Skip to main content
Iranian Journal of Veterinary Research logoLink to Iranian Journal of Veterinary Research
. 2019 Winter;20(1):46–50.

The investigation of molecular characterization of presumptive Listeria monocytogenes isolates from a food-processing environment

M S Ahmed 1
PMCID: PMC6509916  PMID: 31191699

Abstract

Background:

Listeria is a Gram-positive, non-spore forming, facultative anaerobic intracellular bacterium. The most important pathogens in mammals include Listeria monocytogenes and Listeria ivanovii. The former generally causes disease and death in both humans and animals while the latter performs sporadically and primarily causes illness in ruminants.

Aims:

The aim of this project was to use conventional and molecular techniques to determine whether the provided samples were L. monocytogenes, and whether they were genetically similar or different.

Methods:

The provided presumptive Listeria cultures isolated from industrial processed food are conventionally assumed to be L. monocytogenes. All samples were cultured on brain heart infusion agar and broth first and then on blood agar. Later, hly gene amplification was applied.

Results:

The provided culture phenotypically resembled L. monocytogenes as it caused haemolysis on blood agar plates; however, the absence of the hly gene revealed that they were genotypically different. 16S rRNA confirmed three species of Listeria species including L. grayi, L. welshimeri and L. ivanovii. The results from 16S rRNA sequencing confirmed the results obtained from hly gene amplification.

Conclusion:

Enterobacterial repetitive intergenic consensus polymerase chain reaction (ERIC PCR) confirmed that all bacterial cultures were isolated from different sources depending on their ERIC PCR profile variation.

Key Words: Isolation, Listeria monocytogenes, Molecular characterisation

Introduction

Listeria is a Gram-positive, non-spore forming, facultative anaerobic intracellular bacterium (Orsi et al., 2011 ▶). It is 1-1.5 μm long and 0.5 μm wide (Marian et al., 2012 ▶). The genus Listeria has encompassed a number of species: L. innocua, L. seeligeri, L. welshimeri, L. grayi, L. ivanovii, L. monocytogenes, and the recently identified species, L. marthii, L. rocourtiae, L. weihenstephanensis and L. fleischmannii (Hellberg et al., 2013 ▶). The known mammalian pathogenic species within the Listeria genus is L. monocytogenes, which generally causes disease and death in both humans and animals (Jadhav et al., 2012 ▶), and L. ivanovii, which performs sporadically and primarily causes illness to ruminants (Orsi et al., 2011 ▶). Based on ribotypes and virulence gene hly, L. monocytogenes are classified into four genetic lineages (Chen et al., 2011 ▶). They comprise of two main lineages I and II to which almost all serotypes isolated from foods and patients belong. III and IV lineages are infrequent and are mainly isolated from non-primate mammals and ruminants (Chen et al., 2013 ▶). There are a number of serotypes that belong to each lineage including 1/2b, 1/2a, 1/2c, 3a, 3b, 3c and 4b associated with lineage I and II, while 4a, 4b, and 4c belong to lineage III and IV (Orsi et al., 2011 ▶). Listeria monocytogenes is widely present in the environment, water and a wide range of food processing environments and can supposedly appear on all raw food products (Lambertz et al., 2013 ▶). It has the capability to acclimatize and persist in a wide range of different extreme environments (high salt concentration 10% NaCl, pH range 4.5-9.6 and temperature range -1 to 45°C) (Marian et al., 2012 ▶). Nevertheless, pasteurization kills all Listeria; hence the contamination of dairy processing plants is usually a consequence of post pasteurization processes (Jadhav et al., 2012 ▶).

The disease caused by L. monocytogenes is known as listeriosis and can have two forms. The invasive form causes illness primarily among at-risk populations such as pregnant women, infants, elderly and immune-suppressed persons (Laksanalamai et al., 2012 ▶). The other form, febrile gastroenteritis, is a non-invasive variant and a self-limiting form of listeriosis, which affects healthy people and represents itself by aches, self-limiting fever, diarrhoea, nausea and fatigue (Laksanalamai et al., 2012 ▶).

