Abstract
The Reprimo gene family comprises a group of single-exon genes for which their physiological function remains poorly understood. Heretofore, mammalian Reprimo (RPRM) has been described as a putative p53-dependent tumor suppressor gene that functions at the G2/M cell cycle checkpoint. Another family member, Reprimo-like (RPRML), has not yet an established role in physiology or pathology. Importantly, RPRML expression pattern is conserved between zebrafish and human species. Here, using CRISPR-Cas9 and antisense morpholino oligonucleotides, we disrupt the expression of rprml in zebrafish and demonstrate that its loss leads to impaired definitive hematopoiesis. The formation of hemangioblasts and the primitive wave of hematopoiesis occur normally in absence of rprml. Later in development there is a significant reduction in erythroid-myeloid precursors (EMP) at the posterior blood island (PBI) and a significant decline of definitive hematopoietic stem/progenitor cells (HSPCs). Furthermore, loss of rprml also increases the activity of caspase-3 in endothelial cells within the caudal hematopoietic tissue (CHT), the first perivascular niche where HSPCs reside during zebrafish embryonic development. Herein, we report an essential role for rprml during hematovascular development in zebrafish embryos, specifically during the definitive waves of hematopoiesis, indicating for the first time a physiological role for the rprml gene.
Subject terms: Leukopoiesis, Genetics research, Haematopoiesis
Introduction
Early stages of vertebrate hematopoiesis involve two developmental phases, defined as primitive and definitive hematopoiesis. In zebrafish, the primitive wave of hematopoiesis starts from two stripes of hemangioblast-like cells positioned in the lateral plate mesoderm at early somitic stages: i) the anterior lateral-plate mesoderm (ALM), which gives rise to myeloid cells, and ii) the posterior lateral-plate mesoderm (PLM), which produces the primitive erythroid cells1,2. PLM cells migrate across the midline to originate the intermediate cell mass (ICM), where the primitive erythroid cells complete their maturation between the nascent dorsal aorta (DA) and posterior cardinal vein plexus (PCVP). By 26 hours post-fertilization (hpf), the first erythrocytes begin to circulate. This process occurs together with the expression of the proto-oncogene transcription factor cmyb in the first hematopoietic cells budding from the ventral DA (VDA)3,4.
In zebrafish, definitive hematopoiesis also occurs in two waves. The first wave, named transient-definitive hematopoiesis produces erythroid-myeloid progenitors (EMP) in the posterior blood island (PBI)5. The second wave is characterized by the generation of hematopoietic stem/progenitor cells (HSPCs) which can either undergo self-renewal or differentiate into erythroid, myeloid and lymphoid hematopoietic lineages1,2. HSPCs, induced by somite-derived endothelial cells6, arise in the VDA in a region also known as the aorta-gonad-mesonephros (AGM) and characteristically express cmyb and/or runx1 after 26 hpf7,8. The HSPCs emerge from the hemogenic endothelium in the floor of the AGM or VDA, through a process termed endothelial hematopoietic transition (EHT). Previous studies using CD41:GFPlow transgenic animals have defined the migration of HSPC from the AGM to their niche in the caudal hematopoietic tissue (CHT) and then to thymus and pronephros3,9. Recent evidence by our group has reported the expression pattern of the RPRM gene family members during blood vessel development10.
The Reprimo (RPRM) gene family is a group of single-exon genes exclusive to the vertebrate group, that diversified as a product of two rounds of whole genome duplications occurred in the last common ancestor of vertebrates between 676 and 615 million years ago10–12. The repertoire of Reprimo genes includes Reprimo (RPRM), Reprimo-like (RPRML) and Reprimo 3 (RPRM3). To date, only the human RPRM gene has been studied10,12, with no literature describing the role of RPRML or RPRM3 in either physiology or pathophysiology. In humans, RPRM is a highly glycosylated cytoplasmic protein, which has been characterized as a potential tumor-suppressor gene involved in the regulation of the p53-mediated cell cycle arrest at G2 through the regulation of the Cdc2-cyclin B1 complex activity by a yet undiscovered mechanism13.
Zebrafish (Danio rerio) have two co-orthologs of the mammalian RPRM gene (designated rprma, rprmb) and a single co-ortholog of RPRML (rprml) and RPRM3 (rprm3), all of which are expressed during normal embryogenesis10,14. Gene expression profiling of the rprm genes suggested that during their evolutionary history, they have undergone a process of subfunctionalization with some degree of redundancy, as they exhibit unique – although partially overlapping – expression profiles during embryonic and larval blood vessel development. Interestingly, epigenetic silencing of RPRM has been linked to human blood cancers such as pediatric myeloid leukemia15. These studies suggest that RPRM genes may be involved in the formation and differentiation of the blood lineages in a process known as hematopoiesis.
Herein, we characterize the functions of rprml during hematovascular development in zebrafish. By loss-of-function assays either using generated knockdown CRISPR mutants (G0) or morphant embryos, we demonstrate that rprml is required during both waves of definitive hematopoiesis for the specification of both EMP and HSPC. Furthermore, we report that rprml regulates the normal formation of the HSPC perivascular PCVP/CHT niche. To our knowledge, this is the first report describing a physiological role for rprml.
