et al. Immunohistochemical detection of encephalomyocarditis virus (EMCV) antigen in the heart of experimentally infected piglets. J Comp Pathol 2000;122:235–240. [DOI] [PubMed] [Google Scholar]
- 31. Wang Z, et al. A real-time PCR to detect and analyze virulent EMCV loads in sows and piglets. Mol Biol Rep 2012;39:10013–10017. [DOI] [PubMed] [Google Scholar]
- 32. Warren J. Encephalomyocarditis viruses. In: Horsfall FL, Tamm I, eds. Viral and Rickettsial Infections of Man. 4th ed. Philadelphia, PA: Lippincott, 1965:562–568. [Google Scholar]
- 33. Yeo DS, et al. A highly divergent encephalomyocarditis virus isolated from nonhuman primates in Singapore. Virol J 2013;10:248. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34. Yuan W, et al. Rapid detection of encephalomyocarditis virus by one-step reverse transcription loop-mediated isothermal amplification method. Virus Res 2014;189:75–78. [DOI] [PubMed] [Google Scholar]
- 35. Yuan W, et al. Development of a TaqMan-based real-time reverse transcription polymerase chain reaction assay for the detection of encephalomyocarditis virus. J Virol Methods 2014;207:60–65. [DOI] [PubMed] [Google Scholar]
- 36. Zimmerman JJ, et al. Serologic diagnosis of encephalomyocarditis virus infection in swine by the microtiter serum neutralization test. J Vet Diagn Invest 1990;2:347–350. [DOI] [PubMed] [Google Scholar]