Since the first foodborne listeriosis outbreak in 1981 (Schlech III et al., 1983 ▶), cases of listeriosis have increased in humans (Acciari et al., 2011 ▶). The Centres for Disease Control and Prevention stated that around 1600 invasive cases of listeriosis with nearly 255 deaths occur annually in the United States (Laksanalamai et al., 2012 ▶). Whereas in the in European Union, 2-10 cases are reported per million people annually with a large fatality ratio which can be more than 30% (Mammina et al., 2009 ▶). In Australia 3 cases are expected per 100,000 people with high fatality rate of 20-30% (Hogg et al., 2013 ▶).

The diagnosis of L. monocytogenes is challenging because it is related to other species and does not have specific symptoms. Listeria species are not distinguished by any regulatory body such as the US Department of Agriculture (USDA), Food Standards Australia and New Zealand and Food and Drug Administration (FDA), because it is suggested that the non-pathogenic species may be involved in the pathogenicity process of listeriosis. Therefore, sensitive, reproducible and robust methods are needed to detect L. monocytogenes in food industries (Jadhav et al., 2012 ▶).

To detect L. monocytogenes, several methods are available including culture based techniques and immune-based techniques. The most reliable and sensitive methods that rely on genetic rather than phenotypical information are molecular based techniques of detection such as DNA microarrays, multiplex polymerase chain reaction (PCR), real time PCR based methods and conventional PCR (Jadhav et al., 2012 ▶).

The aim of this project was to determine whether the provided samples were L. monocytogenes or not, and whether they were genetically similar or different using both conventional and molecular techniques.

Materials and Methods

The provided samples were 11 presumptive Listeria cultures isolated from a food-processing environment. The appearance of these isolates on selective media morphologically indicated that the samples were presumptively L. monocytogenes. Samples were designated MC1, MC3, MC4, MC5, MC6, MC7B, MC8, MC9A, MC9B, MC10, and MC12.

Bacterial cultures on agar and in broth

Each sample was streaked on brain heart infusion (BHI) agar (Oxoid Basingstoke, United Kingdom) plates and incubated for 24 h at 37°C for further subculturing. The next day, BHI broth media was prepared by inoculating the bacterial sample from previously cultured bacteria and incubated for 24 h at 37°C to prepare for DNA extraction. In addition, ready-to-use horse blood agar plates were provided, on which all bacterial samples were subcultured. Each sample was streaked on the blood agar plates and incubated at 37°C for 24 h to show the haemolysis ability of bacteria. Gram stain techniques were also applied according to Prophet et al. (1992) ▶.

DNA extraction

DNA extraction was performed using Wizard Genomic DNA Purification Kit (Promega Company, USA).

Polymerase chain reaction

PCR for hly gene

PCR was used for the amplification of the hly gene in order to determine the virulence gene of L. monocytogenes. Primers and conditions used in the hly PCR were described by Zhang et al., (2009) ▶. Table 1 lists the primers used in the hly amplification. These primers produced PCR products around 596 bp. Each 25 μL of reaction contained 12.5 μL of Mega mix (Promega, USA), 0.5 μL of each primer, 10.5 μL nuclease-free water and 1 μL of bacterial genomic DNA. The condition for hly PCR is detailed in Table 2. The product was analysed using 1% agarose gel electrophoresis.

Table 1.

List of primers used in this project

Primers Sequence (5´-3´) Product size (bp) References
hly1F AGCACAACAAACTGAAGCAAAGGA 596
hly2R ATTGTGATTCACTGTAAGCCATTTCGTCAT
16s RNA 27F AGAGTTTGATCMTGGCTCAG 1600 Rohwer et al. (2001) ▶
16s RNA 1492R TACGGYTACCTTGTTACGACTT
ERIC1 ATGTAAGCTCCTGGGGATTCAC
ERIC2 AAGTAAGTGACTGGGGTGAGCG

Table 2.

hly PCR condition

Step Number of cycles Temperature (°C) Time
Initial denaturation 1 94 5.0 min
Denaturation 35 94 30 s
Annealing 58 30 s
Extension 72 30 s
Final extension 1 72 7 min

PCR for 16S rRNA gene

PCR for 16S rRNA gene was achieved to detect different types of Listeria by sequencing the PCR product. The two universal primers are shown in Table 1. PCR reaction was performed in 25 μL PCR reaction mixture containing 1 μL of bacterial genomic DNA, 0.5 μL of each primer, 12.5 μL of Mega mix (Promega, USA), and 10.5 μL nuclease-free water. PCR conditions were described previously by Rohwer et al. (2001) ▶.