Results
rprml loss-of-function using MO and CRISPR-Cas9 systems
We previously reported distinctive RNA expression pattern profiles for RPRM gene family members10,14. We also showed that rprml embryonic expression domains include vascular and mesodermal-derived tissues. Here, to assess a possible function of rprml during blood development, we used a combination of antisense oligonucleotide morpholinos (MOs)16 and CRISPR-Cas917 genetic approaches in a transgenic Tg(fli1:GFP) background, which enabled us to visualize endothelial cells (EC) by confocal microscopy. After comparing uninjected WT embryos with MO-injected and mutant specimens, where we observed no evidence of developmental delay generated by the injection (Fig. S1), we compared the phenotypes between the embryos injected with MOs targeting rprml and the CRISPR-Cas9 G0 rprml mutants17. The observed phenotypes were comparable in both experiments (Fig. S2A–C), characterized by reduced CHT territory and mild alterations in vascular morphology at the PCVP, which did not affect normal blood flow. Additionally, macroscopic observations of the different specimens showed no apparent decrease in the length of the trunk (Fig. S1). Abnormal blood accumulation in yolk, trunk edema and or hemorrhage were absent in CRISPR-Cas9 and morphant specimens. Cranial vasculature was also normal in controls compared with morphant and mutant embryos (Fig. S1).
In accordance with the recent guidelines and standard use of MO in zebrafish embryos18, we assessed the expression of p5319,20 by qRT-PCR in MO-injected and Tab5 WT uninjected embryos. This control was performed to rule out activation of p53 and associated cell death in MO-injected embryos. We observed a moderate decrease in p53 expression levels in a pool of rprml-MO injected specimens compared with the control group (Fig. S2G), supporting that this MO dosage was not toxic to the embryos. To assess the effectiveness of the rprml MO knockdown approach, we performed immunohistochemical analysis of Rprml protein. We observed a significant reduction of Rprml in rprml-MO embryos when compared with controls (Fig. S2D,E). Additionally, we performed phenotypic rescue experiments to assess the specificity of the MO. Co-injection of rprml mRNA and rprml-MO renders significantly rescued rprml-MO phenotype (Fig. S5), indicating that the rprml-MO effects over hematopoiesis are specific. Taken together, these results and the comparable phenotypes obtained by antisense MO and CRISPR-Cas9 genetic approaches, validate the use of MOs for the assessment of the physiological role of rprml during zebrafish embryogenesis by gene loss-of-function.
rprml is dispensable for primitive hematopoiesis but required for HSPC development
At early developmental stages, hemangioblasts contain the common precursor cells for hematopoietic and vascular lineages at the anterior and posterior lateral plate mesoderm (ALM and PLM)1,2. We used whole mount in situ hybridization (WISH) to determine the expression of well-known hemangioblast molecular markers in control and morphant embryos at 5–10 somite-stage, including lmo2, fli1a and tal1/scl1. We found comparable expression levels of these markers, suggesting that rprml does not play a relevant role during cell specification in primitive hematopoiesis (Fig. 1A–F). By 22 hpf, expression of tal1/scl1 (a primitive erythroid marker) remained mostly unaffected at the intermediate cell mass (ICM) (Fig. 1G,H). At around 24 hpf, we did not detect significant changes in the expression of lmo2 in rprml morphants compared with control embryos (Fig. S3A,B). However, we did observe a moderate reduction of fli1a in the PCVP at the CHT (Fig. S3C,D). In contrast, after 26 hpf, abrogation of rprml function led to a drastic reduction in the cmyb+ HSPCs population at the ICM and the posterior blood island (PBI) (Fig. 1I,J,I′,J′ in detail). At the same developmental stage, the expression of cmyb remained unaltered in neuronal territories such as the retina in rprml morphants (Fig. 1I,J, arrowheads). Therefore, loss-of-function of rprml does not alter hemangioblast in the ALM/PLM or primitive hematopoiesis but is likely required for HSPCs formation.
Figure 1.
rprml is dispensable for primitive hematopoiesis but required for HSPC formation. (A–F) Dorsal and lateral views of 10 somite-stage zebrafish embryos analyzed by WISH. White and black arrowheads represent the anterior- (ALM) and posterior-lateral plate mesoderm (PLM), respectively. (A,C,E,G,I) control MO-injected embryos; (B,D,F,H,J) rprml MO-injected embryos. (A–F) Expression patterns of typical hemangioblast markers: (A,B) lmo2, (C,D) fli1a, (E,F) tal1/scl1. (G,H) Lateral view of 24 hpf control MO and rprml MO-injected embryos stained by WISH for tal1/scl1. Black arrows indicate the intermediate cell mass (ICM) and red arrowheads normal expression pattern for tal1/scl1. (I,J) 28 hpf embryos stained by WISH for cmyb comparing controls versus rprml MO-injected embryos. Black arrowheads indicate normal expression pattern for cmyb. rprml morphant embryos retain retinal expression of cmyb (eye, e). The number of embryos with the phenotype shown as a fraction of the total number of embryos examined is indicated in the top right corner in (A–J). Scale bars, 100 μm (A–F) and 200 μm (G–J).
rprml is required for transient-definitive wave of hematopoiesis
As stated previously, definitive hematopoiesis occurs in two successive waves during zebrafish development1. The first transient-definitive wave involves the formation of erythroid-myeloid progenitors (EMP) at the PBI (Fig. 2A,B). The second definitive wave produces HSPCs from the hemogenic endothelium located in the AGM. Compared with HSPCs, EMP in zebrafish and mouse lack capacity for self-renewal5. To assess the possible functional role of rprml during transient-definitive hematopoiesis, we analyzed the expression pattern of the erythroid progenitor marker tal1/scl1 by using WISH. We noted a significant reduction of gene expression at the PBI in rprmlkd (Fig. 2C,D), while normal expression was retained in the brain (compared Fig. 2C,D, arrowheads). Furthermore, expression of the myeloid progenitor marker pu.1 was also reduced at the PBI of rprmlkd compared with control embryos (Fig. 2E,F). Of note, pu.1 expression was unaffected in the primitive myeloid precursors of the rostral ICM (compared Fig. 2E,F, arrowheads). We also investigated the development of granulocytic cells in rprmlkd. To this end, we analyzed the expression of the neutrophil marker mpx and noted reduced expression in rprmlkd when compared to control embryos (Fig. 2G,H). Also, the number of neutrophils was drastically reduced in the CHT of transgenic Tg(mpx:GFP) embryos between 32 and 48 hpf (Fig. 2I–J′), consistent with the decreased mpx expression visualized by WISH. Altogether, these results indicate that rprml is required for EMP formation during the transient wave of definitive hematopoiesis.
Figure 2.
rprml is required for transient-definitive hematopoiesis. (A) Schematic diagram for zebrafish hematopoiesis at 28 hpf showing the intermediate cell mass (ICM) and the posterior blood island (PBI). (B) Schematic for the transient-definitive wave of hematopoiesis where EMP give rise to erythroid myeloid and granulocytic/neutrophils cell population at the PBI. (C,E,G,I) Lateral views of control MO and (D,F,H,J) rprml MO-injected embryos. (C–H) 28 hpf embryos analyzed by WISH against erythroid/myeloid progenitor and granulocyte markers: (C–D) tal1/scl1 for erythroid precursor cells, (E,F) pu.1 for myeloid precursor cell, (G,H) mpx for neutrophils. Inset magnifications from (C) to (H) show the posterior blood island (PBI). Black arrowheads in (D,F,H) show normal expression of tal1/scl1, pu.1 and mpx in the anterior primitive hematopoietic territories. (I,J) Representative images of 48 hpf transgenic Tg(mpx:GFP) embryos analyzed by fluorescent microscopy. (I,I′) control and (J,J′) rprml morphant embryos. Inset magnifications in (I′,J′) show positive fluorescence in neutrophils at the caudal hematopoietic tissue. Number of embryos with the phenotype shown as a fraction of the total number of embryos examined is indicated in the top right corner in (C–J). Scale bars, 200 μm (C–H) and 100 μm (I,J).
Loss of rprml hinders HSPC specification
As mentioned above, zebrafish rprmlkd animals exhibited normal primitive hematopoiesis including specification of erythroid and myeloid cells (Fig. 1A–F). During definitive hematopoiesis, at 28 hpf, the cmyb+ HSPC population was greatly reduced in rprmlkd when compared with control embryos (Fig. 1I,J). Emergence of HSPCs from the ventral DA (VDA) has been characterized by the expression of CD41:GFPlow in the AGM (Fig. 3A). To visualize HSPC dynamics, we used time-lapse confocal imaging in double transgenic Tg(flt0.8:mcherry;CD41:GFP) and single Tg(CD41:GFP) embryos (Fig. 3). Consistent with our previous results, zebrafish rprmlkd showed a drastic reduction of CD41:GFPlow+ HSPCs budding derived from the VDA (yellow arrows, Fig. 3B,C,N), a result that was also confirmed in CRISPR-Cas9-rprml mutants (Fig. 3D,E). Thus, the emergence of HSPCs from the AGM/VDA seems to be strongly dependent on rprml activity. Consequently, initial HSPCs migration to the CHT was substantially reduced at 54 hpf (Figs 3F,G,N and S4). This reduction in HSPCs number at the CHT persisted later in development, as the rprml morphants showed greatly reduced CD41:GFPlow+ cells compared with control embryos at 84 hpf (Fig. 3H,I,N). In parallel, the dorsal-ventral width of the CHT was drastically reduced after 48 hpf. Additionally, in rprml-MO injected Tg(CD41:GFP) embryos, CD41:GFPlow+ lymphocyte progenitors failed to colonize the thymus (Fig. 3J,K,N). Furthermore, rag2+ lymphocytes, which depend on upstream HSPCs21, were almost completely absent in rprml morphants (Fig. 3L,M). Finally, the number of CD41+-GFP and mpx+-GFP expressing cells was significantly restored by co-injection of zebrafish rprml mRNA in rprml-morphants, indicating that the effects over hematopoiesis by rprml-MO injections are specific (Fig. S5).
Figure 3.
rprml is required for specification of hematopoietic precursor/stem cells (HSPCs) from the hemogenic endothelium at the ventral dorsal aorta. (A) Lateral view of zebrafish embryo with anterior to the left, showing overview of regions magnified in the fluorescent imaging (B–K) and WISH (L,M) panels. Red region denotes the left thymic lobe, yellow region the anterior gonad mesonephros/ventral dorsal aorta (AGM/VDA), green region the posterior caudal vein plexus/caudal hematopoietic tissue (PCVP/CHT) and white region the pronephric-tubule. (B–M) Lateral views of zebrafish embryos with anterior to the left at denoted developmental stages (48, 54 and 84 hpf). Loss-of function of rprml impairs normal formation of CD41-GFPlow+ HSPCs (yellow arrows in B–E) originating from the AGM/VDA (B–E, red bar graphs in N) and their migration to the CHT (F–I, green bar graphs in N) and thymus (J,K, yellow bar graphs in N). (D,E) Double transgenic Tg(flt0.8:mcherry;CD41:GFP) CRISPR-Cas9-rprml injected embryos show the same decrease in HSPCs originating from the AGM/VDA as rprml-morphant embryos. (L,M) WISH showing that rprml-morphant embryos show a remarkable absence of rag2 (lymphocyte marker) in the thymus. Statistical significance was determined using two-tailed unpaired Student’s t-test. ***P ≤ 0.001, ****P ≤ 0.0001. Scale bars, 50 μm (B–I) and 100 μm (J–M).