Enterobacterial repetitive intergenic consensus (ERIC) PCR

ERIC PCR was achieved to generate DNA fingerprints of all samples by applying the technique described by Duan et al. (2009) ▶. The two primers used in the PCR are detailed in Table 1.

PCR reaction was performed in 25 μL reaction mixture containing 1 µL (30 ng/µL) of bacterial genomic DNA, 1 µL (25 pmol/µL) of each primer and 12.5 μL Mega mix (Promega, USA) and 9.5 µL nuclease-free water. PCR was performed in thermocycler (Bio-Rad) applying the conditions detailed in Table 3. The PCR product was analysed by agarose gel electrophoresis.

Table 3.

ERIC PCR condition

Step Number of cycles Temperature (°C) Time (min)
Initial denaturation 1 94 5.0
Denaturation 35 94 1
Annealing 54 1
Extension 72 8
Final extension 1 72 8

Preparation of DNA for sequencing

Clean ing up DNA from agarose gel

After the amplification of 16S rRNA gene was completed, the DNA was extracted from the gel using the “Wizard SV Gel and PCR clean up system” (Promega, USA). Afterwards, DNA concentration was performed by a Biowave2 spectrophotometer. Finally, following the Australian Genome Research Facility (AGRF) sequencing centre, the total volume of the reaction was 12 μL containing the primer, aliquot DNA and sterile distilled water. The recommended DNA concentration to sequence the product more than 800 bp was 30-75 ng/μL. The appropriate volume of each sample was added to the solution, 1 μL of 27 F primer and completed to 12 μL with sterile distilled water.

Alignment of DNA sequences

The sequences were pasted into the text area of the page to find the closest match with DNA sequences in the Gen Bank database “BLAST”.

Results

Culturing of bacteria on blood agar and Gram stain

All bacterial samples showed β-haemolysis after incubation for 24 h at 37°C (Fig. 1). They appeared as Gram-positive, short, rod shaped bacterium under the microscope. The Gram stain of bacterial samples is important because presumptive Listeria is believed to be Gram-positive (Atil et al., 2011 ▶).

Fig. 1.

Fig. 1

Listeria culture on blood agar showing β-haemolysis

hly gene PCR

To confirm the type of Listeria genotypically, DNA was extracted from the presumptive Listeria samples and analysed for the presence of the hly gene by amplifying this gene. The PCR products for all samples were run on 1% agarose gel as shown in Fig. 2. All bacterial samples in wells 3 to 13 were negative for the hly gene. whereas a clear DNA band, around 560 bp in size, appeared in well 15 as control DNA for L. Monocytogenes.

Fig. 2.

Fig. 2

hly PCR products on 1% agarose gel. Line 1 (1 kb), Lines 3-13 (samples MC1, MC3, MC4, MC5, MC6, MC7B, MC8, MC9A, MC9B, MC10, and MC12), Line 15 (DNA of L. monocytogenes as control), and Lines 2 and 14 (empty)

Due to the importance of the hly gene for the identification of L. monocytogenes (Liu, 2008 ▶), hly PCR was applied to all samples. The results of this experiment indicated that none of the provided samples were L. monocytogenes, due to the fact that the hly gene does not exist in all bacterial samples and the agarose gel was clear from any bands except for control DNA band in L. monocytogenes.

PCR for 16S rRNA gene and sequencing

To verify the results obtained from the hly PCR, amplification of the 16S rRNA gene was carried out for the bacterial samples and the PCR products were sequenced. After running the PCR products on 1% agarose (Fig. 3), a clear band appeared for all samples around 1600 bp on Lines 2 to 12. The DNA bands of 16S rRNA for all samples were cleaned up from the agarose gel after amplification and prepared for sequencing. The DNA sequencing was performed at the AGRF sequencing centre (AGRF, Melbourne, Australia). The size of 16S rRNA sequences obtained was around 1 kb.