There is a close relationship between HSPC formation and the aortic endothelium7,8. To characterize arterial development, we performed WISH using several early arterial-specific markers. We examined the expression of two typical zebrafish artery markers, kdr1 (also known as vegfr-2) and dll4 (Notch ligand). Our results show that the expression of both markers did not drastically change in morphants when compared with control embryos (Fig. S6A–D). Consistently, the overall expression for transgenic arterial markers was normal in rprml-MO injected embryos with Tg(dll4:GFP) and/or Tg(flt0.8:RFP) background (Fig. S6E–I). Given that Notch activation is crucial for HSC specification22, we examined the spatiotemporal pattern of Notch signaling in the VDA using the Tg(Tp1:GFP) transgenic zebrafish line23. This reporter line is characterized by a fluorescent red signal in cells which respond to Notch signal activation. In these assays, we detected fewer Notch+ cells in the VDA in both rprml-morphant and mutant embryos (Fig. S6J–L). This indicates that VDA-cells are not actively responding to Notch signaling, thus affecting HSC specification from the VDA. Collectively, these results suggest that rprml is required for definitive HSPCs specification at the VDA in the hemogenic endothelium.
rprml is required for the formation of the CHT
To explore if rprml has a function during HSPC niche formation, we studied CHT morphogenesis in rprmlkd double transgenic Tg(flk:mcherry;fli1:eGFP) zebrafish embryos. rprmlkd showed reduced thickness of the HSPC niche territory compared with wild type siblings (Fig. 4 and S7). Specifically, rprmlkd embryos displayed increased intervascular spaces at the posterior caudal vein plexus (PCVP; the network of vessels adjacent to the CHT; Fig. 4B,C,J–K and S7). To determine whether the cellular defects of the CHT in rprmlkd were due to increased apoptosis, we monitored cell death by using activated caspase-3 (Casp-3) immunostaining. Surprisingly, PCVP/CHT apoptosis in rprmlkd animals was increased (Fig. 4E,F,H,I). The significant difference in apoptosis between knockdown embryos and wild type/control siblings by 48 hpf, indicates that rprml is required for cell survival during the formation of the CHT. This finding partly explains the reduction in the HSPC niche by rprml loss-of-function. Alternatively, lack of rprml function may inhibit proper sprouting angiogenesis in the PCVP, thus hindering the establishment of proper sprouting connectivity by ECs at the PCVP/CHT. These mechanisms need to be further explored in the future.
Figure 4.
Lack of rprml increases cell apoptosis within the HSPC niche at the CHT. (A) Schematic diagram showing zebrafish vasculature at 48 hpf. In green: (1) aorta-gonad-mesonephros (AGM) where the HSPCs are born, and (2) the posterior caudal vein plexus/caudal hematopoietic tissue (PCVP/CHT), which constitutes the embryonic HSPC niche. Red and blue colors correspond to the artery and vein, respectively. (B–I) Confocal spinning-disk images of the CHT of Tg(kdrl:eGFP) at 48 hpf. (B,C) Note that the spaces are slightly larger in rprml morphants compared to control embryos. Right panel shows a schematic representation of the observed phenotypes from (B,C). Dotted areas indicate intervascular spaces within the CHT. (E,F,H,I) Anti-activated caspase-3 (Casp-3, red) labels apoptotic cells. (D,F) A control MO-injected embryo showing (D) normal morphology of the CHT and (E,F) standard levels of Casp-3 activity. (G–I) rprml-MO injected embryos show (H,I) increased Casp-3 immunoreactivity within the PCVP/CHT. Number of embryos with the phonotype shown as a fraction of the total number of embryos examined is indicated in the bottom left corner in (F,I). (J,K) Statistical significance was determined using two-tailed unpaired Student’s t-test. **P ≤ 0.01, ***P ≤ 0.001.
Discussion
Our previous studies found that RPRM family genes are expressed in the vasculature in zebrafish and humans, specifically in vascular smooth muscle cells and ECs10. Although a potential role of RPRML in human hematopoiesis has not been yet assessed, the recent association between the loss of RPRM and highly aggressive acute myeloid leukemia (AML)15 raises the question of whether products from the RPRM gene family play a relevant role during hematopoiesis. Here we provide the first report of a functional role of rprml in physiology, specifically during hematovascular development. Our results suggest that rprml is dispensable for primitive hematopoiesis but essential for the definitive wave of hematopoiesis. In absence of rprml activity, key hemangioblast genes such as lmo2, fli1a and tal1/scl1 are normally expressed, indicating that rprml does not participate at early stages of hemangioblast specification in the ALM and PLM. In contrast, cmyb+ HSPC expression is strongly reduced in the VDA at the PBI (Fig. 1G–J) suggesting that rprml is essential for the activation of HSPC production. Together, these findings strongly suggest that rprml is not required for the initiation of hematopoiesis such as the primitive wave in the ICM but essential for definitive hematopoiesis along the VDA and PBI.
Previous studies have reported that MOs might present off-target RNA interactions at high concentrations. Accordingly, we followed the Stainier et al. guidelines18 for the use of MO in zebrafish: (i) we used both MOs and CRISPR-Cas9 gene-knockdown methods, (ii) we performed p53 qRT-PCR in rprml MO-injected embryos to discard potential toxicity19,20, and (iii) we performed rescue experiments to assess the specificity of the MOs. Notably, recent evidence has shown that MOs can reveal gene functions concealed by mutants20. Indeed, stable mutations induced by CRISPR-Cas9 might lead to gene compensation by up-regulation of other genes in the same signaling pathway. In contrast, MOs do not trigger as much compensation, therefore producing more extreme phenotypes than their mutant counterparts20. This allows for probing of gene function that is not possible using mutants alone. Our results indicate that our rprml MOs do not produce considerable off-target effects and the observed phenotype between morphants and CRISPR-Cas9 G0 genetic approaches are comparable. Therefore, gene knockdown by MOs is suitable to assess rprml gene function.