Fig. 3.

Fig. 3

PCR of 16S rRNA on 1% agarose gel. Line 1 (1 kb), Lines 2-12 (samples MC1, MC3, MC4, MC5, MC6, MC7B, MC8, MC9A, MC9B, MC10, and MC12)

Basic Local Alignment Search Tool (BLAST) search tool was used to determine the closest matching bacteria to samples’ 16S rRNA sequence. Only three samples identified with the species’ level (Table 4). The remaining samples shared a similarity between 77% and 80% with L. grayi.

Table 4.

Listeria species obtained from the BLAST alignment of 16S rRNA gene sequences

Samples Alignment bacteria Strain Identical (%) Accession No.
MC7B Listeria grayi ATCC 25401 99 JN852815.1
MC9B Listeria welshimeri SLCC5334 99 AM263198.1
MC10 Listeria ivanovii PAM 55 99 FR687253.1

ERIC PCR

ERIC PCR of genomic DNA from presumptive Listeria samples isolated from processing food environments produced fingerprint profiles comprising of two to seven bands of sizes ranging 140-5500 bases as shown in Fig. 4.

Fig. 4.

Fig. 4

ERIC PCR on 1% agarose gel. Line 1 (1 kb), and Lines 2-12 (samples MC1, MC3, MC4, MC5, MC6, MC7B, MC8, MC9B, MC9A, MC10, and MC12)

Discussion

Culturing bacteria on blood agar and Gram stain

Previous studies suggest that only three species of Listeria, L. monocytogenes, L. ivanovii, and L. seeligeri, typically cause β-haemolysis on blood agar (Allerberger, 2003 ▶). They cause the lysis of red blood cells of most mammals and the haemolysis is most frequently revealed using blood agar plates containing horse or sheep blood. β-haemolysis occurs as a result of Listeriolysin O (LLO, ILO and SLO) protein encoded by the hly gene, which is located within the cluster of virulence genes, hence revealing their activity (Liu, 2008 ▶). The important indication of test is isolate the virulent types of Listeria phenotypically from non-pathogenic types because the haemolytic reaction is only performed by the virulent species. Therefore, it is a significant step towards the differentiation of L. monocytogenes and L. ivanovii from other types of Listeria (Liu, 2008 ▶).

Evaluating β-haemolysis can be challenging in L. monocytogenes because the formed clearing zone is very small and in some strains, the colonies need to be removed in order for the haemolysis to be identified. In addition, haemolysis is seen in unusual cases in the non-pathogenic type of Listeria (Liu, 2008 ▶). Moreover, contamination with other haemolytic bacteria such as Streptococcus pyogenes while preparing the culture media or streaking bacteria on agar, may yield false positive results (Liu, 2008 ▶).

It is important to know the Gram stain of bacterial samples because the provided presumptive Listeria are supposedly Gram-positive (Atil et al., 2011 ▶).

hly gene PCR

Due to the importance of the hly gene for identifying L. monocytogenes (Liu, 2008 ▶), hly PCR was applied to all samples. The results of this experiment indicated that none of provided samples were L. monocytogenes because the hly gene does not exist in all bacterial samples and the agarose gel was clear from any bands except for the control DNA band of L. monocytogenes.

PCR for 16S rRNA gene and sequencing

16S rRNA is a small-subunit rRNA molecule in prokaryotic cells with a sedimentation coefficient of 16S, and it is the most conserved gene around 1600 bp in all cells. It is most frequently used to characterize bacteria (Hellberg et al., 2013 ▶). For phylogenetic purposes of higher taxonomic orders such as phylum, family, and genus, the 16S rRNA’s preserved regions are used as targets for most bacteria, whereas the variable sequence regions are significant for isolating the genus (Liu, 2008 ▶). 16S rRNA gene sequencing is a particularly irreplaceable method when recognizing poorly defined or phenotypically unusual strains (Liu, 2008 ▶). All samples produced clear bands at around 1600 bp, which is an entire 16S rRNA gene (Hellberg et al., 2013 ▶).