We also found that rprml deficiency drastically compromised HSPC specification from the VDA and the formation of the PCVP at 30–36 hpf, when budding of the HSPC from the artery floor occurs. The PCVP or HSPC niche appear incompletely branched at a critical period to receive the first HSPCs derived from the AGM/VDA. Initial formation of HSPCs from the VDA is significantly reduced, as characterized by a drastic reduction of CD41:GFPlow+ HSPCs. Hence, we favor the hypothesis that reduction in HSPCs is due to a defect in the specification and formation of the HSPC perivascular niche at the CHT. We tracked the defect in CHT niche formation to increased apoptosis in rprmlkd embryos, as concluded by increased Casp-3 activity. This is consistent with results previously published in a conference paper24, which reported increased apoptosis secondary to knockdown of RPRML in human cultured cells. Theoretically, rprml knockdown could cause instability of HSPCs through increased apoptosis. Interestingly, overexpression of RPRM causes increased apoptotic activity25,26. Therefore, RPRML might have an opposing role when compared with RPRM24. All these possibilities need to be thoroughly examined in future research efforts.
During transient-definitive hematopoiesis, EMPs give rise to the first granulocytes produced in the PBI of the zebrafish embryos5. Our data show that generation of EMPs is impaired by rprml loss-of-function. tal1/scl1+-erythroid-, pu.1+-myeloid precursor- and early mpx+-granulocyte (including neutrophils)- cells fail to form in the PBI of rprml-deficient zebrafish embryos. Thus, rprml seems required for both waves of definitive hematopoiesis: formation of EMPs and HSPCs in the PBI and VDA, respectively. Whether this finding represents a conserved feature of vertebrates will have to be evaluated by future studies using cell culture and murine models. However, the retention of rprml in all main groups of vertebrates (e.g. tetrapods, coelacanths, bony fish, cartilaginous fish)11, could be an indication of the importance of its role in hematopoiesis in all vertebrate groups. In agreement with the phyletic distribution of rprml, other genes that are fundamental for hematopoiesis (e.g. cmyb) are also present in all main groups of vertebrates27.
In conclusion, the data presented here demonstrate for the first time a physiological role for the rprml gene. Specifically, we showed that rprml plays an essential role during both waves of definitive hematopoiesis by regulating the formation of EMPs and HSPCs. Additionally, rprml is required for proper HSPC niche formation in the PCVP/CHT. To our knowledge, this is the first study that provides an understanding of rprml function during hematopoiesis. Thus, the identification and validation of rprml as a regulator of definitive hematopoiesis may lead to a better understanding of both human physiology and pathology. Future studies of the physiological roles and functional interplay between the other members of the Reprimo gene family will shed light not only about the biological process in which the different RPRM genes are involved, but also of the functional evolutionary specification of genes that were originated as a product of whole genome duplications.
Materials and Methods
Zebrafish lines
Wild type TAB5 and transgenic strains were bred according to standard methods28. Embryos were raised in system water at 28 °C and staged according to either hpf or morphological criteria29. Transgenic lines used in this study correspond to Tg(fli1:GFP;flk1:mCherry), Tg(flt0.8:mcherry;CD41GFP), Tg(flt0.8:RFP), Tg(fli1:GFP)28, Tg(kdrl:eGFP), Tg(Cd41:GFP)9, Tg(dll4:GFP), Tg(Tp1:nRFP)23 and Tg(mpx:GFP)29. All zebrafish studies and experimental protocols were conducted under the guidance and approval of the Institutional Animal Care and Use Committee and Bioethical Advisory Board at Pontificia Universidad Católica de Chile; and followed the AALAC reference resource on guidance on the housing and care of zebrafish (Danio rerio)30.
Knockdown of rprml by use of CRISPR-Cas9 genetic system
We used the CRISPR-Cas9 system to disrupt rprml. CRISPR short guide RNAs (sgRNAs) targeting the rprml exon 1 (the only exon present in rprm gene family) were designed using open access internet-based software CRISPRscan (http://www.crisprscan.org/)31. This software was used to determine an on-target score to predict Cas9 cleavage efficiency using previously described algorithms31. sgRNAs were tested in vitro for efficiency (New England Biolabs: 10.17504/protocols.io.ch2t8d). Using the sgRNA forward primer for T7 template 5′-TAATACGACTCACTATAGGTAGGACTGAGTTAGCCGCGTTTTAGAGCTAGAA-3′ and the invariance reverse primer 5′-AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC-3′. Next, fertilized zebrafish eggs from the transgenic line Tg(fli1:GFP) were injected with a mixture of Cas9 protein (400 ng/µL) and gene-specific sgRNAs (300 ng) at one-cell developmental stage, as previously described31. To identify indel mutations in injected embryos with vascular defects, we used the T7 endonuclease assay (Fig. S2F)32,33. This assay relies on the detection of single-base mismatches in the target DNA sequence. A 20 μL reaction volume containing 300 ng of each target DNA amplified from genomic DNA of microinjected and wild type embryos and 1 μL of T7 endonuclease (New England Biolabs) were incubated at 37 °C for an hour. Results were observed on a 1.5% agarose gel. The rprml primer sequences used for T7 endonuclease were; forward primer (5′-3′): CTCCCTCCATCCATCCATGC, and reverse primer (5′-3′): GAACCTCTCGTCCACATCGG.