When alignment is performed to detect the closest matched bacteria, identitying the percentage is considered to be a significant parameter. The similarity between aligned sequences should be ≥99% to confirm the identity of bacterial species, ≥95 to <99% to recognise the genus of bacteria, and less than 95% to identify the bacteria at family level (Bosshard et al., 2003 ▶).

ERIC PCR

ERIC sequences are extremely conserved as an intergenic functional repeat region of DNA with 124-147 bp size. They are present in a varied range of bacterial genomes comprising Listeria that signify prospective sites to bind primers for PCR amplification in order to identify bacterial species and strain (Soni et al., 2013 ▶). Different profiles imply diverse sources for bacteria isolation, which in turn means that the bacteria are isolated from different sources (Liu, 2008 ▶).

Samples MC7B and MC9B yielded two different profiles (as shown in Fig. 4, Line 7 and 9), supporting the idea that the sequence data represent two different species of Listeria. The diverse ERIC profile of other samples indicates that they may form different species of Listeria.

Acknowledgements

I am a grateful to Dr. E. Palombo and Dr. S. McLean, in Swinburne University of Technology, for their help during this project.

References

  1. Acciari, VA , Torresi, M , Migliorati, G , Di Giannatale, E , Semprini, P , Prencipe, V Characterisation of Listeria monocytogenes strains isolated from soft and semi-soft cheeses sampled in a region of Italy. Vet. Ital. 2011;47:15–23. [PubMed] [Google Scholar]
  2. Allerberger, F Listeria: growth, phenotypic differentiation and molecular microbiology. FEMS Immunol. Med. Microbiol. 2003;35:183–189. doi: 10.1016/S0928-8244(02)00447-9. [DOI] [PubMed] [Google Scholar]
  3. Atil, E , Ertas, H , Ozbey, G Isolation and molecular characterization of Listeria spp from animals food and environmental samples. Vet. Med. 2011;56:386–394. [Google Scholar]
  4. Bosshard, PP , Abels, S , Zbinden, R , Böttger, EC , Altwegg, M Ribosomal DNA sequencing for identification of aerobic Gram-positive rods in the clinical laboratory (an 18-month evaluation) Clin. Microbial. 2003;41:4134–4140. doi: 10.1128/JCM.41.9.4134-4140.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Chen, J , Cheng, C , Lv, Y , Fang, W Genetic diversity of internalin genes in the ascB-dapE locus among Listeria monocytogenes lineages III and IV strains. Basic Microbiol. 2013;53:778–784. doi: 10.1002/jobm.201200137. [DOI] [PubMed] [Google Scholar]
  6. Chen, Y , Ross, WH , Whiting, RC , Van Stelten, A , Nightingale, KK , Wiedmann, M , Scott, VN Variation in Listeria monocytogenes dose responses in relation to subtypes encoding a full-length or truncated internalin A. Appl. Envirom. Microbial. 2011;77:1171–1180. doi: 10.1128/AEM.01564-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Duan, H , Chai, T , Liu, J , Zhang, X , Qi, C , Gao, J , Wang, Y , Cai, Y , Miao, Z , Yao, M , Schlenker, G Source identification of airborne Escherichia coli of swine house surroundings using ERIC-PCR and REP-PCR. Envirom. Res. 2009;109:511–517. doi: 10.1016/j.envres.2009.02.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Hellberg, RS , Martin, KG , Keys, AL , Haney, CJ , Shen, Y , Smiley, RD 16S rRNA partial gene sequencing for the differentiation and molecular subtyping of Listeria species. Food Microbial. 2013;36:231–240. doi: 10.1016/j.fm.2013.06.001. [DOI] [PubMed] [Google Scholar]
  9. Hogg, G , Tan, A , Gregory, J Listeria surveillance in Australia from the laboratory perspective. Microbiol. Aust. 2013;34:90–92. [Google Scholar]