Morpholino and RNA injections
Embryos were microinjected at 1–2 cell-stage with 3 nL of morpholino (MO) solution (along with phenol red) at a concentration of 0.5 mM for rprml and 1 mM for the control MOs. MOs were obtained from Gene Tools (Gene Tools, LLC) and designed to block the translation start site. MO sequences were: rprml MO (5′-3′) = ACGTTCCGTTCATCCTGAGCAGAGA, and control MO (5′-3′) = CCTCTTACCTCAGTTACAATTTATA. Since rprml is a single-exon gene, it is not possible to design MOs targeting the splicing donor sites. Efficiency of knockdown was assessed by reduction in protein synthesis, as confirmed by immunohistochemistry (IHC) staining in rprml morphants compared to control MO-injected embryos (Fig. S2D,E). This antibody was validated in our previous work14. Messenger RNA (mRNA) was co-injected with MOs in phenotypic rescue experiments (Fig. S5).
RPRMs molecular cloning and rescue experiments
Rprml gene was amplified by PCR by using the following primer sequences Fwd (5′-3′) = AGTTGCTCGACTCAACAGGC and Rv (5′-3′) = TGTTAACAGGTGTGACCCGC. PCR products were gel purified by using AxyPrep™ DNA Gel Extraction Kit (Axygen) and cloned into pCRII-TOPO cloning vector (Invitrogen) according to manufacturer´s instructions. cDNA fragment identity was confirmed by sequencing. In order to generate mRNA, rprml was subcloned into pCS2+ plasmid vector by using BamHI and XhoI restriction enzyme sites. In turn, the plasmid was linearized by using NotI and messenger RNA was obtained by using mMessage-mMachine kit (Ambion) according to manufacturer’s instructions.
RNA extraction and cDNA synthesis from zebrafish embryos
For cDNA synthesis, total RNA was collected from pools of 50 rprml MO-injected and 50 uninjected control embryos at 48 hpf using E.Z.N.A total RNA kit I (OMEGA), according to manufacturer’s instructions. cDNA was synthesized from 1 µg of total RNA with oligo (dT) using ImProm-II Reverse transcriptase II (PROMEGA) following manufacturer’s guidelines.
Quantitative polymerase chain reaction (qPCR)
Quantitative (q) PCR was carried out with a Stratagene Mx3000P detector system (Agilent Technologies) with optic tubes (SSI Innovations for Life Science) using 2× Brilliant II SYBR® Green qPCR Master Mix (Agilent Technologies). Four technical replicates were performed for rprml MO-injected embryos and three were performed for uninjected control embryos. actb1 was used as reference gene in all qRT-PCR reactions. actb1 forward primer (5′-3′) = TGAGCAGGAGATGGGAACC, and reverse primer (5′-3′) = CAACGGAAACGCTCATTGC (product size 102 base pairs -bps-). p53 forward primer (5′-3′) = CAGTCTGGCACAGCAAAATC, and reverse primer (5′-3′) = TTTGCCAGCTGACAGAAGAG (product size 74 bps). Gene expression data was processed by MxPro qPCR Software 4.10. Relative p53 expression levels in rprml MO-injected embryos and controls are expressed as ΔCq values:. Graphical representation of the data are shown as mean ΔCq ± (SEM). All relevant qPCR data are available in the supplementary material (Supplementary Table 1).
Whole mount in situ hybridization
Templates for probe synthesis were amplified from embryonic zebrafish cDNA using primers including T7 RNA polymerase promoter sequence. The 5′ untranslated regions (5′-UTR) of rprml gene was used for primer design. Expression pattern analysis of hematopoietic (tal1/scl1, pu.1, mpx, cmyb), vascular (fli1, lmo2) and T-lymphocyte (rag-2) markers was carried out as described previously21,34,35. Purified PCR products were transcribed in vitro and labeled using digoxigenin (DIG) RNA labeling Kit (Roche) according to manufacturer’s instructions. Riboprobes were purified by mini Quick Spin RNA Columns (Roche) and stored at −80 °C with deionized formamide for posterior use. Whole mount in situ hybridization (WISH) was carried out as previously described36.
Immunohistochemistry (IHC) staining
24 to 48 hpf embryos were fixed overnight in 4% paraformaldehyde at 4 °C and dehydrated in methanol for subsequent use. Rehydrated embryos were treated with acetone for 20 minutes at −20 °C, washed and treated with Proteinase K 10 ng/mL for 15 min as antigen exposure steps. Blocking was carried out with 10% FBS + 1% DMSO in PBT twice for 1 hour each. Embryos were incubated with the primary antibody overnight at 4 °C in blocking solution at corresponding dilution. Rabbit polyclonal anti-activated Caspase-3 antibody (Abcam, ab13847) was used at a 1:500 dilution, mouse monoclonal anti-GFP at 1:1000 dilution (Thermo Fisher Scientific, A11120), rabbit polyclonal anti-GFP at 1:500 dilution (Thermo Fisher Scientific, A11122) and rabbit polyclonal anti-RPRM at 1:1000 dilution (USbiological life science, 364937). This polyclonal antibody recognizes a common sequence for RPRM and RPRML, justifying its use for assessment of Rprm/Rprml protein expression in rprml-morphant embryos. For secondary antibody labeling, goat anti-rabbit Alexa-555, goat anti-mouse Alexa 488, goat anti-mouse Alexa 488, and goat anti-rabbit Alexa 546 (Invitrogen) were used at a 1:200 dilution in blocking buffer for 2 hours at room temperature.