  10. Jadhav, S , Bhave, M , Palombo, EA Methods used for the detection and subtyping of Listeria monocytogenes. J. Microb. Meth. 2012;88:327–341. doi: 10.1016/j.mimet.2012.01.002. [DOI] [PubMed] [Google Scholar]
  11. Laksanalamai, P , Joseph, LA , Silk, BJ , Burall, LS , L Tarr, C, Gerner-Smidt, P , Datta, AR Genomic characterization of Listeria monocytogenes strains involved in a multistate listeriosis outbreak associated with cantaloupe in US. PLoS One. 2012;7:42–48. doi: 10.1371/journal.pone.0042448. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Lambertz, ST , Ivarsson, S , Lopez-Valladares, G , Sidstedt, M , Lindqvist, R Subtyping of Listeria monocytogenes isolates recovered from retail ready-to-eat foods, processing plants and listeriosis patients in Sweden 2010. Inter. J. Food Microbial. 2013;166:186–192. doi: 10.1016/j.ijfoodmicro.2013.06.008. [DOI] [PubMed] [Google Scholar]
  13. Liu, D . Handbook of Listeria monocytogenes. 1st Edn. US, NW: CRC Press; 2008. p. 139. [Google Scholar]
  14. Mammina, C , Aleo, A , Romani, C , Pellissier, N , Nicoletti, P , Pecile, P , Nastasi, A , Pontello, MM Characterization of Listeria monocytogenes isolates from human listeriosis cases in Italy. Clin. Microbial. 2009;47:2925–2930. doi: 10.1128/JCM.00102-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Marian, MN , Sharifah Aminah, SM , Zuraini, MI , Son, R , Maimunah, M , Lee, HY , Wong, WC , Elexson, N MPN-PCR detection and antimicrobial resistance of Listeria monocytogenes isolated from raw and ready-to-eat foods in Malaysia. Food Control. 2012;28:309–314. [Google Scholar]
  16. Orsi, RH , Bakker, HCD , Wiedmann, M Listeria monocytogenes lineages: genomics, evolution, ecology, and phenotypic characteristics. Med. Microbial. 2011;301:79–96. doi: 10.1016/j.ijmm.2010.05.002. [DOI] [PubMed] [Google Scholar]
  17. Palumbo, JD , Borucki, MK , Mandrell, RE , Gorski, L Serotyping of Listeria monocytogenes by enzyme-linked immunosorbent assay and identification of mixed-serotype cultures by colony immunoblotting. J. Clin. Microb. 2003;41:564–571. doi: 10.1128/JCM.41.2.564-571.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Prophet, EB , Mills, B , Arrington, JB , Sobin, LH . Laboratory methods in histotechnology. 1st Edn. Washington, D.C: American Registry of Pathology; 1992. [Google Scholar]
  19. Rohwer, F , Breitbart, M , Jara, J , Azam, F , Knowlton, N Diversity of bacteria associated with the Caribbean coral Montastraea franksi. Cor. Re. 2001;20:85–91. [Google Scholar]
  20. Schlech III, WF , Lavigne, PM , Bortolussi, RA , Allen, AC , Haldane, EV Epidemic listeriosis: evidence for transmission by food [Listeria monocytogenes] New Engl. J. Med. 1983;308:203–206. doi: 10.1056/NEJM198301273080407. [DOI] [PubMed] [Google Scholar]
  21. Soni, DK , Singh, RK , Singh, DV , Dubey, SK Characterization of Listeria monocytogenes isolated from Ganges water, human clinical and milk samples at Varanasi, India. Infec. Genet. Evol. 2013;14:83–91. doi: 10.1016/j.meegid.2012.09.019. [DOI] [PubMed] [Google Scholar]
  22. Vázquez-Boland, JA , Kuhn, M , Berche, P , Chakraborty, T , Domínguez-Bernal, G , Goebel, W , González-Zorn, B , Wehland, J , Kreft, J Listeria pathogenesis and molecular virulence determinants. Clin. Microbial. 2001;14:584–640. doi: 10.1128/CMR.14.3.584-640.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Zhang, D , Zhang, H , Yang, L , Guo, J , Li, X , Feng, Y Simultaneous detection of Listeria monocytogenes, Staphylococcus aureus, Salmonella enterica and Escherichia coli O157: H7 in food samples using multiplex PCR method. J. Food Saf. 2009;29:348–363. [Google Scholar]

Articles from Iranian Journal of Veterinary Research are provided here courtesy of Shiraz University

RESOURCES