Image acquisition, processing and quantification
WISH stained zebrafish embryos were embedded in 75% glycerol/PBS and imaged using a NIKON eclipse 80i microscope equipped with a DS-Vi1 (NIKON) camera. For whole-mount fluorescent IHC images, embryos were mounted in acrylic rings with glass bottoms containing 1% low melting point agarose and images were acquired using a Zeiss LSM780 laser-scanning spinning disc microscope. VE-DIC and fluorescent microscopy were performed as described previously37 through the 60X/1.00 water-immersion objective of a Nikon eclipse E200 microscope with a 519CU 5.0 M CMOS Camera using the Micrometrics SE Premium 4 program. To quantify the effect of the morpholinos on the development of the vascular system, CHT thickness was measured using ImageJ64. Pooled data were calculated as the mean plus or minus SD with minimum number of three independent experiments. Pairwise comparisons were subject to statistical analysis using unpaired two-tailed Student’s t-test. P-value < 0.05 was considered statistically significant.
Supplementary information
Acknowledgements
The authors wish to thanks to A. Siekmann, N. Lawson and B. Weinstein for providing the Tg(dll4:GFP), Tg(flt0.8:RFP), Tg(Tp1:GFP) and Tg(fli1:GFP;flk1:mcherry) transgenic line. We also wish to thank Dr. Jon D. Moulton for his insights and helpful comments on the manuscript. Lastly, we wish to thank to R. Figueroa and P. Retamal for technical assistance. This work was funded by grants BMBF-CONICYT 20140027 to J.D.A., CONICYT-PIA ACT1402 to J.D.A. and M.L.C., CRP-ICGEB CH15-01 to J.D.A., FONDECYT 1160627 to J.C.O., FONDECYT 1180241 to G.I.O., FONDECYT 1151411 to A.H.C., CONICYT-FONDAP 15130011 to A.H.C. and G.I.O., CONICYT-FONDAP 15150012 to M.L.C., Millennium Science Initiative ICM P09-015-F to M.L.C. and IMII P09/016-F to G.I.O., FONDECYT 11170761 and PAI 79170126 to G.R.
Author Contributions
Conceptualization: G.R., I.A.W. and J.D.A. Investigation: K.S. and J.D.A. Methodology: K.S., I.A.W. and J.D.A. Editing and writing the manuscript: K.S., G.R., I.A.W., J.C.O., G.I.O., A.H.C., M.L.C. and J.D.A. Original draft, analysis and funding acquisition: J.D.A.
Competing Interests
The authors declare no competing interests.
Footnotes
Publisher’s note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary information
Supplementary information accompanies this paper at 10.1038/s41598-019-43436-8.
References
- 1.Davidson AJ, Zon LI. The ‘definitive’ (and ‘primitive’) guide to zebrafish hematopoiesis. Oncogene. 2004;23:7233–7246. doi: 10.1038/sj.onc.1207943. [DOI] [PubMed] [Google Scholar]
- 2.Galloway JL, Zon LI. Ontogeny of hematopoiesis: examining the emergence of hematopoietic cells in the vertebrate embryo. Current topics in developmental biology. 2003;53:139–158. doi: 10.1016/S0070-2153(03)53004-6. [DOI] [PubMed] [Google Scholar]
- 3.Bertrand JY, Kim AD, Teng S, Traver D. CD41+ cmyb+ precursors colonize the zebrafish pronephros by a novel migration route to initiate adult hematopoiesis. Development. 2008;135:1853–1862. doi: 10.1242/dev.015297. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Zhang Y, Jin H, Li L, Qin FX, Wen Z. cMyb regulates hematopoietic stem/progenitor cell mobilization during zebrafish hematopoiesis. Blood. 2011;118:4093–4101. doi: 10.1182/blood-2011-03-342501. [DOI] [PubMed] [Google Scholar]
- 5.Frame JM, McGrath KE, Palis J. Erythro-myeloid progenitors: “definitive” hematopoiesis in the conceptus prior to the emergence of hematopoietic stem cells. Blood cells, molecules & diseases. 2013;51:220–225. doi: 10.1016/j.bcmd.2013.09.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Nguyen PD, et al. Haematopoietic stem cell induction by somite-derived endothelial cells controlled by meox1. Nature. 2014;512:314–318. doi: 10.1038/nature13678. [DOI] [PubMed] [Google Scholar]
- 7.Bertrand JY, et al. Haematopoietic stem cells derive directly from aortic endothelium during development. Nature. 2010;464:108–111. doi: 10.1038/nature08738. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Kissa K, Herbomel P. Blood stem cells emerge from aortic endothelium by a novel type of cell transition. Nature. 2010;464:112–115. doi: 10.1038/nature08761. [DOI] [PubMed] [Google Scholar]
- 9.Lin HF, et al. Analysis of thrombocyte development in CD41-GFP transgenic zebrafish. Blood. 2005;106:3803–3810. doi: 10.1182/blood-2005-01-0179. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Figueroa RJ, et al. Reprimo tissue-specific expression pattern is conserved between zebrafish and human. PloS one. 2017;12:e0178274. doi: 10.1371/journal.pone.0178274. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Wichmann IA, et al. Evolutionary history of the reprimo tumor suppressor gene family in vertebrates with a description of a new reprimo gene lineage. Gene. 2016;591:245–254. doi: 10.1016/j.gene.2016.07.036. [DOI] [PubMed] [Google Scholar]
- 12.Amigo Julio, Opazo Juan, Jorquera Roddy, Wichmann Ignacio, Garcia-Bloj Benjamin, Alarcon Maria, Owen Gareth, Corvalán Alejandro. The Reprimo Gene Family: A Novel Gene Lineage in Gastric Cancer with Tumor Suppressive Properties. International Journal of Molecular Sciences. 2018;19(7):1862. doi: 10.3390/ijms19071862. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Ohki R, et al. Reprimo, a new candidate mediator of the p53-mediated cell cycle arrest at the G2 phase. The Journal of biological chemistry. 2000;275:22627–22630. doi: 10.1074/jbc.C000235200. [DOI] [PubMed] [Google Scholar]
- 14.Stanic K, et al. Expression of RPRM/rprm in the Olfactory System of Embryonic. Zebrafish (Danio rerio). Frontiers in neuroanatomy. 2018;12:23. doi: 10.3389/fnana.2018.00023. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Tao YF, et al. tp53-dependent G2 arrest mediator candidate gene, Reprimo, is down-regulated by promoter hypermethylation in pediatric acute myeloid leukemia. Leukemia & lymphoma. 2015;56:2931–2944. doi: 10.3109/10428194.2015.1011157. [DOI] [PubMed] [Google Scholar]
- 16.Blum M, De Robertis EM, Wallingford JB, Niehrs C. Morpholinos: Antisense and Sensibility. Developmental cell. 2015;35:145–149. doi: 10.1016/j.devcel.2015.09.017. [DOI] [PubMed] [Google Scholar]
- 17.Wu RS, et al. A Rapid Method for Directed Gene Knockout for Screening in G0 Zebrafish. Developmental cell. 2018;46:112–125 e114. doi: 10.1016/j.devcel.2018.06.003. [DOI] [PubMed] [Google Scholar]
- 18.Stainier DYR, et al. Guidelines for morpholino use in zebrafish. PLoS genetics. 2017;13:e1007000. doi: 10.1371/journal.pgen.1007000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Bedell VM, Westcot SE, Ekker SC. Lessons from morpholino-based screening in zebrafish. Briefings in functional genomics. 2011;10:181–188. doi: 10.1093/bfgp/elr021. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Rossi A, et al. Genetic compensation induced by deleterious mutations but not gene knockdowns. Nature. 2015;524:230–233. doi: 10.1038/nature14580. [DOI] [PubMed] [Google Scholar]
- 21.Langenau DM, et al. Myc-induced T cell leukemia in transgenic zebrafish. Science. 2003;299:887–890. doi: 10.1126/science.1080280. [DOI] [PubMed] [Google Scholar]
- 22.Clements WK, et al. A somitic Wnt16/Notch pathway specifies haematopoietic stem cells. Nature. 2011;474:220–224. doi: 10.1038/nature10107. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Lorent K, Moore JC, Siekmann AF, Lawson N, Pack M. Reiterative use of the notch signal during zebrafish intrahepatic biliary development. Developmental dynamics: an official publication of the American Association of Anatomists. 2010;239:855–864. doi: 10.1002/dvdy.22220. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Lin SH. The role of reprimo-like gene methylation in radiation responsiveness and prognosis in pancreatic cancer. Journal of Clinical Oncology. 2010;28:e14593–e14593. doi: 10.1200/jco.2010.28.15_suppl.e14593. [DOI] [Google Scholar]
- 25.Garcia-Bloj B, et al. Waking up dormant tumor suppressor genes with zinc fingers, TALEs and the CRISPR/dCas9 system. Oncotarget. 2016;7:60535–60554. doi: 10.18632/oncotarget.11142. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Xu M, et al. Reprimo (RPRM) is a novel tumor suppressor in pituitary tumors and regulates survival, proliferation, and tumorigenicity. Endocrinology. 2012;153:2963–2973. doi: 10.1210/en.2011-2021. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Campanini EB, et al. Early Evolution of Vertebrate Mybs: An Integrative Perspective Combining Synteny, Phylogenetic, and Gene Expression Analyses. Genome biology and evolution. 2015;7:3009–3021. doi: 10.1093/gbe/evv197. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Westerfield, M. The zebrafish Book, 3rd ed. University of Oregon Press, Eugene, OR. (1995).
- 29.Kimmel CB, Ballard WW, Kimmel SR, Ullmann B, Schilling TF. Stages of embryonic development of the zebrafish. Dev Dyn. 1995;203:253–310. doi: 10.1002/aja.1002030302. [DOI] [PubMed] [Google Scholar]
- 30.Reed, B. & Jennings, M. Guidance on the housing and care of Zebrafish. Southwater: Royal Society for the Prevention of Cruelty to Animals (2011).
- 31.Moreno-Mateos MA, et al. CRISPRscan: designing highly efficient sgRNAs for CRISPR-Cas9 targeting in vivo. Nature methods. 2015;12:982–988. doi: 10.1038/nmeth.3543. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Gagnon JA, et al. Efficient mutagenesis by Cas9 protein-mediated oligonucleotide insertion and large-scale assessment of single-guide RNAs. PloS one. 2014;9:e98186. doi: 10.1371/journal.pone.0098186. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Zhu X, et al. An efficient genotyping method for genome-modified animals and human cells generated with CRISPR/Cas9 system. Scientific reports. 2014;4:6420. doi: 10.1038/srep06420. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Lawson ND, Weinstein BM. In vivo imaging of embryonic vascular development using transgenic zebrafish. Developmental biology. 2002;248:307–318. doi: 10.1006/dbio.2002.0711. [DOI] [PubMed] [Google Scholar]
- 35.Covassin LD, et al. A genetic screen for vascular mutants in zebrafish reveals dynamic roles for Vegf/Plcg1 signaling during artery development. Developmental biology. 2009;329:212–226. doi: 10.1016/j.ydbio.2009.02.031. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Amigo JD, et al. The role and regulation of friend of GATA-1 (FOG-1) during blood development in the zebrafish. Blood. 2009;114:4654–4663. doi: 10.1182/blood-2008-12-189910. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Murayama E, et al. Tracing hematopoietic precursor migration to successive hematopoietic organs during zebrafish development. Immunity. 2006;25:963–975. doi: 10.1016/j.immuni.2006.10.015. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.




